December 2013 Regular Article Biol. Pharm. Bull. 36(12) 1975–1979 (2013) 1975

Use of the psbA-trnH Region to Authenticate Medicinal Species of Fabaceae Ting Gao,a Xinye Ma,b and Xunzhi Zhu*,c a Key Laboratory of Plant Biotechnology in Universities of Shandong Province, College of Life Sciences, Qingdao Agricultural University; Qingdao, Shandong 266109, P.R. China: b Research Center of Chinese Herbal Resource Science and Engineering, Key Laboratory of Chinese Medicinal Resource from Lingnan, Ministry of Education, Guangzhou University of Chinese Medicine; Guangzhou, Guangdong 510006, P.R. China: and c School of Biology and Chemical Engineering, Jiangsu University of Science and Technology; Zhenjiang, Jiangsu 212018, P.R. China. Received August 3, 2013; accepted October 3, 2013; advance publication released online October 8, 2013

Fabaceae is a huge family that contains a large number of medicinal plants, many of which are com- monly used in Chinese traditional medicine. However, traditional taxonomy has not been able to meet the complicated demands of species discrimination within Fabaceae. Thus, we employed a famous DNA barcode, the psbA-trnH region, to discriminate commonly used medicinal species of the family Fabaceae. Here, the psbA-trnH regions derived from 152 samples were amplified. These samples represented 104 Fabaceae me- dicinal species from 60 genera, including 25 authentic Fabaceae species listed in the Chinese pharmacopoeia and common adulterant species. The results indicate that the psbA-trnH region performed well in terms of its universality and high variability in length and composition. Species discriminative power analysis of the psbA-trnH region showed that 91.3% of species could be identified successfully by the BLAST1 method in conjunction with the nearest distance method. And, the species resolution rate of the TaxonGap method ex- ceeded 93%. The results provide support for the use of the psbA-trnH plastid region as a sensitive marker to the authentication of Fabaceae medicinal plants. Key words traditional medicine; Fabaceae; identification; psbA-trnH region

A wide range of medicinal plants are found within Faba- DNA barcoding is an aid to taxonomic identification that ceae, third largest plant family on earth. The Pharmacopoeia uses a short, standard DNA region for species discrimina- of the People’s Republic of China1) states that 31 Fabaceae tion.9) In a number of studies, psbA-trnH plastid region was species spanning 20 genera have been officially designated as found universally within plants and has been demonstrated standard medical plants. These species possess important me- to be effective in telling species apart. And, the psbA-trnH dicinal properties. For instance, the root of Astragalus mem- region has always been proposed as one of the popular DNA branaceus and Astragalus mongholicus, Radix Astragali, is barcodes.7,8,10–14) However, DNA-based species identification one of the well-known traditional Chinese medicines (TCM), using a large set of medicinal species of Fabaceae has not which regulates immune responses, and improves resistance to been carried out. Therefore, we examined the efficacy of using colds, allergies, infections and the flu.2) Sophora tonkinensis is psbA-trnH in medicinal Fabaceae species determination across used for the treatment of acute pharyngolaryngeal infections a wide taxon range. and sore throats.1) The herbal extract from Sophora flavescens has anti-viral activity against influenza.3) Taken together, MATERIALS AND METHODS members of the family Fabaceae have been reported to repre- sent an important group of medicinal plants.4,5) Plant Materials In this study, we employed the psbA- However, the adulteration of the traditional medicines prod- trnH barcode to identify 152 samples from 104 Fabaceae com- ucts has been widely spread for a long time. The family Faba- mon medicinal species, their closely related species or adulter- ceae is no exception in this problem of mis-identification. For ants (Supplementary Table S1). These plant materials include example, the roots of several Indigofera species are used as 49 samples belonging to 25 authentic species and 19 genera Radix Sophorae Tonkinensis in the treatment of inflammatory listed in the Chinese Pharmacopoeia. diseases.6) The contents of the biologically active compounds This Sample Set Includes All Three Subfamilies of Faba- of these adulterations are distinct from those of S. tonkinensis. ceae The plant samples were collected from large geographi- Some poisonous adulterants may cause intoxication or even cal areas in China and were identified by Prof. Yulin Lin death. Thus, incorrect identification of these medicinal plants of IMPLAD (the Institute of Medicinal Plant Development), affects their appropriate usage, breach the safety of the me- Chinese Academy of Medicinal Sciences and deposited in the dicinal market and the confidence of consumers. The classical Herbarium IMPLAD, Beijing, China. morphological authentication approach was confronted with DNA Extraction, Amplification and Sequencing Ge - difficulties.7,8) Hence, a rapid and reliable method is required nomic DNA was extracted according to the protocol associ- to correctly identify the plant species present within the prod- ated with the Plant Genomic DNA Kit (Tiangen Biotech Co., uct for the prevention of misuse and fits a current need in the China) from the collected silica gel-dried leaves or from market. commercially available medicinal materials purchased at the market. The psbA-trnH regions were amplified and sequenced The authors declare no conflict of interest. from the genomic DNA. Polymerase chain reaction (PCR)

* To whom correspondence should be addressed. e-mail: [email protected] © 2013 The Pharmaceutical Society of Japan 1976 Vol. 36, No. 12

Table 1. Primers and Reaction Conditions Used for PCR Amplification

Marker Name of primers Primer sequences 5′–3′ Reaction conditions

fwd PA GTTATGCATGAACGTAATGCTC 94°C 5 min, 94°C 1 min, 55°C 1 min, psbA-trnH rev TH CGCGCATGGTGGATTCACAATCC 72°C 1.5 min, 30 cycles, 72°C 7 min

amplification of the psbA-trnH region was carried out in a Table 2. Analysis of Inter-specific Divergence between Species and Peltier Thermal Cycler PTC0200 (BioRad Lab, Inc., U.S.A.) Intra-specific Variation in the psbA-trnH Sequences using approximately 30 ng of genomic DNA as a template in a psbA-trnH Dataset 25 µL reaction mixture (1×PCR buffer without MgCl2, 2.0 mM All inter-specific distance 0.0719±0.1307 MgCl2, 0.2 mM of each deoxyribonucleotide triphosphate (dNTP), 0.1 µM of each primer (synthesized by Sangon Co., Theta prime 0.0477±0.0690 China), and 1.0 U of Taq DNA Polymerase (Biocolor BioSci- The minimum inter-specific distance 0.0293±0.0370 ence & Technology Co., China). Universal primers and reac- All intra-specific distance 0.0065±0.0122 tion conditions for the amplification of the psbA-trnH region Theta 0.0089±0.0140 were as previously described7–9) (Table 1). PCR products were Coalescent depth 0.0104±0.0157 run on a 1.0% agarose gel in a 0.5×TBE buffer and purified using the TIANGel Midi Purification Kit (Tiangen Biotech Co., China). The purified PCR products were sequenced using study, which mainly due to the presence of poly-A/T struc- an ABI 3730XL sequencer (Applied Biosystems Inc.) using tures. Therefore, use of the psbA-trnH region as a standard primers used for amplification. The quality control of the gen- DNA barcode requires the improved sequencing technology to erated sequence traces followed as Chen et al. used.7) get more high quality sequences.8,23) Sequence Analysis Consensus sequences and contig Nucleotide Sequence Variations of psbA-trnH The generation were performed using CodonCode Aligner V 3.5.7 length of the psbA-trnH region examined in the Fabaceae (CodonCode Co., U.S.A.). Genetic distances were computed species ranged from 249 bp to 515 bp. As previous studies using MEGA 4.0 according to the Kimura 2-Parameter (K2P) reported, owing to its relatively short length (200–400 bp), the model.15) The average intra-specific distance, theta, coalescent psbA-trnH region might be applicable for the authentication of depth, and theta were calculated to test the intra-specific vari- a wide variety of plants, herbarium specimens, and commer- ation using the K2P model.7,16) The average inter-specific dis- cially prepared crude drugs, the amplification of this region tance, the minimum inter-specific distance, and theta primer could be much easier, even without high quality DNA.12) were used to represent the inter-specific divergences.7,16,17) The The inter-specific percentages of nucleotide differences discriminatory power of psbA-trnH sequences for Fabaceae ranged from 0% (in 7 species) to 37.1% (in Cassia fistula, and species was calculated using three methods, BLAST1 method, Cassia obtusifolia), with an average of 7.2% across all taxa. the nearest distance method, and the TaxonGap method as The percent differences between individuals of the same spe- described previously.7,8) In BLAST1 method, species determi- cies among the 152 Fabaceae sequences ranged from 0% (in nation was based on the best hit of the query sequence and an 13 species) to 3.4% (in Lotus corniculatus), with an average E-value for the match less than a cutoff value. In the nearest of 0.6% across all taxa. In addition, six parameters were used distance method, authentication was based on all pairwise ge- to characterize the inter-specific versus intra-specific variation netic distances computed among the reference sequences, and (Table 2). Many researchers considered psbA-trnH provided between each query and each of the reference sequences. In considerable differences between species.10–14) Our findings the TaxonGap method, the minimum distance (defined as sep- displayed the similar trend that the psbA-trnH region showed arability) between certain species and their closest neighbor little intra-specific variation, and large inter-specific diver- and the maximum distance (defined as heterogeneity) within gence, thereby it is an ideal DNA barcode in our dataset. the species were compared using the TaxonGAP software Species Discriminative Power of psbA-trnH Fabaceae (version 2.4.1).8,18,19) The distance between and within species plants have been previously identified using the psbA-trnH was determined by a similarity matrix which was calculated region. Some results obtained using the psbA-trnH regions using the program AlignX (Vector NTI Suite v 9, InforMax, were not satisfactory in certain genus of Fabaceae and it was North Bethesda, MD, U.S.A.) with an engine based on the concluded that the psbA-trnH region was not the proper au- Clustal W algorithm. thentication tool.24) While, more studies support psbA-trnH as a reliable barcode.25,26) Whereas, results derived from those RESULTS AND DISCUSSION previous studies with different small coverage (at the genus level) may not be readily extendable to diverse Fabaceae PCR Efficiency and Sequencing Success of psbA-trnH medicinal species. In our study, the analyses come from the As previously proposed,7–8,20–22) psbA-trnH can be applicable inclusive sampling of Fabaceae medicinal species across mul- to a broad range of Fabaceae plant taxa. The efficiency of tiple taxonomic groups. PCR amplification and sequencing of the psbA-trnH region The result of the TaxonGap method (Fig. 1) demonstrated obtained from the samples of Fabaceae were 98.9% and that the psbA-trnH sequences generated from 97 Fabaceae 77.4%, respectively. There was no difficulty in the psbA-trnH species were specific enough to be separated from their neigh- sequence alignment in our experiments. While, there were bors, in other words, a considerable portion (93.3%) of the approximate 11.4% poor quality psbA-trnH sequences in our species sequences, had the between-species variation (if avail- December 2013 1977

Fig. 1. Species Identification Capability of the psbA-trnH Intergenic Region among 104 Medicinal Fabaceae Species by Taxon Gap The left panel shows the complete list of species used in this study. The right panel depicts the intra-species heterogeneity and inter-species separability for psbA-trnH as horizontal light grey and dark grey bars, respectively. The right panel also shows the names of the closest relatives identified by the similarity method. able), which was higher than the within-species diversity. The the nearest distance method. Therefore, the psbA-trnH regions gene resolution rate of the psbA-trnH region was 100% at the revealed informative traits for differentiating among the com- genus level. And the results showed that 95 out of 104 species mon Fabaceae medicinal species. Our findings showed that (91.3%) was accurately identified both by the BLAST1 and the psbA-trnH region could not only discriminate 22 species 1978 Vol. 36, No. 12

Table 3. The Inter-species Percentages of Nucleotide Differences (K2P) of the psbA-trnH Region between Radix Astragali (A. membranaceus, A. mon- gholicus) and Its Adulterants (%)

Species A1 A2 A3 A4 A5 A6 A7 A8 A9 A10 A11 A12 M1 M2 C1 O1

A1 — 0 0 6.2 5.4 8.6 4.0 4.6 7.4 3.9 4.2 3.9 33.0 16.0 28.6 6.7 A2 0 — 0 6.2 5.4 8.6 4.0 4.6 7.4 3.9 4.2 3.9 33.0 16.0 28.6 6.7 A3 0 0 — 5.9 5.1 8.3 3.7 4.3 7.1 3.6 3.9 3.6 32.4 15.7 28.3 6.4 A1–A2=A. membranaceus, A3=A. mongholicus, A4–A6=A. capillipes, A7=A. chinensis, A8=A. complanatus, A9=A. dahuricus, A10–A12=A. adsurgens, M1=Medicago sativa, M2=Melilotus suaveolens, C1=Caragana sinica, O1=Oxytropis coerulea. of Fabaceae in the Chinese Pharmacopoeia, but also recog- code library of medicinal plants and their adulterants should nize 75 common medicinal species of Fabaceae, their sister be built. And then, the availability of the psbA-trnH sequences species or adulterants. Therefore, the psbA-trnH region can from the Fabaceae species can facilitate the development of confidently serve as a potential DNA barcode for common Fa- biodiversity and phylogeny research and also the protection of baceae medicinal species especially the species in the Chinese endangered Fabaceae species. Pharmacopoeia. Overall, in addition to traditional classification controversial Acknowledgments This work was supported by the Start- species (Tadehagi triquetrum vs. T. pseudotriquetrum and up Foundation for Advanced Talents of Jiangsu University of Caragana rosea vs. C. sinica),27,28) a small amount of species Science and Technology under award (No. 635211204) and the in our dataset could not be effectively identified (Caragana Startup Foundation for Advanced Talents of Qingdao Agricul- rosea vs. Caragana sinica, Glycyrrhiza glabra vs. Glycyrrhiza ture University under award (No. 631313). inflata and Glycyrrhiza uralensis). Therefore, multi-locus bar- code should be necessary to solve complex taxonomic prob- REFERENCES lems in certain close related species.7,8,20–22) Finally, we examined the feasibility of psbA-trnH region 1) The State Pharmacopoeia Commission of the PRC. Pharmacopoeia applied to discriminate the herbal plants (Fabaceae) and their of the People’s Republic of China. Chemical Industry Press, Beijing adulterant species. We might take an example of Radix Sopho- (2010). rae Tonkinensis. The intra-specific variation among S. tonki- 2) Block KI, Mead MN. Immune system effects of echinacea, ginseng, and astragalus: a review. Integr. Cancer Ther., 2, 247–267 (2003). nesis samples examined here was relatively low (2.3%). In 3) Ryu YB, Curtis-Long MJ, Kim JH, Jeong SH, Yang MS, Lee KW, contrast, the inter-specific divegences among Radix Sophorae Lee WS, Park KH. Pterocarpans and flavanones from Sophora fla- Tonkinensis and its adulterant species, Sophora alopecuroides, vescens displaying potent neuraminidase inhibition. Bioorg. Med. Indigofera tinctoria, Flemingia macrophylla and Flemingia Chem. Lett., 18, 6046–6049 (2008). glutinosa were relatively large (8.1–35.5%). Here, we deter- 4) Liu RX, Wang Q, Guo HZ, Li L, Bi KS, Guo DA. Simultaneous de- mined that the psbA-trnH region could distinguish between termination of 10 major flavonoids in Dalbergia odorifera by high Radix Sophorae Tonkinensis and its four common adulterants performance liquid chromatography. J. Pharm. Biomed. Anal., 39, apart. 469–476 (2005). Another example is Radix Astragali, which is becoming 5) Wang D, Li F, Jiang Z. Osteoblastic proliferation stimulating activ- increasingly scarce. A. membranaceus has been under the ity of Psoralea corylifolia extracts and two of its flavonoids. Planta Med., 67, 748–749 (2001). third-grade priority protection of the state in China. This scar- 6) Su Y, Li C, Gao Y, Di L, Zhang X, Guo D. Acryloylated glucose city resulted in the common fraudulent adulteration, Oxytropis 3-nitropropanoates from Indigofera kirilowii. J. Nat. Prod., 68, coerulea, Medicago sativa, Melilotus suaveolens, Caragana 1785–1786 (2005). sinica as well as some congeners of Astragalus, are often 7) Chen SL, Yao H, Han JP, Liu C, Song JY, Shi LC, Zhu YJ, Ma XY, mistaken for the genuine medicinal materials Radix Astragali. Gao T, Pang XH, Luo K, Li Y, Li XW, Jia XC, Lin YL, Leon C. The samples of Radix Astragali and its adulterants species in Validation of the ITS2 region as a novel DNA barcode for identify- our study were found to have unique sequences in the psbA- ing medicinal plant species. PLoS ONE, 5, e8613 (2010). trnH. In Table 3, little intra-specific variation in the psbA-trnH 8) Ma XY, Xie CX, Liu C, Song JY, Yao H, Luo K, Zhu YJ, Gao T, region between Radix Astragali samples was observed. How- Pang XH, Qian J, Chen SL. ZHu YJ, Gao T, Pang XH, Qian J, Chen ever, the inter-specific divergence ranged from 3.6% to 33.0%. SL. Species identification of medicinal pteridophytes by a DNA Therefore, the psbA-trnH regions discrepancy among Radix barcode marker, the chloroplast psbA-trnH intergenic region. Biol. Pharm. Bull., 33, 1919–1924 (2010). Astragali and its adulterants should be sufficient enough to 9) Hebert PDN, Cywinska A, Ball SL, deWaard JR. Biological differentiate them accurately. identifications through DNA barcodes. Proc. Biol. Sci., 270, 313– In conclusion, our study suggests that, the psbA-trnH region 321 (2003). could be a useful barcode for Fabaceae because of its univer- 10) Kress WJ, Erickson DL. A two-locus global DNA barcode for land sality, ease of amplification, and high level of species discrim- plants: the coding rbcL gene complements the non-coding trnH- ination. This result provides a reference for the authentication psbA spacer region. PLoS ONE, 2, e508 (2007). of commonly used Fabaceae medicinal species, their sister 11) Pang XH, Liu C, Shi LC, Liu R, Liang D, Li H, Cherny S, Chen species, and their adulterants. Here, we demonstrate that the SL. Utility of the trnH–psbA intergenic spacer region and its com- psbA-trnH region as a DNA barcode proved valid in confirm- binations as plant DNA barcodes: A meta-analysis. PLoS ONE, 7, ing the identity of common medicinal Fabaceae products and e48833 (2012). 12) Guo X, Wang X, Su W, Zhang G, Zhou R. DNA barcodes for dis- should be designed to ensure quality assurance of common criminating the medicinal plant Scutellaria baicalensis (Lamiaceae) medicinal herbs on the market. A comprehensive DNA bar- December 2013 1979

and its adulterants. Biol. Pharm. Bull., 34, 1198–1203 (2011). 21) Fazekas AJ, Burgess KS, Kesanakurti PR, Graham SW, Newmaster 13) Hao DC, Chen SL, Xiao PG. Sequence characteristics and divergent SG, Husband BC, Percy DM, Hajibabaei M, Barrett SCH. Multiple evolution of the chloroplast psbA-trnH noncoding region in gymno- multilocus DNA barcodes from the plastid genome discriminate sperms. J. Appl. Genet., 51, 259–273 (2010). plant species equally well. PLoS ONE, 3, e2802 (2008). 14) Yao H, Song JY, Ma XY, Liu C, Li Y, Xu HX, Han JP, Duan LS, 22) Hollingsworth ML, Clark AA, Forrest LL, Richardson J, Pen- Chen SL. Identification of Dendrobium species by a candidate DNA nington RT, Long DG, Cowan R, Chase MW, Gaudeul M, Hol- barcode sequence: The chloroplast psbA-trnH intergenic region. lingsworth PM. Selecting barcoding loci for plants: evaluation of Planta Med., 75, 667–669 (2009). seven candidate loci with species-level sampling in three divergent 15) Tamura K, Dudley J, Nei M, Kumar S. MEGA4: Molecular evolu- groups of land plants. Mol. Ecol. Resour., 9, 439–457 (2009). tionary genetics analysis (MEGA) software version 4.0. Mol. Biol. 23) Thomas C. Plant barcode soon to become reality. Science, 325, 526 Evol., 24, 1596–1599 (2007). (2009). 16) Meyer CP, Paulay G. DNA barcoding: Error rates based on compre- 24) Edwards D, Horn A, Taylor D, Savolain V, Hawkins JA. DNA hensive sampling. PLoS Biol., 3, e422 (2005). barcoding of a large genus, Aspalathus L. (Fabaceae). Taxon, 57, 17) Meier R, Zhang G, Ali F. The use of mean instead of smallest inter- 1317–1327 (2008). specific distances exaggerates the size of the “barcoding gap” and 25) Newmaster SG, Ragupathy S. Testing plant barcoding in a sister leads to misidentification. Syst. Biol., 57, 809–813 (2008). species complex of pantropical Acacia (Mimosoideae, Fabaceae). 18) Naser SM, Dawyndt P, Hoste B, Gevers D, Vandemeulebroecke K, Mol. Ecol. Resour., 9 (Suppl. S1), 172–180 (2009). Cleenwerck I, Vancanneyt M, Swings J. Identification of lactobacilli 26) Monkheang P, Sudmoon R, Tanee T, Noikotr K, Bletter N, Chaveer- by pheS and rpoA gene sequence analyses. Int. J. Syst. Evol. Micro- ach A. Species diversity, usages, molecular markers and barcode of biol., 57, 2777–2789 (2007). medicinal Senna species (Fabaceae, Caesalpinioideae) in Thailand. 19) Slabbinck B, Dawyndt P, Martens M, De Vos P, De Baets B. Tax- J. Med. Plants Res., 5, 6173–6181 (2011). onGap: a visualization tool for intra- and inter-species variation 27) Hou X, Liu JE, Zhao YZ. Molecularphylogenyof Caragana (Faba- among individual biomarkers. Bioinformatics, 24, 866–867 (2008). ceae) in China. J. Syst. Evol., 46, 600–607 (2008). 20) Lahaye R, van der Bank M, Bogarin D, Warner J, Pupulin F, Gigot 28) Flora of China Editorial Committee. “Tadehagi pseudotrique- G, Maurin O, Duthoit S, Barraclough TG, Savolainen V. DNA trum.”: ‹http://foc.eflora.cn/content.aspx?TaxonId=242351109›, cited barcoding the floras of biodiversity hotspots. Proc. Natl. Acad. Sci. 30 July, 2013. U.S.A., 105, 2923–2928 (2008).