DOCSLIB.ORG

ED221648.Pdf

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
ED221648.Pdf DOCUMENT RESUME ED 221 648 CE 030 413 AUTHOR k,Eno, Rebecca A. TITLE Project LEAP. "Something Stops You andMakes You Think": Am Adaptation. Final Report. INSTITUTION Center for Literacy, Inc.,Philadelphia, PA. SPONS AGENCY Pennsylvana State Dept. of Education,Harrisburg. Div. of Adult Education andTraining Programs: PUB DATE 81 CONTRACT 80-98-0802 NOTE 136p.; Document contains two cropped pages. EDRS PRICE MF01/PC06 Plus Postage. AMSCRIPTORS- Adult Basic Education; AdultEducation; *Adult' Literacy; Adult Programs; English(Second Language); *Literacy Education; Program Effectiveness;*Program Improvement; *StudentReciiiitment; *Tutoring; Volunteers; *Volunteer Training IDENTIFIERS Project LEAP 6 ABSTRACT Philadelphia's Center for Literacy (CFL),in an -0.-ffort-io-improve_recruitment and retention ofvolunteers for programs in tutorialliteracy indi Eifgrith-as -a-Second-Language___ML)_, conducted the following activitiesUnder its 1980-81 Section 310 grant: (1) installed atelephone recording machine forafter-hours brochure about the program with a 0calls; (2) produced en 'informative response sheet)(I) conducted two ESL and three basicliteracy workshops.to train a total of 77new volunteer,tutors; and (4) continued to use media publicservice announcements developed during the project. The refinementsof the program were recommended tobe continued. (Document appendixescontain log sheets for daytime and after-hours callsthe brochure describing the program, anoutline of CFL tutor-training.workshops,the CFL Literacy Tutor-Training Handbook, and workihop evaluations.)(Author/KC) ********************************************************************* Reproductions supplied by EDRS are thebest that can be made from the original document. *********t******-*******************4****************************;****** Project LEAP "Something Stops You and Makes You Think": An Adaptation final report written by: Rebecca A. Eno Project Director The Center for Literacy Project LEAP originally developed by Thomas R.Newman Contract #80-98-0802, a project of: The:Center for_Literacy, Inc. 3723 Chestnut Straet Philadelphia, PA 19104 Funded by A $3000 grant* from: Commonwealth-of-PennsylvaniaL_______ Department of Education Division of Adult Education, Continuing Education and Training Programs , 333 Market Street Harrisburg, PA 17108 * (with $300 local funding) Copies of this report sent to ERIC and AdvancE The activity which is the subjectof this repert has been supported under an adult education grant awarded tothe Canter for Literacy, Philadelphia, Pennsylvania, by the Pennsylvania Departmentof Education. The opinions expressed herein do notnecessarily reflect the position or policy of the PennsylvaniaDepartment of Education. .g U.S. DEPARTMENT OF EDUCATION NATIONAL INSTITUTE OF EDUCATION "PERMISSION TO REPRODUCETHIS EDUCATIONAL RESOURCES INFORMATION MATERIAL HASBEEN GRANTED -CENTER (ERIC/ BY This document' has been reproduced as received from the person or organdation (Y) originating it. Minor changes have been made to improve /91-61-t_e_ reproduction quality. TO THE EDUCATIONAL Points of view or opinions stated in this docu- RESOURCES ment do not necessarily represent official NIE INFORMATION CENTER (ERIC)." position or policy. TABLE OF CONTENTS Abstract... Introduction 4 The Machine 7 The Brochure 10 The ESL Tutor-Training Program 12 The-Literacy Tutor-Training Program 14 And the Recruitment Goes On 17 Conclusions and Recommendations 18 Appendix A: Comparison of Daytime and After-Hours Calls to the Center for Literacy 20 Appendix B: Brochure: "Filling in the Blanks" and Bookmark 21 APpendix "CFL Tutor-Training Workshop" outline 23 Appendix D: CFL Literacy Tutor-Training Handbook 27 Appendix E: Workshop Evaluations; Pre- and Post-test 95 3 . ABSTRACT In an effort to improve its plan torecruit and retain volunteers for,its tutorial literacy and ESL programs,and to aontinue recruit- ment of students,_Philadelphia's Centerfor Literacy (CFL) set out to achieve the following goals under its1980-81-Section 510 Grant: _.(1) to install a telephoae recording machinefor after-hours calls; (2) too produce.an informative brochurewith a response sheet; (3) to provide 2 Eft and 3 basic literacyworkshops to train volunteer tutors; and (4).to continue to use media spotsdeveloped by Project LEAP. Thil natiAtive-report-and-evaluation attemptsto demonstrate how all of these various specificsub-goatt-combine to help the Center achieve special irterest to its major goal. The new CFL brochure may be of individuals involved in public relations andrecruitment of volunteers for literacy and ESL programs.Educators who are involvedin:training literacy tutors or who teach literacyskills themselves should find the- neww. CFL Literacy TutorTraining Packet most valuable. 4. INTRODUCTION' * Project LEAP (Literacy EducationAwareness in Pennsylvania) was Cenier for originated in 1977 by Thomas R. Newman, astaff member at The make the,public Literacy in Philadelphia. The project was designed to the Commonwealth aware of the problem ofadult illiteracy And the steps has taken to solve this problem; morespecifically, to increase enroll- literacy ment in ABE classes and torecruit more volunteers for one-to-one the booklet, "Something programs. The end product of Project LEAP was Stops You and Makes YouThink: A Practical Guide toPublic Information and the Media." to meet the The Center forLiteracy.(CFL) has continued in its efforts reach the hard-to- standards set by Project LEAP. We continue to try to education, and to reach folks who most needthe.services of adult basic social problem, rather promote the notion thatilliteracy is a legitimate While we may not yet beattracting -than a shameful individualfailure. enough potential students those most.difficult toreach, we have attracted _ a_student waiting for .our--own-literacy,andrESL_programs that we .maintain available volunteer list which is consistentlylarger than our pool of tutors. retention of Thus, our major problem hasbecome the recruitment and solve this problem that CFL volunteer tutors. It was in order to help concept,.under an embarked upon a new plan toadapt the Project LEAP The "Adapter/Adopter Grant" from AdultEducation Act's Section 310 funds. goals of the new project were: machine to 1. to purchase andinstall a telephone message-recording recruits responding to prevent the loss ofafter-hours and weekend public service announcements. 5. 2. to_develop an informativebrochure with a tear-off response form lo be mailed-to-potentil volunteers orstudents. 3. to provide 2 training.workshopsfor English as a Second Language volunteer tutors4 4. to provide 3 training workshopsfor basic literacy volunteer tutors. 5. to utilize radio and television spotsdeveloped by Project LEAP to recruit tutors and students. The proposed starting and endingdates for this project were Septem- ber,1, 1980, and June 30, 1981 respectively. The project did not actually until CFL received get under way until March , 1981, necessarily delayed start-up moneys. CFL's business manager, William J. Barrett,administered this mini- in the project until he took a positionelsewhere and the project.was left The director hands of this report writer,Rebecca Eno in late April, 1981. in the of CFL's Adult LearningServices, Marlyn DeWitt, was instrumental and transition between project directorsand continued as a resource person contributed to the success champion of the cause. Other individuals who have specialist, of the project are: HelenaFrazier, our information and referral who took charge of the new"Record-a-Call" machine by recordingout-going machine; Mawrien messages and contacting everyonewho left informatiOn on the designed and Pitcher, a student at the ArtInstitute of Philadelphia, who completed the art work for thebrochure; Martha Lane and the Lutheran Church Women who produced the ESLtutor's guide, EmergencyEnglish for . literacy Refugees; ESL tutor trainers KarenDahmer and Gail Weinstein;'basic John Cole and tutor trainers RobertPreSton,,Martha Lane, Marlyn,DeWitt, training cur- Rebecca Eno (the last threeof whom developed CFL's own tutor riculum included with this report);Mary Larkin who designee thebookmark; Bridget Martin who patiently typedthis report; and the Board of Trustees, students. the Adult Learning ServicesCommittee, and CFL's tutors and LIL 6. This final project report should provemost useful to adult educatdrs, particularly those in volunteer, onetooneliteracy programs, who volunteer liter- are involved in publicrelations and/or in the training bf 1 acy or ESL tutors. It is our hope that the ideas andresults contained in permanent file at herein are helpful. Copies of this report are kept Pennsylvania's Department of Education.Copies have also been sent to the following dissemination centerg: (1) ERIC Documentation ReproductionService P.O. Box 190 Arlington, VA 22210 (2) AdvancE Stayer Research and Learning Center Millersville State College Millersville, PA 17551 ...TkE MACHINE t For yearg, the Center for Literacy has sentpublic service an- nouncements to various local radio andtelevision stations:The stations' generosity in running these PSA's has resulted in many, manycalls to CFL from potential tutors and students.However, we have always feared that there might be a big hole in the efficacy of thePSA scheme.PSA's are often played at odd hours.Bbit people watch/listen to the electronic media after regular working hours. Individuals who are'interested in the Center's program are most likely to call the given telephonenumber immediately
Load more

Recommended publications
  • A Couverture AFTER
    UNIVERISTE D’ANTANANARIVO DEPARTEMENT DE FORMATION INITIAL LITERAIRE CENTRE D’ETUDE ET DE RECHERCHE EN LANGUE ET LETTRES ANGLAISES Using Snakes And Ladders Board Games With Dice to Teach Wishes and Regrets to Malagasy Students C.A.P.E.N. Dissertation Presented by TOMARIELSON Christian Espérant Advisor: RANDRIAMAMPIONONA Christiane ACADEMIC YEAR: 2014-2015 12 January 2016 Acknowledgments We would like to express our deepest gratitude to God for His guidance and everything He has done to me. First of all, we are extremely grateful to Mrs RANDRIAMAMPIONONA Christiane, our Dissertation Advisor for her invaluable kindness, patience, directives, encouragement, and keen editorial eye before the printing of the work. Our warmest thanks must equally go to Mr MANORO Regis and Mrs RAMINOARIVONY Mirany whose helpful comments and suggestions have helped us in the completion and the official presentation of our work. We would like to express our sincere acknowledgments to all teachers at the CER Langue et Lettres Anglaises, and we equally thank all those who contributed, in one way or another, to the elaboration of the present work. Last but by no means least, we wish to express our sincere gratitude to my wife, my children, and our friends who have supported us through their prayers, care, and encouragements. I TABLE OF CONTENTS GENERAL INTRODUCTION 0.1. Rationale and objective of the study 0.2.Scope and limitations 0.3. Structure of the work Part 1: THEORETICAL CONSIDERATIONS 1.1. On conditionals 1.1.1. Definitions of conditional construction……………………………………….........1 1.1.2. Likely conditionals……………………………………………………………........2 1.1.3. Unlikely conditionals…………………………………………………………........2 1.1.4.
    [Show full text]
  • Scrabble Fans to Choose Newest Playable Word in the Scrabble Word Showdown
    March 12, 2014 Scrabble Fans to Choose Newest Playable Word in the Scrabble Word Showdown The Merriam-Webster Official SCRABBLE Players Dictionary To Be Updated With A Fan-Voted Word PAWTUCKET, R.I.--(BUSINESS WIRE)-- Over the past decade, changes in technology, trends and pop culture events have introduced many new words like ‘selfie' and ‘hashtag' into everyday vocabulary. To keep relevant for today's fans, SCRABBLE and Merriam-Webster will be updating The Official SCRABBLE Players Dictionary for the first time in nine years with thousands of new words and have reserved a spot in the dictionary for a word nominated and chosen by SCRABBLE fans during the SCRABBLE Word Showdown. Starting today through March 28, fans can nominate their favorite words that they want added to the dictionary on the Hasbro Game Night Facebook page. These nominations could include fan favorites that haven't been made official yet, or a new word that's become popular since the last edition of the dictionary was published in 2005. On April 2, SCRABBLE and Merriam- Webster will unveil sixteen words from the pool of nominations for the bracket-style SCRABBLE Word Showdown. Fans will cast their votes on the Hasbro Game Night Facebook page until it is narrowed down to one final word. The chosen word will be revealed on April 10 and will be included in the fifth edition of Merriam-Webster's Official SCRABBLE Players Dictionary, available this August, making it an official playable word. "The SCRABBLE Word Showdown will let fans nominate and vote on words that are fun and relevant for today's players," said Jonathan Berkowitz, vice president of marketing at Hasbro.
    [Show full text]
  • The Scrabble Player's Handbook Is Available for Free Download At
    The Scrabble Player's Handbook is available for free download at www.scrabbleplayershandbook.com 1 Contents Introduction 3 Meet The Team 5 What's Different About Competitive Scrabble? 10 How To Play Good Scrabble 11 The Words 14 What Is Scrabble? 16 Scoring Well 21 Understanding Rack Leaves 32 Word Learning 35 The First Move 46 Tile Tracking 50 Time Management 54 Exchanging 58 Phoneys 64 Set-Ups 65 Open and Closed Boards 68 The Endgame 75 Playing Style 85 How To Play Amazing Scrabble 94 The Luck Element 98 The Game Behind The Game 99 Starting Out in Competitive Play 101 Quackle 103 Zyzzyva 109 Internet Scrabble Club 115 Aerolith 117 Scrabble by Phone 119 Books 121 Scrabble Variants 123 Scrabble Around The World 125 Playing Equipment 127 Glossary 128 Appendix 133 Rules Governing Word Inclusion 133 Two-letter words 137 Three-letter words 140 SCRABBLE® is a registered trademark. All intellectual property rights in and to the game are owned in the U.S.A. by Hasbro Inc., in Canada by Hasbro Canada Inc. and throughout the rest of the world by J.W. Spear & Sons Ltd. of Maidenhead SL6 4UB, England, a subsidiary of Mattel Inc. Mattel and Spear are not affiliated with Hasbro or Hasbro Canada. The Scrabble Player's Handbook is available free of charge. There is no copyright on the contents and readers are encouraged to distribute the book in PDF or printed form to all who would benefit from it. Please respect our work by retaining the footer on every page and by refraining from reproducing any part of this book for financial gain.
    [Show full text]
  • Iianri|Phtpr Leumng Lipralb Formerly of 34 Village St., Died of 12 Emerson St
    PAGE SIXTEEN - MANCHESTER EVENING HERALD, Manchester, Conn.. Tues., Feb. 4,1975 OBITUARIES Mrs. Augusta Lamprecht Reinhold A. Rautenberg m • Mrs. Augusta Lamprecht, 95, Reinhold A. Rautenberg, 85, k iIanrI|PHtpr lEumng lipralb formerly of 34 Village St., died of 12 Emerson St. died Monday and brush fire on two acres off jured on lawn outside Monday at the Lutheran Home at Manchester Memorial MANCHESTER Manchester High School Manchester’s Town and Rt. 30, Tolland. MANCHESTER, CONN., WEDNESDAY, FEBRUARY 5.1K5- VOL. XaV, No, 107 in Clinton, N.Y. She was the Hospital. He was the husband of Monday, 5:32 p.m. — Field (Manchester Ambulance). Manchf!»ter-A City of Village Charm widow of Herman Lamprecht. Mrs. Minnie Pohl Rautenberg. Eighth District Fire TWENTY-EIGHT PAGES — TWO SECTIONS Departments, along with East and brush fire on two acres off Pitici:: KiiTEivN <;|.;,Ms Mrs. Lamprecht was bom He was born in West Prussia, Hunter Rd., Tolland. Nov. 24, 1879 in Germany and Germany, and lived here 65 Hartford firemen, responded to % a Monday morning report of a Monday, 6:37 p.m. — Brush had liv ^ most of her life in years. He was employed as a TOLLAND COUNTY grass fire near the town line at fire at Scott and Hemlock Drs., Manchester before entering the toolmaker at Cheney Bros, for Vernon. Monday, 7:07 p.m. — Lutheran Home three years 43 years before retiring 19 Wickham Park and took about half an hour to douse the blaze. Automobile accident at Rt. 30 ago. She was a charter member years ago. AMBULANCE CALLS and Dobson Rd., Vernon (Ver­ of Concordia Lutheran Church.
    [Show full text]
  • Sheriff Department Pushes for $60,000 Crime Unit Althaver, Two Trustees To
    95 per cent federal funding Sheriff department pushes for $60,000 crime unit The Tuscola County Sher- just over $3,000. eight-foot van equipped with of foot and tire prints at the "It's something that we unit. He is optimistic that the iff's Department hopes to Sheriff Hugh Marr is push- modern crime detection and crime scene, lift latent finger- to every one of the 11 local counties with their large ur- really need," Marr said. grant will be approved, but police agencies in the county increase its arsenal against ing hard for the unit. He says evidence preservation tools. prints, take and develop pic- "With our crime rate contin- .ban populations, Marr main- an ever-increasing crime rate if the grant application is says there's a good chance as well as the State Police. tains some of their crime The mobile unit would be used tures at the scene and allow uing to rise, we have to have some items, such as the with a mobile crime unit approved, funding would be- primarily in all crime search officers to render composite According to figures sup- problem spills into the rural all the help we can get. Even added police car, may be cut. plied by the sheriff in the areas. designed to help detect and gin next July 1 and the project operations, specializing in drawings of suspects. with the State Police Post in preserve evidence. The proj- could be operational in the "We expect to hear some- grant request, the crime rate In addition, a large amount gathering evidence at the Marr maintains the unit is the county, our crime rate is thing to the effect that the ect, which includes a van-type county by next fall.
    [Show full text]
  • American Games: a Historical Perspective / by Bruce Whitehill
    American Games: A Historical Perspective / by Bruce Whitehill istorians investigating board games of the world have traditionally examined ancient or early games, using artifacts, drawings, and available text. From this, Hthey hoped to learn more about the cultures in which these games flourished, how the games moved from one territory to another (trade routes), and how they chan- ged and evolved in different cultures. Traditional classic games such as chess, checkers (draughts), Mancala, Pachisi, Mill (Mühle or Nine Mens Morris), Fox and Geese, and the Game of Goose, among others, have been studied in great detail by many scholars. Some of these games were played on quite elaborate, carved wooden boards, and, as such, they were available only to a privileged few. In the middle 1800s, however, advances in lithography and in techniques of the mass production of printed matter allowed games to be commercially produced in large quantities. They were also inexpensive enough to be affordable by the less affluent. This meant that games could reach a larger portion of the population, and become a staple in more homes. What purposes have games served in society? Were they recreational or were they intended as educational or instructional instruments? And who manufactured and sup- plied these games to the public? In the United States, a study of games poses one immediate limit for the researcher: the term “ancient” hardly applies to a country that was not formally “discovered” until 1492. Well into the 1800s, most board games played in North America were of European origin. Culin (1907) lists the board games played by the American Indians under the hea- ding “European games,” though games he categorized as “dice games” are actually board games that use dice to determine movement.
    [Show full text]
  • For 2-4 Players AGES 8 and up ABOUT the GAME
    If, at the same time, they touch other letters in adjacent rows, those must form complete words, crossword fashion, with all such letters. The player gets credit for all words formed or modified on his or her turn. 4. New words may be formed by: a. Adding one or more letters to a word or letters already on the board. b. Placing a word at right angles to a word already on the board. The new word must use one of the letters already on the board or must add a letter to it. (See Turn 2, 3 and 4 in example below.) c. Placing a complete word parallel to a word already played so the adjacent letters also form complete words. (See Turn 5 in example.) 5. No tile may be shifted or replaced after it has been played and scored. 6. Blanks: The two blank tiles may be used as any letters. When playing a blank, you must state which letter it represents. It remains that letter for the rest of the game. 7. You may use a turn to exchange all or some of your letters. To do this, place your discarded letter(s) facedown. Draw the same number of letters from the pool, then For 2-4 players mix your discarded letter(s) into the pool. This ends your turn. AGES 8 and up 8. Before the game begins, players should agree which dictionary they will use, in case of a challenge. All words labeled as a part of speech (including those listed of foreign ABOUT THE GAME origin, and as archaic, obsolete, colloquial, slang, etc.) are permitted with the The clever “tile lock” system on exception of the following: words always capitalized, abbreviations, prefixes and this gameboard keeps your tiles in suffixes standing alone, words requiring a hyphen or an apostrophe.
    [Show full text]
  • Word Buff's Ultimate Scrabble Cheat
    Word Buff's Ultimate Scrabble Cheat It's Totally Unfair! This is a free ebooklet for Word Buff subscribers. I'm always adding freebies to the members area, so make sure you check in from time to time. (Join here) Inside you'll find a list of every single two-to-five letter word allowed in English Scrabble. If you're going to cheat, this is the list you need to peek at ;-) Why? Because even though long words are more exciting to play (especially the plays that garner 50 bonus points!), the short words give you far greater bang for your buck. You will use them in almost every move of every game. Plus, there are nowhere near as many to learn as there are seven to nine letter words. So you get ten times the value for one tenth of the work. And that's the definition of 'bang for your buck'! Now, I know you're in a hurry to get into the words, but just a couple of pointers... You'll notice that the words do not all appear in the same format. I know it's annoying, but the thing is there are two official Scrabble dictionaries in use around the world and although they have a lot of words in common, there are quite a few differences too. If you want to know more about the different Scrabble lexicons I suggest you have a quick read of one of my old Word Buff newsletters here. But for now, all you really need to know is this..
    [Show full text]
  • Strings Chapter 9 Programming with Mathematica: an Introduction Paul Wellin
    The Mathematica® Journal Strings Chapter 9 Programming with Mathematica: An Introduction Paul Wellin This article is an excerpt from the recently released book, Programming with Mathematica: An Introduction by Paul Wellin © 2013 [1]. The book, which follows on the well-known An Introduction to Mathematica Programming, provides an example- driven primer on the foundations of the Mathematica programming language. Strings are used across many disciplines to represent filenames, data, and other objects: linguists working with text data study representation, classification, and patterns involved in audio and text usage; biologists dealing with genomic data as strings are interested in sequence structure and assembly and perform extensive statistical analysis of their data; programmers operate on string data for such tasks as text search, file manipulation, and text processing. Strings are so ubiquitous that almost every modern programming language has a string datatype and dozens of functions for operating on and with strings. ‡ Introduction In Mathematica, strings are represented by any concatenation of characters enclosed in double quotes. StringQ@"The magic words are squeamish ossifrage."D True 2 Paul Wellin Strings are also used to represent file names that you import and export. Import@"ExampleDataêocelot.jpg"D Strings are used as arguments, option values, and as the output to many functions. GenomeData@"SNORD107"D GGTTCATGATGACACAGGACCTTGTCTGAACATAATGATTTCAAAATTTGAGCTTAAAAÖ ATGACACTCTGAAATC StringQ@%D True In this chapter we will introduce the tools available for working with strings in Mathe- matica. We will begin with a look at the structure and syntax of strings, then move on to a discussion of the many high-level functions that are optimized for string manipulation.
    [Show full text]
  • PDF of the 8Th Edition
    THE GAME CATALOG U.S. GAMES THROUGH 1950 (With AGCA Archives Instruction Availability Noted) 8th An official publication of the American Game Collectors Association Edition (AGCA) P.O. Box 44 October 1998 Dresher PA 19025 website http://agca.com Editor, Rick Tucker [email protected] © 1998 Bill Alexander, Anne D. Williams, and Richard W. Tucker. All Rights Reserved. CONTENTS The Game Catalog—Update Submission Forms........................................1 Introduction About The Game Catalog.....................................................................3 What’s New in the 8th Edition..............................................................3 Submitting Updates..............................................................................3 How to Use The Game Catalog ............................................................4 Game Instruction Availability...............................................................4 Sources of Information.........................................................................4 The Catalog Key to Symbols Used in The Game Catalog.........................................5 U.S. Games, Listed by Company..........................................................5 Foreign Games for Which the AGCA Archives Has Instructions......129 Indices Name Index .....................................................................................131 Count of Games Per Publisher..........................................................135 Index of Games with Instructions in the AGCA Archives.................137
    [Show full text]
  • Gameplay Guide EDITION
    AGES 8+ 2 TO 4 PLAYERS PROOF OF PURCHASE E D I T I O N ® 16807 ® Gameplay Guide EDITION We will be happy to hear your questions or comments about this game. US consumers please write to: Hasbro Games, Consumer Affairs Dept., P.O. Box 200, Pawtucket, RI 02862. Tel: 888-836-7025 (toll free). Canadian consumers please write to: Hasbro Canada Corporation, 2350 de la Province, Longueuil, QC Canada, J4G 1G2. © 2010 Hasbro, Pawtucket, RI 02862. All Rights Reserved. TM & ® denote U.S. Trademarks. 16807 scrabble.com TM 6. Bingos ! Always look for Bingos (using all 7 tiles at If you can master 3 once). Optimism and know-how will mean these 2-letter words, The History of the SCRABBLE ® Game more 50-point bonuses. Learn common word beginnings and endings and know how to they can improve place them on your rack. (See the box on your score! page 9 and #3 on page 14.) AA EH LI OY 7. Q without U AB EL LO PA 4 Learn the Q-without-U words. The Official AD EM MA PE Getting Started SCRABBLE® Players Dictionary Fourth Edition lists these: MBAQANGA(S), QABALA(S), AE EN ME PI QABALAH(S), QADI(S), QAT(S), QAID(S), AG ER MI QI QI(S), QOPH(S), FAQIR(S), QANAT(S), AH ES MM RE TRANQ(S), QINDAR(S), QINTAR(S), AI ET MO SH 6 QWERTY(S), SHEQEL, QINDARKA, and Gameplay SHEQALIM. AL EX MU SI AM FA MY SO 8. Look for Hooks “Hooks” are single letters that you can add AN FE NA TA to existing words that form other words.
    [Show full text]
  • Here Are 30 Fun Facts to Help You Celebrate Scrabble Day
    Here Are 30 Fun Facts To Help You Celebrate Scrabble Day National Scrabble Day is observed annually on April 13th. Originally named Lexiko and then Criss-Cross Words, Alfred Mosher Butts eventually settled on the name Scrabble. The amateur artist and unemployed architect developed the word game in the midst of the depression. Still, it wasn’t until 1948, a final name change and a trademark that Butts finally began to produce the game. Scrabble is played with two to four players who score points by forming words from individual lettered tiles on a game board marked with a 15 x 15 grid. In the United States, the name Scrabble is a trademark of Hasbro, Inc. Scrabble is sold in 121 countries with 29 different language versions. Worldwide, over One hundred and fifty million sets have been sold with sets being found in nearly one-third of American homes. Scrabble was invented in 1931 by New York architect Alfred Mosher Butts. Butts invented the game in an attempt to create a word game that combined anagrams and crosswords, which involved luck, chance and a great deal of skill. Butts died at the age of 93 in 1993. Back in 1931, the original name for Scrabble was ‘Lexico‘, before becoming ‘Criss-Cross Words‘ and eventually ‘Scrabble‘. ‘Lexico‘ is a shortened version of the word ‘Lexicon‘, which is another term for ‘Language‘ or ‘Vocabulary‘. Alfred Butts decided on the frequency and distribution of the letter tiles through analysing the front page of the New York Times. There is a Braille version of Scrabble produced.
    [Show full text]