Myxophaga, Hydroscaphidae) and Aspidytes Niobe Ribera Et Al., 2002 (Adephaga, Aspidytidae

Annotation of the mitochondrial genomes of the Hydroscapha granulum Motschulsky, 1855 (Myxophaga, Hydroscaphidae) and Aspidytes niobe Ribera et al., 2002 (Adephaga, Aspidytidae). Material and methods Total DNA was extracted from single beetles using the Qiagen DNeasy tissue kit (Qiagen, Hilden, Germany) and nondestructive methods to preserve specimens. Gene fragments at opposing ends of the mitochondrial genome were amplified using standard protocols outlined elsewhere (Balke et al., 2005). We used universal primers (Suppl. Table 1). Based on the sequence information thus obtained, we designed species-specific longer primers of about 26–38 base pairs (bp; Suppl. Table 1) to amplify the following longer fragments: cox1–rrnS (c. 13 kb) on the mtDNA plus strand and nad2–cox1 (c. 1 kb) on the minus strand for A. niobe; and cox1–cob (c. 9 kb) on the plus strand and cob–cox 1 (c. 7 kb) on the minus strand for H. granulum. Long-range polymerase chain reaction (PCR) amplifications were performed using TaKaRa LA TaqTM polymerase (Takara Bio Inc., Tokyo, Japan) according to the manufacturer’s specifications. The general reaction mixture for 50 μl samples was: 10 × LA PCR buffer 5 μl, 25 mM MgCl2 5 μl, dNTP mixture (2.5 mM each) 8 μl, primer A (10 μM) 2.5 μl, primer B (10 μM) 2.5 TM μl, TaKaRa LA Taq (5 U/μl), 0.5 μl, double-distilled H2O 24.5 μl and 2 μl genomic DNA as template. PCR followed this protocol: after an initial denaturation step at 94 °C for 90 s, 14 cycles were performed at 95 °C for 15 s, annealing for 15 s and 68 °C for 15 min. This was followed by 16 cycles at 95 °C for 15 s, annealing for 15 s and 68 °C for 15 min (increasing by 15 s each cycle), and a final extension step at 72 °C for 10 min. Primer annealing temperature ranged from 58 to 65 °C depending on the melting temperature, and elongation time from 5 to 15 min depending on the expected length of the fragment to be polymerized (about 1 min per kb). Amplification of the fragment going through the control region of H. granulum using the primer combination cob forward and cox1 reverse was achieved only when polymerization (the extension step) was performed at 60 °C. Long PCR fragments from Aspidytes niobe were sequenced in the laboratory of the Zoological State Collection of Munich using a primer walking approach. Eighty specific forward and reverse primers were designed on sequence data obtained from previous runs that allowed us to extend each contig sequence, to obtain double strand sequence data for all positions and to verify our findings. Long PCR products of Hydroscapha granulun (UPF and IMEDEA Laboratories) were sequenced using a shotgun approach. Briefly, long DNA fragments were digested, purified, cloned and sequenced using standard protocols (Bauzà-Ribot et al., 2009). Then, primers were designed from clone sequences to sequence the long PCR products directly and hence obtain an overlapping contig on both forward and reverse strands. The software CodonCode Aligner 2.06 (CodonCode Corp., Denham, MA, USA) was used to assess the quality of electropherograms and to build contigs. Mitochondrial sequence annotation was performed using the software DOGMA (Dual Organellar GenoMe Annotator) available online (http://dogma.ccbb.utexas.edu/). Transfer (t)RNAs were also inferred with tRNAscan-SE Search Server (http://lowelab.ucsc.edu/tRNAscan-SE/). The 5' and 3' ends of protein and ribosomal genes were refined manually by comparison to complete genes of other insect species. Results and Discussion. The complete mitochondrial genome of the myxophagan Hydroscapha granulum was 15,975 bp long (accession number AM_493667). The near-complete genome of the adephagan Aspidytes niobe was 14,257 bp long (AM_493668). We could not obtain the region comprising the genes trnI, trnQ, trnM, the control region, and the 5' end of rrnS, probably because of the A+T richness and palindromic structures found on that region. Both mitogenomes (Suppl. Fig. 1) had identical gene order to that described in other beetles and many other insects (Dowton et al., 2002; Friedrich and Muqim, 2003; Sheffield et al., 2008). Overlaps between genes were infrequent and limited to few bases. Both mitochondrial genomes exhibited differences with respect to the canonical starting and stop codon of the mitochondrial genetic code in invertebrates as described for other beetles (Sheffield et al., 2008 and references therein); for example, the starting codon for cox1 was TTA and nad4 showed a truncated stop codon (see GenBank annotations for further details). All 22 tRNA genes typically found in metazoan mtDNAs were identified in H. granulum according to their secondary structure and anticodon sequence (Suppl. Fig. 2). We only identified 19 tRNA genes in A. niobe (Suppl. Fig. 3), the three missing tRNA genes (Ile, Met, and Gln) are located in other beetle mitogenomes in the non-amplified fragment of Aspidytes (Sheffield et al., 2008). Both species showed three typical features found in the tRNAs of other beetles and insects (Carapelli et al., 2008; Sheffield et al., 2008): a reduction of the DHU arm in the tRNASucu, and the same mismatch in the acceptor arm in the tRNA W (A-G) and tRNALuaa (U-U). Hydroscapha granulum showed an additional mismatch in the TΨC arm of the tRNA K. It is thought that base pairing is restored post- or co-transcriptionally with an RNA-editing mechanism (Yokobori and Pääbo, 1995). We made no attempt to reconstruct the structure of the rrnS (12S) and rrnL (16S) because their putative secondary structures have been already characterized elsewhere (Sheffield et al., 2008). Finally, the control region of H. granulum had similar A+T richness (86.4%) and length (1154 bp, positions 12,615–13,758) than those described in other beetles (A+T richness 84.9 ± 4.7 % and length 1244.7 ± 319.9 bp; Sheffield et al., 2008). In its middle part, there is a long stretch of thymines forming a stable palindrome (Suppl. Fig. 1) that resembles the origin of replication found in the center of the control region of some Drosophila species (Oliveira et al., 2007; Carapelli et al., 2008). References Carapelli, A., Comandi, S., Convey, P., Nardi, F., Frati, F., 2008. The complete mitochondrial genome of the Antarctic springtail Cryptopygus antarcticus (Hexapoda: Collembola). BMC Genomics 9, 315. Balke, M., Ribera, I., Beutel, R.G., 2005. The systematic position of Aspidytidae the diversification of Dytiscoidea (Coleoptera Adephaga) and the phylogenetic signal of third codon positions. J. Zool. Syst. Evol. Res. 43 (3), 223–42. Bauzà-Ribot, M.M., Jaume, D., Juan, C., Pons, J., 2009. The complete mitochondrial genome of the subterranean crustacean Metacrangonyx longipes (Amphipoda): A unique gene order and extremely short control region. Mitochondrial DNA 20 (4), 88–99. Dowton, M., Castro, L.R., Austin, A.D., 2002. Mitochondrial gene rearrangements as phylogenetic characters in invertebrates the examination of genome 'morphology'. Invert. Syst. 16 (3), 345–56. Friedrich, M., Muqim, N., 2003. Sequence and phylogenetic analysis of the complete mitochondrial genome of the flour beetle Tribolium castanaeum. Mol. Phylogenet. Evol. 26 (3), 502–12. Oliveira, M.T., Azeredo-Espin, A.M.L., Lessinger, A.C., 2007. The mitochondrial DNA control region of Muscidae flies: evolution and structural conservation in a dipteran context. J Mol Evol 64 (5), 519– 27. Yokobori, S.I., Pääbo, S., 1995., tRNA editing in metazoans. Nature 377 (6549), 490. Supplementary Figure 1. Gene order of the mitochondrial genome of Hydroscapha granulum and Aspydites niobe. Genes highlighted on gray are coded on the minus strand, and those without color on the plus strand. Note that the secondary structure of the putative origin of replication within the control region is shown for H. granulum. Numbers indicate the nucleotide position in the complete mitochondrial DNA. The region highlighted in black in A. niobe could be not obtained. Single letters indicates each particular tRNA gene. Supplementary Figure 2. Secondary structure of the 22 tRNAs found in the mitochondrial genome of H. granulum. Supplementary Figure 3. Secondary structure of the 19 tRNAs found in the mitochondrial genome of A. niobe. Supplementary Table 1. Primers list. Universal primers used to amplify short mitochondrial fragments, which allowed the design of more specific primers (this paper) to amplify longer mitochondrial fragments. Forward (F), and reverse (R) primers. Gene / species Primer name Direction Reference Primer sequence cox1 5' LCO 1490 F Folmer et al. 1994 GGTCAACAAATCATAAAGATATTGG HCO 2198 R Folmer et al. 1994 TAAACTTCAGGGTGACCAAAAAATCA cox1 3' Jerry F Simon et al. 1994 CAACATTTATTTTGATTTTTTGG Pat R Simon et al. 1994 TCCAATGCACTAATCTGCCATATTA cob CB3 F Barraclough et al. 1999 GAGGAGCAACTGTAATTACTAA CB4 R Barraclough et al. 1999 AAAAGAAARTATCATTCAGGTTGAAT rrnS 12S ai F Simon et al. 1994 AAACTAGGATTAGATACCCTATTAT 12S bi R Simon et al. 1994 AAGAGCGACGGGCGATGTGT rrnL 16S a F Simon et al. 1994 CGCCTGTTTAACAAAAACAT ND1 a R Simon et al. 1994 GGTCCCTTACGAATTTGAATATATCCT Aspidytes cox1 F This paper AATTGGGTTATTAGGATTTGTAGTATGAGCAC rrnS R This paper CTGTTCAGAGGAACCTGTTCTATAATTGATAGTC nad2 Frank F Simon et al. 1994 GCTAAATAAAGCTAACAGGTTCAT cox1 HCO 2198 R Folmer et al. 1994 TAAACTTCAGGGTGACCAAAAAATCA Hydroscapha cox1 F This paper CTATTGGGCTTTTAGGCTTCATTGTCTG cob R This paper CTTTGTATCTGAAGTAAGGGTGAAATGGG cob F This paper CCCATTTCACCCTTACTTCAGATAC cox1 R This paper CTCAGACAATGAAGCCTAAAAGCCC Barraclough TG, Hogan JE, Vogler AP. 1999. Testing whether ecological factors promote cladogenesis in a group of tiger beetles (Coleoptera Cicindelidae). Proc Roy Soc Lond B 266:1061–7. Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol Mar Biol Biotechnol 3:294–9. Simon C, Frati F, Beckenbach AT, Crespi B, Liu H, Flook P. 1994. Evolution weighting and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers.

Load more