JPET Fast Forward. Published on April 3, 2007 as DOI: 10.1124/jpet.106.117556 JPETThis Fast article Forward. has not been Published copyedited and on formatted. April 3, The 2007 final asversion DOI:10.1124/jpet.106.117556 may differ from this version.
JPET #117556
Flufenamic acid bi-directionally modulates the transient outward K+ current in rat cerebellar granule cells
Zheng-Ge Zhao*, Man Zhang*, Xi-Min Zeng, Xiao-Wei Fei, Lin-Yun Liu, Zhi-Hong Zhang, Yan-Ai Mei
School of Life Sciences, Institute of Brain Science and State Key Laboratory of
Medical Neurobiology, Fudan University, Shanghai China, 200433 Downloaded from
jpet.aspetjournals.org
at ASPET Journals on September 30, 2021
1
Copyright 2007 by the American Society for Pharmacology and Experimental Therapeutics. JPET Fast Forward. Published on April 3, 2007 as DOI: 10.1124/jpet.106.117556 This article has not been copyedited and formatted. The final version may differ from this version.
JPET #117556
Running Title: Flufenamic Acid Bidirectionally Modulated IA
Address correspondence to:
Dr. Mei Yan-Ai
School of Life Sciences Institute of Brain Science Fudan University Shanghai 200433
P.R.China Downloaded from Tel: 8621-55664711 Fax: 8621-55664388
E-mail: [email protected] jpet.aspetjournals.org (or) [email protected]
Number of Text Pages: 32 at ASPET Journals on September 30, 2021 Number of Figures: 8 Number of Tables: 1 Number of References: 36 Number of Words in Abstract: 240 Number of Words Introduction: 463 Number of Words Discussion: 1377
Abbreviations: FFA, Flufenamic acid; COX, cyclooxygenase; NSAIDs, nonsteroidal anti-inflammatory drugs
2 JPET Fast Forward. Published on April 3, 2007 as DOI: 10.1124/jpet.106.117556 This article has not been copyedited and formatted. The final version may differ from this version.
JPET #117556
Abstract In this report, the effect of flufenamic acid on voltage-activated transient outward
+ K current (IA) in cultured rat cerebellar granule cells was investigated. At a concentration of 20 µM–1mM, flufenamic acid reversibly inhibited IA in a dose-independent manner. However, flufenamic acid at a concentration of 0.1–10 µM significantly increased the current amplitude of IA. In addition to the current amplitude
of IA, a higher concentration of flufenamic acid had a significant effect on the kinetic Downloaded from parameters of the steady-state activation and inactivation process, suggesting that the
binding affinity of flufenamic acid to IA channels may be state-dependent. Silencing the jpet.aspetjournals.org
Kv4.2, Kv4.3 and Kv1.1 genes of IA channels using small interfering RNA did not change the inhibitory effect of flufenamic on IA, indicating that flufenamic acid did not
act specifically on any of the subunits of the IA-channel protein. Intracellular application at ASPET Journals on September 30, 2021 of flufenamic acid could significantly increase the IA amplitude, but did not alter the inhibited effect induced by extracellular application of flufenamic acid, implying that flufenamic acid may exert its effect from both the inside and outside sites of the channel.
Furthermore, the activation of current induced by intracellular application of flufenamic acid could mimic other cyclooxygenase inhibitors and arachidonic acid. Our data are the
first that demonstrate how flufenamic acid is able to bi-directionally modulate IA channels in neurons at different concentrations and by different methods of application, and two different mechanisms may be involved.
3 JPET Fast Forward. Published on April 3, 2007 as DOI: 10.1124/jpet.106.117556 This article has not been copyedited and formatted. The final version may differ from this version.
JPET #117556
Introduction Non-steroidal anti-inflammatory drugs (NSAIDs) play essential roles as anti-inflammatory, analgesic and antipyretic drugs. The fenamate NSAIDs – such as meclofenamic, flufenamic, mefenamic and niflumic acids – are all derivatives of
N-phenylanthranilic acid, and are the most common NSAIDs used to reduce inflammation and pain associated with arthritis (Dawood et al., 1993; Alves and Duarte,
2002). In addition, the potential effects of NSAIDs on the central nervous system, such Downloaded from as neuro-protection in Alzheimer’s disease, have instigated several basic and clinical studies (Rich et al., 1995). It is well known that the major mechanism mediating the jpet.aspetjournals.org anti-inflammatory effects of fenamate and other NSAIDs is inhibition of cyclooxygenase, resulting in decreased prostaglandin formation (Vane, 1996)
On the other hand, the effects of fenamate NSAIDs on different ion channels have at ASPET Journals on September 30, 2021 been studied widely. It has been shown that local administration of voltage-dependent or Ca2+-activated K+ channel blockers could prevent the fenamate-induced peripheral anti-nociception, suggesting that fenamate may open several K+ channels at the primary afferent neurons (Alves and Duarte, 2002). In the trabecular meshwork of the eye, flufenamic acid enhances current through maxi-K channels (Stumpff et al., 2001). In addition, activation and inhibition of kidney CLC-K chloride channels by distinct binding sites of niflumic acid and fenamate acid has been reported by Liantonio et al.
(Liantonio et al., 2006). However, the effect of fenamate NSAIDs on ion channels was considered to directly block ion channels, and few report were concerned with the main mechanism that mediates fenamate-induced inhibition of cyclooxygenase.
It has been shown that cerebellar granule cells grown in primary culture have two
4 JPET Fast Forward. Published on April 3, 2007 as DOI: 10.1124/jpet.106.117556 This article has not been copyedited and formatted. The final version may differ from this version.
JPET #117556
+ + main voltage-activated outward K currents: rectify outward K current (IK) and
+ transient outward K (IA) (Mei et al., 2004). They are distinguishable by their activation and inactivation voltage ranges and kinetics, and by their pharmacological sensitivities.
Generally, the functional roles of IA include influencing cell excitability, action-potential firing, controlling spike latency and repetitive firing (Shibata et al.,
2000). Recently, our own data indicated that apoptosis of cerebellar granule neurons Downloaded from + induced by low K and free serum incubation is associated with an increase of IA (Hu et al., 2005; Hu et al., 2006). Therefore, finding a new IA-channel modulator or modulated mechanism is highly useful for further investigations into neuron excitability, neuronal jpet.aspetjournals.org apoptosis or neuronal protection.
Our recent studies demonstrated that the diphenyl structural NSAID, diclofenac, at ASPET Journals on September 30, 2021 could activate IA in rat cerebellar granule cells as a novel voltage-dependent IA channel opener (Liu et al., 2005). In the present study, we used a whole-cell patch-clamping technique and small interfering RNA (siRNA) to investigate the effects of flufenamic
acid on IA channels, as well as on their steady-state activation and steady-state inactivation. The results first demonstrate that flufenamic acid bi-directionally
modulated the IA current of rat granule neurons at different concentrations and that two different mechanisms were involved.
5 JPET Fast Forward. Published on April 3, 2007 as DOI: 10.1124/jpet.106.117556 This article has not been copyedited and formatted. The final version may differ from this version.
JPET #117556
Methods
Cell culture
Cells were derived from cerebellum of 7-8 day-old Sprague-Dawley rat pups as described previously. Isolated cells then were plated onto 35-mm-diameter petri dishes coated with poly-L-lysine (1µg/ml) at a density of 106 cells/mL. Cultured cells were
incubated at 37℃ with 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM) Downloaded from supplemented with 10% fetal calf serum, glutamine (5mM), insulin (5µg/mL), KCl
(25mM), and 1% antibiotic-antimycotic solution. After culturing for 24 h, cytosine jpet.aspetjournals.org β-D-arabinofuranoside (5 µM) was added to the culture medium to inhibit the proliferation of non-neuronal cells. All experiments were carried using cerebellar granule neurons at 5-7 days in culture. at ASPET Journals on September 30, 2021 Patch-clamp recordings
Whole-cell currents of granule neurons were recorded using a conventional patch-clamp
technique. Prior to IA current recording, the culture medium was replaced with a bath solution containing (in mM): NaCl 125, KCl 2.5, HEPES 10, MgCl2 1, tetrodotoxin
0.001, TEA 20 (pH adjusted to 7.4 using NaOH). Soft glass recording pipettes were filled with an internal solution containing (in mM): K gluconate 135, KCl 10, HEPES
10, CaCl2 1, MgCl2 1, EGTA 10 (pH adjusted to 7.3 using KOH). The pipette resistance is 6-7MΩ after filling with the internal solution. Flufenamic acid solutions were prepared extemporaneously and gravity ejected for 10-20 s from MSC-200 Manual
Solution Changer (Bio-Logic-Science Instruments, France). All recordings were performed at room temperature.
6 JPET Fast Forward. Published on April 3, 2007 as DOI: 10.1124/jpet.106.117556 This article has not been copyedited and formatted. The final version may differ from this version.
JPET #117556
Data acquisition and analysis
All currents were recorded using an Axopatch 200B amplifier (Axon Instrument, USA) operated in voltage-clamp mode. Data acquisition and analysis were performed with pClamp 8.01 software (Axon Instruments) and /or Origin6.1 (Microcal analysis software). Statistical analysis was performed using the Student t-test with non-paired comparison or paired comparisons where it is relevant. Values were given as means ± Downloaded from s.e.m. with n as the number of cell tested. P-value < 0.05 was used to denote the statistical difference between groups. When multiple comparisons were made, data were analyzed by a one-way ANOVA test. jpet.aspetjournals.org siRNA vector construction
The oligonucleotides specifying the short hairpin RNAs (shRNAs) were designed via at ASPET Journals on September 30, 2021 the website http://katahdin.cshl.org:9331/RNAi/html/rnai.html. (Table 1). For preparation of duplexes, 2 µl of sense-stranded and antisense-stranded oligonucleotides
(1 µg/µl each) were mixed together in 46 µl of DNA annealing buffer (30 mM Hepes,
100 mM potassium acetate, 2 mM magnesium acetate, adjusted to pH 7.4), heat-denatured at 90°C for 3 min, and annealed at 37°C for 1 h. Following this, 1 µl of annealed DNA was ligated into 30–50 ng of BamHI/EcoRI restriction-digested, gel-purified siRNA vector (RNAi-Ready pSIREN-RetroQ; BD Biosciences Clontech,
San Jose, CA USA) using phage T4 DNA ligase in a volume of 10 µl. Several colonies were sequenced to select the correct one.
7 JPET Fast Forward. Published on April 3, 2007 as DOI: 10.1124/jpet.106.117556 This article has not been copyedited and formatted. The final version may differ from this version.
JPET #117556
Transfection
The correct SiRNA vectors were extracted using a Qiagen plasmid midi kit. The
DNA concentration and purity were determined by measuring the absorbance at 260 nm and at 280 nm. Then, 10 µl of LipofectaminTM 2000 (Invitrogen, CA, USA) was preincubated with 250 µl of Opti-MEM I Reduced Serum Medium (Gibco, CA USA) at room temperature for 5 min. Meanwhile, the siRNA and pEGFP-F (BD Biosciences Downloaded from Clontech, NJ, USA) vectors (total, 4 µg of plasmids) were diluted to 50 µl with
Opti-MEM I Reduced Serum Medium (Gibco, CA, USA) at a ratio of 5:1 (v/v).
Following this, the LipofectaminTM 2000 and plasmid dilution were mixed and jpet.aspetjournals.org incubated at room temperature for 15 min. The DNA and LipofectaminTM 2000 complexes were added to the 4-day-old granule cells that had been cultured in 1 ml of at ASPET Journals on September 30, 2021 growth medium without antibiotics. After incubation for 5 h, the transfection medium was replaced with normal growth medium containing antibiotics. At 48 h after transfection, the cells with green fluorescence were further analyzed.
Chemicals
All drugs used were purchased from Sigma-Aldrich (St. Louis, MO, USA) except the fetal calf serum. DMEM culture medium and antibiotic–antimycotic solution were obtained from Gibco Life Technologies (Grand Island, NY, USA). Flufenamic acide, diclofenac, mefenamic acid, indomethacin and arachidonic acide were first dissolved in
DMSO and then diluted in extracellular or intracellular solution, with a final DMSO
concentration <0.1%, which alone did not produce any modulation of IA.
8 JPET Fast Forward. Published on April 3, 2007 as DOI: 10.1124/jpet.106.117556 This article has not been copyedited and formatted. The final version may differ from this version.
JPET #117556
Results As rat cerebellar granule neurons display two main voltage-dependent outward K+
currents – the transient outward current (IA) and the delayed rectifier current (IK) – we first identified whether flufenamic acid is specific for IA in the rat granule neurons. In the experiments carried out, the outward K+ currents were evoked by two sequential 200 ms depolarizing pulses to 40 mV at 1 s intervals, from holding potentials of –100 and
–40 mV, respectively (Fig. 1A). When the membrane potential was held at –100 mV, Downloaded from
depolarizing voltage pulses elicited a global outward current (IA plus IK) that activated rapidly (5–10 ms) and then decayed as time progressed. After 1 s intervals at a jpet.aspetjournals.org conditioning potential of –40 mV, the same depolarizing step only evoked a slight inactivating or non-inactivating outward K+ current that had been previously described
as a delayed rectifier IK current. It is evident in Fig. 1a that flufenamic acid significantly at ASPET Journals on September 30, 2021
(100 µM) inhibited the early inactivating IA component that was elicited by, first, depolarizing the pulse and then activating the later current that was evoked by the
second depolarizing pulse. Flufenamic acid decreased the amplitude of IA from 2107.5 ±
270 pA to 1859.6 ± 263.7 pA (n = 5, P < 0.05 using Student’s t-test) and, by contrast, it
increased the IK amplitude from 791.5 ± 270 pA to 941.6 ± 263.7 pA (n = 5, P < 0.05 using the Student’s t-test). The effect of flufenamic acid on the amplitude of IA and IK was illustrated in Fig. 1B. In view of the fact that flufenamic acid was dissolved by
0.1% DMSO, we simultaneously examined the effect of DMSO on IA and IK. As shown in Fig. 1C, neither IA nor IK was modulated by 1% DMSO (n = 5, P > 0.05, using
Student’s t-test). In some cases, washout of flufenamic acid from the bath solution took
a long time, the IA amplitude then recovered to a higher level than that of the control,
9 JPET Fast Forward. Published on April 3, 2007 as DOI: 10.1124/jpet.106.117556 This article has not been copyedited and formatted. The final version may differ from this version.
JPET #117556
suggesting that a lower concentration of flufenamic acid could augment IA (Fig. 1D).
We therefore tested whether flufenamic acid inhibited IA in a concentration-dependent manner. To investigate merely the effect of flufenamic acid on
IA, all the results described thereafter were obtained using a bath solution containing 20 mM TEA to eliminate the IK currents. IA currents were then evoked by 200 ms constant depolarizing pulses, ranging from –100 mV to 40 mV at 10-s intervals. We Downloaded from unexpectedly found that application of flufenamic acid to the bath solution produced bi-directional modulation of current amplitude depending on the concentration used jpet.aspetjournals.org (Fig. 2A). At concentrations from 20 µM to 1mM, flufenamic acid significantly inhibited IA amplitude. The inhibitory effect of flufenamic acid on IA was fast and reversible following washing; application of flufenamic acid to the bath solution at ASPET Journals on September 30, 2021 resulted in a clear, rapid decrease of current amplitude that reached its maximum effect within 30–60 s and returned to control levels after 1–2 min of wash-out. Moreover, the
inhibition of IA is concentration-dependent. The inhibition of IA current by flufenamic acid 50 µM, 250 µM, 500µM and 1mM was 24± 5% (n=8), 27.3 ±3.8% (n=5), 44.6
±5.8% (n=5), 69.3 ± 6.3% (n=3), respectively. (P < 0.05, using a one-way ANOVA test).
Interestingly, when reducing the concentration to 10 µM, 1 µM and 0.1µM, flufenamic acid significantly and reversibly increased IA current amplitude to 143 ± 8% (n=9),
119.5 ±3.7% (n=5) and 106.7 ±1.7% (n=4) of control, respectively (P < 0.05, using a one-way ANOVA test). Moreover, flufenamic acid activated IA current gradually and reached its maximum activation of IA within 2–3 min of drug application. Figure 2A illustrates typical experiments in which flufenamic acid was applied at different
10 JPET Fast Forward. Published on April 3, 2007 as DOI: 10.1124/jpet.106.117556 This article has not been copyedited and formatted. The final version may differ from this version.
JPET #117556
concentrations. The sum of bi-directional modulation on IA amplitude was demonstrated in Fig. 2B, which revealed that stimulatory or inhibitory effect of FA on IA current was dose-dependent.
The effect of flufenamic acid on the activation and inactivation properties of IA was studied using the appropriate voltage protocols. In the activation protocol, IA was evoked by a 200-ms depolarizing pulse from the first pulse potential of –80 mV to +20 Downloaded from mV in 10-mV steps at 10-s intervals (Fig. 3A and 3B). When the peak current that was evoked from each command potential was normalized to the maximal current amplitude, jpet.aspetjournals.org we obtained an activation curve of IA. As shown in Fig. 3C, the activation curve was significantly shifted by the application of flufenamic acid (100 µM); the current was half-activated at 17.7 ± 1.4 and 7 ± 2.4 mV in the absence and presence of at ASPET Journals on September 30, 2021 flufenamic acid, respectively (n=6, P < 0.05), suggesting that flufenamic acid significantly changed the voltage-dependent steady-state activation properties of IA.
We then studied the effect of flufenamic acid on voltage-dependent steady-state
inactivation of IA. Currents were elicited using 1-s conditioning prepulses from –110 mV to various membrane potentials prior to a 200-ms test pulse of +20 mV (Fig. 4A and
4B). The data obtained from figure 4A showed when conditioning prepulse applying at
-90 mV, the flufenamic-acid-induced inhibitory effect on IA was 26 ±5.5 %. By contrast, when conditioning prepulse was at -60 mV, the inhibitory effect of flufenamic acid reduced to 3 ±3 %. After normalizing each current peak to the maximal current amplitude obtained from the –110 mV prepulses as a function of the conditioning prepulse potential, we found that flufenamic acid modified the steady-state inactivation
11 JPET Fast Forward. Published on April 3, 2007 as DOI: 10.1124/jpet.106.117556 This article has not been copyedited and formatted. The final version may differ from this version.
JPET #117556
curve of IA. In five cells studied, the half-maximal inactivation voltage was –58.5 ±
1.8 mV and –49.7 ± 1.1 in the absence or presence of flufenamic acid, respectively
(n=6, P < 0.05). Figure 4C shows the statistical results of an inactivation curve that has been shifted about 9 mV towards the depolarizing potential by addition of flufenamic
acid. These results suggest that flufenamic acid decreased the IA current by modifying the steady-state IA-channel activation and inactivation properties. Downloaded from Previous studies have demonstrated that fenamates (niflumic and flufenamic acid) have more evidence of inhibition of Kv4.3, which was stably expressed in Chinese hamster ovary (CHO) cells (Wang et al., 1997). Our own studies showed, as assessed by jpet.aspetjournals.org quantitative RT-PCR, whole cell recording and detrodoxin-K, that besides Kv4.2 and
Kv4.3, the known main α-subunit of the IA channel, Kv1.1 is very important in IA at ASPET Journals on September 30, 2021 channel (Hu et al., unpublished results). By RT-PCR technique, three subunits – Kv4.2,
Kv4.3 and Kv1.1 – were detected on the granule cells and are part of the IA channels
(Fig. 5A). We then used siRNA to silence the Kv4.2, Kv4.3 and Kv1.1 genes in cerebellar granule neurons to determine whether the flufenamic acid specifically
inhibited some of the subunits of the IA-channel protein. Three types of Kv gene siRNA vector – Kv4.2, Kv4.3 and Kv1.1 – were cotransfected with enhanced green fluorescent protein (eGFP) in order to label the transfected cells. At 48 h after transfection, the cells
with green fluorescence were recorded. The IA current was evoked by depolarizing pulse to 40 mV from holding potentials of –100 mV (Fig. 5B). As shown in Fig. 5B, the
IA amplitude and shape were modulated distinctly after silencing the expression of
Kv4.2, Kv4.3 or Kv1.1, respectively. However, silencing the expression of Kv4.2,
12 JPET Fast Forward. Published on April 3, 2007 as DOI: 10.1124/jpet.106.117556 This article has not been copyedited and formatted. The final version may differ from this version.
JPET #117556
Kv4.3 or Kv1.1 by siRNA did not affect the efficiency of flufenamic acid on the IA current amplitude. After silencing Kv4.2, Kv4.3 or Kv1.1, the inhibition of the
remaining IA current by flufenamic acid was 19.2 ± 3.9 % (n = 9), 20.1 ± 2.9 % (n = 9) and 27.0 ± 5% (n = 4), respectively. As shown in Fig. 5C, the inhibitory effect of flufenamic acid on the remaining current silencing of Kv4.2, Kv4.3 or Kv1.1 expression
was similar to that of the normal IA channel current in the control (with empty vector, Downloaded from
20.8 ± 5.8%). The results indicated that flufenamic acid modulated native IA channels of rat granule neurons rather than of the Kv4.2, Kv4.3 and Kv1.1 subunits of the IA channel. However, the molecular target remains unknown jpet.aspetjournals.org
To assess at what point flufenamic acid exerts its bi-directional effect on the IA channel, we tested whether the intracellular application of flufenamic acid could mimick at ASPET Journals on September 30, 2021 the effect of the extracellular application of flufenamic acid on IA. When 10 µM flufenamic acid was added to the pipette solution, we found that the current amplitude increased along with time after establishment of the whole-cell configuration and
reached its maximum activation of IA within 3–5 min; these results were similar to those observed by extracellularly applying the lower concentration of flufenamic acid (Fig.
6A). The percentage of current amplitude increase by intracellular 10 µM and 100 µM flufenamic acid was 135 ± 7% (n = 6) and 132 ± 5 % (n= 4), respectively (P < 0.05, using Student’s t-test). We then examined whether the intracellular application of
flufenamic acid could modify the effect of flufenamic acid on IA induced by extracellular application. As Fig. 6B shows, after the current reached its maximal amplitude with 10 µM flufenamic acid in the pipette solution, applying 100 µM
13 JPET Fast Forward. Published on April 3, 2007 as DOI: 10.1124/jpet.106.117556 This article has not been copyedited and formatted. The final version may differ from this version.
JPET #117556
flufenamic acid extracellularly could still decrease the IA current amplitude. Figure 6C illustrates that, after IA was increased by intracellular application of flufenamic acid, flufenamic acid was applied extracellularly to reduce the current amplitude to 67 ± 4% of control: a similar inhibitory effect as that obtained without intracellular flufenamic acid (73 ± 4% of control). These results showed that flufenamic acid exerts separately
its effects on the intracellular and extracellular side of IA channels. Downloaded from As fenamates are the inhibitors of the cyclooxygenase (COX), like all NSAIDs
(Ouellet & Percival, 1995), we tested whether IA activation is common to all NSAIDs by using three NSAIDs of different chemical groups (diclofenac, mefenamic acid and jpet.aspetjournals.org indomethacin). All of the three NSAIDs can mimick the flufenamic acid-induced
activatory effect on IA. The internal application of mefenamic acid (Fig. 7A), diclofenac at ASPET Journals on September 30, 2021 (Fig. 7B) and indomethacin (Fig. 7C) was performed by pipette solution, and the current amplitude increased after establishment of the whole-cell configuration and reached its maximum within 2–4 min. The percentage of current amplitude increased by intracellular methflunamic, indomethacin and diclofenac was 145 ± 7% (n = 6), 130.2 ±
3.6% (n = 6) and 124.5 ± 1.3% (n = 6), respectively (P < 0.05, using Student’s t-test).
Statistical analysis of the above data is shown in Fig. 7D.
Furthermore, the effects of eicosatetraynoic acid (ETYA) and arachidonic acid were tested to address whether increasing arachidonic acid and/or reducing its metabolic products was involved. Applying 10 µM ETYA, which blocks the formation of active arachidonic-acid metabolites, in the pipette solution mimicked the effect of flufenamic
acid on IA (Fig. 8A), and an average increase of IA current amplitude of 23 ± 5% (n = 5)
14 JPET Fast Forward. Published on April 3, 2007 as DOI: 10.1124/jpet.106.117556 This article has not been copyedited and formatted. The final version may differ from this version.
JPET #117556 was observed under these conditions. The effect of arachidonic acid was similar with
ETYA, flufenamic acid and other NSAIDs (Fig. 8B). In the presence of intracellular
arachidonic acid (10 µM), the IA amplitude was augmented to 141 ± 9%. We then observed whether the low concentration of flufenamic acid could still increase the IA amplitude while arachidonic acid was used in the pipette solution. The result obtained from 4 cells tested showed that in the presence of intracellular arachidonic acid (10 µM), Downloaded from the IA amplitude was augmented to 136 ± 4%, applying 10 µM FA sequentially in the bash solution increased the IA current to 149 ± 4 % of control (n=4), having an jpet.aspetjournals.org augmentation of 13.2 ± 2.6 % (Fig.8C). To avoid the effect of DMSO on IA, the intracellular solution with 1% DMSO was also tested as the control. The 1% DMSO
alone did not produce any modulation of IA; the percentage of current amplitude that at ASPET Journals on September 30, 2021 increased as a result of intracellular 1% DMSO was 105 ± 6%. There was no significant difference compared with the normal intracellular solution (n = 5, P > 0.05, using
Student’s t-test). Statistical analysis of the above data is shown in Fig. 8C.
Discussion
Our results first demonstrate that flufenamic acid bi-directionally modulated the IA current of rat granule neurons at different concentrations and via different methods of application: external application at concentrations beyond 10 µM resulted in inhibiting
IA; while external application or intracellular application of 10 µM flufenamic acid augmented IA. Stimulatory or inhibitory effect of FA on IA current was dose-dependent.
The mode by which fenamatic acids inhibited ion channels is uncertain. As
15 JPET Fast Forward. Published on April 3, 2007 as DOI: 10.1124/jpet.106.117556 This article has not been copyedited and formatted. The final version may differ from this version.
JPET #117556 diphenylcarboxylate and its derivates, including flufenamic acid, are highly lipophilic molecules, modifying membrane ion channels by them can result in alterations of the permeability of cell membranes (Ottolia and Toro, 1994) or a nonspecific lipid effect on the channels (Bock et al., 2003; Li et al., 1999). In our study, the rapid onset and reversible inhibition induced by flufenamic acid suggests that its effects are probably mediated by a direct action on the channel and are not caused by indirect effects such as Downloaded from lowering and/or increasing intracellular factors. The direct blocking effect on ion channels was similar to that in previous studies on rat supraoptic neurons and expressed systems in which flufenamic acid blocked the Ca2+-dependent non-selective cation jpet.aspetjournals.org channels and human Kv 2.1 subunits stably expressed in the CHO cells (Lee and Wang,
1999; Partridge & Valenzuela, 2000). These results, together with our observations on at ASPET Journals on September 30, 2021
IA channels, suggest that flufenamic acid, like other members of the fenamate acid class, have a broad spectrum of nonspecific actions on ion-channel proteins.
Transient potassium currents (IA) have been described in neurons from many regions of the central nervous system, and also in cardiac and vascular cells (Hoffman and
Johnston, 1998; Song et al., 1998). Comparisons with other voltage-gated K+ channels
show that IA significantly operates at sub-threshold membrane potentials and transiently inactivates during depolarizing pulses. In the rat cereballar granule cells, fenamate acid significantly shifted both the steady-state activation and steady-state inactivation curves towards a more depolarized potential. Moreover, a flufenamic-acid-induced inhibitory
effect on IA channels was seen at a hyperpolarizing potential at which few IA channels were inactivated. Thus, these results indicate that flufenamic acid might have a much
16 JPET Fast Forward. Published on April 3, 2007 as DOI: 10.1124/jpet.106.117556 This article has not been copyedited and formatted. The final version may differ from this version.
JPET #117556
more higher affinity for activated IA channels than for inactivated channels. These results therefore suggest that flufenamic acid not only decreased the current amplitude
by blockading the IA channels, but also modified the channel properties in terms of activation or inactivation gating. The latter function might involve modulation of neuronal excitability.
Recent reports have suggested that members of the shal (Kv4) family form the Downloaded from major components of the IA channels in the central nervous system (Serodio and Rudy,
1998; An et al., 2000). Shibata et al. (2000) reported that IA channels encoded by the
Kv4 family were found in cerebellar neurons; moreover, our own results revealed that jpet.aspetjournals.org
the majority of the IA channels were not only conducted by the Kv4 family, but also by
Kv1.1 in rat granule cells. As the previous study by Wang et al. showed, by using a at ASPET Journals on September 30, 2021 heterologous expression system, fenamates (niflumic and flufenamic acid) more strongly inhibited Kv4.3 than Kv4.2 (Wang et al., 1997). To identify whether the
inhibitory effect induced by flufenamic acid on IA was associated with the unitary subunit of IA-channel protein, we tested the effect of flufenamic acid on the remaining current by silencing Kv4.2, Kv4.3 and Kv1.1, respectively. However, our results
indicated that silencing the expression of any of the above subunits of the IA channel could not eliminate the effect of flufenamic acid on the IA current. As there is a high degree of structural similarity between the Kv4.3 and Kv4.2 channels, and the Kv4.3 channel is 75% identical to the Kv4.2 channel at the amino acid level (Dixone al., 1996), these results suggested that the effects of flufenamic acid were probably not isoform-selective. The discrepancy between our observation and Wang’s report may
17 JPET Fast Forward. Published on April 3, 2007 as DOI: 10.1124/jpet.106.117556 This article has not been copyedited and formatted. The final version may differ from this version.
JPET #117556 result from the differences between the reconstituted Kv4.2 or Kv4.3 channel complex
and the native IA channel of granule neurons; the latter consisted of Kv4 family and
Kv1.1 subunits simultaneously.
It was surprising to find in our studies that when a lower concentration of flufenamic
acid was used, it induced the activator effect on IA. This was the opposite of what happened at higher concentrations, but similar to what happened when the drug was Downloaded from administered internally via patch pipettes. Moreover, intracellular application of flufenamic acid did not alter the inhibitory effect induced by extracellular application of jpet.aspetjournals.org flufenamic acid. It is therefore conceivable that flufenamic acid augmented IA via another mechanism other than the channel block. One possibility could be the inhibition of cyclooxygenase, as it has been well established that fenamates are also inhibitors of at ASPET Journals on September 30, 2021 cyclooxygenase, as well as other NSAIDs (Wu et al., 1998). We therefore tested whether IA activation is common to all NSAIDs; three NSAIDs of different chemical groups (diclofenac, mefenamic acid and indomethacin) were randomly chosen. All of
the three NSAIDs could mimick the flufenamic-acid-induced stimulatory effect on IA when they were applied internally by pipette solution. One possibility could be that the enzyme cyclooxygenase was inhibited, as it has been well established that fenamates are also inhibitors of the enzyme cyclooxygenase (Ouellet & Percival, 1995). Thus, it is conceivable that a lower concentration or intracellular flufenamic-acid-induced
augmention of IA was due to the modulatory effect of COX inhibition, while external application at higher concentrations of flufenamic acid decreased IA by the channel blocking mechanism.
18 JPET Fast Forward. Published on April 3, 2007 as DOI: 10.1124/jpet.106.117556 This article has not been copyedited and formatted. The final version may differ from this version.
JPET #117556
Inhibitors of the cyclooxygenase pathway in the arachidonic acid (AA) cascade can cause the buildup of AA and/or reduce its metabolic products (for a review, see Bazan,
2003). By intercellular application of AA, we determined whether the
fenamate-acid-induced activation effect on IA was associated with accumulation of AA or its metabolic products. The observation that internal application of AA mimicked the
effect of fenamate acid on IA is consistent with our hypothesis. To avoid the effect of Downloaded from
DMSO on IA, which is a solvent of AA, we also tested the effect of AA dissolved in
0.1% ethanol, and obtained the same results (data not shown). It thus indicated that AA jpet.aspetjournals.org could act as a mediator of IA channels, as reported first in smooth muscle (Ordway et al.,
1989). In addition, ETYA, which blocks the formation of active AA metabolites,
mimicked the effect of AA activation on IA, indicating that AA activation was direct at ASPET Journals on September 30, 2021 and not mediated by its oxygenated metabolites, as reported by Danthi et al. in bovine adrenal zona fasciculata cells (Danthi et al., 2003). However, whether AA has a direct
mediatory effect on IA channels or indirectly activates the downstream signal in granule neurons needs to be further explored.
Arachidonic acid and its metabolic products have been shown to modulate a large number of ligand- and voltage-gated ion channels in a variety of systems (Ordway,
1991). The modulator effects of AA and its metabolites either activate or inactivate ion channels depending on the cell types studied (Takahira et al., 2001; Patel & Honore,
2001; Wei et al., 2004). However, it is noticeable that, in rat granule neurons, our own and Holmqvist’s study have revealed that extracelluar application of AA remarkably
inhibited IA amplitude and modulated its kinetics (Wang et al., 2005; Holmqvist et al.,
19 JPET Fast Forward. Published on April 3, 2007 as DOI: 10.1124/jpet.106.117556 This article has not been copyedited and formatted. The final version may differ from this version.
JPET #117556
2001). Moreover, molecular cloning showed that the AA-induced inhibition effect on IA occurs by acting directly on the Kv4–KChIP complex (Holmqvist et al., 2001). Here, our results have revealed that although AA was applied intracellularly, it evoked an
opposite stimulatory effect on IA. To date, few investigations have used AA intracellularly, although Kim’s study in excised membrane patches has shown that AA applied to the cytoplasmic or extracellular side of the membrane caused opening of Downloaded from three types of channels (Kim et al., 1995). We reason that the conflicting function of AA may result from its difference in binding location in cytoplasmic or extracellular sides of the membrane. Further work will be necessary to examine this possibility. jpet.aspetjournals.org
The overall properties of IA make it an excellent target for any modulatory mechanism influencing cell excitability and action-potential firing (Shibata et al., 2000; at ASPET Journals on September 30, 2021 Kiss et al., 2002). Although the reliable mechanism of fenamate-acid-induced bio-directed modulation of IA remains unknown, our results may partially account for the unwanted side effects of fenamate acid, and might be a valuable new avenue to investigate in terms of therapeutic and/or basic research applications of NSAIDs.
Acknowledgements
We would like to thank Drs. Chen HC and Zhu H of Chinese University of Hong Kong for their technical help on setting up RNA interference method.
20 JPET Fast Forward. Published on April 3, 2007 as DOI: 10.1124/jpet.106.117556 This article has not been copyedited and formatted. The final version may differ from this version.
JPET #117556
References
Alves D and Duarte I (2002) Involvement of ATP-sensitive K+ channels in the
peripheral antinociceptive effect induced by dipyrone. Eur J Pharmacol 444:47-52.
An WF, Bowlby MR, Betty M, Cao J, Ling HP, Mendoza G, Hinson JW, Mattsson KI,
Strassle BW, Trimmer JS and Rhodes KJ (2000) Modulation of A-type potassium
channels by a family of calcium sensors. Nature 403:553-556. Downloaded from Bazan NG (2003) Synaptic lipid signaling: significance of polyunsaturated fatty acids
and platelet-activating factor J Lipid Res 44:2221–2233.
Bock J, Szabo I, Gamper N, Adams C and Gulbins E (2003) Ceramide inhibits the jpet.aspetjournals.org
potassium channel Kv1.3 by the formation of membrane platforms. Biochem
Biophys Res Commun 305:890-897. at ASPET Journals on September 30, 2021 Danthi S, Enyeart JA and Enyeart JJ (2003) Modulation of Native TREK-1 and Kv1.4
K+ Channels by Polyunsaturated Fatty Acids and Lysophospholipids. J Membrane
Biol 195:147–164.
Dawood MY (1993) Nonsteroidal antiinflammatory drugs and reproduction. Am J
Obstet Gynecol 169:1255–1265.
Dixon JE, Shi W, Wang HS, McDonald C, Yu H, Wymore RS, Cohen IS and McKinnon
D (1996) Role of the Kv4.3 K+ channel in ventricular muscle: a molecular correlate
for the transient outward current. Circ Res 79:659-668.
Hoffman DA and Johnston D (1998) Downregulation of transient K+ channels in
dendrites of hippocampal CA1 pyramidal neurons by activation of PKA and PKC. J
Neurosci 18:3521–3528.
21 JPET Fast Forward. Published on April 3, 2007 as DOI: 10.1124/jpet.106.117556 This article has not been copyedited and formatted. The final version may differ from this version.
JPET #117556
Holmqvist MH, Cao J, Knoppers MH, Jurman ME, Distefano PS, Rhodes KJ, Xie Y and
An WF (2001) Kinetic Modulation of Kv4-mediated A-Current by Arachidonic Acid
Is Dependent on Potassium Channel Interacting Proteins. J Neurosci 21:4154–4161.
Hu CL, Gao ZY, Zheng L, Zhang ZH and Mei YA (2005) 2-iodomelatonin prevents
apoptosis of cerebellar granule neurons via inhibition of A-type transient outward
K+ currents. J Pineal Res 38:53-61. Downloaded from Hu CL, Liu Z, Zeng XM, Liu ZQ, Cheng XH, Zhang ZH and Mei YA (2006)
4-aminopyridine, a Kv channel antagonist, prevents apoptosis of rat cerebellar
granule neurons. Neuropharmacology 51: 737-746. jpet.aspetjournals.org
Kim D, Sladek CD, Aquado-Velasco C and Mathiasen JR (1995) Arachidonic acid
activation of a new family of K+ channels in cultured rat neuronal cells. J Physiol at ASPET Journals on September 30, 2021 484:643-660.
Kiss T, Laszlo Z and Szabadics J (2002) Mechanism of 4-aminopyridine block of the
transient outward K-current in identified Helix neuron. Brain Res 927:168-179.
Lee YT and Wang Q (1999) Inhibition of hKv2.1, a major human neuronal
voltage-gated K+ channel, by meclofenamic acid. Eur J Pharmacol 378:349–356.
Li L, Vaali K, Vapaatalo H and Kankaanranta H (1999) Effects of K(+) channel
inhibitors on relaxation induced by flufenamic and tolfenamic acids in guinea-pig
trachea. Eur J Pharmacol 383:169-176.
Liantonio A, Picollo A, Babini E, Carbonara G, Fracchiolla G, Loiodice F, Tortorella V,
Pusch M and Camerino DC (2006) Activation and inhibition of kidney CLC-K
chloride channels by fenamates. Mol Pharmacol 69:165-173.
22 JPET Fast Forward. Published on April 3, 2007 as DOI: 10.1124/jpet.106.117556 This article has not been copyedited and formatted. The final version may differ from this version.
JPET #117556
Liu LY, Fei XW, Li ZM and Mei YA (2005) The nonsteroidal anti-inflammatory drug,
diclofenac, activates the transient outward K+ current in rat cereballer granule cells.
Neuropharmacology 48:918-926.
Mei YA, Vaudry D, Basille M, Castel H, Fournier A, Vaudry H and Gonzalez BJ (2004)
PACAP inhibits delayed rectifier potassium current via a cAMP/PKA transduction
pathway: evidence for the involvement of Ik in the anti-apoptotic action of PACAP. Downloaded from Eur J Neurosci 19:1446-1458.
Ouellet M and Percival MD (1995) Effect of inhibitor time-dependency on selectivity
towards cyclooxygenase isoforms. Biochem J 306:247-251. jpet.aspetjournals.org
Ordway RW, Singer JJ and Walsh JV Jr (1991) Direct regulation of ion channels by
fatty acids. Trends Neurosci 14:96-100. at ASPET Journals on September 30, 2021 Ordway RW, Walsh JV Jr and Singer JJ (1989) Arachidonic acid and other fatty acids
directly activate potassium channels in smooth muscle cells. Science
244:1176–1179.
Ottolia M and Toro L. (1994) Potentiation of large conductance KCa channels by
niflumic, flufenamic, and mefenamic acids. Biophys J 67:2272-2279.
Partridge LD and Valenzuela CF (2000) Block of hippocampal CAN channels by
flufenamate. Brain Res 867:143–148.
Patel AJ and Honore E (2001) Properties and modulation of mammalian 2P domain K+
channels. Trends Neurosci 24:339–346.
Rich J, Rasmusson DX, Folstein MF, Carson KA, Kawas C and Brandt J (1995)
Nonsteroidal antiinflammatory drugs in Alzheimer’s disease. Neurology 45:51–55.
23 JPET Fast Forward. Published on April 3, 2007 as DOI: 10.1124/jpet.106.117556 This article has not been copyedited and formatted. The final version may differ from this version.
JPET #117556
Serodio P and Rudy B (1998) Differential expression of KV4 K+ channel subunits
mediating subthreshold transient K+ (A-type) currents in rat brain. J Neurophysiol
79:1081-1091.
Shibata R, Nakahira K, Shibasaki K, Wakazono Y, Imoto K and Ikenaka K (2000)
A-type K+ current mediated by the KV4 channel regulates the generation of action
potential in developing cerebellar granule cells. J Neurosci 20:4145-4155. Downloaded from Song WJ, Tkatch T, Baranauskas G, Ichinohe N, Kitai ST and Surmeier DJ (1998)
Somatodendritic depolarization-activated potassium currents in rat neostriatal
cholinergic interneurons are predominantly of the A type and attributable to jpet.aspetjournals.org
coexpression of KV4.2 and KV4.1 subunits. J Neurosci 18:3124-3137.
Stumpff F, Boxberger M, Thieme H, Strauss O and Wiederholt M (2001) Flufenamic at ASPET Journals on September 30, 2021 acid enhances current through maxi-K channels in the trabecular meshwork of the
eye. Curr Eye Res 22:427– 437.
Takahira M, Sakurada N, Segawa Y and Shirao Y (2001) Two types of K+ currents
modulated by arachidonic acid in bovine corneal epithelial cells. Invest Ophthalmol
Vis Sci 42:1847–1854.
Vane JR (1996) Introduction: mechanism of action of NSAIDs. Br J Rheumatol 35
suppl 1:1–3.
Wang HS, Dixon JE and McKinnon D (1997) Unexpected and differential effects of Cl-
channel blockers on the Kv4.3 and Kv4.2 K+ channels. Implications for the study of
the I (to2) current. Circulation Res 81:711-718.
Wang X, Bao J, Zeng XM, Liu Z and Mei YA (2005) Elevation of intracellular Ca2+
24 JPET Fast Forward. Published on April 3, 2007 as DOI: 10.1124/jpet.106.117556 This article has not been copyedited and formatted. The final version may differ from this version.
JPET #117556
modulates A-currents in rat cerebellar granule neurons. J Neurosci Res 81:530-540.
Wei Y, Lin DH, Kemp R, Yaddanapudi GS, Nasjletti A, Falck JR and Wang WH (2004)
Arachidonic Acid Inhibits Epithelial Na Channel Via Cytochrome P450 (CYP)
Epoxygenase-dependent Metabolic Pathways. J Gen Physiol 124:719–727.
Wu KK (1998) Biochemical pharmacology of nonsteroidal anti-inflammatory drugs.
Biochem Pharmacol 55:543-547. Downloaded from
jpet.aspetjournals.org
at ASPET Journals on September 30, 2021
25 JPET Fast Forward. Published on April 3, 2007 as DOI: 10.1124/jpet.106.117556 This article has not been copyedited and formatted. The final version may differ from this version.
JPET #117556
Footnotes
* The first two authors contributed equally to this work. Downloaded from This work is supported by The Ministry of Education Foundation of China (No.
20060246018).
jpet.aspetjournals.org
at ASPET Journals on September 30, 2021
26 JPET Fast Forward. Published on April 3, 2007 as DOI: 10.1124/jpet.106.117556 This article has not been copyedited and formatted. The final version may differ from this version.
JPET #117556
Legends for figures
Fig. 1. 100 µM flufenamic acid inhibited IA current amplitudes but increased IK current amplitudes. A, The original current traces recorded in the absence and presence of 100 µM flufenamic acid (FFA). The current was evoked by two sequential
200 ms depolarizing pulses to 40 mV at 1-s intervals. The holding potentials were set to Downloaded from
–100 mV (first pulse) for full activation of the IA, and at –40 mV (second pulse) for activation of the IK. B, IA and IK current recorded from the granule neuron; 1% DMSO jpet.aspetjournals.org was added to the bath solution. C, IA and IK current amplitude obtained from granule cells in the absence and presence of 100 µM flufenamic acid. Each value is the mean ±
SEM of 5–6 independent experiments. *P < 0.05 compared with control group. D, A at ASPET Journals on September 30, 2021 sample in which washout of 100 µM flufenamic acid from bath solution induced the augmentation of IA current amplitude. The current was elicited by a depolarizing pulse to 40 mV from the holding potentials of –100 mV.
Fig. 2. Flufenamic acid bi-modulated IA current at different concentrations with dose-dependent. A, Superimposed K+ current evoked by 200 ms depolarizing pulses from –100 mV to 40 mV. The current traces were obtained in the absence and presence of flufenamic acid （FFA）at a concentration of 0.1 µM to 1mM, respectively. B,
Statistical analysis of the effect of various flufenamic acid concentrations on IA. The data represent the mean values ± SEM obtained from 5 to 7 cells. *P < 0.05 compared with the control; # P < 0.05 compared with the data obtained from the different
27 JPET Fast Forward. Published on April 3, 2007 as DOI: 10.1124/jpet.106.117556 This article has not been copyedited and formatted. The final version may differ from this version.
JPET #117556 concentration, using a one-way ANOVA test.
Fig. 3. Flufenamic acid externally applied altered the steady-state activation
property of IA. A, IA recordings using an activation voltage protocol in the absence (top) and presence (bottom) of flufenamic acid (FFA,100 µM). The cells were held at –100 mV and depolarized in 10 mV steps from –80 mV to 20 mV at 10-s intervals. B, The Downloaded from voltage-dependent activation curve of IA obtained in the absence or presence of flufenamic acid. C, Plot of the normalized conductance as a function of the command potential in the absence or presence of flufenamic acid. The data points were fitted with jpet.aspetjournals.org a Boltzmann function. A leftward shift of the voltage-dependent activation curve was observed in the presence of flufenamic acid. The data represent the mean values ± SEM at ASPET Journals on September 30, 2021 obtained from 6 cells.
Fig. 4. Flufenamic acid externally applied altered the steady-state inactivation
property of IA. A, IA currents recorded in the absence (top) and presence of flufenamic acid (FFA 100µM, bottom). 1-s conditioning prepulses from –110 mV to 0 mV in
10-mV increments were applied before the test pulse to 20 mV. The voltage protocol is
shown below the current records. B, Steady-state inactivation curves of IA plot in the absence or presence of flufenamic acid. The abscissa indicates conditioning prepulse potentials. C, The peak current amplitude normalized to the maximal current was plotted against the prepulse potential. Normalized current points were fitted with a
Boltzmann function, showing that the application of flufenamic acid shifted the
28 JPET Fast Forward. Published on April 3, 2007 as DOI: 10.1124/jpet.106.117556 This article has not been copyedited and formatted. The final version may differ from this version.
JPET #117556 steady-state inactivation curve towards positive potential. The data represent the mean values ± SEM obtained from 6 cells.
Fig. 5. Silencing three main α-subunits of IA channel expressed in rat cerebullar granule cells did not modulate the flufenamic acid-induced inhibitory effect. A, The
main α-subunits of IA channel detected in primary cultured rat cerebullar granule cells Downloaded from using RT-PCR. B, The IA current recorded after silencing the Kv4.2, Kv4.3 and Kv1.1 genes, respectively, by siRNA in the absence and presence of flufenamic acid (FFA).
Three types of siRNA vector of Kv gene – Kv4.2, Kv4.3 and Kv1.1 – were, respectively, jpet.aspetjournals.org cotransfected with pEGFP-F in order to label the transfected cells. The K+ current was evoked by the 200-ms depolarizing pulse to 40 mV at 1-s intervals from holding at ASPET Journals on September 30, 2021 potentials of –100 mV. C, The inhibitory effect of flufenamic acid on IA amplitude when silencing Kv4.2, Kv4.3 and Kv1.1 genes. Each value is the mean ± SEM of 5–15 independent experiments.
Fig. 6. The IA current amplitude could be bi-modulated by intracellular and extracellular application of flufenamic acid. A, The time course of changed IA amplitudes induced by the internal application of flufenamic acid (FFA, 10 µM). The
insets in the graphs show the superimposed IA traces taken from the initial control levels
(after establishment of the whole-cell configuration), after internal infusion of flufenamic acid, respectively. The time points (a, b, c) noted on the curves correspond to
the superimposed IA current traces illustrated by insets. B, Time course of the changed
29 JPET Fast Forward. Published on April 3, 2007 as DOI: 10.1124/jpet.106.117556 This article has not been copyedited and formatted. The final version may differ from this version.
JPET #117556 current amplitudes obtained from the cell with intracellular and external flufenamic acid.
The insets in the graphs show the superimposed IA traces taken from the same cell. C,
Statistical analysis of the effect induced by internal flufenamic acid alone and without internal flufenamic acid. The data represent the mean values± SEM obtained from 5 to 7 cells. *P < 0.05 compared with the control group without internal flufenamic acid. # P <
0.05 compared with the internal flufenamic acid. Downloaded from
Fig. 7. Intracellular application of three NSAIDs of different chemical groups jpet.aspetjournals.org could mimic the internal flufenamic acid-induced effect on IA current. A–C, The time course of increased IA amplitudes induced by the internal application of 10 µM mefenamic acid (MA, A), 10 µM diclofenac (DIC, B) and 10 µM indomethacin (INDO, at ASPET Journals on September 30, 2021
C). The insets in the graphs show the superimposed IA traces taken from the same cells.
D, Statistical analysis of the effect on IA current amplitudes induced by internal flufenamic acid, mefenamic acid, diclofenac and indomethacin. The data represent the mean values ± SEM obtained from 5 to 7 cells.
Fig. 8. Intracellular application of eicosatetraynoic acid and arachidonic acid could
mimick the internal flufenamic-acid-induced effect on IA current. A and B, The time course of increased IA current amplitudes induced by the internal application of eicosatetraynoic acid (10 µM ETYA, A) and arachidonic acid (10 µM AA, B). C, Time course of the changed current amplitudes obtained from the cell with intracellular arachidonic acid (10 µM AA) and external flufenamic acid (10 µM, AA). The insets in
30 JPET Fast Forward. Published on April 3, 2007 as DOI: 10.1124/jpet.106.117556 This article has not been copyedited and formatted. The final version may differ from this version.
JPET #117556
the graphs show the superimposed IA traces taken from the same cells. D, Statistical analysis of the effect on IA current amplitudes induced by internal arachidonic acid,
ETYA and 1% DMSO, which is a solvent of ETYA and arachidonic acid. And the
effect on IA current amplitudes induced by extracellular FFA while internal arachidonic acid was used. The data represent the mean values ± SEM obtained from 5 to 7 cells. *P
< 0.05 compared with the control, # P < 0.05 compared with intracellular arachidonic Downloaded from acid alone.
jpet.aspetjournals.org
at ASPET Journals on September 30, 2021
31 JPET Fast Forward. Published on April 3, 2007 as DOI: 10.1124/jpet.106.117556 This article has not been copyedited and formatted. The final version may differ from this version.
JPET #117556
Table 1: Synthesized oligonucleotides in the siRNA study
Name Sequence Kv1.1 Si 5'-AATTCAAAAAATTATCGATGCAATGAATGGTGCCCGTGAACCAATTCACG GGCACCATTCACCGCATCGATAAG-3' Kv1.1 Ri 5'-GATCCTTATCGATGCGGTGAATGGTGCCCGTGAATTGGTTCACGGGCACCA Downloaded from TTCATTGCATCGATAATTTTTTG-3' Kv4.2 Si 5'-AATTCAAAAAAATATCGTTCCAAGGTGTCTTGCCATGTCTCCAAAGACATG GCAAGACACCCTGGAACGATACG-3' Kv4.2 Ri 5'-GATCCGTATCGTTCCAGGGTGTCTTGCCATGTCTTTGGAGACATGGCAAGA
CACCTTGGAACGATATTTTTTTG-3' jpet.aspetjournals.org Kv4.3 Si 5'-AATTCAAAAAACAATGAGTGACATGGTCTTGCCCATGTGCCCAAGCACAT GGGCAAGACCACGTCACTCATCGG-3' Kv4.3 Ri 5'-GATCCCGATGAGTGACGTGGTCTTGCCCATGTGCTTGGGCACATGGGCAA GACCATGTCACTCATTGTTTTTTG-3'
at ASPET Journals on September 30, 2021
32 JPET Fast Forward. Published on April 3, 2007 as DOI: 10.1124/jpet.106.117556 This article has not been copyedited and formatted. The final version may differ from this version. Downloaded from jpet.aspetjournals.org at ASPET Journals on September 30, 2021 JPET Fast Forward. Published on April 3, 2007 as DOI: 10.1124/jpet.106.117556 This article has not been copyedited and formatted. The final version may differ from this version. Downloaded from jpet.aspetjournals.org at ASPET Journals on September 30, 2021 JPET Fast Forward. Published on April 3, 2007 as DOI: 10.1124/jpet.106.117556 This article has not been copyedited and formatted. The final version may differ from this version. Downloaded from jpet.aspetjournals.org at ASPET Journals on September 30, 2021 JPET Fast Forward. Published on April 3, 2007 as DOI: 10.1124/jpet.106.117556 This article has not been copyedited and formatted. The final version may differ from this version. Downloaded from jpet.aspetjournals.org at ASPET Journals on September 30, 2021 JPET Fast Forward. Published on April 3, 2007 as DOI: 10.1124/jpet.106.117556 This article has not been copyedited and formatted. The final version may differ from this version. Downloaded from jpet.aspetjournals.org at ASPET Journals on September 30, 2021 JPET Fast Forward. Published on April 3, 2007 as DOI: 10.1124/jpet.106.117556 This article has not been copyedited and formatted. The final version may differ from this version. Downloaded from jpet.aspetjournals.org at ASPET Journals on September 30, 2021 JPET Fast Forward. Published on April 3, 2007 as DOI: 10.1124/jpet.106.117556 This article has not been copyedited and formatted. The final version may differ from this version. Downloaded from jpet.aspetjournals.org at ASPET Journals on September 30, 2021 JPET Fast Forward. Published on April 3, 2007 as DOI: 10.1124/jpet.106.117556 This article has not been copyedited and formatted. The final version may differ from this version. Downloaded from jpet.aspetjournals.org at ASPET Journals on September 30, 2021