DOCSLIB.ORG

Generate Metabolic Map Poster

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Authors: Pallavi Subhraveti Ron Caspi Peter Midford Peter D Karp An online version of this diagram is available at BioCyc.org. Biosynthetic pathways are positioned in the left of the cytoplasm, degradative pathways on the right, and reactions not assigned to any pathway are in the far right of the cytoplasm. Transporters and membrane proteins are shown on the membrane. Ingrid Keseler Periplasmic (where appropriate) and extracellular reactions and proteins may also be shown. Pathways are colored according to their cellular function. Gcf_000971295Cyc: Devosia epidermidihirudinis E84 Cellular Overview Connections between pathways are omitted for legibility. Anamika Kothari RS06150 RS12955 TrkD RS11615 RS15810 RS11365 RS11290 RS11165 RS07705 RS05785 RS03390 RS10640 CobD RS17455 RS14945 RS00945 RS00805 YejB RS02090 YajC RS13620 RS08710 CysA RS06300 RS14000 RS06930 RS13875 RS06915 RS06215 ArsB RS00420 RS05185 RS06210 SecY RS00490 RS13915 RS06260 RS14010 RS14120 RS08520 RS13535 RS13725 TatC SecA MacB RS16730 RS16965 RS03310 RS10470 RS02410 RS03365 RS00125 RS12050 RS07730 RS15485 RS12045 RS12185 RS15915 RS02770 RS12830 RS13080 RS06160 RS02150 Polyprenyl Biosynthesis Amino Acid Degradation Aminoacyl-tRNA Charging glutaminyl-tRNA gln Macromolecule Modification tRNA-uridine 2-thiolation ATP di-trans,octa-cis UDP-N-acetyl- ditrans,octacis- a peptidoglycan with ditrans,octacis- ditrans,octacis- a [glutamine (4R)-4-hydroxy- DNA with an N-terminal- biosynthesis via transamidation and selenation (bacteria) a [glutamine- an L-cysteinyl- di-trans,poly-cis biosynthesis L-leucine degradation I -undecaprenyl α-D-muramoyl- undecaprenyldiphospho- (L-alanyl-γ-D-glutamyl- undecaprenyldiphospho- undecaprenyldiphospho- synthetase]-O 2-oxoglutarate adenine:7,8- L-methionyl-L- 3',5'-ADP L-tyrosine degradation I L-histidine L-proline degradation I L-glutamate L-citrulline degradation ATP [tRNA Cys ] dGDP RS06245 RS15765 Alcohol Degradation phosphate γ β L-lysyl-D-alanyl-D- synthetase]- 4 -(5'-adenylyl) seryl-[protein] -undecaprenyl degradation VI phospho-N- L-alanyl- -D- N-acetyl-(N-acetyl- -D- N-acetyl-(N- N-acetyl-(N- dihydro-8- 3'(2'),5'- glu cys degradation II L-tyrosine class 1b phosphate biosynthesis acetylmuramoyl- glutamyl-meso-2,6- glucosaminyl)muramoyl- alanine) pentapeptide acetylglucosaminyl) acetylglucosaminyl) -L-tyrosine oxoguanine bisphosphate ADP leu (to pyruvate) bifunctional ribonucleoside- (2E,6E)-farnesyl pro glycerol and glycerophosphodiester degradation pentapeptide- diaminopimeloyl- L-alanyl-γ-D-glutamyl-L- muramoyl-L-alanyl-γ- muramoyl-L-alanyl- mismatch nucleotidase IPP cysteine F0F1 ATP branched-chain tyr his L-citrulline 4-hydroxy-2- type I methionyl aminoacyl-tRNA diphosphate diphosphate bifunctional glu transferase: D-alanyl-D-alanine lysyl-D-alanyl-D-alanine D-isoglutaminyl-N-(β- γ-D-isoglutaminyl- bifunctional [glutamine CysQ: desulfurase: synthase: amino acid aspartate/ ornithine bifunctional [glutamine oxoglutarate aminopeptidase: hydrolase: reductase: RS14015 FlgK gln proline glycerol WH87_RS16315 D-asparaginyl)-L-lysyl- N-(β-D-asparaginyl) synthetase] WH87_RS14290 sufS WH87_RS17935 aminotransferase: tyrosine/aromatic carbamoyltransferase: synthetase] aldolase/2- A/G-specific map WH87_RS13215 nrdF nrdE dehydrogenase/L- D-alanyl-D-alanine -L-lysyl-D-alanine adenylyltransferase/ an L-glutamyl- isoprenyl an [L-cysteine atpD WH87_RS11790 aminotransferase: argF monofunctional adenylyltransferase/ dehydro-3-deoxy- adenine type I methionyl aminoacyl-tRNA 3'(2'),5'- transferase: 4-methyl-2- 3-(4- urocanate glutamate gamma- carbamoyl phosphate [glutamine synthetase]- vitamin B12- [tRNA Gln ] imidazole desulfurase]-S- WH87_RS17945 WH87_RS17335 biosynthetic [glutamine synthetase]- phosphogluconate glycosylase: aminopeptidase: hydrolase: bisphosphate WH87_RS03710 oxopentanoate hydroxyphenyl) semialdehyde adenylyl-L-tyrosine adenylyl-L-tyrosine dependent glycerol sulfanyl-L-cysteine WH87_RS17950 urocanate a glycerophosphodiester peptidoglycan monofunctional monofunctional aldolase: eda WH87_RS00850 map WH87_RS12600 nucleotidase Asp-tRNA(Asn) pyruvate dehydrogenase (2S, 3S)-3- glutamine-hydrolyzing phosphorylase: ribonucleotide RS06295 RS15880 phosphate WH87_RS17955 glycerol undecaprenyldiphospho- UMP transglycosylase: biosynthetic biosynthetic phosphorylase: A/G-specific CysQ: cysQ /Glu-tRNA(Gln) di-trans,octa-cis hydratase: PutA: putA methylaspartate carbamoyl-phosphate WH87_RS06650 reductase: synthase: (S)-1-pyrroline- N-acetylmuramoyl-L- mtgA peptidoglycan peptidoglycan WH87_RS06650 amidotransferase: -undecaprenyl [+ 2 isozymes] WH87_RS11020 synthase small glycerophosphodiester adenine an N-terminal WH87_RS07555 hisF hisH alanyl-γ-D-glutamyl-meso transglycosylase: transglycosylase: Cys AMP a [TusA sulfur- ATP 3-methylbutanoyl- 4-imidazolone- 5-carboxylate phosphodiesterase: glycerol kinase glyoxylate pyruvate glycosylase: met L-seryl-[protein] cys a tRNA gatC gatA gatB diphosphate subunit: carA a [glutamine GDP [+ 6 isozymes] carrier protein]-S- CoA WH87_RS05735 -2,6-diaminopimeloyl- a peptidoglycan with di-trans,octa-cis mtgA mtgA a [glutamine- WH87_RS01205 a 5-phosphooxy- undecaprenyl- homogentisate 5-propanoate carbamoyl-phosphate GlpK: glpK sulfanyl-L-cysteine D-alanyl-D-alanine (L-alanyl-γ-D-glutamyl- -undecaprenyl synthetase]-O synthetase]- RS14110 L-glutamyl- diphosphate 4 ADP ammonium mesaconate synthase large -(5'-adenylyl) [tRNA Gln ] phosphatase: L-lysyl-D-alanyl-D- diphosphate a peptidoglycan di-trans,octa-cis a peptidoglycan di-trans,octa-cis L-tyrosine subunit: carB sn-glycerol 3-phosphate -L-tyrosine an apurinic site WH87_RS09520 L-glutamate-5- alanine) pentapeptide dimer (E. faeciums) -undecaprenyl dimer (E. faecium -undecaprenyl 3-methylcrotonyl- semialdehyde adenine within DNA Asp-tRNA(Asn) di-trans,octa-cis a [TusD sulfur- N-formimino- carbamate diphosphate , tetrapeptide) diphosphate CoA 4-maleyl- glycerol-3-phosphate /Glu-tRNA(Gln) -undecaprenyl carrier protein]-S- L-glutamate bifunctional RS08720 acetyl/propionyl/ acetoacetate dehydrogenase: amidotransferase: phosphate sulfanyl-L-cysteine proline methylcrotonyl- (S)-citramalate WH87_RS17270 gatC gatA gatB dehydrogenase/L- a ring-opened 7- a reduced ditrans,octacis- a mature a peptide with CoA carboxylase an N-modified a ribonucleoside an L-asparaginyl- UDP glutamate gamma- DHAP methylguanine adenosylcobinamide a purine ubiquinone-6 electron-transfer undecaprenyldiphospho- peptidoglycan leukotriene-D4 an N-terminal (n) aminoacyl-[tRNA] diphosphate [tRNA Asn ] dADP subunit alpha: citramalate CO in DNA ribonucleoside class 1b an L-glutaminyl- a [TusE sulfur 4-fumaryl- N-formyl- semialdehyde 2 flavoprotein N-acetyl-(N- (meso-DAP class 1b L-methionine RS08785 Gln WH87_RS09940 synthase: 5'-triphosphate ribonucleoside- class 1b [tRNA ] acetoacetate L-glutamate dehydrogenase acetylglucosaminyl) containing) 34 carrier protein]-S ribonucleoside- diphosphate tRNA charging a uridine in tRNA 3-methylglutaconyl- PutA: putA WH87_RS06470 electron transfer muramoyl-L-alanyl-γ-D- membrane ribonucleoside- -sulfanylcysteine fumarylacetoacetate N-formylglutamate bifunctional DNA- aminoacyl-tRNA diphosphate aminoacyl-tRNA type I methionyl reductase: CoA bifunctional flavoprotein- isoglutaminyl-L-lysyl- dipeptidase: diphosphate hydrolase: amidohydrolase: Aldehyde Degradation formamidopyrimidine lytic hydrolase: reductase: hydrolase: aminopeptidase: nrdF nrdE glu adenosylcobinamide ubiquinone (glycyl) -D-alanyl-D-alanine WH87_RS15310 reductase: glu tRNA 2- WH87_RS10765 acetate pyruvate glycosylase/ 5 WH87_RS13215 nrdF nrdE WH87_RS13215 map glu a tRNA WH87_RS02550 kinase/ transglycosylase membrane vitamin B12- nrdF nrdE RS08845 Gly thiouridine(34) DNA-(apurinic oxidoreductase: gly a tRNA fumarylacetoacetate glycine cleavage methylglyoxal degradation I adenosylcobinamide- domain-containing aminoacyl-tRNA dipeptidase: vitamin B12- aminoacyl-tRNA type I methionyl dependent synthase glu or apyrimidinic WH87_RS00785 vitamin B12- phe a tRNA Phe tRNA asp asp ser a tRNA ser a tRNA Ala ala hydrolase: phosphate monofunctional protein: hydrolase: WH87_RS07805 dependent hydrolase: aminopeptidase: ribonucleotide elongator glutamate-- MnmA: mnmA HMG-CoA a [glycine-cleavage site) lyase: mutM electron transfer dependent met initiator tRNA Met met arg a tRNA Arg val a tRNA Val cys a tRNA Cys pro a tRNA Pro tyr a tRNA Tyr trp a tRNA Trp thr a tRNA Thr lys a tRNA Lys his a tRNA His ile a tRNA Ile leu a tRNA Leu WH87_RS11965 guanylyltransferase: biosynthetic WH87_RS10055 WH87_RS12600 ribonucleotide WH87_RS12600 map reductase: tRNA Met tRNA ligase: complex H protein] N 6 methylglyoxal flavoprotein- ribonucleotide glycine-- cobU peptidoglycan [+ 4 isozymes] reductase: WH87_RS07555 Asn Gln 34 L-methionine degradation lactoylglutathione reductase: RS13625 phenylalanine- asn tRNA gln a tRNA aspartate- WH87_RS03665 serine- tRNA ligase alanine- a 2-thiouridine fumarate -[(R)-lipoyl]-L-lysine glycine cleavage system a [DNA]- 2,6-diamino-4- ubiquinone transglycosylase: WH87_RS07555 I (to L-homocysteine) a 5'-phospho- adenosyl- leukotriene-E4 gly a 2'- WH87_RS07555 in tRNA lyase: 4-oxo-2-pentenal oxidoreductase: an N-modified an uncharged Asn dUDP -tRNA ligase: -tRNA methionine-- methionine-- glutamate-- -tRNA arginine-- valine-- cysteine-- proline-- tyrosine-- tryptophan- threonine- subunit beta: -tRNA lysine-- histidine-- isoleucine-- leucine-- aminomethyltransferase nucleotide- [DNA] hydroxy-5-(N-methyl) mtgA a mature GlcNAc-1,6- deoxyribonucleoside asn tRNA met a peptide tRNA uridine-5- glycine cleavage
Recommended publications
  • Biochemical and Electrophoretic Studies of Erythrocyte Pyridoxine Kinase in White and Black Americans

    Biochemical and Electrophoretic Studies of Erythrocyte Pyridoxine Kinase in White and Black Americans

    Am J Hum Genet 28:9-17, 1976 Biochemical and Electrophoretic Studies of Erythrocyte Pyridoxine Kinase in White and Black Americans CHING J. CHERN1 AND ERNEST BEUTLER2 Pyridoxine kinase (PNK; EC 2.7.1.35) catalyzes the phosphorylation of pyridox- ine to its active coenzyme form, pyridoxine phosphate: pyridoxine + ATP - + pyridoxine phosphate + ADP. The same enzyme catalyzes the phosphorylation of pyridoxal to pyridoxal phos- phate. Previous communications [1, 21 have shown that the average PNK activity in red cells of American blacks is significantly lower than that of American whites; in contrast, the activities of the enzyme in lymphocytes, granulocytes, and cultured skin fibroblasts from black subjects are the same as those from whites. To gain a better understanding of the genetics of the red cell PNK of blacks, the size of our population survey has been expanded, and some limited family studies have been carried out. To determine whether the enzyme deficiency of black subjects is due to a structural gene mutation or regulatory mutation, we have investigated further the biochemical characteristics of PNK in red cells of white and black donors. The results of our investigations suggest that low red cell PNK activity may be coded by a single structural allele which results in the pro- duction of an enzyme with reduced in vivo stability. MATERIALS AND METHODS Pyridoxine kinase activity was estimated by measuring MH-pyridoxine-5'-phosphate as described previously [3]. Assay results were found to be highly reproducible in the same subject at different times. The red cells of one normal white subject were assayed four times over a 2 month period.
  • Non-Homologous Isofunctional Enzymes: a Systematic Analysis Of

    Non-Homologous Isofunctional Enzymes: a Systematic Analysis Of

    Omelchenko et al. Biology Direct 2010, 5:31 http://www.biology-direct.com/content/5/1/31 RESEARCH Open Access Non-homologousResearch isofunctional enzymes: A systematic analysis of alternative solutions in enzyme evolution Marina V Omelchenko, Michael Y Galperin*, Yuri I Wolf and Eugene V Koonin Abstract Background: Evolutionarily unrelated proteins that catalyze the same biochemical reactions are often referred to as analogous - as opposed to homologous - enzymes. The existence of numerous alternative, non-homologous enzyme isoforms presents an interesting evolutionary problem; it also complicates genome-based reconstruction of the metabolic pathways in a variety of organisms. In 1998, a systematic search for analogous enzymes resulted in the identification of 105 Enzyme Commission (EC) numbers that included two or more proteins without detectable sequence similarity to each other, including 34 EC nodes where proteins were known (or predicted) to have distinct structural folds, indicating independent evolutionary origins. In the past 12 years, many putative non-homologous isofunctional enzymes were identified in newly sequenced genomes. In addition, efforts in structural genomics resulted in a vastly improved structural coverage of proteomes, providing for definitive assessment of (non)homologous relationships between proteins. Results: We report the results of a comprehensive search for non-homologous isofunctional enzymes (NISE) that yielded 185 EC nodes with two or more experimentally characterized - or predicted - structurally unrelated proteins. Of these NISE sets, only 74 were from the original 1998 list. Structural assignments of the NISE show over-representation of proteins with the TIM barrel fold and the nucleotide-binding Rossmann fold. From the functional perspective, the set of NISE is enriched in hydrolases, particularly carbohydrate hydrolases, and in enzymes involved in defense against oxidative stress.
  • Guanylate Kinase (Ec 2.7.4.8)

    Guanylate Kinase (Ec 2.7.4.8)

    Enzymatic Assay of GUANYLATE KINASE (EC 2.7.4.8) PRINCIPLE: Guanylate Kinase GMP + ATP > GDP + ADP Pyruvate Kinase ADP + PEP > ATP + Pyruvate Pyruvate Kinase GDP + PEP > GTP + Pyruvate Lactic Dehydrogenase 2 Pyruvate + 2 ß-NADH > 2 Lactate + 2 ß-NAD Abbreviations used: GMP = Guanosine 5'-Monophosphate ATP = Adenosine 5'-Triphosphate GDP = Guanosine 5'-Diphosphate ADP = Adenosine 5'-Diphosphate PEP = Phospho(enol)phosphate ß-NADH = ß-Nicotinamide Adenine Dinucleotide, Reduced Form ß-NAD = ß-Nicotinamide Adenine Dinucleotide, Oxidized Form CONDITIONS: T = 30°C, pH = 7.5, A340nm, Light path = 1 cm METHOD: Continuous Spectrophotometric Rate Determination REAGENTS: A. 200 mM Tris HCl Buffer, pH 7.5 at 30°C (Prepare 50 ml in deionized water using Trizma Base, Sigma Prod. No. T-1503. Adjust to pH 7.5 at 30°C with 1 M HCl.) B. 1 M Potassium Chloride Solution (KCl) (Prepare 10 ml in deionized water using Potassium Chloride, Sigma Prod. No. P-4504.) C. 60 mM Magnesium Sulfate Solution (MgSO4) (Prepare 20 ml in deionized water using Magnesium Sulfate, Heptahydrate, Sigma Prod. No. M-1880.) D. 40 mM Phospho(enol)pyruvate Solution (PEP) (Prepare 50 ml in deionized water using Phospho(enol)Pyruvate, Trisodium Salt, Hydrate, Sigma Prod. No. P-7002. PREPARE FRESH.) Revised: 03/10/94 Page 1 of 4 Enzymatic Assay of GUANYLATE KINASE (EC 2.7.4.8) REAGENTS: (continued) E. 100 mM Ethylenediaminetetraacetic Acid Solution (EDTA) (Prepare 10 ml in deionized water using Ethylenediaminetetraacetic Acid, Tetrasodium Salt, Hydrate, Sigma Stock No. ED4SS.) F. 3.8 mM ß-Nicotinamide Adenine Dinucleotide, Reduced Form (ß-NADH) (Prepare 2 ml in deionized water using ß-Nicotinamide Adenine Dinucleotide, Reduced Form, Dipotassium Salt, Sigma Prod.
  • WO 2013/180584 Al 5 December 2013 (05.12.2013) P O P C T

    WO 2013/180584 Al 5 December 2013 (05.12.2013) P O P C T

    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2013/180584 Al 5 December 2013 (05.12.2013) P O P C T (51) International Patent Classification: AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, C12N 1/21 (2006.01) C12N 15/74 (2006.01) BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, C12N 15/52 (2006.01) C12P 5/02 (2006.01) DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, C12N 15/63 (2006.01) HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KN, KP, KR, KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, ME, (21) International Application Number: MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, PCT/NZ20 13/000095 OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SC, (22) International Filing Date: SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, 4 June 2013 (04.06.2013) TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, GH, (26) Publication Language: English GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, SZ, TZ, (30) Priority Data: UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, 61/654,412 1 June 2012 (01 .06.2012) US TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, LV, (71) Applicant: LANZATECH NEW ZEALAND LIMITED MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, [NZ/NZ]; 24 Balfour Road, Parnell, Auckland, 1052 (NZ).
  • A Screen for Suppressors of Gross Chromosomal Rearrangements Identifies a Conserved Role for PLP in Preventing DNA Lesions

    A Screen for Suppressors of Gross Chromosomal Rearrangements Identifies a Conserved Role for PLP in Preventing DNA Lesions

    A Screen for Suppressors of Gross Chromosomal Rearrangements Identifies a Conserved Role for PLP in Preventing DNA Lesions Pamela Kanellis1,2, Mark Gagliardi1, Judit P. Banath3, Rachel K. Szilard1, Shinichiro Nakada1, Sarah Galicia1, Frederic D. Sweeney1,2, Diane C. Cabelof4, Peggy L. Olive3, Daniel Durocher1,2* 1 Samuel Lunenfeld Research Institute, Mount Sinai Hospital, Toronto, Ontario, Canada, 2 Department of Medical Genetics and Microbiology, University of Toronto, Toronto, Ontario, Canada, 3 British Columbia Cancer Research Centre, Vancouver, British Columbia, Canada, 4 Karmanos Cancer Institute, Detroit, Michigan, United States of America Genome instability is a hallmark of cancer cells. One class of genome aberrations prevalent in tumor cells is termed gross chromosomal rearrangements (GCRs). GCRs comprise chromosome translocations, amplifications, inversions, deletion of whole chromosome arms, and interstitial deletions. Here, we report the results of a genome-wide screen in Saccharomyces cerevisiae aimed at identifying novel suppressors of GCR formation. The most potent novel GCR suppressor identified is BUD16, the gene coding for yeast pyridoxal kinase (Pdxk), a key enzyme in the metabolism of pyridoxal 59 phosphate (PLP), the biologically active form of vitamin B6. We show that Pdxk potently suppresses GCR events by curtailing the appearance of DNA lesions during the cell cycle. We also show that pharmacological inhibition of Pdxk in human cells leads to the production of DSBs and activation of the DNA damage checkpoint. Finally, our evidence suggests that PLP deficiency threatens genome integrity, most likely via its role in dTMP biosynthesis, as Pdxk-deficient cells accumulate uracil in their nuclear DNA and are sensitive to inhibition of ribonucleotide reductase.
  • (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk Et Al

    (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk Et Al

    US 2014O155567A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk et al. (43) Pub. Date: Jun. 5, 2014 (54) MICROORGANISMS AND METHODS FOR (60) Provisional application No. 61/331,812, filed on May THE BIOSYNTHESIS OF BUTADENE 5, 2010. (71) Applicant: Genomatica, Inc., San Diego, CA (US) Publication Classification (72) Inventors: Mark J. Burk, San Diego, CA (US); (51) Int. Cl. Anthony P. Burgard, Bellefonte, PA CI2P 5/02 (2006.01) (US); Jun Sun, San Diego, CA (US); CSF 36/06 (2006.01) Robin E. Osterhout, San Diego, CA CD7C II/6 (2006.01) (US); Priti Pharkya, San Diego, CA (52) U.S. Cl. (US) CPC ................. CI2P5/026 (2013.01); C07C II/I6 (2013.01); C08F 136/06 (2013.01) (73) Assignee: Genomatica, Inc., San Diego, CA (US) USPC ... 526/335; 435/252.3:435/167; 435/254.2: (21) Appl. No.: 14/059,131 435/254.11: 435/252.33: 435/254.21:585/16 (22) Filed: Oct. 21, 2013 (57) ABSTRACT O O The invention provides non-naturally occurring microbial Related U.S. Application Data organisms having a butadiene pathway. The invention addi (63) Continuation of application No. 13/101,046, filed on tionally provides methods of using Such organisms to produce May 4, 2011, now Pat. No. 8,580,543. butadiene. Patent Application Publication Jun. 5, 2014 Sheet 1 of 4 US 2014/O155567 A1 ?ueudos!SMS |?un61– Patent Application Publication Jun. 5, 2014 Sheet 2 of 4 US 2014/O155567 A1 VOJ OO O Z?un61– Patent Application Publication US 2014/O155567 A1 {}}} Hººso Patent Application Publication Jun.
  • (Helianthus Annuus L.) Plastidial Lipoyl Synthases Genes Expression In

    (Helianthus Annuus L.) Plastidial Lipoyl Synthases Genes Expression In

    Impact of sunflower (Helianthus annuus L.) plastidial lipoyl synthases genes expression in glycerolipids composition of transgenic Arabidopsis plants Raquel Martins-Noguerol, Antonio Javier Moreno-Pérez, Acket Sebastien, Manuel Adrián Troncoso-Ponce, Rafael Garcés, Brigitte Thomasset, Joaquín Salas, Enrique Martínez-Force To cite this version: Raquel Martins-Noguerol, Antonio Javier Moreno-Pérez, Acket Sebastien, Manuel Adrián Troncoso- Ponce, Rafael Garcés, et al.. Impact of sunflower (Helianthus annuus L.) plastidial lipoyl synthases genes expression in glycerolipids composition of transgenic Arabidopsis plants. Scientific Reports, Nature Publishing Group, 2020, 10, pp.3749. 10.1038/s41598-020-60686-z. hal-02881038 HAL Id: hal-02881038 https://hal.archives-ouvertes.fr/hal-02881038 Submitted on 25 Jun 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. www.nature.com/scientificreports OPEN Impact of sunfower (Helianthus annuus L.) plastidial lipoyl synthases genes expression in glycerolipids composition of transgenic Arabidopsis plants Raquel Martins-Noguerol1,2, Antonio Javier Moreno-Pérez 1,2, Acket Sebastien2, Manuel Adrián Troncoso-Ponce2, Rafael Garcés1, Brigitte Thomasset2, Joaquín J. Salas1 & Enrique Martínez-Force 1* Lipoyl synthases are key enzymes in lipoic acid biosynthesis, a co-factor of several enzyme complexes involved in central metabolism.
  • Crystallographic Snapshots of Sulfur Insertion by Lipoyl Synthase

    Crystallographic Snapshots of Sulfur Insertion by Lipoyl Synthase

    Crystallographic snapshots of sulfur insertion by lipoyl synthase Martin I. McLaughlina,b,1, Nicholas D. Lanzc, Peter J. Goldmana, Kyung-Hoon Leeb, Squire J. Bookerb,c,d, and Catherine L. Drennana,e,f,2 aDepartment of Chemistry, Massachusetts Institute of Technology, Cambridge, MA 02139; bDepartment of Chemistry, The Pennsylvania State University, University Park, PA 16802; cDepartment of Biochemistry and Molecular Biology, The Pennsylvania State University, University Park, PA 16802; dHoward Hughes Medical Institute, The Pennsylvania State University, University Park, PA 16802; eDepartment of Biology, Massachusetts Institute of Technology, Cambridge, MA 02139; and fHoward Hughes Medical Institute, Massachusetts Institute of Technology, Cambridge, MA 02139 Edited by Vern L. Schramm, Albert Einstein College of Medicine, Bronx, NY, and approved July 5, 2016 (received for review March 8, 2016) Lipoyl synthase (LipA) catalyzes the insertion of two sulfur atoms substrate and at an intermediate stage in the reaction, just after at the unactivated C6 and C8 positions of a protein-bound octanoyl insertion of the C6 sulfur atom but before sulfur insertion at C8. chain to produce the lipoyl cofactor. To activate its substrate for sulfur insertion, LipA uses a [4Fe-4S] cluster and S-adenosylmethio- Results nine (AdoMet) radical chemistry; the remainder of the reaction The crystal structure of LipA from M. tuberculosis was de- mechanism, especially the source of the sulfur, has been less clear. termined to 1.64-Å resolution by iron multiwavelength anoma- One controversial proposal involves the removal of sulfur from a lous dispersion phasing (Table S1). The overall fold of LipA consists second (auxiliary) [4Fe-4S] cluster on the enzyme, resulting in de- of a (β/α)6 partial barrel common to most AdoMet radical enzymes struction of the cluster during each round of catalysis.
  • Identifying and Characterizing Genes Involved in Telomere Length

    Identifying and Characterizing Genes Involved in Telomere Length

    Tel Aviv University George S. Wise Faculty of Life Sciences Graduate School The Department of Molecular Microbiology and Biotechnology Identifying and Characterizing Genes Involved in Telomere Length Regulation in Saccharomyces cerevisiae Thesis submitted to the Senate of Tel Aviv University For the degree "Doctor of Philosophy (Ph.D.)" Submitted by Tal Yehuda Under the supervision of The deceased Dr. Anat Krauskopf and Prof. Martin Kupiec May 2008 עבודת המחקר שלי ארכה זמן רב, הן בגלל הנסיבות המיוחדות במעבדה והן בגלל סוג המחקר שבחרתי, לכן אני רוצה להודות לכל האנשים שליוו אותי בדרך ארוכה זו: החל מהמנחה הראשונה שלי- ענת קראוסקופף ז"ל, תודה על ההיכרות האישית והמדעית, למרטין קופייק- על הסבלנות הבלתי נלאית ללמד, לחנך ולהרביץ בי תורה, יישר כח! (תדע שהקשבתי לכל מילה), לחברי המעבדה- הישנים והחדשים, ובמיוחד לך יובל, תודה על העזרה ועל שיתוף הפעולה, למשפחתי העניפה- סבתותי, דודיי, חמיי, גיסותיי, הוריי ואחיי הנפלאים שהתעניינתם ושאלתם (גם אם ההסברים נשמעו לרוב עלומים), בעזרתכם הרבה סיימתי סוף סוף, ובמיוחד לבעלי האהוב- תודה על הכל ! וילדי היקרים לי מכל... ABSTRACT Telomeres are nucleoprotein structures present at the ends of eukaryotic chromosomes. Telomeres play a central role in guarding the integrity of the genome by protecting chromosome ends from degradation and fusion. Regulation of telomere length is central to their function. In order to broaden our knowledge about the mechanisms that control telomere length, we have carried out a systematic examination of ~4800 haploid deletion mutants of Saccharomyces cerevisiae for telomere-length alterations. Using this screen we have identified more than 150 new genes that affect telomere length. A novel array-based method for creating double mutants was used to sort the newly identified genes into epistasis groups.
  • Table S1. List of Oligonucleotide Primers Used

    Table S1. List of Oligonucleotide Primers Used

    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
  • A Dissection of SARS‑Cov2 with Clinical Implications (Review)

    A Dissection of SARS‑Cov2 with Clinical Implications (Review)

    INTERNATIONAL JOURNAL OF MOleCular meDICine 46: 489-508, 2020 A dissection of SARS‑CoV2 with clinical implications (Review) FELICIAN StanCIOIU1, GEORGIOS Z. PapaDAKIS2, STELIOS KTENIADAKIS3, BORIS NIKovaeviCH Izotov4, MICHAEL D. COLEMAN5, DEMETRIOS A. SpanDIDOS6 and ARISTIDIS TsatsaKIS4,7 1Bio‑Forum Foundation, 030121 Bucharest, Romania; 2Department of Radiology, Medical School, University of Crete, 71003 Heraklion; 3Emergency Department, Venizeleion General Hospital, 71409 Heraklion, Greece; 4Department of Analytical and Forensic Medical Toxicology, Sechenov University, 119991 Moscow, Russia; 5School of Life and Health Sciences, Aston University, B4 7ET Birmingham, UK; 6Laboratory of Clinical Virology, Medical School, 7Department of Forensic Sciences and Toxicology, Faculty of Medicine, University of Crete, 71003 Heraklion, Greece Received May 15, 2020; Accepted June 9, 2020 DOI: 10.3892/ijmm.2020.4636 Abstract. We are being confronted with the most consequen- 1. Clinical aspects of COVID‑19 infections; acute respi‑ tial pandemic since the Spanish flu of 1918‑1920 to the extent ratory distress syndrome (ARDS); known and potential that never before have 4 billion people quarantined simultane- treatments ously; to address this global challenge we bring to the forefront the options for medical treatment and summarize SARS‑CoV2 In China, the first comprehensive analysis published on the structure and functions, immune responses and known treat- COVID‑19 (1) included 44,672 cases and 1,023 deaths, with an ments. Based on literature and our own experience we propose overall case-fatality rate (CFR) of 2.3%. There were 0 deaths new interventions, including the use of amiodarone, simv- in patients 9 years old or younger, and the CFR increased with astatin, pioglitazone and curcumin.
  • Curriculum Vitae Vern Lee Schramm

    Curriculum Vitae Vern Lee Schramm

    September 2011 CURRICULUM VITAE VERN LEE SCHRAMM Department of Biochemistry Albert Einstein College of Medicine of Yeshiva University 1300 Morris Park Avenue Bronx, New York 10461 Phone: (718) 430-2813 Fax: (718) 430-8565 E-mail: [email protected] Personal Information: Date of Birth: November 9, 1941 Place of Birth: Howard, South Dakota Citizenship: U.S.A. Home Address: 68 Hampton Oval New Rochelle, NY 10805 Home Telephone: (914) 576-2578 Education: Sept 1959 – June 1963 B.S. in Bacteriology (chemistry emphasis), South Dakota State College Sept 1963 – June 1965 Masters Degree in Nutrition (biochemistry emphasis), Harvard University Research Advisor, Dr. R.P. Geyer Oct 1965 – April 1969 Ph.D. in Mechanism of Enzyme Action, Department of Biochemistry, Australian National University Research Advisor, Dr. John Morrison Postdoctoral Experience: Aug 1969 – Aug 1971 NRC-NSF Postdoctoral Research Associate at NASA Ames Research Center, Biological Adaptation Branch Appointments: July 1999 – Present University Professor of the Albert Einstein College of Medicine July 1995 – Present Ruth Merns Endowed Chair of Biochemistry Aug 1987 – Present Professor and Chairman, Department of Biochemistry, Albert Einstein College of Medicine July 1981 - July 1987 Professor of Biochemistry, Temple University School of Medicine July 1976 - June 1981 Associate Professor of Biochemistry, Temple University School of Medicine Aug 1971 - July 1976 Assistant Professor of Biochemistry, Temple University School of Medicine Vern L. Schramm 2 Fields of Interest: Enzymatic