Supplementary Material

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Supplementary Material ASSESSMENT OF FULL-SCALE TERTIARY WASTEWATER TREATMENT BY AOPs: REMOVAL OR PERSISTENCE OF ANTIBIOTICS AND ANTIBIOTIC RESISTANCE GENES? Jorge RODRÍGUEZ-CHUECA1,2, Saulo VARELA DELLA GIUSTINA3, Jaqueline ROCHA4, Telma FERNANDES4, Cristina PABLOS1, Ángel ENCINAS5, Damià BARCELÓ3,6, Sara RODRÍGUEZ-MOZAZ3, Célia M. MANAIA4, Javier MARUGÁN1* (1) Department of Chemical and Environmental Technology (ESCET), Universidad Rey Juan Carlos, C/ Tulipán s/n, 28933 Móstoles, Madrid, Spain (2) Department of Chemical and Environmental Engineering, Escuela Técnica Superior de Ingenieros Industriales, Universidad Politécnica de Madrid, C/ José Gutiérrez Abascal 2, 28006, Madrid, Spain. (3) Catalan Institute for Water Research (ICRA), H2O Building, Scientific and Technological Park of the University of Girona, 17003 Girona, Spain (4) Universidade Católica Portuguesa, CBQF - Centro de Biotecnologia e Química Fina – Laboratório Associado, Escola Superior de Biotecnologia, Rua Arquiteto Lobão Vital, 172, 4200-374 Porto, Portugal (5) Department of Innovation & Technology, FCC Aqualia, S.A., C/ Montesinos 28, 06002, Badajoz, Spain. (6) Environmental Chemistry Department, IDAEA–CSIC, Jordi Girona 18-26, E- 08034 Barcelona, Spain *Author to whom correspondence should be addressed: Tel: +34 916 64 7466 [email protected] 1 Table S1. Experimental design matrix. 3 Treatment UV-C [PMS] mM [H2O2] mM [Fe(II)] mM Flow rate (m /h) ON 28 UV-C ON 114 ON 0.2 28 H2O2/UV-C ON 0.5 75 ON 0.5 114 ON 0.2 28 PMS/UV-C ON 0.5 75 ON 0.5 114 ON 0.2 0.2 28 PMS/Fe(II)/UV-C ON 0.5 0.5 75 ON 0.5 0.5 114 2 Table S2. Antibiotics analysed, classified by their chemical group. Chemical Chemical group Compounds Compounds group Ofloxacin Azithromycin Ciprofloxacin Clarithromycin Enrofloxacin Roxithromycin Macrolides Danofloxacin Tylosin Fluoroquinolones Norfloxacin Tilmicosin Orbifloxacin Spiramycin Marbofloxacin Nitroimidazole Metronidazole Cinoxacin antibiotics Metronidazole-OH Flumequine Clindamycin Lincosamides Oxolinic acid Lincomycin Quinolones Dihydrofolate Nalidixic acid reductase Trimethoprim Pipemidic acid inhibitors Amoxicillin Sulfamethoxazole Ampicillin Sulfadiazine Penicillins Penicillin G Sulfisomidin Penicillin V Sulfathiazole Oxacillin Sulfadimethoxine Cefalexin Sulfapyridine Cefazolin Sulfamerazine Cephalosporins Cefotaxime Sulfonamides Sulfamethizole Cefuroxime Sulfamethoxypiridazine Ceftiofur Sulfisoxazole Cefapirin Sulfanitran Tetracycline Sulfabenzamide Chlortetracyline N-acetylsulfadiazine Tetracyclines Doxycycline N-acetylsulfamethazine Oxytetracycline N-acetylsulfamerazine 3 Table S3 - Conditions used in qPCR assays Target qPCR Limit of quantification Primers Primers sequence Conditions Primers reference gene Standard (no. of copies) E.coli 95 °C for 10 min (1 cycle); 95 °C 16S rRNA 1114F CGGCAACGAGCGCAACCC ATCC for 15s, 55 °C for 20 s and 72 °C for 330 Denman et al. 2006 gene 25922 1275R CCATTGTAGCACGTGTGTAGCC 10 s (35 cycles) Other: 1a Clone blaTEM-F TTCCTGTTTTTGCTCACCCAG 95ºC 10 min (1 cycle), 95ºC 15 s – bla bla 54 Bibbal et al., 2007 TEM TEM 60ºC 1 min (40 cycles) Other: 2a (pNORM) blaTEM-R CTCAAGGATCTTACCGCTGTTG E. coli OXA1B14_fw CACTTACAGGAAACTTGGGGTCG 95ºC 10 min (1 cycle), 95ºC 15 s - Ahammad et al., blaOXA-A 64 A2FC14 blaOXA1_rv AGTGTGTTTAGAATGGTGATC 60ºC 1 min (40 cycles) Other: 2d 2014 clone sul1 sul1-FW CGCACCGGAAACATCGCTGCAC 95ºC 5 min (1 cycle), 95ºC 15 s - sul1 135 Marti et al., 2014 (pNORM) sul1-RV TGAAGTTCCGCCGCAAGGCTCG 60ºC 30 s (35 cycles) Other: 3b Clone sul2-FW TCCGGTGGAGGCCGGTATCTGG 95ºC 5 min (1 cycle), 95ºC 15 s - sul2 47 Pei et al., 2006 sul2 sul2-RV CGGGAATGCCATCTGCCTTGAG 60ºC 1 min (40 cycles) Other: 1a clone qnrS qnrSrtF11 GACGTGCTAACTTGCGTGAT 95ºC 5 min (1 cycle), 95ºC 15 s - qnrS 10 Martí et al., 2013 (pNORM) qnrSrtR11 TGGCATTGTTGGAAACTTG 60ºC 1 min (40 cycles) Other: 2d clone intI1 95ºC 10 min (1 cycle), 95ºC 15 s - intI1 intI1-LC1 GCCTTGATGTTACCCGAGAG 54 Barraud et al., 2010 (pNORM) 60ºC 1 min (40 cycles) Other: 2a 1) KAPA SYBR® FAST ABI Prism® qPCR Master Mix; 2) SYBR® Select Master Mix; 3) Fast SYBRTM Green Master Mix; a) 200 nM of primer; b) 300nM; c) 400 nM of primer; d) 600 nM of primer. 4 References Ahammad, Z.S., Sreekrishnan, T.R., Hands, C.L., Knapp, C.W., Graham, D.W., 2014. Increased waterborne blaNDM-1 resistance gene abundances associated with seasonal human pilgrimages to the Upper Ganges River. Environ. Sci. Technol. 48, 3014–3020. Barraud, O., Baclet, M.C., Denis, F., Ploy, M.C., 2010. Quantitative multiplex real- time PCR for detecting class 1, 2 and 3 integrons. J. Antimicrob. Chemother. 65, 1642–1645. Bibbal, D., Dupouy, V., Ferré, J.P., Toutain, P.L., Fayet, O., Prère, M.F., Bousquet- Mélou, A., 2007. Impact of three ampicillin dosage regimens on selection of ampicillin resistance in Enterobacteriaceae and excretion of blaTEM genes in swine feces. Appl. Environ. Microbiol. 73, 4785–4790. Denman, S.E., McSweeney, C.S., 2006. Development of a real-time PCR assay for monitoring anaerobic fungal and cellulolytic bacterial populations within the rumen. FEMS Microbiol. Ecol. 58, 572–82. Marti, E., Variatza, E., Balcazar, J.L., 2014. Bacteriophages as a reservoir of extended-spectrum beta-lactamase and fluoroquinolone resistance genes in the environment. Clin. Microbiol. Infect. 20, O456–O459. Marti, E., Balcázar, J.L., 2013. Real-time PCR assays for quantification of qnr genes in environmental water samples and chicken feces. Appl. Environ. Microbiol. 79, 1743–1745. Pei, R., Kim, S.C., Carlson, K.H., Pruden, A., 2006. Effect of river landscape on the sediment concentrations of antibiotics and corresponding antibiotic resistance genes (ARG). Water Res. 40, 2427–2435. 5 .
Recommended publications
  • (12) Patent Application Publication (10) Pub. No.: US 2010/0221245 A1 Kunin (43) Pub

    (12) Patent Application Publication (10) Pub. No.: US 2010/0221245 A1 Kunin (43) Pub

    US 2010O221245A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2010/0221245 A1 Kunin (43) Pub. Date: Sep. 2, 2010 (54) TOPICAL SKIN CARE COMPOSITION Publication Classification (51) Int. Cl. (76) Inventor: Audrey Kunin, Mission Hills, KS A 6LX 39/395 (2006.01) (US) A6II 3L/235 (2006.01) A638/16 (2006.01) Correspondence Address: (52) U.S. Cl. ......................... 424/133.1: 514/533: 514/12 HUSCH BLACKWELL SANDERS LLP (57) ABSTRACT 4801 Main Street, Suite 1000 - KANSAS CITY, MO 64112 (US) The present invention is directed to a topical skin care com position. The composition has the unique ability to treat acne without drying out the user's skin. In particular, the compo (21) Appl. No.: 12/395,251 sition includes a base, an antibacterial agent, at least one anti-inflammatory agent, and at least one antioxidant. The (22) Filed: Feb. 27, 2009 antibacterial agent may be benzoyl peroxide. US 2010/0221 245 A1 Sep. 2, 2010 TOPCAL SKIN CARE COMPOSITION stay of acne treatment since the 1950s. Skin irritation is the most common side effect of benzoyl peroxide and other anti BACKGROUND OF THE INVENTION biotic usage. Some treatments can be severe and can leave the 0001. The present invention generally relates to composi user's skin excessively dry. Excessive use of some acne prod tions and methods for producing topical skin care. Acne Vul ucts may cause redness, dryness of the face, and can actually garis, or acne, is a common skin disease that is prevalent in lead to more acne. Therefore, it would be beneficial to provide teenagers and young adults.
  • A TWO-YEAR RETROSPECTIVE ANALYSIS of ADVERSE DRUG REACTIONS with 5PSQ-031 FLUOROQUINOLONE and QUINOLONE ANTIBIOTICS 24Th Congress Of

    A TWO-YEAR RETROSPECTIVE ANALYSIS of ADVERSE DRUG REACTIONS with 5PSQ-031 FLUOROQUINOLONE and QUINOLONE ANTIBIOTICS 24Th Congress Of

    A TWO-YEAR RETROSPECTIVE ANALYSIS OF ADVERSE DRUG REACTIONS WITH 5PSQ-031 FLUOROQUINOLONE AND QUINOLONE ANTIBIOTICS 24th Congress of V. Borsi1, M. Del Lungo2, L. Giovannetti1, M.G. Lai1, M. Parrilli1 1 Azienda USL Toscana Centro, Pharmacovigilance Centre, Florence, Italy 2 Dept. of Neurosciences, Psychology, Drug Research and Child Health (NEUROFARBA), 27-29 March 2019 Section of Pharmacology and Toxicology , University of Florence, Italy BACKGROUND PURPOSE On 9 February 2017, the Pharmacovigilance Risk Assessment Committee (PRAC) initiated a review1 of disabling To review the adverse drugs and potentially long-lasting side effects reported with systemic and inhaled quinolone and fluoroquinolone reactions (ADRs) of antibiotics at the request of the German medicines authority (BfArM) following reports of long-lasting side effects systemic and inhaled in the national safety database and the published literature. fluoroquinolone and quinolone antibiotics that MATERIAL AND METHODS involved peripheral and central nervous system, Retrospective analysis of ADRs reported in our APVD involving ciprofloxacin, flumequine, levofloxacin, tendons, muscles and joints lomefloxacin, moxifloxacin, norfloxacin, ofloxacin, pefloxacin, prulifloxacin, rufloxacin, cinoxacin, nalidixic acid, reported from our pipemidic given systemically (by mouth or injection). The period considered is September 2016 to September Pharmacovigilance 2018. Department (PVD). RESULTS 22 ADRs were reported in our PVD involving fluoroquinolone and quinolone antibiotics in the period considered and that affected peripheral or central nervous system, tendons, muscles and joints. The mean patient age was 67,3 years (range: 17-92 years). 63,7% of the ADRs reported were serious, of which 22,7% caused hospitalization and 4,5% caused persistent/severe disability. 81,8% of the ADRs were reported by a healthcare professional (physician, pharmacist or other) and 18,2% by patient or a non-healthcare professional.
  • AMEG Categorisation of Antibiotics

    AMEG Categorisation of Antibiotics

    12 December 2019 EMA/CVMP/CHMP/682198/2017 Committee for Medicinal Products for Veterinary use (CVMP) Committee for Medicinal Products for Human Use (CHMP) Categorisation of antibiotics in the European Union Answer to the request from the European Commission for updating the scientific advice on the impact on public health and animal health of the use of antibiotics in animals Agreed by the Antimicrobial Advice ad hoc Expert Group (AMEG) 29 October 2018 Adopted by the CVMP for release for consultation 24 January 2019 Adopted by the CHMP for release for consultation 31 January 2019 Start of public consultation 5 February 2019 End of consultation (deadline for comments) 30 April 2019 Agreed by the Antimicrobial Advice ad hoc Expert Group (AMEG) 19 November 2019 Adopted by the CVMP 5 December 2019 Adopted by the CHMP 12 December 2019 Official address Domenico Scarlattilaan 6 ● 1083 HS Amsterdam ● The Netherlands Address for visits and deliveries Refer to www.ema.europa.eu/how-to-find-us Send us a question Go to www.ema.europa.eu/contact Telephone +31 (0)88 781 6000 An agency of the European Union © European Medicines Agency, 2020. Reproduction is authorised provided the source is acknowledged. Categorisation of antibiotics in the European Union Table of Contents 1. Summary assessment and recommendations .......................................... 3 2. Introduction ............................................................................................ 7 2.1. Background ........................................................................................................
  • Transdermal Drug Delivery Device Including An

    Transdermal Drug Delivery Device Including An

    (19) TZZ_ZZ¥¥_T (11) EP 1 807 033 B1 (12) EUROPEAN PATENT SPECIFICATION (45) Date of publication and mention (51) Int Cl.: of the grant of the patent: A61F 13/02 (2006.01) A61L 15/16 (2006.01) 20.07.2016 Bulletin 2016/29 (86) International application number: (21) Application number: 05815555.7 PCT/US2005/035806 (22) Date of filing: 07.10.2005 (87) International publication number: WO 2006/044206 (27.04.2006 Gazette 2006/17) (54) TRANSDERMAL DRUG DELIVERY DEVICE INCLUDING AN OCCLUSIVE BACKING VORRICHTUNG ZUR TRANSDERMALEN VERABREICHUNG VON ARZNEIMITTELN EINSCHLIESSLICH EINER VERSTOPFUNGSSICHERUNG DISPOSITIF D’ADMINISTRATION TRANSDERMIQUE DE MEDICAMENTS AVEC COUCHE SUPPORT OCCLUSIVE (84) Designated Contracting States: • MANTELLE, Juan AT BE BG CH CY CZ DE DK EE ES FI FR GB GR Miami, FL 33186 (US) HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI • NGUYEN, Viet SK TR Miami, FL 33176 (US) (30) Priority: 08.10.2004 US 616861 P (74) Representative: Awapatent AB P.O. Box 5117 (43) Date of publication of application: 200 71 Malmö (SE) 18.07.2007 Bulletin 2007/29 (56) References cited: (73) Proprietor: NOVEN PHARMACEUTICALS, INC. WO-A-02/36103 WO-A-97/23205 Miami, FL 33186 (US) WO-A-2005/046600 WO-A-2006/028863 US-A- 4 994 278 US-A- 4 994 278 (72) Inventors: US-A- 5 246 705 US-A- 5 474 783 • KANIOS, David US-A- 5 474 783 US-A1- 2001 051 180 Miami, FL 33196 (US) US-A1- 2002 128 345 US-A1- 2006 034 905 Note: Within nine months of the publication of the mention of the grant of the European patent in the European Patent Bulletin, any person may give notice to the European Patent Office of opposition to that patent, in accordance with the Implementing Regulations.
  • Therapeutic Class Overview Fluoroquinolones

    Therapeutic Class Overview Fluoroquinolones

    Therapeutic Class Overview Fluoroquinolones INTRODUCTION The fluoroquinolones are broad-spectrum antibiotics grouped into generations based on their spectrum of activity (Bolon 2011). ○ First generation agents, which are structurally quinolones rather than fluoroquinolones, possess activity against aerobic gram-negative bacteria but are not effective against aerobic gram-positive bacteria or anaerobes. The first generation agents (eg, nalidixic acid, cinoxacin) are no longer on the market. ○ Second generation agents, the original fluoroquinolones, contain a fluorine atom at position C-6. These agents offer improved coverage against gram-negative bacteria and moderately improved gram-positive coverage. The available second generation fluoroquinolones include ciprofloxacin, levofloxacin, and ofloxacin. Lomefloxacin and norfloxacin are second generation agents which are no longer on the market. ○ Third generation agents achieve greater potency against gram-positive bacteria, particularly pneumococci, and also possess good activity against anaerobes. All 3 of the third generation agents, gatifloxacin, grepafloxacin, and sparfloxacin, were removed from the market due to toxicities. ○ Fourth generation fluoroquinolones have superior coverage against pneumococci and anaerobes. The available agent is moxifloxacin. Trovafloxacin, was removed from the market due to toxicities, and there is a drug shortage of gemifloxacin. ○ The most recently approved fluoroquinolone, delafloxacin, has an even broader spectrum of antibiotic activity and is commonly referred to as a “next generation” fluoroquinolone. The fluoroquinolones have been used to treat a variety of infections including urinary tract infections, sinusitis, lower respiratory tract infections, intra-abdominal infections, infectious diarrhea, skin and skin structure infections, sexually transmitted diseases, and bacterial prostatitis. A few of the agents also have Food and Drug Administration (FDA) approval for inhalational anthrax and plague.
  • Paper I and II)

    Paper I and II)

    Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 1335 Constraints on up-regulation of drug efflux in the evolution of ciprofloxacin resistance LISA PRASKI ALZRIGAT ACTA UNIVERSITATIS UPSALIENSIS ISSN 1651-6206 ISBN 978-91-554-9923-5 UPPSALA urn:nbn:se:uu:diva-320580 2017 Dissertation presented at Uppsala University to be publicly examined in B22, BMC, Husargatan 3, Uppsala, Friday, 9 June 2017 at 09:00 for the degree of Doctor of Philosophy (Faculty of Medicine). The examination will be conducted in English. Faculty examiner: Professor Fernando Baquero (Departamento de Microbiología, Hospital Universitario Ramón y Cajal, Instituto Ramón y Cajal de Investigación Sanitaria (IRYCIS), Madrid, Spain). Abstract Praski Alzrigat, L. 2017. Constraints on up-regulation of drug efflux in the evolution of ciprofloxacin resistance. Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 1335. 48 pp. Uppsala: Acta Universitatis Upsaliensis. ISBN 978-91-554-9923-5. The crucial role of antibiotics in modern medicine, in curing infections and enabling advanced medical procedures, is being threatened by the increasing frequency of resistant bacteria. Better understanding of the forces selecting resistance mutations could help develop strategies to optimize the use of antibiotics and slow the spread of resistance. Resistance to ciprofloxacin, a clinically important antibiotic, almost always involves target mutations in DNA gyrase and Topoisomerase IV. Because ciprofloxacin is a substrate of the AcrAB-TolC efflux pump, mutations causing pump up-regulation are also common. Studying the role of efflux pump-regulatory mutations in the development of ciprofloxacin resistance, we found a strong bias against gene-inactivating mutations in marR and acrR in clinical isolates.
  • PT Animal Feed Drugs

    PT Animal Feed Drugs

    Animal Feed Drugs • 26 labs/facilities reported at least one drug between 2016 to April 2018 • 2017 Lab Method’s Need Survey (based on the 2016 Compendium) – 41 drugs were checked by respondents. Up to 23 labs indicated that they run or were interested in adding certain drugs. • 44 Drugs or Drug Combination are listed in the 2018 Compendium • 66 AAFCO PT Method Codes – Mix of some current drugs and drugs no longer listed in the compendium. • Only 19 drugs reported from the current method code list between 2016 to April 2018 © 2018 Association of American Feed Control Officials (AAFCO) 1800 S. Oak Street, Suite 100, Champaign, IL 61820-6974 Methods Needs Survey 2017 vs 30 25 20 15 Chlortet 10 Decoquinate 5 0 Lasalocid Amprolium Lasalocid Arsanilic Acid Bacitracin Sodium Bacitracin Zinc Carbadox Chlortetracycline/Penicillin/Sulfamethazine Clopidol Cyromazine Reported Diclazuril Diflubenzuron Ethopabate Fenbendazole Furazolidone Hygromycin B Ivermecti n Oxytet Lasalocid (Max per Round) LeVamisole Maduramicin Menadione (form) Monensin Narasin © 2018 MethodsAssociation Needs ofSurVey American - 2017 Feed Control OfficialsNeomycin (AAFCO) Nicarbazin 1800 S. Oak Street, Suite 100, Champaign, IL 61820 Nitrofurazone NoVobiocin Ormetoprim Penicillin Piperazine Pyrantel Tartrate Tylosin Max Reported from 2016 to 2018 (April) Ractopamine Hydrochloride Robenidine Hyrochloride (S)-Methoprene Semduramicin Spectinomycin Sulfadimethoxine Sulfadimethoxine and Ormetoprim 5:3 Sulfanitran -6974 Sulfathiazole Thiabendazole Til micosin Tylosin/Sulfamethazine Tyl Valosin Tartarate Zilpaterol Zoalene • VFD drugs and/or Feeds • Residues – We’ve added residue levels of drugs. We have between 1 to 16 labs report in a round. • Why are drugs not analyzed? • Not required by program? • Regional? • Economic? • Lack of equipment? • Specific drug not used internationally? • Melegestrol acetate –Are labs planning on analyzing steroids? © 2018 Association of American Feed Control Officials (AAFCO) 1800 S.
  • An End-To-End Workflow for Quantitative Screening of Multiclass, Multiresidue Veterinary Drugs in Meat Using the Agilent 6470 Triple Quadrupole LC/MS

    An End-To-End Workflow for Quantitative Screening of Multiclass, Multiresidue Veterinary Drugs in Meat Using the Agilent 6470 Triple Quadrupole LC/MS

    Application Note Food Testing & Agriculture An End-To-End Workflow for Quantitative Screening of Multiclass, Multiresidue Veterinary Drugs in Meat Using the Agilent 6470 Triple Quadrupole LC/MS Authors Abstract Siji Joseph, Aimei Zou, Chee A comprehensive LC/MS/MS workflow was developed for targeted screening or Sian Gan, Limian Zhao, and quantitation of 210 veterinary drug residues in animal muscle prepared for human Patrick Batoon consumption, with the intention to accelerate and simplify routine laboratory testing. Agilent Technologies, Inc. The workflow ranged from sample preparation through chromatographic separation, MS detection, data processing and analysis, and report generation. The workflow performance was evaluated using three muscle matrices—chicken, pork, and beef— and was assessed on two different Agilent triple quadrupole LC/MS models (an Agilent 6470 and a 6495C triple quadrupole LC/MS). A simple sample preparation protocol using Agilent Captiva EMR—Lipid cartridges provided efficient extraction and matrix cleanup. A single chromatographic method using Agilent InfinityLab Poroshell 120 EC-C18 columns with a 13-minute method delivered acceptable separation and retention time distribution across the elution window for reliable triple quadrupole detection and data analysis. Workflow performance was evaluated based on evaluation of limit of detection (LOD), limit of quantitation (LOQ), calibration curve linearity, accuracy, precision, and recovery, using matrix-matched spike samples for a range from 0.1 to 100 μg/L. Calibration curves were plotted from LOQ to 100 μg/L, where all analytes demonstrated linearity R2 >0.99. Instrument method accuracy values were within 73 to 113%. Target analytes response and retention time %RSD values were ≤19% and ≤0.28% respectively.
  • A Class-Selective Immunoassay for Sulfonamides Residue Detection in Milk Using a Superior Polyclonal Antibody with Broad Specificity and Highly Uniform Affinity

    A Class-Selective Immunoassay for Sulfonamides Residue Detection in Milk Using a Superior Polyclonal Antibody with Broad Specificity and Highly Uniform Affinity

    Article A Class-Selective Immunoassay for Sulfonamides Residue Detection in Milk Using a Superior Polyclonal Antibody with Broad Specificity and Highly Uniform Affinity Chenglong Li 1, Xiangshu Luo 1, Yonghan Li 2, Huijuan Yang 1, Xiao Liang 3, Kai Wen 1, Yanxin Cao 1, Chao Li 1, Weiyu Wang 1, Weimin Shi 1, Suxia Zhang 1, Xuezhi Yu 1,* and Zhanhui Wang 1 1 Beijing Advanced Innovation Center for Food Nutrition and Human Health, College of Veterinary Medicine, China Agricultural University, Beijing Key Laboratory of Detection Technology for Animal- Derived Food Safety, Beijing Laboratory of Food Quality and Safety, 100193 Beijing, China; [email protected] (C.L.); [email protected] (X.L.); [email protected] (H.Y.); [email protected] (K.W.); [email protected] (Y.C.); [email protected] (C.L.); [email protected] (W.W.); [email protected] (W.S.); [email protected] (S.Z.); [email protected] (Z.W.) 2 Henan Animal Health Supervision Institute, 450008 Zhengzhou, China; [email protected] 3 College of Veterinary Medicine, Qingdao Agricultural University, 266109 Qingdao, China; [email protected] * Correspondence: [email protected]; Tel.: +86-10-62734565; Fax: +86-10-62731032 Academic Editors: Patricia Regal and Carlos M. Franco Received: 13 December 2018; Accepted: 24 January 2019; Published: 26 January 2019 Abstract: The development of multianalyte immunoassays with an emphasis on food safety has attracted increasing interest, due to its high target throughput, short detection time, reduced sample consumption, and low overall cost. In this study, a superior polyclonal antibody (pAb) against sulfonamides (SAs) was raised by using a bioconjugate of bovine serum albumin with a rationally designed hapten 4-[(4-aminophenyl) sulfonyl-amino]-2-methoxybenzoic acid (SA10-X).
  • United States Patent 19 11 Patent Number: 5,668,134 Klimstra Et Al

    United States Patent 19 11 Patent Number: 5,668,134 Klimstra Et Al

    US.005668134A United States Patent 19 11 Patent Number: 5,668,134 Klimstra et al. (45) Date of Patent: Sep. 16, 1997 54 METHOD FOR PREVENTING OR Keiichi Tozawa, et al. "AClinical Study of Lomefloxacin on REDUCNG PHOTOSENSTIWTY AND/OR Patients with Urinary Tract Infections. Focused on Lom PHOTOTOXCTY REACTIONS TO efloxacin-induced photosensitivity reaction”. Acta Urol. MEDCATIONS Jpn., vol.39, pp. 801-805. (1993) *(English translation of Japanese article is attached). 75 Inventors: Paul Dale Klimstra, Northbrook; Pierre Treffel, et al. "Chronopharmacokinetics of 5-Meth Barbara Roniker, Chicago; Edward oxypsoralen'", Acta Derm. Venerol, vol. 70, No. 6, pp. Allen Swabb, Kenilworth, all of Ill. 515-517, (1990). (73) Assignee: G. D. Searle & Co., Chicago, Ill. Primary Examiner-James H. Reamer Attorney, Agent, or Firm-Roberta L. Hastreiter; Roger A. 21) Appl. No.: 188,296 Williams 22 Filed: Jan. 28, 1994 57 ABSTRACT (51 Int. Cl. ... A61K 31/395 The present invention provides a method for preventing or 52 U.S. Cl. .............................................................. 514/254 reducing a photosensitivity and/or phototoxicity reaction which may be caused by a once-per-day dose of a medica 581 Field of Search ........................................ 514/254 tion which causes a photosensitivity and/or phototoxicity 56) References Cited reaction in a patient comprising administering the prescribed or suggested dose of the medication to the patient during the U.S. PATENT DOCUMENTS evening or early morning hours. 4,528,287 7/1985 Itoh et al. ............................... 514/254 The present invention also provides an article of manufac OTHER PUBLICATIONS ture comprising: (1) a packaging material, and (2) a once a-day dose medication which causes a photosensitivity and/ Bowee et al, Abstract of J.A.
  • Anew Drug Design Strategy in the Liht of Molecular Hybridization Concept

    Anew Drug Design Strategy in the Liht of Molecular Hybridization Concept

    www.ijcrt.org © 2020 IJCRT | Volume 8, Issue 12 December 2020 | ISSN: 2320-2882 “Drug Design strategy and chemical process maximization in the light of Molecular Hybridization Concept.” Subhasis Basu, Ph D Registration No: VB 1198 of 2018-2019. Department Of Chemistry, Visva-Bharati University A Draft Thesis is submitted for the partial fulfilment of PhD in Chemistry Thesis/Degree proceeding. DECLARATION I Certify that a. The Work contained in this thesis is original and has been done by me under the guidance of my supervisor. b. The work has not been submitted to any other Institute for any degree or diploma. c. I have followed the guidelines provided by the Institute in preparing the thesis. d. I have conformed to the norms and guidelines given in the Ethical Code of Conduct of the Institute. e. Whenever I have used materials (data, theoretical analysis, figures and text) from other sources, I have given due credit to them by citing them in the text of the thesis and giving their details in the references. Further, I have taken permission from the copyright owners of the sources, whenever necessary. IJCRT2012039 International Journal of Creative Research Thoughts (IJCRT) www.ijcrt.org 284 www.ijcrt.org © 2020 IJCRT | Volume 8, Issue 12 December 2020 | ISSN: 2320-2882 f. Whenever I have quoted written materials from other sources I have put them under quotation marks and given due credit to the sources by citing them and giving required details in the references. (Subhasis Basu) ACKNOWLEDGEMENT This preface is to extend an appreciation to all those individuals who with their generous co- operation guided us in every aspect to make this design and drawing successful.
  • Marrakesh Agreement Establishing the World Trade Organization

    Marrakesh Agreement Establishing the World Trade Organization

    No. 31874 Multilateral Marrakesh Agreement establishing the World Trade Organ ization (with final act, annexes and protocol). Concluded at Marrakesh on 15 April 1994 Authentic texts: English, French and Spanish. Registered by the Director-General of the World Trade Organization, acting on behalf of the Parties, on 1 June 1995. Multilat ral Accord de Marrakech instituant l©Organisation mondiale du commerce (avec acte final, annexes et protocole). Conclu Marrakech le 15 avril 1994 Textes authentiques : anglais, français et espagnol. Enregistré par le Directeur général de l'Organisation mondiale du com merce, agissant au nom des Parties, le 1er juin 1995. Vol. 1867, 1-31874 4_________United Nations — Treaty Series • Nations Unies — Recueil des Traités 1995 Table of contents Table des matières Indice [Volume 1867] FINAL ACT EMBODYING THE RESULTS OF THE URUGUAY ROUND OF MULTILATERAL TRADE NEGOTIATIONS ACTE FINAL REPRENANT LES RESULTATS DES NEGOCIATIONS COMMERCIALES MULTILATERALES DU CYCLE D©URUGUAY ACTA FINAL EN QUE SE INCORPOR N LOS RESULTADOS DE LA RONDA URUGUAY DE NEGOCIACIONES COMERCIALES MULTILATERALES SIGNATURES - SIGNATURES - FIRMAS MINISTERIAL DECISIONS, DECLARATIONS AND UNDERSTANDING DECISIONS, DECLARATIONS ET MEMORANDUM D©ACCORD MINISTERIELS DECISIONES, DECLARACIONES Y ENTEND MIENTO MINISTERIALES MARRAKESH AGREEMENT ESTABLISHING THE WORLD TRADE ORGANIZATION ACCORD DE MARRAKECH INSTITUANT L©ORGANISATION MONDIALE DU COMMERCE ACUERDO DE MARRAKECH POR EL QUE SE ESTABLECE LA ORGANIZACI N MUND1AL DEL COMERCIO ANNEX 1 ANNEXE 1 ANEXO 1 ANNEX