Non-Invasive Sex Determination and Genotyping of Transgenic Brugia Malayi Larvae

University of South Florida Scholar Commons

Graduate Theses and Dissertations Graduate School

June 2020

Non-invasive Sex Determination and Genotyping of Transgenic Brugia malayi Larvae

Santiago E. Hernandez Bojorge University of South Florida

Follow this and additional works at: https://scholarcommons.usf.edu/etd

Part of the Epidemiology Commons, and the Parasitology Commons

Scholar Commons Citation Hernandez Bojorge, Santiago E., "Non-invasive Sex Determination and Genotyping of Transgenic Brugia malayi Larvae" (2020). Graduate Theses and Dissertations. https://scholarcommons.usf.edu/etd/8217

This Thesis is brought to you for free and open access by the Graduate School at Scholar Commons. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Scholar Commons. For more information, please contact [email protected].

Non-invasive Sex Determination and Genotyping of Transgenic Brugia malayi Larvae

Santiago E. Hernandez Bojorge

A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science in Public Health with a concentration in Global Communicable Diseases College of Public Health University of South Florida

Major Professor: Thomas R. Unnasch, Ph.D. Francis Ntumngia, Ph.D. Sai Lata De, Ph.D.

Date of Approval: August 15th, 2019

Keywords: B. malayi, Y chromosome marker gene, primer development, nested PCR

DEDICATION

I would like to dedicate this work to my other half, Marissa Anne Rickloff and my mother, Ana Rosa Bojorge Valle. I will be forever grateful for the help and encouragement provided by the most important women in my life, who have always given me strength and moral support to pursue my dreams and become a better person.

I would also like to dedicate this study to the professors and colleagues from Universidad

Nacional Autónoma de Nicaragua-Managua (UNAN-Managua) that have always inspired me to follow their spirit of adventure regarding research, scholarship, and teaching. Without their guidance and continuous assistance, this thesis would not have been possible.

ACKNOWLEDGEMENTS

My sincerest regards and appreciation to Thomas R. Unnasch, Ph.D., for the vast knowledge and expertise that facilitated the successful completion of this research. It has been an honor to work under Dr. Unnasch’s tutelage on this project and to participate on this project as an investigator. His unsurpassed knowledge on the molecular basis of parasitic infections and his incomparable discipline has inspired me on an academic and personal level. My deepest gratitude to Hassan K. Hassan for assisting me as a laboratory mentor and for reinforcing the skills that were necessary to complete this research. Without his guidance and patience, this thesis project would not have been possible. I would also like to thank Dr. Canhui Liu for his continuous help, as well as my fellow lab members Kristi Miley and Sean Beeman for their moral support and research advice. Furthermore, I would like to acknowledge my committee members, Francis Ntumngia, Ph.D., and Sai Lata De, Ph.D., for their technical directions and professional support during this project.

TABLE OF CONTENTS

List of Tables ...... ii

List of Figures ...... iii

Abstract ...... v

Chapter One: Introduction ...... 1 Lymphatic filariasis: etiology, life cycle, epidemiology and control strategies ...... 1 Genetic studies of Brugia malayi ...... 5 Objective ...... 8

Chapter Two: Material and Methods ...... 9 B. malayi L3 molting media and BESM cell line culture ...... 9 DNA extraction-QIAGEN DNeasy® Blood & Tissue Kit ...... 10 DNA extraction-Oligo-beads Conjugation Method ...... 11 Primer design ...... 12 PCR and nested PCR assays ...... 13 Agarose gel electrophoresis ...... 18 DNA Purification following PCR ...... 18 Sequencing ...... 19

Chapter Three: Results ...... 20

Chapter Four: Discussion ...... 26

References ...... 30

LIST OF TABLES

Table 1: Procedures for purification of total DNA from insects using the DNeasy® Blood & Tissue kit ...... 11

Table 2: Biotinylated probe used for Oligo-Beads Conjugation Method ...... 12

Table 3: Basic and nested primers for Shp2 and TOY gene of Brugia malayi ...... 13

Table 4: PCR component for genomic DNA amplification of B. malayi (Initial PCR) ...... 16

Table 5: PCR component for genomic DNA amplification of B. malayi (Nested PCR) ...... 16

LIST OF FIGURES

Figure 1: Person with lymphatic filariasis (elephantiasis) of the left leg ...... 2

Figure 2: Distribution of lymphatic filariasis and the status of preventive chemotherapy (PC) in endemic countries. (2016)...... 3

Figure 3: The life cycle of Brugia malayi ...... 4

Figure 4: Incubation of L3 Brugia malayi in vitro ...... 10

Figure 5: B. malayi Y chromosome marker gene sequence showing initial and nested primers ...... 14

Figure 6: B. malayi shp2 gene for microfilarial sheath protein sequence showing initial and nested primers ...... 14

Figure 7: PCR conditions for initial PCR using BR5 and Shp2 primers of B. malayi ...... 17

Figure 8: PCR conditions for nested PCR using NPRx2 and NPSet1 primers of B. malayi ...... 17

Figure 9: Agarose gel electrophoresis of PCR amplification products from the genomic DNA of Brugia malayi using nested primers of microfilarial sheath protein sequence (NPSet1) ...... 22

Figure 10: Agarose gel electrophoresis of PCR amplification products from the genomic DNA of Brugia malayi using nested primers of Y chromosome marker gene (NPRx2) ...... 22

Figure 11: Agarose gel electrophoresis of PCR amplification products from the genomic DNA of B. malayi using nested primers RPS12UTRF1and RPS12UTRR1 ...... 23

Figure 12: Sequencing results of products from genomic DNA of B. malayi using nested primers Shp2-F and Shp2-R for males and females L3 ...... 24

Figure 13: Sequencing results of products from genomic DNA of B. malayi using nested primers 601F5-1 and 826R5-2 for males L3...... 24

iii

Figure 14: Agarose gel electrophoresis of PCR amplification products from genomic DNA of B. malayi using nested primers Shp2-F and Shp2-R for males and females L3 Positive controls ...... 25

Figure 15: Agarose gel electrophoresis of PCR amplification products from genomic DNA of B. malayi using nested primers 601F5-1 and 826R5-2 for males L3 Positive controls ...... 25

ABSTRACT

Lymphatic filariasis is a very painful and disfiguring helminth disease caused by the tissue nematodes Wuchereria bancrofti, Brugia malayi, and Brugia timori. This parasitosis is considered a Neglected Tropical Disease and it is a major public health burden for 72 tropical countries of Africa, Southeast Asia, the Caribbean, and South America. Despite the effectiveness of many control programs, there remains the need to develop new pharmacological agents to treat lymphatic filariasis, as most programs rely on a limited variety of drugs that are expensive, logistically difficult to obtain, and can lead to drug resistance. The Clustered Regularly

Interspaced Short Palindromic Repeats (CRISPR) based technology is currently being used to develop a genetic toolkit and methods for the study of transcriptional and post-transcriptional regulation in all lifecycle stages and tissues of B. malayi. To genotype transgenic parasites, it is necessary to detect the genomic DNA of B. malayi in a non-invasive way, since the invasive sampling of the parasite damages its cuticle resulting in death. This study presents the development of specific nested primers to amplify Y chromosomal DNA from the DNA present in the media of the molting parasites. Knowing the sex of the larvae will allow us to optimize the sex ratio for the backcrossing of transgenic parasites. B. malayi third stage infective L3 were cultured with 1x105 Bovine Embryo Skeletal Muscle (BESM) cells/well and Minimal Essential

Media (MEM) containing 20% fetal bovine serum (FBS). Following the collection of the molting media for day 8, DNA was extracted using the DNeasy® Blood & Tissue Kit and the

DynabeadsTM M-280 Streptavidin method. A single distinct band of approximately 210-220 bp

v was obtained from molting media samples that contained one singe L3 larvae using the NPRx2 and NPSet1 nested primers. A single distinct band of approximately 420 bp was obtained from the same media samples using the RPS12UTRF2 and the RPS12UTRR2 nested primers.

Amplification from both the shp2 and BmRPS12 genes demonstrated that the genomic DNA present in the media of molting parasites can be used to non-invasively genotype individual larvae. Furthermore, the Tag on Y (ToY) assay can then be used to determine the sex of the cultured parasites. This study provides important tools to genotype and to optimize the sex ratio for the backcrossing of transgenic parasites.

CHAPTER ONE:

INTRODUCTION

Lymphatic filariasis: etiology, life cycle, epidemiology and control strategies

Lymphatic filariasis (LF) is a very painful and disfiguring helminth disease caused by the tissue nematodes Wuchereria bancrofti, Brugia malayI, and Brugia timori (Taylor et al., 2010).

The disease is transmitted from human to human by the bite of blood-feeding mosquitoes of different genus including Anopheles, Culex, Aedes, and Mansonia (Centers for Disease Control and Prevention [CDC], 2019). It is also known as elephantiasis since the adult-worms invade the lymphatic vessels of lower extremities causing lymphangiectasia and limb swelling, similar to elephant’s limbs, which may result in temporary or permanent disability (Figure 1).

This parasitosis is considered a Neglected Tropical Disease (NTD) and it is a major public health burden for 72 tropical countries of Africa, Southeast Asia, the Caribbean and South

America, where it imposes severe physical, psychological and socioeconomic issues (Joshi,

2018). It is estimated that 1.4 billion people are currently living in these endemic regions, 120 million are infected with the disease and 40 million present incapacitating clinical manifestations

(Figure 2) (World Health Organization [WHO], n.d.-a). The morbidity burden of LF is 5.09 million disability-adjusted life years (DALYs) and 229,537 DALYs attributable to their caregivers (Ton et al., 2015). This causes an estimated annual loss of one billion dollars per country and impairment of economic activity up to 88% (WHO, n.d.-c). The male worms are about 3-4 centimeters in length and the female worms are 8-10 cm long. Together both adult

1 worms migrate to lymphoid tissue to form “nests” to live and reproduce for many years. Adult females produce fully developed sheathed microfilariae (mf) measuring 309-346.8 µm in length and 18-23 µm in width, in the peripheral blood beginning 6 months to one year after initial infection (Paily et al., 2009). The ovoviviparous females give birth to as many as 50,000 mf per day, which remain in the arterioles of the lungs during the day and come out into the peripheral circulatory system at night. During the night, the mosquito feeds on infected persons, and it also becomes infected. The mf migrates to the proventriculus and cardiac region of the vector’s midgut to invade the thoracic muscles. Once there, the mf develops into first-stage larvae and subsequently into second and third stage larvae.

Figure 1. A person with lymphatic filariasis (elephantiasis) of the left leg. Source: (Pan American Health Organization, 2019).

Figure 2. Distribution of lymphatic filariasis and the status of preventive chemotherapy (PC) in endemic countries. (2016). Source: (World Health Organization, 2020)

The third-stage larvae migrate to the hemocoel of the mosquito’s proboscis and serves as the infective form of the parasite when the mosquito bites an uninfected human (Paily et al.,

2009) (Figure 3). In the year 2000, the WHO launched the Global Program to Eliminate

Lymphatic Filariasis (GPELF). This elimination strategy focuses on interrupting the transmission of the disease and controlling morbidity through delivering mass drug administration (MDA) to the population at risk and implementing morbidity management and disability prevention

(MMDP) (Ichimori et al., 2014). As of 2016, preventive chemotherapy to eliminate the disease was considered a requirement in 53 out of 72 endemic nations (WHO, n.d.-b).

Figure 3. The life cycle of Brugia malayi. Source: (Center for Disease Control and Prevention, 2019)

In 2012, the London Declaration gathered the intention and commitment of pharmaceutical companies, donors, non-government organizations and endemic countries to eliminate ten NTDs from developing nations, including LF (Turner et al., 2014). The Bill & Melinda Gates

Foundation called for the elimination of the disease by 2030 (Gates, 2015), while the United

Nations assembly committed on accelerating the pace of progress made in fighting communicable diseases in developing nations (UN, 2015) (Rebollo & Bockarie, 2017).

4 Genetic studies of Brugia malayi

Despite the effectiveness of many control programs, there remains the need to develop new pharmacological agents to treat lymphatic filariasis, as most programs rely on a limited variety of drugs that are repeatedly administered to patients over a long period of time which are expensive, logistically difficult and can lead to drug resistance (Osei-Atweneboana et al., 2011).

The study of many pathogenic microorganisms has benefitted through the development of reverse genetic technologies (Lok et al., 2017). Unfortunately, filarial nematodes have lagged behind most other parasites in this technology. This is mainly because most filarial nematodes cannot survive outside the human host, therefore their life cycle and parasitic forms cannot be cultured in the laboratory. Because most human filarial nematodes are obligate parasites of man,

B. malayi has become the model of choice to study the other organisms of the suborder

Filarioidea. This tissue nematode can be cultured in animal hosts, most conveniently in

Mongolian jirds or gerbils (Meriones unguiculatus) (Mak et al., 1990). Therefore, it is the reference filarial nematode selected by the WHO-sponsored Filarial Genome Project (Unnasch,

1994). The Filarial Genome Project has advanced continuously in the effort of studying expressed sequence tags (ESTs) from filarial parasites (Williams & Johnston, 1999). However, it has not been possible to carry out conventional genetic studies as it has been extremely difficult to isolate mutants or to carry out genetic crosses.

In the absence of classical genetic studies, reverse methods have been carried out successfully to transfect Caenorhabditis elegans by microinjection of circular DNA directly into the gonad of the hermaphrodite nematode (Stinchcomb et al., 1985). Transient transfection by microinjection and particle bombardment were successfully used to introduce exogenous DNA into C. elegans, and later in B. malayi (Wilm et al., 1999) (Higazi et al., 2002). Transient

5 transfections are limiting for studying parasites with complex life cycles, as the exogenous DNA introduced is not inherited. Mechanical transfection methods can damage the larvae cuticle of B. malayi larval stages, resulting in the death of the parasite when it is re-inoculated into the gerbil.

The co-injection of CaCl2 coprecipitates and third-stage larvae into the peritoneal cavity of uninfected gerbils resulted in developmentally competent parasites, which eventually developed into adult parasites that expressed a secreted luciferase reporter (Xu et al., 2011). Unfortunately, this process was very inefficient (Xu et al., 2011). Additional research revealed that transgenesis in Strongyloides spp. and related nematodes, such as B. malayi, were maintained in extrachromosomal arrays in which gene silencing occurred in subsequent generations (Lok et al., 2017). In order to get stable transgenic parasitic lines, genomic integration is necessary (Lok et al., 2017).

The piggyBac system results in a stable integration of transgeneses into the B. malayi genome (Liu et al., 2018). Nevertheless, the piggyBac system presents a semi-random nature of the insertion point that can result in position effects which can be difficult to control. Therefore, the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) based technology has generally supplanted the piggyBac system. CRISPR permits precise targeting of sequences in the genome (Zamanian & Andersen, 2016).

At Dr. Thomas Unnasch’s laboratory (Interdisciplinary Research Building, University of

South Florida) this cutting-edge technology is being used to develop a genetic toolkit and methods for the study of transcriptional and post-transcriptional regulation in all lifecycle stages and tissues of B. malayi. Once the CRISPR-CAS9 targeted gene editing system for B. malayi is developed, it is imperative to create methods for genotyping, isolation of isogenic lines, and cryopreservation of transgenic parasites.

6 To genotype transgenic parasites, it is necessary to detect the genomic DNA of B. malayi in a non-invasive way, since the invasive sampling of the parasite damages its cuticle resulting in its death. To isolate homozygous transgenic parasite lines, it is necessary to develop methods to efficiently produce fecund female parasites from the smallest number of infective larvae possible. The typical yield of adults from an injection of L3 parasite into the peritoneal cavity of the jird is 30%, with the male-to-female ratio of adult worms being 1:1. Therefore, it is imperative to determine the sex of larval stages of B. malayi in vitro (from molting media) before inoculating them into the gerbil’s peritoneum.

Many studies have sequenced B. malayi genes related to its larval sheath coverage or its

Y chromosome marker. Hirzmann et. al described a sequence for the microfilarial sheath protein gene (shp2) (Hirzmann et al., 1995). This technique would not differentiate between male larvae and female larvae since both sexes are sheathed. Male larvae can be identified using specific primers to amplify the tag on Y chromosome marker (Underwood & Bianco, 1999). A nested

PCR would increase the sensitivity and specificity of the conventional PCR. This assay involves the use of two primer sets and two successive PCR reactions. The first set of primers are annealed to sequences upstream containing the target of interest with extended flanking regions.

The product of this first reaction is used as a template for a secondary reaction using the second set of nested primers. This second set of primers (nested primers) corresponds to the specific region of DNA to be amplified (Wanger et al., 2017).

7 Objective

This study aims to develop an assay to determine the sex of the L4 (fourth stage larvae).

We will develop specific nested primers to amplify Y chromosomal DNA from the DNA present in the media of the molting parasites. In developing this assay, we will target a 2.3kb B. malayi

Y specific sequence that has been previously isolated by random PCR amplification.

Additionally, female larvae will be detected using nested primers of the B. malayi shp2 gene for microfilarial sheath protein. The specificity of the primers will be validated on isolated adult males and unfertilized immature females. Knowing the sex of the larvae will allow us to optimize the sex ratio for the backcrossing of transgenic parasites. By amplifying across a

CRISPR site, it will be possible to genotype individual parasites, allowing one to differentiate parasites that are heterozygous or homozygous for the CRISPR mutation. This procedure would help in the production of homozygous transgenic parasite lines in a single generation.

CHAPTER TWO:

MATERIALS AND METHODS

B. malayi L3 molting media and BESM cell line culture

In a piggyBac-mediated integrative transfection study, Liu et al. (2018) described the technical procedures used in these experiments:

“B. malayi third stage infective L3 were obtained from the Filarial Research Reagent

Resource Center (FR3), College of Veterinary Medicine at the University of Georgia

(Athens, GA. USA). Prior to the arrival of the L3, individual wells of a 96-well tissue

culture plate were seeded with 1x105 Bovine Embryo Skeletal Muscle (BESM) cells/well

(Figure 3-A). The cells were cultured for one to two days in Minimal Essential Media

(MEM) containing 20% fetal bovine serum (FBS) until they reached 70-90% confluency.

Upon receipt, the L3 were washed five times with a solution consisting of RPMI 1640

medium containing 0.1x Antibiotic Antimycotic solution (Gibco) 10 μg/ml gentamycin

and 2 μg/ml Ciprofloxacin. The L3 (100 maximum) were then dispersed in 10 ml of

RPMI 1640 media containing 25 mM HEPES, 20% fetal calf serum, 20 mM glucose, 24

mM sodium bicarbonate, 2.5 μg/ml amphotericin B, 100 U/ml penicillin, 100 U/ml

streptomycin, 40 μg/ml gentamicin, 2 μg/ml Ciprofloxin and 2 μg/ml Fortaz (CF-RPMI)

(Figure 3-B). The L3 were allowed to settle and all but 8 ml of media removed. The

media on the feeder cells was replaced with CF-RPMI and transwells (Costar, 3.0 um

pore size) were placed in the wells. The dispersed L3 were then aliquoted among the

9 transwells so that each transwell contained 1-4 L3. Additional CF-RPMI was added to the

transwell to bring the total volume in the transwell to 200 μl. The L3 were then cultured

at 37°C under 5% CO2. The feeder cell medium was changed for freshly prepared media,

which was added to the transwells daily for eight days. On day 5, molting of the L3 was

induced by the inclusion of ascorbic acid to a final concentration of 75 μM to the feeder

cell medium. The L3 were incubated for a total of eight days. The media collected daily

from day 1 to day 8 was stored at -20°C for future extraction” (Pg. 5).

A B

Figure 4: Incubation of L3 Brugia malayi in vitro. *A. 96-well plate with BESM cells, B. malayi L3, and molting media. B. Microphotograph of a well that shows multiple B. malayi L3

DNA extraction-QIAGEN DNeasy® Blood & Tissue Kit

Following the collection of the molting media DNA was extracted hrough the QIAGEN supplementary protocol for purification of total DNA from insects (DNeasy® Blood & Tissue

Kit) and using modified manufacturer’s conditions (Table 1). This kit was chosen on its ability to extract DNA from the small volume of molting media. For negative controls, PBS was used

10 instead of molting media at the beginning of the procedure. The positive control DNA was obtained from adult B. malayi. DNA samples were kept frozen at -20°C until use.

Table 1: Procedures for purification of total DNA from molting media using the DNeasy® Blood & Tissue kit

No. Procedure 1 Add 150 μl of Brugia malayi molting media in a 1.5 ml tube. 2 Add 180 μl Buffer ATL.

3 Add 20 μl proteinase K. Mix thoroughly by vortexing and incubate at 56°C until the cells are completely lysed. Vortex occasionally during incubation to disperse the sample, or place in a thermomixer, shaking water bath, or on a rocking platform. 4 Vortex for 15 s. Add 200 μl Buffer AL to the sample and mix thoroughly by vortexing. Then add 200 μl ethanol (96–100%) and mix again thoroughly by vortexing. 5 Pipet the mixture from step 4 (including any precipitate) into the DNeasy Mini spin column placed in a 2 ml collection tube (provided). Centrifuge at ≥6000 x g (8000 rpm) for 1 min. Discard flow-through and collection tube. 6 Place the DNeasy Mini spin column in a new 2 ml collection tube (provided), add 500 μl Buffer AW1, and centrifuge for 1 min at ≥6000 x g (8000 rpm). Discard flow- through and collection tube. 7 Place the DNeasy Mini spin column in a new 2 ml collection tube (provided), add 500 μl Buffer AW2, and centrifuge for 3 min at 20,000 x g (14,000 rpm) to dry the DNeasy membrane. Discard flow-through and collection tube. 8 Place the DNeasy Mini spin column in a clean 1.5 ml or 2 ml microcentrifuge tube (not provided), and pipet 50 μl Buffer AE directly onto the DNeasy membrane. Incubate at room temperature for 1 min, and then centrifuge for 1 min at ≥6000 x g (8000 rpm) to elute the DNA

DNA extraction-Oligo-beads Conjugation Method

Indirect capture was done using DynabeadsTM M-280 Streptavidin. In this method, the biotinylated molecules (probe) were mixed with the L3 molting media to capture the molecule target complex before adding the beads. 20 µl of proteinase K was mixed with 150 µl of L3 molting media for 2 hours (56°C). The mixture was incubated at 90°C for 30 minutes to inactivate the proteinase K. 5 µl of 1M Tris-HCl (pH 7.5), 2.5 µl of 4M NaCl and 5 µl of 0.5 µM probe was added to the media (Table 2). The L3 molting media mixed with the buffer solutions

11 and the probe was incubated at 95°C for 3 minutes and allowed to cool to room temperature over

1.5 hours. A total of 15 µl of beads was used per each L3 molting media sample. The coated beads were washed 5 times in washing buffer (10 mM Tris-HCl [pH 7.5], 1 mM EDTA, and 2 M

NaCl). The tube was placed in a magnetic separator for 2 minutes, to discard the supernatant between each wash. 10 µl of washed magnetic beads were added to each sample and the mixture was placed on a rotator overnight to mix thoroughly at room temperature. The coated beads were washed 5 times in washing buffer. The DNA sample attached to the coated beads were used for

PCR.

Table 2. Biotinylated probe used for Oligo-Beads Conjugation Method

Seq Name Seq 5’ to 3’ Length GC Tm

Probe [Biotin~5]AGCGAAAAGTGTAGAACCG 19 47.4 58

B.malayi.1

Primer design

Four PCR primers were designed from the Brugia malayi Y chromosome marker (TOY) gene (GenBank Accession No: AF067253.1) to detect male L3 (Figure 4). Two nested PCR primers were designed from the B. malayi shp2 gene for microfilarial sheath protein (GenBank

Accession No: Z35444.1) to detect both male and female L3 DNA in molting media (Figure 5).

The sequences were designed using Integrated DNA Technology Inc. (Coralville, IA) and

MacVector Inc. (Apex, NC). The primer selection was based on general primer design criteria

(Tm=55°C—65°C, guanine-cytosine content between 40-60% with the 3ˈ ending in cytosine or guanine to promote binding). The primer concentration for the initial PCR and nested PCR were determined empirically. The basic primers for TOY and Shp2 produced a product of more than

12 500 base pairs (bp) while the nested primers for both genes amplified a product of less than 300 bp. (Table 3). Additionally, an external nested primer set designed from the BmRPS12

(ribosomal small subunit 12 KDa protein gene) was used to confirm the presence of B. malayi

DNA in the molting media. Primer concentrations for each primer set were optimized by checkerboard titration. Briefly, 20, 50- and 100-mM concentrations of each -5′primer were tested with 20, 50- and 100-mM concentrations of the corresponding -3′primer. This optimization step identified primer concentrations that provided the highest sensitivity and specificity for each target sequence.

Table 3: Basic and nested primers for Shp2 and TOY gene of Brugia malayi

Primer Seq Seq 5’ to 3’ Start Stop Length GC Tm Product

Name Name Size

BR5 BR5-F GGAAGGATGAAGTACCCACAAA 560 582 22 45.5 60.8 559

BR5-R CTAATCGACCGGCAACAATTTAC 1096 1119 23 43.5 61

NPRx2 601F5-1 CCTAATTCCATGTACAATGCCG 601 623 22 45.5 60.8 226

826R5- CGCTAGTTTTCCATAGCAACAG 805 827 22 45.5 60.8

Shp2 Shp2-F AAAGGAAAGATGTGGGTT 837 855 18 38.9 53.1 501

Shp2-R CTGCGGATATTTTGAAGC 1320 1338 18 44.4 55.3

NPSet1 Forward CACCAATGATTCCGCCATT 859 878 20 45 58.4 206

Reverse TGGACACCACCAAAGAGAT 1046 1065 20 45 58.4

PCR and nested PCR assays

The reactions were carried out using Bio-Rad My Cycler Thermal Cycler. Initial PCR were performed in 25 µl total volume containing 0.625 µl of each primer (20 nM

Position Symbol Primer Position Symbol Primer 560-582 Forward initial 805-827 Reverse Nested

Primer Primer 601-623 Forward Nested 1096-1119 Reverse Initial Primer Figure 5: Brugia malayi Y chromosome marker gene (ToY) sequence showing initial and nested primers

Position Symbol Primer Position Symbol Primer 837-855 Forward Initial 1046-1065 Reverse Nested

Primer Primer 859-878 Forward Nested 1320-1338 Reverse Initial Primer Figure 6: Brugia malayi shp2 gene for microfilarial sheath protein sequence showing initial and nested primers

14 concentration), 0.5 of enzyme (Invitrogen, Thermo Fisher Scientific, MA), 2.5 µl of 10X PCR buffer, 2.5 µl of 2 µM dNTPs and 15.75 µl of PCR water.

Cycling conditions consisted of an initial 3 min hold at 94°C, followed by 40 cycles of 1 min at 94°C, 1 min at 58°C and 90 sec at 72°C. Following cycling, a final hold at 4°C was performed (Figure 6). A 1:10 dilution of the initial PCR reaction was used as a template sample for the nested PCR reaction. Nested PCR was performed in 25 µl final volume containing 0.625

µl of each primer (20 nM concentration), 0.5 of enzyme (Invitrogen, Thermo Fisher Scientific,

MA), 2.5 µl of 10X reaction buffer, 2.5 µl of 2 mM dNTPs and 1 µl of the DNA extraction product (Table 5). The thermocycler profile was set to allow for an initial 3 min hold at 94°C, followed by 30 cycles of 1 min at 94°C, 1 min at 60°C and 90 sec at 72°C. Following cycling, a final hold at 4°C was performed (Figure 7). Each PCR run included the following controls: DNA elution buffer (negative control) and DNA from adult B. malayi known females and males

(positive control). The nested PCR for the BmRPS12 primers was performed using Thermo

Maxima Hot Start PCR master mix (cat K1051). 12.5 µl master buffer, 5 µl of the DNA extraction, 0.5 µl of 10 nM of RPS12-UTRF1 (GACTATTGTTTGTTTATTGTTTGTATTGA),

0.5 µl of 10 nM RPS12UTRR1 (GCCCA-AGCAATTTCGAATGA) and 6.5ul of water was used for the initial reaction. The cycling conditions are as follows: 1 Cycle 94°C (4 min). 30 cycles

94°C (30 seconds), 55°C (30 seconds), 72°C (1 min). A 1:20 dilution of the initial PCR reaction was used as a template sample for the second nested PCR reaction. 12.5 µl master buffer, 1 µl of the initial PCR product dilution, 0.5 µl of 10 nM of RPS12UTRF2 (GTGTTTGT-

TACGCATGCAAGA), 0.5 µl of 10 nM RPS12UTRR2 (CGGCTCCATACGAAACTTCT) and

10.5 µl of water was used for the nested reaction. The cycling conditions for the nested reaction was identical to the initial PCR reaction.

15 Table 4: PCR component for genomic DNA amplification of B. malayi (Initial PCR)

Component 22.5 µl reaction + 2.5 µl DNA

PCR water 15.75

10X PCR Buffer 2.5

2mM dNTPs 2.5

20 µM Forward primer 0.625

20 µM Reverse primer 0.625

Taq DNA polymerase (5 U/μL) 0.5

Total 22.5

Table 5: PCR component for genomic DNA amplification of B. malayi (Nested PCR)

Component 24 µl reaction + 1 µl DNA

PCR water 17.25

10X PCR Buffer 2.5

2mM dNTPs 2.5

20 µM Forward primer 0.625

20 µM Reverse primer 0.625

Taq DNA polymerase (5 U/μL) 0.5

Total 24

Figure 7: PCR conditions for initial PCR using BR5 and Shp2 primers of Brugia malayi

Figure 8: PCR conditions for nested PCR using NPRx2 and NPSet1 primers of Brugia malayi

17 Agarose gel electrophoresis

PCR products were separated by electrophoresis through 1.5% agarose gels prepared in 1×TAE buffer and stained with ethidium bromide. Eight microliters of each PCR product was mixed with two microliters 6×loading dye and loaded onto the gel. Six microliters of 100 bp ladder was added to the first lane of each gel and run for 60 min at a current of 120 volts and 400 mA. DNA bands were visualized by amplicons (successful PCR reactions that yielded single bands on the gel) under UV transluminator (Enduro GDS, Labnet International,

Inc.) (Figure 8-9). Samples showing DNA bands at the expected size of 200-230 bp were considered as positive. The BmRPS12 gene was recognized through bands between 400-450 bp.

DNA Purification following PCR

The amplified product was purified using the QIAquick® PCR Purification Kit according to manufacturer’s protocol. Briefly, 5 volumes of PB buffer was added to 1 volume of PCR product and mixed (30 µl of PCR product and 150 µl of PB buffer). The mixture was added to a

QIAquick column placed in a 2 ml collection tube. To bind DNA the sample was centrifuged tor

60 seconds. The flow-through was discarded and the QIAquick column was placed in a new collection tube. 0.75 ml of PE buffer was added to the QIAquick column and centrifuged for 60 seconds. The flow-through was discarded and the QIAquick column was placed in a new collection tube. The QIAquick column was centrifuged again for 3 minutes to remove residual buffer. To elute the DNA, 30 µl of DNase free water was added to the center of the QIAquick membrane. The column was let stand for 1 minute and then centrifuged for 3 minutes at 15,000 rpm.

18 Sequencing

The purified PCR products were sequenced using Eurofins sequencing services

(Eurofins-LLC). All amplified products were sequenced from both directions using the NPRx2 and NPSet1 nested primers.

CHAPTER THREE:

RESULTS

In previous work, it was shown that L3 can be induced to molt by the addition of ascorbic acid to the culture medium (Xu et al., 2011). The co-culture of BESM cells and L3 larvae has been shown to enhance the molting and continued development of Onchocerca volvulus L4, resulting in the development of healthy adult worms (Lustigman S, Tricoche N, Kolesnichenko

O, Sakanari JA & Suderman MT, 2015). We hypothesized that molting B. malayi L3 might shed

DNA into the medium and that this DNA could be used to genotype the parasites.

As the first test of this hypothesis, individual L3 were co-cultured in the presence of

BESM cells to enhance the molting activity of the larvae. The L3 were induced to molt to the L4 stage on day 5 through the addition of ascorbic acid, and the media was collected daily from days

1-9. DNA was extracted from the aliquots and assayed for the presence of B. malayi DNA by nested PCR targeting the B. malayi Y chromosome marker gene and the B. malayi shp2 gene for microfilarial sheath protein. The L3-L4 molting process was expected to be complete by day 8, therefore the molting media from day 8 was used for the experiment. The DNA concentration and purity was determined by Microvolume Spectrophotometry (MVS) of the molting media taken from the 96-well tissue culture plate. The average concentration for the media samples was

7.14 ng/µl and the average 260/280 reading was 1.73. A single distinct band of approximately

210-220 bp was obtained from molting media samples that contained one singe L3 larvae during the incubation period. Six bands were detected for the Sph2/BmRPS12 genes (B4-8, B10-8, F5-

20 8, F7-8, D4-8, and F3-8) and other six for the TOY gene (B4-8, B10-8, F7-8, F3-8, B68, and F2-

8) (Figure 8-10). The DNA sequence of the nested PCR product was determined (Figure 10-11).

Controls for this experiment included known male and female L4 specific DNA, which were also assayed for the presence of B. malayi DNA by nested PCR targeting the B. malayi Y chromosome marker gene and the B. malayi shp2 gene for microfilarial sheath protein (Figure

12-13). The ribosomal small subunit 12 KDa protein gene (BmRPS12) was also recognized in the molting media samples that contained one singe L3 larvae during the incubation period. An initial and a nested PCR reaction was carried out using the RPS12UTRF2 and the RPS12UTRR2 nested primers to confirm the presence of B. malayi DNA in the molting media. A single distinct band of approximately 420 bp was obtained from the media samples that contained one singe L3 larvae during the incubation period (Figure 10).

The amplified products were sequenced and compared with the target genes. The products amplified by the BR5-F, BR5-R, 601F5-1, and 826R5-2 primers resulted in a product with 98% resemblance to Brugia malayi Y chromosome marker, while the products amplified by the Shp2-F, Shp2-R and NPSet1 (Forward and Reverse) primers resulted in a product with 97% resemblance to Brugia malayi microfilarial sheath protein gene (Figure 10-11).

21 Ladder B4-8 B10-8 F5-8 F7-8 D4-8 B8-8 F3-8 B3-8 B6-8 B2-8 D2-8 F2-8 +CFe +Cma -Control Blank + C l

Figure 9. Agarose gel electrophoresis of PCR amplification products from genomic DNA of B. malayi using nested primers NPSet1 forward and NPSet1 reverse for males and females L3 *100 bp DNA Ladder (15628019). B4-8: DNA present in molting media placed in B4 of day 8. +CFe: Positive control of female worms. +Cma: Positive control of male worms. – Control. Blank: Negative control without DNA

Ladder B4-8 B10-8 F5-8 F7-8 D4-8 B8-8 F3-8 B3-8 B6-8 B2-8 D2-8 F2-8 +CFe +Cma -Control Blank k l

Figure 10. Agarose gel electrophoresis of PCR amplification products from genomic DNA of B. malayi using nested primers 601F5-1 and 826R5-2 for males L3 *100 bp DNA Ladder (15628019). B4-8: DNA present in molting media placed in B4 of day 8. +CFe: Positive control of female worms. +Cma: Positive control of male worms. – Control. Blank: Negative control without DNA

22 Ladder B4-8 B10-8 F5-8 F7-8 D4-8 B8-8 F3-8 B3-8 B6-8 B2-8 D2-8 F2-8 +CFe +Cma -Control Blank + C l

Figure 11. Agarose gel electrophoresis of PCR amplification products from genomic DNA of B. malayi using nested primers RPS12UTRF2 and RPS12UTRR2 *100 bp DNA Ladder (15628019). B4-8: DNA present in molting media placed in B4 of day 8. +CFe: Positive control of female worms. +Cma: Positive control of male worms. – Control. Blank: Negative control without DNA

Figure 12. Sequencing results of products from genomic DNA of B. malayi using nested primers NPSet1 forward and NPSet1 for males and females L3

Figure 13. Sequencing results of products from genomic DNA of B. malayi using nested primers 601F5-1 and 826R5-2 for males L3

24 100 bp Ladder + control female 1 + control female 2 + control female 3 + control male 1 + control male 2 + control male 3 Negative control Blank

Figure 14. Agarose gel electrophoresis of PCR amplification products from positive controls of genomic DNA of B. malayi using nested primers Shp2-F and Shp2-R

100 bp Ladder + control female 1 + control female 2 + control female 3 + control male 1 + control male 2 + control male 3 Negative control Blank

Figure 15. Agarose gel electrophoresis of PCR amplification products from positive controls of genomic DNA of B. malayi using nested primers BR5-F and BR5-R

CHAPTER FOUR:

DISCUSSION

Recent advances in stable transfection of B. malayi have motivated leading researchers in this field to explore the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) based technology to produce an efficient production of stably transfected parasite lines. As the first test to this project, a CRISPR-CAS9 targeted gene editing system for B. malayi was developed by producing CRISPR targeted knock-in and knock out mutations. The second specific aim validated the constructs for the study of gene regulation and protein localization.

These studies confirmed that the pattern of gene expression from the reporter construct is appropriate and that gene silencing or ectopic expression will not interfere with their intended use. The third aim for this research initiative was to develop methods for genotyping, isolation of isogenic lines, and cryopreservation of transgenic parasites. An important part of this research aim was to develop specific primers to amplify Y chromosomal DNA from the DNA present in the media of molting parasites and to determine the sex of individual L4. To accomplish this aim we co-cultured B. malayi L3 with molting media and Bovine Embryo Skeletal Muscle (BESM) as the base for subsequent experiments.

The co-culture of BESM cells and L3 larvae has been shown to enhance the molting of

Onchocerca volvulus, resulting in the development of L4 larvae (Lustigman S, Tricoche N,

Kolesnichenko O, Sakanari JA & Suderman MT, 2015). Liu et al. also co-culture B. malayi L3

26 with BESM cells which resulted in parasites that were developmentally competent as fresh L3 when introduced into naïve vertebrate hosts (Liu et al., 2018).

In previous studies, the co-culturing of B. malayi L3/BESM cells and the molting induction with ascorbic acid resulted in an effective technique for the development of the larval stages of the parasite (Liu et al., 2018). Rajan T.V et al demonstrated that B. malayi depends on an exogenous source of vitamin C to complete the L3 to L4 molt and therefore this nutrient serves as an efficient additive to support the L3-L4 molt in culture medium (Rajan et al., 2003).

Vitamin C is critical for the regulation of enzymes required to hydroxylate amino acids (lysines and prolines), which are necessary for the formation of collagen and the external cuticle of B. malayi larvae. Therefore, it is possible that B. malayi and similar filarial nematodes present a peculiar tropism for lymphatic vessels due to the high concentration of ascorbate present in leukocytes and neutrophils (Jacob, 1996).

The DNA present in the molting media (day 8) was successfully extracted using the

QIAGEN supplementary protocol for purification of total DNA from insects (DNeasy® Blood &

Tissue Kit). The conventional indirect capture using DynabeadsTM M-280 Streptavidin was not effective as described in the protocol. To capture DNA by this method we had to modify it by ruling out the elution with PCR water and using the magnetic beads attached to the larval DNA directly as a sample for the PCR procedure. This extraction method has proven to be efficient for the capture of Onchocerca volvulus DNA In PCR pool screenings for Simulium spp. vectors

(Gopal et al., 2012). It is possible that the low concentration of L3 cells in the molting media was lost during the elution process of previous experiments. Both methods, the QIAGEN (DNeasy®

Blood & Tissue Kit) and the indirect capture using DynabeadsTM M-280 Streptavidin, showed

27 poor results after two months of molting media storage. This is probably due to the degradation of DNA amino acids after long storage time.

The Tag On Y gene (TOY) derives from Y chromosome DNA and is inherited by the paternal line of B. malayi (Underwood & Bianco, 1999). Because of its association with the Y chromosome, we used the TOY to create six pairs of BR primers and its nested primer reaction

(NPR). Six of these were initially selected for the experiments. Guanine-Cytosine (GC) content of 45.5 and melting temperatures (Tm) from 54-60 resulted in single distinct bands in the agarose gel. The Sph2 gene of B. malayi encoding the microfilarial sheath protein described by Hirzmann et al. (Hirzmann et al., 1995) provided an excellent model to detect secreted genomic DNA from both male and female L3. This gene is well known to encode a protein that is exported as a monomer and is polymerized in situ in the microfilarial sheath (Conraths et al., 1997).

Experiments from this study detected both sexes effectively through the derived nested primers

NPSet1 forward and NPSet1 reverse (Table 3). Since worms of B. malayi are ovoviviparous, both male and female first-stage larvae are enclosed by a bag-like structure or a characteristic sheath that covers their bodies (Schraermeyer et al., 1987). This sheath originated from the primary eggshell by changes in the surface structure and composition during the intrauterine development of the embryo (Zaman, 1987).

The amplification products obtained through the nested primers 601F5-1 and 826R5-2 for males L3 resulted in an effective way to detect male L3. The amplification of the genomic DNA of B. malayi in molting media using the nested primers RPS12UTRF2 and RPS12UTRR2 resulted in the amplification of the same samples amplified by Shp2 nested primers. These results indicate that many target genes that can be amplified from the DNA present in the media

28 of molting parasites, making it likely that this method can be applied to genotype CRISPR modified parasites.

In conclusion, amplification from both the shp2 and RPS12 genes demonstrated that the genomic DNA present in the media of molting parasites can be used to non-invasively genotype individual larvae. Furthermore, the ToY assay can then be used to determine the sex of the cultured parasites. Therefore, this study provides important tools to genotype and to optimize the sex ratio for the backcrossing of transgenic parasites. These results can lead to the differentiation of homozygous and heterozygous parasites for the CRISPR mutation and the production of homozygous transgenic parasite lines in a single generation. The reported results can be used to efficiently produce integrated transgenic filarial parasite lines, allowing genetic technologies to be applied to all life cycle stages of Brugia malayi.

REFERENCES

Conraths, F. J., Hirzmann, J., Hobom, G., & Zahner, H. (1997). Expression of the Microfilarial

Sheath Protein 2 (shp2) of the Filarial ParasitesLitomosoides sigmodontisandBrugia

malayi. Experimental Parasitology, 85(3), 241–248.

https://doi.org/10.1006/expr.1996.4138

Gates, B. (2015). A big bet for 2030. Gatesnotes.Com. https://www.gatesnotes.com/2015-

Annual-Letter

Gopal, H., Hassan, H. K., Rodríguez-Pérez, M. A., Toé, L. D., Lustigman, S., & Unnasch, T. R.

(2012). Oligonucleotide Based Magnetic Bead Capture of Onchocerca volvulus DNA for

PCR Pool Screening of Vector Black Flies. PLOS Neglected Tropical Diseases, 6(6),

e1712. https://doi.org/10.1371/journal.pntd.0001712

Higazi, T. B., Merriweather, A., Shu, L., Davis, R., & Unnasch, T. R. (2002). Brugia malayi:

Transient transfection by microinjection and particle bombardment. Experimental

Parasitology, 100(2), 95–102. https://doi.org/10.1016/S0014-4894(02)00004-8

Hirzmann, J., Schnaufer, A., Hintz, M., Conraths, F., Stirm, S., Zahner, H., & Hobom, G. (1995).

Brugia spp. and Litomosoides carinii: Identification of a covalently cross-linked

microfilarial sheath matrix protein (shp2). Molecular and Biochemical Parasitology,

70(1–2), 95–106. https://doi.org/10.1016/0166-6851(95)00011-o

Ichimori, K., King, J. D., Engels, D., Yajima, A., Mikhailov, A., Lammie, P., & Ottesen, E. A.

(2014). Global Programme to Eliminate Lymphatic Filariasis: The Processes Underlying

30 Programme Success. PLoS Neglected Tropical Diseases, 8(12).

https://doi.org/10.1371/journal.pntd.0003328

Jacob, R. A. (1996). Three eras of vitamin C discovery. Sub-Cellular Biochemistry, 25, 1–16.

Joshi, P. L. (2018). Epidemiology of Lymphatic Filariasis. In B. K. Tyagi (Ed.), Lymphatic

Filariasis: Epidemiology, Treatment and Prevention—The Indian Perspective (pp. 1–14).

Springer. https://doi.org/10.1007/978-981-13-1391-2_1

Liu, C., Mhashilkar, A. S., Chabanon, J., Xu, S., Lustigman, S., Adams, J. H., & Unnasch, T. R.

(2018). Development of a toolkit for piggyBac-mediated integrative transfection of the

human filarial parasite Brugia malayi. PLoS Neglected Tropical Diseases, 12(5),

e0006509. https://doi.org/10.1371/journal.pntd.0006509

Lok, J. B., Shao, H., Massey, H. C., & Li, X. (2017). Transgenesis in Strongyloides and related

parasitic nematodes: Historical perspectives, current functional genomic applications and

progress towards gene disruption and editing. Parasitology, 144(3), 327–342.

https://doi.org/10.1017/S0031182016000391

Mak, J. W., Choong, M. F., Lam, P. L., & Suresh, K. (1990). Experimental infection of the leaf-

monkeys, Presbytis cristata and Presbytis melalophos with subperiodic Brugia malayi.

Acta Tropica, 47(4), 223–226.

Osei-Atweneboana, M. Y., Awadzi, K., Attah, S. K., Boakye, D. A., Gyapong, J. O., & Prichard,

R. K. (2011). Phenotypic evidence of emerging ivermectin resistance in Onchocerca

volvulus. PLoS Neglected Tropical Diseases, 5(3), e998.

https://doi.org/10.1371/journal.pntd.0000998

31 Paily, K. P., Hoti, S. L., & Das, P. K. (2009). A review of the complexity of biology of

lymphatic filarial parasites. Journal of Parasitic Diseases: Official Organ of the Indian

Society for Parasitology, 33(1–2), 3–12. https://doi.org/10.1007/s12639-009-0005-4

Center for Disease Control and Prevention (2019, April 18). CDC - Lymphatic Filariasis—

General Information—Vectors of Lypmhatic Filaraisis.

https://www.cdc.gov/parasites/lymphaticfilariasis/gen_info/vectors.html

Rajan, T. V., Paciorkowski, N., Kalajzic, I., & McGuiness, C. (2003). Ascorbic acid is a

requirement for the morphogenesis of the human filarial parasite Brugia malayi. The

Journal of Parasitology, 89(4), 868–870. https://doi.org/10.1645/GE-3137RN

Rebollo, M. P., & Bockarie, M. J. (2017). Can Lymphatic Filariasis Be Eliminated by 2020?

Trends in Parasitology, 33(2), 83–92. https://doi.org/10.1016/j.pt.2016.09.009

Schraermeyer, U., Peters, W., & Zahner, H. (1987). Formation by the uterus of a peripheral layer

of the sheath in microfilariae of Litomosoides carinii and Brugia malayi. Parasitology

Research, 73(6), 557–564. https://doi.org/10.1007/bf00535333

Stinchcomb, D. T., Shaw, J. E., Carr, S. H., & Hirsh, D. (1985). Extrachromosomal DNA

transformation of Caenorhabditis elegans. Molecular and Cellular Biology, 5(12), 3484.

https://doi.org/10.1128/MCB.5.12.3484

Taylor, M. J., Hoerauf, A., & Bockarie, M. (2010). Lymphatic filariasis and onchocerciasis.

Lancet (London, England), 376(9747), 1175–1185. https://doi.org/10.1016/S0140-

6736(10)60586-7

Ton, T. G. N., Mackenzie, C., & Molyneux, D. H. (2015). The burden of mental health in

lymphatic filariasis. Infectious Diseases of Poverty, 4, 34. https://doi.org/10.1186/s40249-

015-0068-7

32 Turner, H. C., Walker, M., Churcher, T. S., Osei-Atweneboana, M. Y., Biritwum, N.-K.,

Hopkins, A., Prichard, R. K., & Basáñez, M.-G. (2014). Reaching the London

Declaration on Neglected Tropical Diseases Goals for Onchocerciasis: An Economic

Evaluation of Increasing the Frequency of Ivermectin Treatment in Africa. Clinical

Infectious Diseases, 59(7), 923–932. https://doi.org/10.1093/cid/ciu467

United Nations. (2015). Transforming our World: The 2030 Agenda for Sustainable

Development. /resources/transforming-our-world-2030-agenda-sustainable-development

Underwood, A. P., & Bianco, A. E. (1999). Identification of a molecular marker for the Y

chromosome of Brugia malayi. Molecular and Biochemical Parasitology, 99(1), 1–10.

https://doi.org/10.1016/s0166-6851(98)00180-7

Unnasch, T. R. (1994). The filarial genome project. Parasitology Today, 10(11), 415–416.

https://doi.org/10.1016/0169-4758(94)90168-6

Wanger, A., Chavez, V., Huang, R. S. P., Wahed, A., Actor, J. K., & Dasgupta, A. (2017).

Chapter 12—Overview of Molecular Diagnostics Principles. In A. Wanger, V. Chavez,

R. S. P. Huang, A. Wahed, J. K. Actor, & A. Dasgupta (Eds.), Microbiology and

Molecular Diagnosis in Pathology (pp. 233–257). Elsevier. https://doi.org/10.1016/B978-

0-12-805351-5.00012-0

World Health Organization- Global programme to eliminate lymphatic filariasis: Progress

report, 2014. (n.d.-a). WHO. Retrieved December 21, 2019, from

http://www.who.int/lymphatic_filariasis/resources/who_wer9038/en/

World Health Organization- Global programme to eliminate lymphatic filariasis: Progress

report, 2016. (n.d.-b). WHO. Retrieved December 23, 2019, from

http://www.who.int/lymphatic_filariasis/resources/who_wer9240/en/

33 World Health Organization- What is lymphatic filariasis. (n.d.). WHO. Retrieved December 21,

2019, from http://www.who.int/lymphatic_filariasis/disease/en/

Williams, S. A., & Johnston, D. A. (1999). Helminth genome analysis: The current status of the

filarial and schistosome genome projects. Filarial Genome Project. Schistosome Genome

Project. Parasitology, 118 Suppl, S19-38. https://doi.org/10.1017/s0031182099004473

Wilm, T., Demel, P., Koop, H.-U., Schnabel, H., & Schnabel, R. (1999). Ballistic transformation

of Caenorhabditis elegans. Gene, 229(1), 31–35. https://doi.org/10.1016/S0378-

1119(99)00043-8

Xu, S., Liu, C., Tzertzinis, G., Ghedin, E., Evans, C. C., Kaplan, R., & Unnasch, T. R. (2011). In

vivo transfection of developmentally competent Brugia malayi infective larvae.

International Journal for Parasitology, 41(3–4), 355–362.

https://doi.org/10.1016/j.ijpara.2010.10.005

Zaman, V. (1987). Ultrastructure of Brugia malayi egg shell and its comparison with

microfilarial sheath. Parasitology Research, 73(3), 281–283.

https://doi.org/10.1007/bf00578518

Zamanian, M., & Andersen, E. C. (2016). Prospects and challenges of CRISPR/Cas genome

editing for the study and control of neglected vector-borne nematode diseases. The FEBS

Journal, 283(17), 3204–3221. https://doi.org/10.1111/febs.13781