Phenotypic and Molecular Analysis of Desensitization to Levamisole in Male and Female Adult Brugia Malayi

Iowa State University Capstones, Theses and Graduate Theses and Dissertations Dissertations

2019

Phenotypic and molecular analysis of desensitization to levamisole in male and female adult Brugia malayi

Mengisteab T. Wolday Iowa State University

Follow this and additional works at: https://lib.dr.iastate.edu/etd

Part of the Toxicology Commons

Recommended Citation Wolday, Mengisteab T., "Phenotypic and molecular analysis of desensitization to levamisole in male and female adult Brugia malayi" (2019). Graduate Theses and Dissertations. 17809. https://lib.dr.iastate.edu/etd/17809

This Thesis is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. Phenotypic and molecular analysis of desensitization to levamisole in male and female adult Brugia malayi

Mengisteab Wolday

A thesis submitted to the graduate faculty

in partial fulfillment of the requirements for the degree of

MASTER OF SCIENCE

Major: Toxicology

Program of Study Committee: Richard J. Martin, Major Professor Alan P. Robertson Aileen F. Keating

The student author, whose presentation of the scholarship herein was approved by the program of study committee, is solely responsible for the content of this thesis. The Graduate College will ensure this thesis is globally accessible and will not permit alterations after a degree is conferred.

Iowa State University

Ames, Iowa

2019

DEDICATION

This

Thesis research

is dedicated to

my loving and caring parents

Tesfaldet Wolday and Mizan Teckleab,

and my siblings

Mussie, Selam, Daniel, Yonas, Alek and Abraham,

and my son Yosias.

iii

TABLE OF CONTENTS

Page

LIST OF FIGURES ...... v

LIST OF TABLES ...... vii

NOMENCLATURE ...... viii

ACKNOWLEDGMENTS ...... ix

ABSTRACT ...... xi

CHAPTER 1. GENERAL INTRODUCTION ...... 1 1.1 Introduction ...... 1 1.2 Thesis Organization ...... 2 1.3 References ...... 3

CHAPTER 2. LITERATURE REVIEW ...... 5 2.1 Parasitic Nematodes ...... 5 2.2 Lymphatic filariasis (Elephantiasis) ...... 6 2.3 Nicotinic acetylcholine receptors (nAChRs) ...... 12 2.3.1 Parasitic nematode nAChRs ...... 13 2.4 Anthelmintics and Anthelmintic Resistance ...... 15 2.4.1 Anthelmintics ...... 15 2.4.2 Imidazothiazoles ...... 15 2.4.3 Anthelmintic resistance ...... 16 2.5 References ...... 18

CHAPTER 3. PHENOTYPIC AND MOLECULAR ANALYSIS OF DESENSITIZATION TO LEVAMISOLE IN ADULT BRUGIA MALAYI...... 26 3.1 Abstract ...... 26 3.2 Significance ...... 27 3.3 Introduction ...... 28 3.4 Materials and Methods ...... 30 3.4.1 Parasites ...... 30 3.4.2 nAChR Primer Design...... 30 3.4.3 Worminator assay ...... 31 3.4.4 RNA extraction and reverse transcriptions by PCR ...... 32 3.4.5 SYBR Green quantitative RT-PCR ...... 32 3.4.6 Data analysis...... 33 3.5 Results ...... 34 3.5.1 Expression of nAChR subunit genes at the whole worm level ...... 34 3.5.2 Levamisole transiently inhibits B. malayi motility ...... 35 3.5.3 Significant up regulation of Bma-unc-38 increases recovery and motility ...... 38 3.5.4 Worms under flaccid paralysis show significant upregulation of Bma-unc-29 ...... 41 3.5.5 Desensitization and relative expresssion in male B.malayi ...... 42 iv

3.6 Discussion ...... 46 3.6.1 Interpretation of the Worminator assay ...... 47 3.6.2 Gender based variation in desensitization ...... 48 3.7 References ...... 51

CHAPTER 4. CONCLUSION AND FUTURE DIRECTIONS ...... 62 4.1 Conclusion ...... 62 4.2 Future Directions ...... 65 v

LIST OF FIGURES

Page

Figure 2-1 Global distribution of neglected tropical diseases...... 6

Figure 2-2 Global distribution of lymphatic filariasis indicated in red...... 7

Figure 2-3 Adult female Brugia malayi in well plate...... 9

Figure 2-4 Life cycle of Brugia malayi...... 12

Figure 2-5 Structure of the nicotinic acetylcholine receptor...... 13

Figure 3-1 A representative gel picture of whole worm PCR reveals the presence of different nAChR amplicon expression...... 35

Figure 3-2 In vitro effects of levamisole on the motility of adult female B. malayi a dose response curve observed at the 3 minute time point following...... 36

Figure 3-3 In vitro effects of levamisole on the motility of B. malayi following exposure to various concentrations of levamisole...... 38

Figure 3-4 Time-course of the motility of adult female B. malayi following exposure to 100 µM of levamisole...... 39

Figure 3-6 Motility of adult female B. malayi versus time in the presence and absence of 100 µM levamisole...... 41

Figure 3-7 B. malayi incubated in 100 µM levamisole for 1 h, showed significant upregulation of Bma-unc-29...... 42

Figure 3-8 Motility of adult B. malayi male versus time in the presence and absence of 100 µM levamisole...... 43

Figure 3-9 Quantitative gene expression of nAChRs in male B. malayi after incubated for 4 h in 100 µM levamisole and partially recovered...... 44

Figure 3-10 Motility of adult male B. malayi versus time in the presence of 100 µM levamisole...... 45 vi

Figure 3-11 Expression of the different nAChR subunits after 1 h incubation in 100 µM levamisole...... 46 vii

LIST OF TABLES

Page

Table 3.1 Primer sequences used for qRT-PCR experiments BP, base pairs; F, forward; R, reverse. Bp size (150-200bp)...... 31

viii

NOMENCLATURE nAChR Nicotinic Acetyl Choline Receptor

MMU Mean Motility Unit

BP Base Pair

LF Lymphatic Filariasis

LGIC ligand gated ion channel

NTD Neglected Tropical Diseases

WHO World Health Organization ix

ACKNOWLEDGMENTS

I would like to thank my committee chair, Distinguished Professor Richard J. Martin, and my committee members, Dr. Alan P. Robertson, and Dr. Aileen Keating for their guidance and support throughout the course of this research. Their self-less guidance, immeasurable support and encouragement made me a productive young scientist. They were also shape and treat me as my parents and created an environment to feel like at home and encourage me to be confident and productive young scientist I am today. I am grateful to Dr. Sudanva Kashyap for spending long hours on the bench and lab with me just to guide and support in academic and non- academic life. I would also like to thank my lab colleagues, Dr. Saurabh Verma, Dr. Shivani

Choudhary, Dr. Paul Williams, Dr. Melanie Abongawa and Mr. Mark McHugh, for the wonderful experience I had working with them. Special thanks to Nyzil Massey for giving persistent support. I would like to thank the Interdepartmental Toxicology program coordinator

Linda Wild, Glenn Clark and the Department of Biomedical Sciences staff for making my stay at

Iowa State University successful one at the departmental/administrative level. I would like to thank the National Institutes for Health (NIH) for providing funding for my research. I would like to thank the NIAID/NIH Filariasis Research Reagent Resource Center (FR3) (Athens, GA) for their generous supply of adult Brugia malayi used in my research. I would like to express my heartfelt gratitude to my cousins Andom, Semere, Zyiada and Mrs. Azezet. I would like also to thank Mr. Okubab and Mr. Ashenafi for the love and support they gave me throughout my stay in Ames, Iowa. My deepest gratitude to my family and ALL my friends, relatives and well- wishers who during the course of my career provided any form of support to me. I am forever indebted to my parents, Mr. Tesfaldet Wolday and Mrs. Mizan Teckleab, for the enormous sacrifices they made in life to see that I succeed in my career pursuits as well as for their love, x care, prayers, encouragement, and blessings. My special regards to my siblings: Mussie,

Selamawit, Daniel, Yonas, Alek and Abrham, who have always believed in me and have stood by me whether good or bad. Lastly, I would like to thank the department faculty and staff for making my time at Iowa State University a wonderful experience. I want to also offer my appreciation to those who were willing to give information and support in all aspects, without them, this thesis would not have been possible. xi

ABSTRACT

Parasitic nematode infections persist as a serious global public health threat to humans and animals. These infections cause debilitating conditions in humans and significant economic losses through infection of livestock and crop damage. One of the many parasitic nematode infections is lymphatic filariasis; one of the causative agents is Brugia malayi. Presently, the treatment of parasitic infection relies on anthelmintics as there are no vaccines. Therefore, regular use of the same drugs is expected to produce either loss of potency or resistance.

Resistance to anthelmintics compromises the control of nematode infections and is also a major problem in veterinary and human medicine, resulting in untold morbidity and even mortality.

Therefore, deciphering pharmacological targets in parasitic nematode species is an urgent need to identify potential molecular mechanisms associated with resistance and drug discovery. nAChRs (nicotinic acetylcholine receptors) will continue to present targets for such strategies. nAChRs are homo- or hetero-pentameric ligand-gated ion channels mediating excitatory neurotransmission and muscle activation. In Brugia, there are multiple subtypes of nicotinic receptors on the body muscle (M-, P-, L, and N-) that are sensitive to different cholinergic anthelmintics. Levamisole is an anthelmintic drug that acts by activating an L-type of nAChR at the nematode neuromuscular junction to cause paralysis.

We hypothesized that the populations of receptor subtypes are dynamic and change to compensate and limit the effects of anthelmintic exposure. Therefore, we investigated the issues of anthelmintic resistance in vitro using Worminator, which quantitatively measures the motility of B. malayi and qRT-PCR (quantitative real time polymerase chain reaction) to analysis the relative expression changes of nAChR subunit mRNAs. These were performed to characterize xii the phenotypic and molecular analysis of nAChR gene expression at different concentrations and time intervals.

We measured the in vitro effects of levamisole on the motility of adult male and female

Brugia malayi at different time points. We also determined real time IC50 values of different concentrations of levamisole at 10 minutes against adult B. malayi which was 10 nM. Both, high and low drug concentrations induced an immediate spastic paralysis that lasted for up to one hour in worms. However, female worms completely recovered around 4 hours later, whereas male worms were only partially desensitized. This suggests a difference in sensitivity to levamisole between male and female worms. The variation in motility during levamisole incubation was possibly due to differences in nAChR genes expression. Completely recovered female worms had upregulation of the Bma-unc-38 gene (ANOVA, P < 0.01). Partially desensitized male worms also showed significant upregulation of Bma-unc-38 (ANOVA, P <

0.01). This indicates that the Bma-unc-38 gene upregulation plays a key role for motility in male and female worms. However, the motility variation may be possibly due to differences in nAChR genes expression of other nAChR genes also. Female worms under flaccid paralysis had increased Bma-unc-29 (ANOVA, P < 0.01).

Therefore, we concluded that both Bma-unc-38 and Bma-unc-29 genes are important for the pharmacology of L-type receptors and motility. Together expression of these genes may induce a functional receptor which responded to levamisole. In male worms, robust increased expression of Bma-unc-38 and Bma-unc-29 together might delay desensitization. However, in female worms, robust expression of Bma-acr-8 and Bma-unc-38 may result in failure to form a functional receptor to respond to levamisole. 1

CHAPTER 1. GENERAL INTRODUCTION

1.1 Introduction

Parasitic nematodes are a major problem in both animals and humans, particularly in tropical and subtropical regions of the world. Parasitic nematodes also cause economic losses through infection and resulting morbidity and even mortality in human and animals. In humans and animals, treatment and control of parasitic nematodes relies mainly on the use of available anthelmintic drugs, most of which act on ion channels.

Anthelmintic drugs can be categorized in to three groups based on chemical structure and mode of action. The three major classes are the benzimidazoles (BZs), imidazothiazoles/tetrahydro pyrimidines and macrocyclic lactones (MLs). The benzimidazoles

(e.g thiabendazole, mebendazole, albendazole, flubendazole) target beta-tubulin, an important protein in maintaining parasite cell structure [1-3]. Imidazothiazoles/tetrahydro pyrimidines (e.g levamisole, pyrantel, oxantel, morantel) act on nicotinic acetylcholine receptors (nAChRs), which are ligand gated ion channels that mediate fast signal transmission at parasite neuromuscular and nerve-nerve junctions [4]. Macrocyclic lactones (e.g ivermectin, abamectin, moxidectin) act on glutamate-gated chloride channels (GluCls). Activation of GluCls via ML inhibits movement and pharyngeal pumping [5, 6]. New classes of synthetic anthelmintic drugs are amino-acetonitrile derivatives (AADs) (e.g monepantel), spiroindoles (e.g derquantel) and cyclooctadepsipeptides (e.g emodepside). They have a broad activity against parasites resistant to the benzimidazoles, imidazothiazoles and macrocyclic lactones [7-9]. Monepantel acts on

DEG-3- type nAChRs: ACR-20, ACR-23 and MPTL-1[8]. Derquantel is a first semisynthetic anthelmintic that acts as an antagonist of several nAChR types and leads to flaccid paralysis and 2 expulsion from the host [10]. Emodepside is a semisynthetic derivative of PF1022A, which acts on SLO-1 Ca-activated K channels and latrophilin (LAT) receptors [11].

The recently introduced anthelmintic drug, tribendimidine, targets nAChRs and is approved for human use in China [12]. The actions of anthelmintic drugs are by interfering with locomotion, feeding, and growth. Unfortunately, resistance has been reported for all anthelmintic drug classes, therefore, to slow or overcome resistance it is urgent to decipher the pharmacological targets in parasitic nematode species [13, 14].

This MS study seeks to address two main strategies by which anthelmintic resistance can be circumvented. The first aim was to characterize the phenotypic changes with time after worms were exposed to different concentrations of levamisole. The second aim was to investigate the molecular analysis of nAChRs genes during levamisole exposure to measure the dynamic expression changes of the receptor subunits.

1.2 Thesis Organization

In this thesis, a general introduction is provided about B. malayi, levamisole and the target sites of levamisole used to treat nematode infections. Ion channels are highlighted as targets for the majority of available classic anthelmintic drugs and an emphasis is placed on anthelmintic drug resistance and the need to overcome drug resistance. Two strategies are proposed as ways of understanding drug resistance and these are: the characterization of phenotype change with time courses during worms incubated with levamisole and then proceeding to analysis of the nAChRs subunits to decipher the relative expression of each subtype. In chapter 2, I have reviewed the literature on Brugia malayi, Levamisole, and nicotinic acetylcholine receptors

(nAChRs) of parasitic nematodes. In chapter 3, I did all the work outlined in this paper. All the work in all chapters were done by me. The last chapter is a conclusion of my MSc research and suggestions for future work. 3

1.3 References

1. Prichard RK. Mode of action of anthelminthic thiabendazole in haemonchus-contortus. Nature. 1970;228(5272):684-+. doi: 10.1038/228684a0. PubMed PMID: WOS:A1970H740000053.

2. Tejada P, Sanchezmoreno M, Monteoliva M, Gomezbanqueri H. Inhibition of malate- dehydrogenase enzymes by benzimidazole anthelmintics. Veterinary Parasitology. 1987;24(3-4):269-74. doi: 10.1016/0304-4017(87)90048-3. PubMed PMID: WOS:A1987H831700013.

3. Lacey E. Mode of action of benzimidazoles. parasitology today. 1990;6(4):112-5. doi: 10.1016/0169-4758(90)90227-u. PubMed PMID: WOS:A1990DA15600006.

4. Aceves J, Erlij D, Martinez.R. Mechanism of paralysing action of tetramisole on ascaris somatic muscle. British Journal of Pharmacology. 1970;38(3):602-+. doi: 10.1111/j.1476-5381.1970.tb10601.x. PubMed PMID: WOS:A1970F667500013.

5. Cully DF, Vassilatis DK, Liu KK, Paress PS, Vanderploeg LHT, Schaeffer JM, et al. Cloning of an avermectin-sensitive glutamate-gated chloride channel from caenorhabditis-elegans. Nature. 1994;371(6499):707-11. doi: 10.1038/371707a0. PubMed PMID: WOS:A1994PM77300058.

6. Martin RJ. Modes of action of anthelmintic drugs. Veterinary Journal. 1997;154(1):11-34. doi: 10.1016/s1090-0233(05)80005-x. PubMed PMID: WOS:A1997XL02900004.

7. Ducray P, Gauvry N, Pautrat F, Goebel T, Fruechtel J, Desaules Y, et al. Discovery of amino- acetonitrile derivatives, a new class of synthetic anthelmintic compounds. Bioorganic & Medicinal Chemistry Letters. 2008;18(9):2935-8. doi: 10.1016/j.bmcl.2008.03.071. PubMed PMID: WOS:000255444300034.

8. Kaminsky R, Ducray P, Jung M, Clover R, Rufener L, Bouvier J, et al. A new class of anthelmintics effective against drug-resistant nematodes. Nature. 2008;452(7184):176-U19. doi: 10.1038/nature06722. PubMed PMID: WOS:000253925600032.

9. Kaminsky R, Gauvry N, Weber SS, Skripsky T, Bouvier J, Wenger A, et al. Identification of the amino-acetonitrile derivative monepantel (AAD 1566) as a new anthelmintic drug development candidate. Parasitology Research. 2008;103(4):931-9. doi: 10.1007/s00436-008-1080-7. PubMed PMID: WOS:000258058100025.

10. Robertson AP, Clark CL, Burns TA, Thompson DP, Geary TG, Trailovic SM, et al. Paraherquamide and 2-deoxy-paraherquamide distinguish cholinergic receptor subtypes in Ascaris muscle. Journal of Pharmacology and Experimental Therapeutics. 2002;302(3):853-60. PubMed PMID: BIOSIS:PREV200200513507.

11. Harder A, Holden-Dye L, Walker R, Wunderlich F. Mechanisms of action of emodepside. Parasitology research. 2005;97 Suppl 1:S1-S10. doi: 10.1007/s00436-005-1438-z. PubMed PMID: MEDLINE:16228263.

12. Xiao SH, Wu HM, Tanner M, Utzinger J, Chong W. Tribendimidine: a promising, safe and broad- spectrum anthelmintic agent from China. Acta Tropica. 2005;94(1):1-14. doi: 10.1016/j.actatropica.2005.01.013. PubMed PMID: WOS:000228597700001. 4

13. Tyrrell KL, LeJambre LF. Overcoming macrocyclic lactone resistance in Haemonchus contortus with pulse dosing of levamisole. Veterinary Parasitology. 2010;168(3-4):278-83. doi: 10.1016/j.vetpar.2009.11.002. PubMed PMID: WOS:000276520400015.

14. Kaplan RM, Vidyashankar AN. An inconvenient truth: Global worming and anthelmintic resistance. Veterinary Parasitology. 2012;186(1-2):70-8. doi: 10.1016/j.vetpar.2011.11.048. PubMed PMID: WOS:000303183200010.

CHAPTER 2. LITERATURE REVIEW

2.1 Parasitic Nematodes

Parasites are organisms that live in or outside another organism known as the host, and benefit at the expense of the host. Parasites broadly include viruses and bacteria along with protozoa, helminths and arthropods. Parasites are a major cause of disease in the host and may possibly cause death, poor growth, weight loss, compromised immune system, anemia and in humans, impaired cognitive skills. Parasites are categorized in to endoparasites and ectoparasites. Endoparasites live inside the body and the ectoparasites lives outside the body. In animals, endoparasites may live in the blood, muscles, liver, brain or digestive tract [15].

Nematodes are nonsegmented roundworms belong to the phylum Nematoda. More than

50% of the 25,000 nematode species are parasitic [16]. These include the soil-transmitted helminths (STHs) and filarial worms. Parasitic nematodes infection causes global health and economic impacts. According to the World Health Organization (WHO), four of the seventeen

“Neglected Tropical Diseases” (NTDs) are caused by soil-transmitted helminths (STHs) and filarial worms. Neglected tropical diseases (NTDs) are a group of infectious diseases categorized by the neglect they have been suffered in terms of funding, research, and policy.

The seventeen NTDs are Lymphatic filariasis, Soil-transmitted helminthiases, Dracunculiasis

(guinea-worm disease), Buruli ulcer, Chagas disease, Dengue and Chikungunya,

Echinococcosis, Foodborne trematodiases, Human African trypanosomiasis (sleeping sickness),

Leishmaniasis, Leprosy (Hansen’s disease), Onchocerciasis (river blindness), Rabies,

Schistosomiasis, Taeniasis/Cysticercosis, Trachoma and Yaws (Endemic treponematoses) [17].

One of the NTDs is Filariases (lymphatic filariasis and onchocerciasis) which is caused by filarial worms. Lymphatic filariasis is among the five diseases primarily the goals and vision 6

(leprosy, sleeping sickness, blinding trachoma, guinea worm disease, and lymphatic filariasis), to be eliminated by NTD program at WHO [18].

Parasitic nematode infections affect approximately one billion people primarily living in developing areas of sub-Saharan Africa, Asia and the Americas with poor sanitation and lack of health education program [19]. Parasitic nematode infections cause debilitating conditions and serious problems in health of human and livestock. Moreover, they jeopardize food security and cause significant economic loss [18, 20, 21]. Consequently, the infection through the communities are persistently trapped in a cycle of poverty and disease (Figure 2-1).

Figure 2-1 Global distribution of neglected tropical diseases. https://www.cdc.gov/globalhealth/ntd/diseases/ntd-worldmap-static.html

2.2 Lymphatic filariasis (Elephantiasis)

Lymphatic filariasis (LF), commonly known as elephantiasis, is a NTD infection, caused by thread-like vector born nematodes of the family filariodidea. These include Wuchereria 7 bancrofti, Brugia malayi and Brugia timori. Almost 90% of LF cases are caused by W. bancrofti, while B. malayi and B. timori account for the remaining 10% of infections [22].

The mode of transmission of the parasites that cause LF is via blood sucking vector mosquitoes. Different types of mosquito transmit LF including, Culex, Anopheles, Mansonia and Aedes [23]. LF is a major hinderance to socioeconomic development and causes immense psychosocial suffering among the affected. According to the WHO, LF is the second leading cause of chronic disability globally after mental illness. LF damages the lymphatic system resulting in peripheral swelling, causing pain and severe disability [23, 24]. Lymphatic filariasis affects ∼120 million people worldwide, most of whom reside in developing countries, with over one billion being at risk of acquiring this infection in 83 countries and about 40 million deformed and debilitated as a result of the disease [23], [25, 26]. The majority of LF cases occur in Africa (Figure 2-2).

Figure 2-2 Global distribution of lymphatic filariasis indicated in red. https://www.amnh.org/explore/science-topics/disease-eradication/countdown-to-zero/lymphatic-filariasis. 8

The majority of LF infections are asymptomatic because they do not manifest strong inflammatory responses even though microfilaria circulate in the system, but symptoms can develop years after infection. When LF develops in to chronic conditions, acute symptoms include inflammation of the skin, lymphdoma or elephantiasis and hydrocele (scrotal swelling)

[27, 28]. Elephantiasis impairs the lymphatic system and develops to abnormal enlargement of peripheral body parts. It is the most chronic and obvious symptom, occurring in a small percentage of persons of LF cases. Body deformities often lead to social stigma, sub-optimal mental health and loss of income earnings opportunities and increase medical expenses and their caretakers [29-31].

The life cycle of parasites that cause LF involve both mosquito and human stages

(Figure 2-4). Adult worms live in the lumen of the lymphatic system and have been found in parts of the lymphatic circulation. The majority of worms live in the lower and upper part of the lymphatic system including the male genitalia. After mating, the female worm releases around

10,000 or more offspring per day. The worms release L1 larvae (microfilariae) instead of eggs.

Each microfilaria measures approximately 270 μm by 10 μm and contains nuclei that characteristically do not extend to the tip of the tail. One distinguishing feature of microfilaria is they are encased in a sheath comprised of chitin, a remnant of its eggshell. Microfilariae migrate from the lymphatic system to the blood circulation. Most of them aggregate in the peripheral blood at night (between 10 pm and 6 am) termed nocturnal periodicity. However, during the daytime, the microfilariae migrate to the lung capillaries as activity of host is increased. During sleep the microfilaria migrate to peripheral blood circulation due to a pH change in the pulmonary venous circulation [32]. Microfilariae live for about 1.5 years and must be ingested by a mosquito to continue their life cycle. 9

During a blood meal, infected mosquitoes introduce L3 larvae into the body of a human host where they penetrate the bite wound and migrate to the lymphatic vessels and develop into adult worms. Adult B. malayi females are larger (measuring 43 – 55 mm in length by 130 – 170

µm in width) than adult males (measuring 13 – 23 mm in length by 70 – 80 µm in width). Adult worms produce sheathed microfilariae (measuring 177 – 230 µm in length by 5 – 7 µm in width) which typically enter the bloodstream reaching the peripheral blood and are ready to be ingested by the mosquito during another blood meal. Microfilariae shed their sheaths and migrate to mosquito’s thoracic muscles via midgut where they moult into L1 larvae and subsequently develop into L3. The L3 larvae then migrate to the mosquito’s head and proboscis, whereby they can infect another human, thus continuing the transmission cycle.

Figure 2-3 Adult female Brugia malayi in well plate.

Lymphatic filariasis should be suspected in an individual who lives in an endemic area.

A definitive diagnosis has traditionally depended upon microscopically observing the 10 characteristic microfilariae in the blood. Blood samples for microfilariae detection are usually collected at night because lymphatic filariasis due to nocturnal periodicity. An antigen test is an alternative method that has been developed to detect circulating antigens which is more sensitive than microscopy [33-37]. These tests are available in different form such as ELISA

(Enzyme-linked immunosorbent assay) test or an immunochromatographic card, adult worm antigen and are very sensitive and specific. The ELISA has a sensitivity approaching 100 percent in microfilaremic patients. For both assays, the circulating filarial antigen remains diurnally constant, so blood for diagnosis can be collected during the day. PCR-based tests have been developed, but while used to monitor filarial infection in mosquitos, are currently not routinely used in clinical practice [38-40]. A rapid serological test has been developed which detect the human antibody IgG against the worms, these tests are used in clinical diagnosis of

LF [41, 42]. Moreover, a noninvasive method of diagnosis has been also developed which is used to monitor the efficacy of antifilarial drugs such as DEC. Ultrasound examination provides a picture of filaria in lymphatic vessels known as the “filarial dance sign” which is reflective of nests of live worms in the lymphatics [43]. Treatment strategies for LF rely on chemotherapy through mass drug administration (MDA). It is recommended all patients be treated, because some patients are asymptomatic. However, early treatment prevents subsequent lymphatic damage and may reverse lymphatic dysfunction [44]. The treatment of choice for mono-infected patients, is diethylcarbamazine (DEC) has both macrofilaricidal (adult worm) and microfilaricidal properties. The treatment is given as a single a dose of 6 mg/kg/day for 12 consecutive days for a total dose of 72 mg/kg. DEC decreases largely microfilaremia within one month and in some patients reverses existing damages. The addition of doxycycline to DEC improves the effect of microfilaricidal activity and decreases LF pathology [43, 45-47]. 11

However, DEC is only partially effective against the adult worms, thus, repeat treatment is needed every 6-12 months [44]. Alternative drugs, ivermectin (150–200 µg/kg) and albendazole

(200 mg), have been used in MDA to reduce transmission and microfilarial blood levels [48,

49]. However, these drugs kill only the microfilaria, with partial activity against adult worms which can live for an average of 5–10 years and will continue to produce microfilariae.

Currently, effective novel drugs are critically needed. DEC should not be given to patients who may also have onchocerciasis as it can worsen onchocercal eye disease (Mazzotti reaction) [50].

Moreover, prior treatment density of Loa loa microfilarial should be ruled out [51]. Co- infection of LF with onchocerciasis can be treated with combination of ivermectin and albendazole. Bancroftian filariasis treatment is more effective using triple therapy that include

DEC, albendazole and ivermectin than DEC and albendazole. However, more studies are needed to ascertain the safety of this triple drug therapy, particularly in individuals who are co- infected with onchocerciasis and loiasis. Aside from the use of anthelmintic drugs, strategies to improve chronic sequelae of LF, including lymphedema and elephantiasis. In both conditions, increased personal hygiene and antibiotic treatment prevents acute bacterial infections and worse symptoms [43].

Figure 2-4 Life cycle of Brugia malayi.

https://www.cdc.gov/parasites/images/lymphaticfilariasis/b_malayi_lifecycle.gif

2.3 Nicotinic acetylcholine receptors (nAChRs)

Nicotinic acetylcholine receptors (nAChRs) are ligand ion channel made up of five subunits arranged around a central pore that is permeable to cations [52, 53]. The nAChRs are large transmembrane proteins and members of the Cys-loop ligand-gated ion channels that mediate fast synaptic transmission in the neurons and muscles of vertebrates and invertebrates.

They are an important site for many anthelmintics and unlike the muscarinic AChRs, the nAChR receptors are not coupled to second messenger cascades [52, 54, 55]. Each nAChR subunit consists of an N-terminal, extracellular domain that contains the cys-loop (two cysteine 13 residues separated by 13 amino acids), six loops (A–F) and four transmembrane domains (TM1

– TM4). TM2 forms the lining of the ion pore (Figure 2-5).

Subunits of nAChR are categorized in to α and non-α, by which α subunits contain two adjacent cysteine residues (connected by a strained disulfide bond) in loop C which is an important site for acetylcholine binding while subunits without this motif are non-α subunits.

Pentameric receptor of nAChR contains a minimum two α subunits while the binding site of

ACh involves an α subunit and an adjacent subunit [56]. nAChRs are made up of the same subunits or different subunits. Homopentamers are the same subunits, whereas the nonidentical subunits are heteropentamers and contain at least two  subunits [57, 58].

Figure 2-5 Structure of the nicotinic acetylcholine receptor. Each nAChR consists of five subunits arranged around a cationic channel pore. (Brown et al., 2006)

2.3.1 Parasitic nematode nAChRs

The nAChRs of parasitic nematodes are the site of action of anthelmintic drugs such as levamisole, pyrantel, oxantel, bephenium and morantel. Anthelmintic drugs activate the receptors found in the parasite body muscle and result in worm contraction [59]. Most studies of 14 parasitic nematode nAChRs were performed in Ascaris suum (clade III). Initial patch clamp analysis from Ascaris muscles revealed the presence of three pharmacologically distinct acetyl choline-activated channel types, L-type activated by levamisole and pyrantel, N-type activated by nicotine and oxantel and B-type by bephenium [60] [61, 62]. Single channel recordings showed low levamisole concentrations (1 – 10 M) cause channel opening and high levamisole concentrations (30 and 90 M) cause flickering channel block. Levamisole activates the three channels but preferentially activates the L- type [61]. Unlike in C. elegans where the actions of levamisole and nicotine are selective (levamisole-sensitive currents are not activated by nicotine and vice versa), the differences in agonist action are subtler in A. suum. For instance, although levamisole preferentially activates L-type channels, it also opens N- and B-type channels to a lesser extent. Bephenium preferentially activates B-type channels but also opens some L-type but not N-type channels. Hence, nAChR types in A. suum are less distinct in terms of agonist pharmacology than those in C. elegans. At high concentrations, levamisole activates all three nAChR types in A. suum.

In the strongylid nematode Oesophagostomum dentatum (clade V) four levamisole- sensitive channels have been identified on body wall muscle [63]. In H. contortus, Teladorsagia circumcincta and Trichostrongylus colubreformis (all clade V) genes are orthologous to C. elegans unc-29, unc-63, unc-38 and lev-1 genes. However, they differ only in one gene which is lev-8 of C. elegans. Instead of that a truncated variant (Hco-acr-8b) of a related gene, Hco-acr-

8, was identified which might play a role as a marker for levamisole resistance [64].

2.4 Anthelmintics and Anthelmintic Resistance

2.4.1 Anthelmintics

Drugs used to treat an infection caused by parasites are called anthelmintics [65].

Helminths are invertebrate organisms characterized by elongated, flat or round bodies and generally visible to naked eye during adult stages. Helminths can be either free-living or parasitic in nature. In their adult form, they do not multiply in humans. Generally, helminths are classified in to three classes namely: nematodes (roundworms), trematodes (flukes) and cestodes (tapeworms) [66]. Anthelmintics selectively kill or eject the parasite from body, without causing significant side effects to the host [6]. Helminths are categorized in to two phylum which are nematodes (roundworms) and platyhelminths (trematodes and cestodes) [67,

68]. Even though, the prevalence of parasitic infection is high, anthelmintic drug discovery and development by pharmaceutical companies is slow. The most contributing factor that delay discovering of the new drugs is most of those infections are prevalent in developing countries which lack the resources to support a profitable drug market [69]. Novel drug discovery is estimated at US $ 40 million for livestock use, and more than US $ 800 million for human use

The global market for antiparasitic drugs and chemicals is estimated at US $12 billion for plant pathogens, $11 billion for livestock and companion animals, and $0.5 billion for human health

[70] [71-73]. Initially most of anthelmintic drugs used to treat humans were developed and marketed as veterinary drugs [74] [75, 76]. The few classes of anthelmintics are benzimidazoles, imidazothiazoles, tetrahydopyrimidines, macrocyclic lactones, amino- acetonitrile derivatives, spiroindoles and cyclooctadepsipeptides.

2.4.2 Imidazothiazoles

Imidazothiazoles are bicyclic heterocycle consisting of an imidazole ring fused to a thiazole ring; it contains three hetero atoms in structure two nitrogen and one sulphur atom, and 16 act as nAChR agonists. Imidazothiazoles bind to the ion channel nAChRs, that cause paralysis of the worms and cause their expulsion from the body [4]. The first drug member of the

Imidazothiazoles is Tetramisole, an aminothiazol derivative constitutes a racemic mixture of

50% L- or S- and D- or R-isomers [77]. The L-isomer is more potent than the racemic mixture or the D-isomer [78, 79]. Consequently, the D-isomer was removed from the racemic mixture and this led to the development of the L-isomer as levamisole. The detailed mode of action of levamisole, the only existing drug in this class, has been carefully studied at the single-channel level in nematode body wall muscles [61, 80, 81] using the patch-clamp technique at the single- channel level in A. suum muscle. Levamisole (1 – 90 M concentrations) causes activation of cation-selective channels, in addition to voltage-sensitive open channel blocking and desensitization. Recently, it has been shown that adult Brugia malayi, possesses levamisole- sensitive nAChRs [63, 82].

2.4.3 Anthelmintic resistance

In broad terms, anthelmintic resistance is referred to as loss of sensitivity of a drug in a population of parasites that were once susceptible to the drug. Anthelmintic resistance develops when more individuals in a parasite population that were hitherto affected by a given drug dose/concentration become unaffected or when there is a decline in the efficiency of a drug against a hitherto susceptible parasite population [1, 83]. This definition does not however suggest what causes the decline in the efficiency of a drug. An alternative definition of anthelmintic resistance that points to an origin states that anthelmintic resistance is “the genetically transmitted loss of sensitivity in worm populations that were previously sensitive to the same drug” (Köhler, 2001). This definition emphasizes the importance of genetics in determining drug resistance. Detecting resistance at the early stage is necessary in preventing an 17

“endemic” problem. Usually, the first sign of resistance is treatment failure. Development of resistance in numerous veterinary parasite species has occurred, with concerns that may extend to humans. This happens, due to repeated and inappropriate use of anthelmintics [84-86].

Moreover, mechanism action of drugs which share the same site are more likely vulnerable to resistance to happen to other drugs in the same class (side resistance) [87]. Drugs from one class and another class but share similar targets also increased the likelihood for the development of cross resistance [83]. Hence, resistance to most of anthelmintic drugs can develop.

Unfortunately, the onset of anthelmintic resistance can be rapid, thiabendazole resistance occurred only three years after its introduction to the market [88]. Reports of resistance to anthelmintics in various parts of the world have been well documented [14, 89]. Despite the numerous reports of anthelmintic resistance, the mechanisms by which resistance occurs remain to be fully elucidated. Resistance mechanisms may include: (i) mutation or deletion of one or more amino acids in the target genes, (drug target modification) (ii) reduction in the number of receptors, (iii) decreased affinity of receptors for drugs, (iv) absence of bioactivating enzymes,

(iv) gender variation in drug sensitivity; variation in sensitivity by the same parasite species in different hosts; variation in sensitivity by the same parasite species in different hosts; [87] and

(v) target gene amplification in order to overcome drug action [90-93]. Management practices can also delay or overcome anthelmintic resistance [94].

Anthelmintic resistance can be delayed or overcome by: (i) identifying new drug targets with different pharmacological profiles from those of existing drugs, (ii) introducing new anthelmintics with different modes of action from those of existing anthelmintics, (iii) combination therapy, with members of the combination from different drug classes, (iv) rotating drugs with different modes of action between dosing seasons, and (v) keeping some parasites in 18 untreated refugia. Refugium is an area in which a population of organisms can survive through a period of unfavorable conditions [94-96]. A detailed understanding of the biochemical and genetic basis of anthelmintic action is, therefore, crucial as this will allow for the development of sensitive assays for early detection and, hence, more efficient management of anthelmintic resistance [97].

2.5 References

1. Hopla CE, Durden LA, Keirans JE. Ectoparasites and classification. Revue Scientifique Et Technique De L Office International Des Epizooties. 1994;13(4):985-1017. doi: 10.20506/rst.13.4.815. PubMed PMID: WOS:A1994QB92200002.

2. Zhang Z-Q, Hooper JNA, Van Soest RWM, Pisera A, Crowther AL, Tyler S, et al. Animal biodiversity: An outline of higher-level classification and taxonomic richness. Zootaxa. 2011;(3148):7- 237. doi: 10.11646/zootaxa.3148.1.3. PubMed PMID: WOS:000209467300001.

3. Johnston KL, Ford L, Taylor MJ. Overcoming the Challenges of Drug Discovery for Neglected Tropical Diseases: The A.WOL Experience. Journal of Biomolecular Screening. 2014;19(3):335-43. doi: 10.1177/1087057113511270. PubMed PMID: WOS:000330756600001.

4. Hotez PJ, Fenwick A, Savioli L, Molyneux DH. Rescuing the bottom billion through control of neglected tropical diseases. Lancet. 2009;373(9674):1570-5. doi: 10.1016/s0140-6736(09)60233-6. PubMed PMID: WOS:000265710300036.

5. Chan MS. The global burden of intestinal nematode infections - Fifty years on. Parasitology Today. 1997;13(11):438-43. doi: 10.1016/s0169-4758(97)01144-7. PubMed PMID: WOS:A1997YE09000011.

6. Fitzpatrick JL. Global food security: The impact of veterinary parasites and parasitologists. Veterinary Parasitology. 2013;195(3-4):233-48. doi: 10.1016/j.vetpar.2013.04.005. PubMed PMID: WOS:000322413300005.

7. Hotez PJ, Kamath A. Neglected Tropical Diseases in Sub-Saharan Africa: Review of Their Prevalence, Distribution, and Disease Burden. Plos Neglected Tropical Diseases. 2009;3(8). doi: 10.1371/journal.pntd.0000412. PubMed PMID: WOS:000269220900003.

8. Knopp S, Steinmann P, Hatz C, Keiser J, Utzinger J. Nematode Infections: Filariases. Infectious Disease Clinics of North America. 2012;26(2):359-+. doi: 10.1016/j.idc.2012.02.005. PubMed PMID: WOS:000305853100012.

9. Mak JW. Epidemiology of lymphatic filariasis. Ciba Foundation Symposia. 1987;127:5-14. PubMed PMID: WOS:A1987K911700002.

10. Wynd S, Melrose WD, Durrheim DN, Carron J, Gyapong M. Understanding the community impact of lymphatic filariasis: a review of the sociocultural literature. Bulletin of the World Health Organization. 2007;85(6):493-8. doi: 10.2471/blt.06.031047. PubMed PMID: WOS:000248813700015. 19

11. Fenwick A. The global burden of neglected tropical diseases. Public Health. 2012;126(3):233-6. doi: 10.1016/j.puhe.2011.11.015. PubMed PMID: WOS:000301376000017.

12. Nutman TB. Insights into the Pathogenesis of Disease in Human Lymphatic Filariasis. Lymphatic Research and Biology. 2013;11(3):144-8. doi: 10.1089/lrb.2013.0021. PubMed PMID: WOS:000324477300007.

13. Babu S, Nutman TB. Immunopathogenesis of lymphatic filarial disease. Seminars in Immunopathology. 2012;34(6):847-61. doi: 10.1007/s00281-012-0346-4. PubMed PMID: WOS:000310988000009.

14. Shenoy RK. Clinical and pathological aspects of filarial lymphedema and its management. Korean Journal of Parasitology. 2008;46(3):119-25. doi: 10.3347/kjp.2008.46.3.119. PubMed PMID: WOS:000259500600001.

15. Bandyopadhyay L. Lymphatic filariasis and the women of India. Social Science & Medicine. 1996;42(10):1401-10. doi: 10.1016/0277-9536(95)00288-x. PubMed PMID: WOS:A1996UM37300006.

16. Coreil J, Mayard G, Louis-Charles J, Addiss D. Filarial elephantiasis among Haitian women: social context and behavioural factors in treatment. Tropical Medicine & International Health. 1998;3(6):467-73. doi: 10.1046/j.1365-3156.1998.00238.x. PubMed PMID: WOS:000074449500007.

17. Gyapong M, Gyapong JO, Adjei S, Vlassoff C, Weiss M. Filariasis in northern Ghana: Some cultural beliefs and practices and their implications for disease control. Social Science & Medicine. 1996;43(2):235-42. doi: 10.1016/0277-9536(95)00365-7. PubMed PMID: WOS:A1996VA08300009.

18. Hawking F, Pattanayak S, Sharma HL. Periodicity of microfilariae .11. effect of body temperature and other stimuli upon cycles of wuchereria bancrofti brugia malayi b ceylonensis and dirofilaria repens. Transactions of the Royal Society of Tropical Medicine and Hygiene. 1966;60(4):497-+. doi: 10.1016/0035-9203(66)90275-6. PubMed PMID: WOS:A19668162400033.

19. El-Moamly AAR, El-Sweify MA, Hafez MA. Using the AD12-ICT rapid-format test to detect Wuchereria bancrofti circulating antigens in comparison to Og4C3-ELISA and nucleopore membrane filtration and microscopy techniques. Parasitology Research. 2012;111(3):1379-83. doi: 10.1007/s00436- 012-2870-5. PubMed PMID: WOS:000308112300049.

20. Rocha A, Braga C, Belem M, Carrera A, Aguiar-Santos A, Oliveira P, et al. Comparison of tests for the detection of circulating filarial antigen (Og4C3-ELISA and AD12-ICT) and ultrasound in diagnosis of lymphatic filariasis in individuals with microfilariae. Memorias Do Instituto Oswaldo Cruz. 2009;104(4):621-5. doi: 10.1590/s0074-02762009000400015. PubMed PMID: WOS:000269466900015.

21. Wattal S, Dhariwal AC, Ralhan PK, Tripathi VC, Regu K, Kamal S, et al. Evaluation of Og4C3 antigen ELISA as a tool for detection of bancroftian filariasis under lymphatic filariasis elimination programme. The Journal of communicable diseases. 2007;39(2):75-84. PubMed PMID: MEDLINE:18338684.

22. Melrose WD, Durrheim DD, Burgess GW. Update on immunological tests for lymphatic filariasis. Trends in Parasitology. 2004;20(6):255-7. doi: 10.1016/j.pt.2004.04.002. PubMed PMID: WOS:000222043100003. 20

23. Weil GJ, Ramzy RMR. Diagnostic tools for filariasis elimination programs. Trends in Parasitology. 2007;23(2):78-82. doi: 10.1016/j.pt.2006.12.001. PubMed PMID: WOS:000244396300011.

24. Cunningham J, Hasker E, Das P, El Safi S, Goto H, Mondal D, et al. A Global Comparative Evaluation of Commercial Immunochromatographic Rapid Diagnostic Tests for Visceral Leishmaniasis. Clinical Infectious Diseases. 2012;55(10):1312-9. doi: 10.1093/cid/cis716. PubMed PMID: WOS:000310374600012.

25. Weil GJ, Jain DC, Santhanam S, Malhotra A, Kumar H, Sethumadhavan KVP, et al. A Monoclonal antibody-based enzyme-immunoassay for detecting parasite antigenemia in bancroftian filariasis. Journal of Infectious Diseases. 1987;156(2):350-5. doi: 10.1093/infdis/156.2.350. PubMed PMID: WOS:A1987J144600014.

26. Wijegunawardana AD, Gunawardane NS, Hapuarachchi C, Manamperi A, Gunawardena K, Abeyewickrama W. Evaluation of PCR-ELISA as a tool for monitoring transmission of Wuchereria bancrofti in District of Gampaha, Sri Lanka. Asian Pacific Journal of Tropical Biomedicine. 2013;3(5):381-7. PubMed PMID: BCI:BCI201300265378.

27. Steel C, Golden A, Kubofcik J, LaRue N, de los Santos T, Domingo GJ, et al. Rapid Wuchereria bancrofti-Specific Antigen Wb123-Based IgG4 Immunoassays as Tools for Surveillance following Mass Drug Administration Programs on Lymphatic Filariasis. Clinical and Vaccine Immunology. 2013;20(8):1155-61. doi: 10.1128/cvi.00252-13. PubMed PMID: WOS:000322316800008.

28. Steel C, Kubofcik J, Ottesen EA, Nutman TB. Antibody to the Filarial Antigen Wb123 Reflects Reduced Transmission and Decreased Exposure in Children Born following Single Mass Drug Administration (MDA). Plos Neglected Tropical Diseases. 2012;6(12). doi: 10.1371/journal.pntd.0001940. PubMed PMID: WOS:000312910200013.

29. Taylor MJ. A new insight into the pathogenesis of filarial disease. Current Molecular Medicine (Hilversum). 2002;2(3):299-302. doi: 10.2174/1566524024605662. PubMed PMID: BCI:BCI200200350312.

30. Moore TA, Reynolds JC, Kenney RT, Johnston W, Nutman TB. Diethylcarbamazine-induced reversal of early lymphatic dysfunction in a patient with bancroftian filariasis: Assessment with use of lymphoscintigraphy. Clinical Infectious Diseases. 1996;23(5):1007-11. doi: 10.1093/clinids/23.5.1007. PubMed PMID: WOS:A1996VQ90600011.

31. Mand S, Debrah AY, Klarmann U, Batsa L, Marfo-Debrekyei Y, Kwarteng A, et al. Doxycycline Improves Filarial Lymphedema Independent of Active Filarial Infection: A Randomized Controlled Trial. Clinical Infectious Diseases. 2012;55(5):621-30. doi: 10.1093/cid/cis486. PubMed PMID: WOS:000307498300003.

32. Mand S, Pfarr K, Sahoo PK, Satapathy AK, Specht S, Klarmann U, et al. Macrofilaricidal Activity and Amelioration of Lymphatic Pathology in Bancroftian Filariasis after 3 Weeks of Doxycycline Followed by Single-Dose Diethylcarbamazine. American Journal of Tropical Medicine and Hygiene. 2009;81(4):702-11. doi: 10.4269/ajtmh.2009.09-0155. PubMed PMID: WOS:000270474000031.

33. Taylor MJ, Hoerauf A. A new approach to the treatment of filariasis. Current Opinion in Infectious Diseases. 2001;14(6):727-31. doi: 10.1097/00001432-200112000-00011. PubMed PMID: WOS:000172663200011. 21

34. Dembele B, Coulibaly YI, Dolo H, Konate S, Coulibaly SY, Sanogo D, et al. Use of High-Dose, Twice-Yearly Albendazole and Ivermectin to Suppress Wuchereria bancrofti Microfilarial Levels. Clinical Infectious Diseases. 2010;51(11):1229-35. doi: 10.1086/657063. PubMed PMID: WOS:000283850200003.

35. Ottesen EA, Duke BOL, Karam M, Behbehani K. Strategies and tools for the control/elimination of lymphatic filariasis. Bulletin of the World Health Organization. 1997;75(6):491-503. PubMed PMID: WOS:000072149000001.

36. Awadzi K, Gilles HM. Diethylcarbamazine in the treatment of patients with onchocerciasis. British Journal of Clinical Pharmacology. 1992;34(4):281-8. doi: 10.1111/j.1365-2125.1992.tb05632.x. PubMed PMID: WOS:A1992JT32600001.

37. Changeux J-P. The Nicotinic Acetylcholine Receptor: The Founding Father of the Pentameric Ligand-gated Ion Channel Superfamily. Journal of Biological Chemistry. 2012;287(48):40207-15. doi: 10.1074/jbc.R112.407668. PubMed PMID: WOS:000311448800012.

38. Karlin A. Emerging structure of the nicotinic acetylcholine receptors. Nature Reviews Neuroscience. 2002;3(2):102-14. doi: 10.1038/nrn731. PubMed PMID: WOS:000173726300017.

39. Brown LA, Jones AK, Buckingham SD, Mee CJ, Sattelle DB. Contributions from Caenorhabditis elegans functional genetics to antiparasitic drug target identification and validation: Nicotinic acetylcholine receptors, a case study. International Journal for Parasitology. 2006;36(6):617-24. doi: 10.1016/j.ijpara.2006.01.016. PubMed PMID: WOS:000238551300002.

40. Unwin N. Refined structure of the nicotinic acetylcholine receptor at 4 angstrom resolution. Journal of Molecular Biology. 2005;346(4):967-89. doi: 10.1016/j.jmb.2004.12.031. PubMed PMID: WOS:000227187800003.

41. Corringer PJ, Bertrand S, Bohler S, Edelstein SJ, Changeux JP, Bertrand D. Critical elements determining diversity in agonist binding and desensitization of neuronal nicotinic acetylcholine receptors. Journal of Neuroscience. 1998;18(2):648-57. PubMed PMID: WOS:000071414200008.

42. Bouzat C. New insights into the structural bases of activation of Cys-loop receptors. Journal of Physiology-Paris. 2012;106(1-2):23-33. doi: 10.1016/j.jphysparis.2011.09.012. PubMed PMID: WOS:000305111000004.

43. Taly A, Corringer PJ, Guedin D, Lestage P, Changeux JP. Nicotinic receptors: allosteric transitions and therapeutic targets in the nervous system. Nature Reviews Drug Discovery. 2009;8(9):733- 50. doi: 10.1038/nrd2927. PubMed PMID: WOS:000269413100019.

44. Harrow ID, Gration KAF. Mode of action of the anthelmintics morantel, pyrantel and levamisole on muscle-cell membrane of the nematode ascaris-suum. Pesticide Science. 1985;16(6):662-72. doi: 10.1002/ps.2780160612. PubMed PMID: WOS:A1985AXH8500011.

45. Colquhoun L, Holdendye L, Walker RJ. The pharmacology of cholinoceptors on the somatic muscle-cells of the parasitic nematode ascaris-suum. Journal of Experimental Biology. 1991;158:509-30. PubMed PMID: WOS:A1991FW63800029. 22

46. Qian H, Martin RJ, Robertson AP. Pharmacology of N-, L-, and B-subtypes of nematode nAChR resolved at the single-channel level in Ascaris suum. Faseb Journal. 2006;20(14):2606-+. doi: 10.1096/fj.06-6264fje. PubMed PMID: WOS:000242490700039.

47. Robertson AP, Clark CL, Burns TA, Thompson DP, Geary TG, Trailovic SM, et al. Paraherquamide and 2-deoxy-paraherquamide distinguish cholinergic receptor subtypes in ascaris muscle (vol 302, pg 853, 2002). Journal of Pharmacology and Experimental Therapeutics. 2002;303(2):888-. PubMed PMID: WOS:000178684800056.

48. Robertson AP, Puttachary S, Martin RJ. Single-channel recording from adult Brugia malayi. Invertebrate Neuroscience. 2011;11(1):53-7. doi: 10.1007/s10158-011-0118-1. PubMed PMID: WOS:000290964100006.

49. Fauvin A, Charvet C, Issouf M, Cortet J, Cabaret J, Neveu C. cDNA-AFLP analysis in levamisole- resistant Haemonchus contortus reveals alternative splicing in a nicotinic acetylcholine receptor subunit. Molecular and Biochemical Parasitology. 2010;170(2):105-7. doi: 10.1016/j.molbiopara.2009.11.007. PubMed PMID: WOS:000275224400007.

50. Holden-Dye L, Walker RJ. Anthelmintic drugs and nematicides: studies in Caenorhabditis elegans. WormBook : the online review of C elegans biology. 2014:1-29. doi: 10.1895/wormbook.1.143.2. PubMed PMID: MEDLINE:25517625.

51. Castro GA. Helminths structure classification growth and development. Baron, S (Ed) Medical Microbiology, Third Edition Xx+1340p Churchill Livingstone: New York, New York, USA; London, England, Uk Illus. 1991:1065-75. PubMed PMID: BCI:BCI199242091420.

52. Martin RJ. Modes of action of anthelmintic drugs. Veterinary Journal. 1997;154(1):11-34. doi: 10.1016/s1090-0233(05)80005-x. PubMed PMID: WOS:A1997XL02900004.

53. Hotez PJ, Brindley PJ, Bethony JM, King CH, Pearce EJ, Jacobson J. Helminth infections: the great neglected tropical diseases. Journal of Clinical Investigation. 2008;118(4):1311-21. doi: 10.1172/jci34261. PubMed PMID: WOS:000254588600023.

54. Wang LJ, Cao Y, Shi HN. Helminth infections and intestinal inflammation. World Journal of Gastroenterology. 2008;14(33):5125-32. doi: 10.3748/wjg.14.5125. PubMed PMID: WOS:000259091000004.

55. Pink R, Hudson A, Mouries MA, Bendig M. Opportunities and challenges in antiparasitic drug discovery. Nature Reviews Drug Discovery. 2005;4(9):727-40. doi: 10.1038/nrd1824. PubMed PMID: WOS:000232340800021.

56. DiMasi JA, Hansen RW, Grabowski HG. The price of innovation: new estimates of drug development costs. Journal of Health Economics. 2003;22(2):151-85. doi: 10.1016/s0167- 6296(02)00126-1. PubMed PMID: WOS:000181521300002.

57. Evans AM, Martin RJ. Activation and cooperative multi-ion block of single nicotinic- acetylcholine channel currents of Ascaris muscle by the tetrahydropyrimidine anthelmintic, morantel. British Journal of Pharmacology. 1996;118(5):1127-40. doi: 10.1111/j.1476-5381.1996.tb15515.x. PubMed PMID: WOS:A1996UX11100006. 23

58. Martin RJ, Robertson AP, Buxton SK, Beech RN, Charvet CL, Neveu C. Levamisole receptors: a second awakening. Trends in Parasitology. 2012;28(7):289-96. doi: 10.1016/j.pt.2012.04.003. PubMed PMID: WOS:000306252200005.

59. Morgan S, Grootendorst P, Lexchin J, Cunningham C, Greyson D. The cost of drug development: A systematic review. Health Policy. 2011;100(1):4-17. doi: 10.1016/j.healthpol.2010.12.002. PubMed PMID: WOS:000289220800002.

60. Crump A, Omura S. Ivermectin, 'Wonder drug' from Japan: the human use perspective. Proceedings of the Japan Academy Series B-Physical and Biological Sciences. 2011;87(2):13-28. doi: 10.2183/pjab.87.13. PubMed PMID: WOS:000288185000001.

61. Geary TG. Ivermectin 20 years on: maturation of a wonder drug. Trends in Parasitology. 2005;21(11):530-2. doi: 10.1016/j.pt.2005.08.014. PubMed PMID: WOS:000233212900012.

62. Omura S. Ivermectin: 25 years and still going strong. International Journal of Antimicrobial Agents. 2008;31(2):91-8. doi: 10.1016/j.ijantimicag.2007.08.023. PubMed PMID: WOS:000253225400001.

63. Aceves J, Erlij D, Martinez.R. Mechanism of paralysing action of tetramisole on ascaris somatic muscle. British Journal of Pharmacology. 1970;38(3):602-+. doi: 10.1111/j.1476-5381.1970.tb10601.x. PubMed PMID: WOS:A1970F667500013.

64. Raeymaek.Ah, Allewijn FT, Vandenbe.J, Demoen PJA, Vanoffen.Tt, Janssen PAJ. Novel broad- spectrum anthelmintics . tetramisole and related derivatives of 6-arylimidazo 2,1-b)thiazole. Journal of Medicinal Chemistry. 1966;9(4):545-+. doi: 10.1021/jm00322a023. PubMed PMID: WOS:A19667902100023.

65. Thienpont D, Brugmans J, Abadi K, Tanamal S. Tetramisole in treatment of nematode infections in man. American Journal of Tropical Medicine and Hygiene. 1969;18(4P1):520-+. doi: 10.4269/ajtmh.1969.18.520. PubMed PMID: WOS:A1969D758900008.

66. Van Den Bossche H, Janssen PAJ. The biochemical mechanism of action of the anthelmintic drug tetramisole. Life Sci. 1967;6((16 Pt. 2)):1781-92. doi: 10.1016/0024-3205(67)90150-6. PubMed PMID: BCI:BCI19684900058182.

67. Robertson AP, Bjorn HE, Martin RJ. Resistance to levamisole resolved at the single-channel level. Faseb Journal. 1999;13(6):749-60. PubMed PMID: WOS:000079527200016.

68. Robertson SJ, Martin RJ. Levamisole-activated single-channel currents from muscle of the nematode parasite ascaris-suum. British Journal of Pharmacology. 1993;108(1):170-8. doi: 10.1111/j.1476-5381.1993.tb13458.x. PubMed PMID: WOS:A1993KF00100030.

69. Sangster NC, Gill J. Pharmacology of anthelmintic resistance. Parasitology Today. 1999;15(4):141-6. doi: 10.1016/s0169-4758(99)01413-1. PubMed PMID: WOS:000079407100006.

70. Prichard RK. Mode of action of anthelminthic thiabendazole in haemonchus-contortus. Nature. 1970;228(5272):684-+. doi: 10.1038/228684a0. PubMed PMID: WOS:A1970H740000053.

71. Coles GC, Jackson F, Pomroy WE, Prichard RK, von Samson-Himmelstjerna G, Silvestre A, et al. The detection of anthelmintic resistance in nematodes of veterinary importance. Veterinary Parasitology. 2006;136(3-4):167-85. doi: 10.1016/j.vetpar.2005.11.019. PubMed PMID: WOS:000236342800001.

72. Geerts S, Gryseels B. Drug resistance in human helminths: Current situation and lessons from livestock. Clinical Microbiology Reviews. 2000;13(2):207-+. doi: 10.1128/cmr.13.2.207-222.2000. PubMed PMID: WOS:000086683500003.

73. Geerts S, Gryseels B. Anthelmintic resistance in human helminths: a review. Tropical Medicine & International Health. 2001;6(11):915-21. doi: 10.1046/j.1365-3156.2001.00774.x. PubMed PMID: WOS:000172100000011.

74. Conway DP. Variance in effectiveness of thiabendazole against haemonchus contortus in sheep. American Journal of Veterinary Research. 1964;25(106):844-&. PubMed PMID: WOS:A19643710A00009.

75. Kaplan RM. Drug resistance in nematodes of veterinary importance: a status report. Trends in Parasitology. 2004;20(10):477-81. doi: 10.1016/j.pt.2004.08.001. PubMed PMID: WOS:000224257600005.

76. Kaplan RM, Vidyashankar AN. An inconvenient truth: Global worming and anthelmintic resistance. Veterinary Parasitology. 2012;186(1-2):70-8. doi: 10.1016/j.vetpar.2011.11.048. PubMed PMID: WOS:000303183200010.

77. Gilleard JS. Understanding anthelmintic resistance: The need for genomics and genetics. International Journal for Parasitology. 2006;36(12):1227-39. doi: 10.1016/j.ijpara.2006.06.010. PubMed PMID: WOS:000241298800001.

78. Jabbar A, Iqbal Z, Kerboeuf D, Muhammad G, Khan MN, Afaq M. Anthelmintic resistance: The state of play revisited. Life Sciences. 2006;79(26):2413-31. doi: 10.1016/j.lfs.2006.08.010. PubMed PMID: WOS:000242565600001.

79. James CE, Hudson AL, Davey MW. Drug resistance mechanisms in helminths: is it survival of the fittest? Trends in Parasitology. 2009;25(7):328-35. doi: 10.1016/j.pt.2009.04.004. PubMed PMID: WOS:000268378200008.

80. Wolstenholme AJ, Fairweather I, Prichard R, von Samson-Himmelstjerna G, Sangster NC. Drug resistance in veterinary helminths. Trends in Parasitology. 2004;20(10):469-76. doi: 10.1016/j.pt.2004.07.010. PubMed PMID: WOS:000224257600004.

81. Shalaby HA. Anthelmintics Resistance; How to Overcome it? Iranian Journal of Parasitology. 2013;8(1):18-32. PubMed PMID: WOS:000317132200002.

82. Coles GC. Anthelmintic resistance - looking to the future: a UK perspective. Research in Veterinary Science. 2005;78(2):99-108. doi: 10.1016/j.rvsc.2004.09.001. PubMed PMID: WOS:000227005500001.

83. Leathwick DM, Hosking BC, Bisset SA, McKay CH. Managing anthelmintic resistance: Is it feasible in New Zealand to delay the emergence of resistance to a new anthelmintic class? New Zealand Veterinary Journal. 2009;57(4):181-92. doi: 10.1080/00480169.2009.36900. PubMed PMID: WOS:000268542900002. 26

CHAPTER 3. PHENOTYPIC AND MOLECULAR ANALYSIS OF DESENSITIZATION TO LEVAMISOLE IN ADULT BRUGIA MALAYI

Mengisteab T. Woldaya, Sudhanva Kashyapa, Saurabh Vermaa, Alan Robertsona, Richard J.

Martina1

1To whom correspondence should be addressed. Email: [email protected] a Department of Biomedical Sciences, Iowa state university, Ames, IA, 50011

Modified from a manuscript to be submitted to PLOS Neglected Tropical Diseases

3.1 Abstract

Parasitic nematodes are the causative agents of many infections such as elephantiasis; one of the causative agents is B. malayi. Control of parasitic infections rely on the use of anthelmintic drugs as there is currently no effective vaccine against the infections. Therefore, regular use of the same drugs is expected to produce either loss of potency or resistance.

Deciphering pharmacological targets in parasitic nematode species is urgently needed to identify potential molecular mechanisms associated with resistance. Circumvention of resistance will involve the discovery of new anthelmintics, either singly or as combination therapies, and nicotinic acetylcholine receptor (nAChRs) will continue to present targets for such strategies. Therefore, we have investigated the issue of desensitization of levamisole in vitro using B. malayi as a model through motility phenotyping (Worminator) and qRT-PCR

(quantitative real time polymerase chain reaction). The two techniques were performed to characterize the phenotypic and molecular analysis of nAChR subunit expression at different time points. In B. malayi, there are multiple subtypes of nicotinic receptors on their body muscle

(M-, P-, L, and N-) sensitive to different cholinergic anthelmintics.

Levamisole is an anthelmintic drug that acts by activating L-type nAChRs at the nematode neuromuscular junction and causing paralysis. In vitro, we measured the effects of levamisole on motility of adult male and female B. malayi at different time courses. High and low drug concentrations of levamisole induce a spastic paralysis that lasted for up to one hour. However, female worms completely recovered at four hours, whereas male worms did not. This suggests, a difference in sensitivity to levamisole between male and female worms. The variation in motility after levamisole incubation was possibly due to differences in nAChR subunit gene expression.

Completely recovered female and partially recovered had increased abundance (ANOVA, P <

0.01) of mRNA encoding Bma-unc-38, while female worms under flaccid paralysis had increased abundance (ANOVA, P < 0.01) of mRNA encoding Bma-unc-29. This potentially indicates that

Bma-unc-38 upregulation is required for recovery of motility. However, Bma-unc-29 is required for rescuing worms from spastic to flaccid paralysis.

Keywords

Levamisole; Brugia malayi; ion channel receptor; subtypes; relative expression; resistance, nAChR.

3.2 Significance

Parasitic nematodes globally have an impact on health and economics. They infect animals, including livestock, humans and plants. Their control in human and veterinary medicine relies on the available anthelmintic drugs. However, resistance against these drugs compromises the sustainable control nematode parasites. Acetylcholine receptors (AChRs) are a ligand gated ion channel required for body movement in parasitic nematodes and are targets of

“classical” anthelmintic drugs such as levamisole and pyrantel. Here we used the Worminator to characterize the phenotypic changes and qRT-PCR to measure relative expression changes in male and female worms exposed to levamisole. We have found that desensitization in male and 28 female worms is associated with Bma-unc-38 upregulation. However, in worms under flaccid paralysis we observed Bma-unc-29 upregulation. These genetic changes may allow for an increase of nAChRs that contributes to the recovery of motility and enhance resistance.

3.3 Introduction

Neglected tropical diseases (NTDs) are communicable diseases caused by nematode parasites which affect about 2 billion people of the global population. Poverty, inadequate sanitation and in close contact with infectious vectors and domestic animals increased susceptibility to these infections [98-101]. Lymphatic filariasis is one of the neglected tropical diseases caused by Brugia malayi, Wuchereria Bancrofti and Brugia timori. Globally lymphatic filariasis is the second leading cause of permanent and long term disabilities [102]. It has infected around 120 million people in 73 countries, and an estimated 1.34 billion live in areas where lymphatic filariasis is endemic and are at risk of infection. About 40 million people suffer from the painful and disabling clinical manifestations of the disease [89, 102-105]. The parasite microfilaria is transmitted by vector mosquitos; therefore, integrated vector management significantly reduces the spread of infection. Currently, there is no effective vaccine against nematodes, therefore treatment strategies mainly rely on a number of classes of anthelmintic drugs. Many anthelmintic agents are selective and produce spastic paralysis after causing depolarization of the muscle of nematodes [106]. However, development of drug resistance is a major concern [107, 108]. Available treatments kill the parasite larvae (microfilariae) and paralyze the adult worms. But the mechanism of action is poorly understood. Studies are needs to advance the information on the available classical anthelmintic drugs.

Our study investigates the phenotype change and molecular analysis of desensitization can lead to discovery of novel site of action. nAChRs are pentameric ligand gated cation channels, which have a pore in the center and are activated by binding of the neurotransmitter and other 29 cholinergic agonists to their alpha subunits [109]. These ion channels, if they are composed of five identical subunits, are described as homomeric or if these are different heteromeric. Adult B. malayi, possesses levamisole-sensitive nAChRs which are made up of BMA-UNC-38, BMA-

UNC-29, BMA-UNC-63, and BMA-ACR-8 channels [110-112].

Most mode of action studies of anthelmintic drugs have been conducted on the model nematode, Caenorhabditis elegans, which is not a parasite, it is free living nematode. It is evolutionarily distant from parasitic nematodes and it does not possess “parasitism genes” [112].

This separation highlights the need for anthelmintic studies using real parasites, but until now many of the techniques applied on C. elegans have not been tractable in animal parasites.

Recently, there are many more systems for the measurement of nematode movement in vitro, one of them is the worminator system. The Worminator is an image processing computer attached to a high definition video camera for studying phenotypic movement [113]. The worm assay is a computer application utilizing high definition (HD) video as an input to assess motility of macro parasites (i.e. visible to the naked eye) in 12, 24, 48, and 96 well cell culture plates for the purpose of screening of potential anthelmintic drug compounds [114]. The program analyzes differences in worm position from successive video frames to determine the rate of movement using the Lucas–Kanade Optical flow algorithm. The lower the movement, the lower the motility number and more effective the drug is against the parasite.

To characterize and quantify the gene expression changes of treated and control worms, qRT-PCR is a good technique, especially useful for confirming expression of targeted genes.

Detection of amplified product can be done with specific fluorescent probes or with DNA binding dye like SYBR green which is rapid and sensitive. qRT-PCR is a powerful tool to measure differentially expressed transcripts in B. malayi. 30

Levamisole is a cholinergic anthelmintic drug which acts by interfering with the function on nAChRs found at the neuromuscular junctions of nematodes [115, 116]. Evidence point out that levamisole resistance may involve a decrease in the number of nAChRs and/or mutational change in receptor function [117-120]. Therefore, we hypothesized that populations of receptors are dynamic and change to compensate and limit the effects of anthelmintic exposure. We investigated our hypothesis using two strategies, first we applied different concentrations of levamisole to B. malayi to measure motility at different times and concentrations using

Worminator, and to quantify motility relative expression changes of nAChRs subunit genes using qRT-PCR.

3.4 Materials and Methods

To study the phenotype and molecular analysis of desensitization to levamisole in male and female adult B. malayi, we used the following materials and methods. Levamisole hydrochloride was purchased from MP Biomedicals, LLC.

3.4.1 Parasites

Female and male adult B. malayi used in this study were supplied from the NIH/NIAID

Filariasis Research Reagent Resource Center (FR3) College of Veterinary Medicine, University of Georgia, Athens, GA. The worms were maintained in non-phenol red Roswell Park

Memorial Institute (RPMI: Invitrogen) 1640 medium supplemented with 10% heat-inactivated

FBS (Fisher Scientific) and 1% penicillin-streptomycin (Invitrogen) at a temperature of 37 °C in a 5% CO2 incubator. The worms were sorted individually in 24-well microtiter plates containing 1ml of media for the studies of these effects of levamisole on motility.

3.4.2 nAChR Primer Design

Complementary DNA primers were designed from sequences obtained from worm base with Primer3 plus software. The product size of primers for qRT-PCR range between 150-200bp 31

(Table 3.1). We also required that the nucleotides have a maximum GC content of 40%. All primer sets had a calculated annealing temperature of ≥ 58◦C. Primers were ordered from DNA facility at Iowa State University, Department of Molecular Biology. Primer concentration for each primer were resuspended and diluted to a working concentration. Contamination of primers checked using water as control by setting up a PCR with the same primers.

Table 3.1 Primer sequences used for qRT-PCR experiments BP, base pairs; F, forward; R, reverse. Bp size (150-200bp).

nAChR subunits Forward primer Reverse primer

Bma-acr-8 F: 5′ CGGTTTCCAAATTGATGTTC -3′ F: 5′ AGGATACAGGCGTTCATGTC -3′

Bma-unc-38 F: 5′ GTTGCCATTTCAAGTTTGGT-3′ F: 5′ TCGACGGACGGATAGTAGTC -3′

Bma-unc-29 F: 5′ GGCTGCCAGATATCGTTTTA-3′ F: 5′ ACGGGAAGAATTCAACATCA -3′

Bma-unc-63 F: 5′ CAGAAACATTGCTTGGCTTT-3′ F: 5′ AGGTGATTCACAGCATGGAT -3′

Bma-acr-16 F: 5′ CGACCAGGAGTTCATCTCTC-3′ F:5′GAAATTGGGCTCTTTCCATT -3′

Bma-acr-26 F: 5′ GTTCTTCTTGCATTCTCGGT-3′ F:5′TCAAATGGACCACGATGATG -3′

Bma-gapdh F:5′GACGGAGCCGGAGTATGTTGT-3′ F:5′CAAACAATTGGTGGTGCAAG -3′

3.4.3 Worminator assay

Motility phenotypes were measured using Worminator system to quantify simultaneously the movement of the worms in each well of a 24-well plate. To obtain the videos of the movements of each worm for mean motility the worm assay version 1.4 software was used. Worm movement as mean motility unit (MMU) were measured for 30 sec after incubated at different concentrations of levamisole. Our observations revealed that motility in male and female worms is different after incubation with same concentrations of levamisole for four hours. We prepared different stock solutions of levamisole and serially diluted using deionized water to yield working concentrations of 3 ոM, 10 nM, 30 nM, 100 nM, 300 nM, 1 µM, 3 µM, 32

10 µM and 100 µM. One adult B. malayi was added to an individual well of a 24 well cell culture plate. Levamisole (1 µl) solutions were added to each of wells in order to further achieve a final levamisole concentration. Deionized water (1 µl) was added to the negative control wells contained RPMI solution. The prepared plate was then incubated at 37 °C and 5% CO2 for several hours to optimize the temperature. Worminator readings were recorded prior to addition of the drug and immediately following addition of the drug, and at 10 min, 20 min, 30 min,

40min, 50 min ,1 h, 2 h and 4 h post-levamisole treatment.

3.4.4 RNA extraction and reverse transcriptions by PCR

Worms were crushed under liquid nitrogen with a plastic pestle and re-suspended in

Trizole reagent (ambion, Carlsbad, CA). Total RNA was prepared according to the manufacturer’s instructions with minor modifications. The quantity of RNA was measured with

Thermo Scientific Nano-drop using Spectrophotometer (Pharmacia Biotech, Piscataway, NJ).

First-strand complementary DNA was synthesized from total RNA using Invitrogen superscriptTM IV VILOTM master mix (Invitrogen by Thermo Fisher scientific, Vilnius,

Lithuania) according to the manufacturer’s instructions.

3.4.5 SYBR Green quantitative RT-PCR

The PCR reactions were carried out in 96 well microtiter plate wells in a 20 µl reaction volume with PowerUpTM SYBRTM Green Master Mix (applied biosystems, Vilnius, Lithuania) and SsoadvancedTM Universal SYBR Green supermix with optimized concentrations of specific primers. Every assay was performed in triplicate and 1000 ng cDNA was added to each reaction.

The specificity of PCR amplification of each primer pair was confirmed by analyzing PCR products by agarose gel electrophoresis prior to qRT-PCR. Reference, control and target genes were amplified from each cDNA sample using the CFX96 touch real-time PCR detection system and SSO advanced universal SYBR green supermix/PowerUpTM SYBRTM Green Master Mix 33

(BIORAD and Thermo Fisher). The cycling condition were according the manufacturer’s guidelines. An ABI Prism 7500 Sequence Detector (Applied Biosystems, Hercules, CA) was programmed for an initial step of 2 minutes at 50 ◦C and 10 minutes at 95◦C, followed by 40 thermal cycles of 15 second at 95 ◦C and 1 minute at 60 ◦C. The formula used for fold difference calculation was 2-ΔΔCt, where the value of ΔΔCt was the difference in Ct values obtained with control and test samples [121].

3.4.6 Data analysis

The Worminator output is written to two comma separated value (CSV) files; one contains the average motion detected in the individual well for the analyzed period for each well or plate tested, and a second file contains the underlying raw values used in determining the aforementioned averages. The average motility scores for the four technical replicates of each drug concentration were used in the analysis. The average motility for the control wells was calculated by averaging the average motility results of the four negative control wells on each plate. The results for the drug containing wells were analyzed in terms of percent inhibition of motility at each concentration as compared to the control wells, with a higher percentage motility unit inhibition interpreted as a higher level of drug activity (effectiveness). Percentage motility inhibition was calculated using a formula average control motility unit minus average treated motility units divided by average control motility unit times by one hundred.

Average control motility units−Average treated motility units %Motility inhibition = X 100 Average control motility units

Dose response analysis was performed with Graph Pad Prism version 5 using a variable slope nonlinear regression model (Graph Pad Software, La Jolla, California,

USA, http://www.graphpad.com). Drug concentrations were log10 transformed prior to analysis.

The “log (inhibitor) vs response (four parameters) logistic equation” output provided IC50 values, 34 as well as dose response curves for each drug and time point tested. To determine the motility differences between treated and untreated worms, two-way ANOVA and Bonferroni post hoc tests were performed. Whereas for relative expressions of different phenotype, one-way ANOVA and Bonferroni post hoc tests were used to investigate, if there were significant differences between groups treated relative to control and a reference gene Gapdh.

3.5 Results

3.5.1 Expression of nAChR subunit genes at the whole worm level

Preliminary studies were performed to assess the expression level of the nAChR subunits at the whole worm level using PCR. The quality of RNA preparations and cDNA synthesis were assessed by PCR amplification. The expected ∼200 bp products were amplified with female and male cDNA templates (Table 3.1). We designed specific primer and were able to detect amplicons. After Worminator assays were done, worms were frozen at -80oC. RNA extractions and synthesis of cDNA were performed to check the presence of nAChR genes in the whole worms such as Bma-acr-8, Bma-unc-63, Bma-unc-38, Bma-unc-29, Bma-acr-26 and Bma-acr-

16, along with the internal control (Gapdh) (Figure 3-1). After we confirmed the presence of the listed genes in the whole worm, qRT-PCR was run to quantify the expression of nAChR subunits.

Evidently, there are additional subunits present indicating the presence of additional nAChR subtypes. Our objective was to investigate the relative expression of the subunits that constitute the L-, P-, M and N-type receptors.

Figure 3-1 A representative gel picture of whole worm PCR reveals the presence of different nAChR amplicon expression. Presence of mRNA for Bma-acr-16, Bma-acr-26 Bma-unc-29, Bma-unc-38, Bma-unc-63 and Bma-acr-8. gapdh was the internal control for each worm (n = 4, all positive for each gene).

3.5.2 Levamisole transiently inhibits B. malayi motility

Parasite movement is an important indication of the effectiveness of a drug [20][21]22].

We used in vitro B. malayi as a model for assessing the phenotypic changes in motility with time course after levamisole administration. Pretreatment worms were healthy and motile, and 36 their average motility was around 30 mmu. Figure 3-3 shows the effect of levamisole was quick, potent and levamisole incubation immobilizes the worms very quickly. Male and female worms undergo spastic paralysis at low and high concentration of levamisole. But gradually worms recovered from spastic paralysis and then progress to flaccid paralysis over 40 minutes.

We observed a very significant difference between treated and untreated worms during the first hour. Then, the next 3 hours, worms recovered gradually and around 4 hours completely recovered and their movements was similar to untreated worms.

Figure 3-2 In vitro effects of levamisole on the motility of adult female B. malayi a dose response curve observed at the 3 minute time point following. Dose response curve was generated applying the variable slope nonlinear regression model analysis contained in GraphPad Prism 6. IC50 of 10 nM which indicated worms immediately paralyzed by lower concentrations (n = 24).

The dose response curve reveals that motility was inhibited by 50% at around 10 nM, indicating levamisole was initially very potent (Figure 3-2). However, the effects quickly waned with time and the worms completely recovered around 4 hours. Possibly, levamisole causes the nAChRs at the neuromuscular junction to be downregulated or otherwise desensitized [58].

Studies have also revealed that endocytosis of neuromuscular receptors induced by agonist after

5 minutes of drug applications [122]. But, if this was the cause of the effects of desensitization, we need to reason that the relative expression of nAChR subunits would always less than one.

However, in completely desensitized worms, we measured relative expression of some subunits were higher than one. We also need to reason that worms treated with 100 µM levamisole that had recovered from paralysis should also be more resistant to the effects of a second nicotinic agonist.

Figure 3-3 In vitro effects of levamisole on the motility of B. malayi following exposure to various concentrations of levamisole. Visual examination and Worminator assay indicated, the first 10 min all worms were paralyzed which called spastic paralysis; then progresses to flaccid paralysis; and then gradually recovery to normal motility. (two-way ANOVA with Bonferroni post-hoc test, ***P < 0.001, **P < 0.01, *P < 0.05, n = 4 for each concentration). Statistical comparison of between control and 10 µM incubated worms.

3.5.3 Significant up regulation of Bma-unc-38 increases recovery and motility

We did phenotypic observation of different concentrations of levamisole to determine which concentration to use in subsequent experiments. Recovery of worms was quick at higher concentrations of levamisole. We decided to quantify all gene expression changes of nAChRs incubated at 100 µM levamisole. We use Worminator video tracking system to measure motility of worms quantitatively for 30 sec at different intervals of time for 4 hours. (Figure 3.3) MMU

(mean motility unity) of female worms at different time courses. In the first 20 minutes, the movement of worms exposed to levamisole significantly dropped and come under spastic 39 paralysis. Worms stayed under spastic paralysis; then followed by flaccid paralysis and then recovery to normal motility around 4 hours. In the first hour, there was a significant difference between treated and control worms. However, at 4 hours worms were completely desensitized and no significant difference among treated and untreated worms. This indicates that initially levamisole was potent, but with time the effect of the drug was significantly reduced and eventually inefficient. We assessed the nAChR subtypes to quantify gene expression changes and we compared relative gene expression of treated to untreated worms in the presence of internal control.

Figure 3-4 Time-course of the motility of adult female B. malayi following exposure to 100 µM of levamisole. Initially treated worms come under spastic paralysis and then desensitized quickly to significantly recover at 4 h. (two-way ANOVA with Bonferroni post-hoc test, ***P < 0.001, **P < 0.01, *P < 0.05, n = 24).

In completely desensitized female worms, relative expressions of Bma-unc-38 were increased in all experimental results. These observations indicate that Bma-unc-38 upregulation has an essential role in motility and quickly rescued the worms from paralysis. 40

Previous studies showed dsRNA Knock down of Bma-unc-38/ Bma-unc-29 produce motility inhibition that substantiated the role of Bma-unc-38 in motility [123]. However, in our experimental results, we confirmed significant upregulation of Bma-unc-38 rescued the worms from paralysis and enhanced recovery. Increased Bma-unc-29 does not rescue the worms from paralysis.

Figure 3-5 Quantitative gene expression of nAChRs in female B. malayi after incubation for 4 h with 100 µM levamisole and when they were completely desensitized. Bma-unc-38 is significantly up-regulated. This suggests, Bma-unc-38 has an essential role in recovery and motility. Robust expression of Bma-acr-8 and Bma-unc-63 may also contribute in desensitization. (one-way ANOVA with Bonferroni post-hoc test, ***P < 0.001, **P < 0.01, *P < 0.05, n = 11 with three technical replicates).

3.5.4 Worms under flaccid paralysis show significant upregulation of Bma-unc-29

Around one-hour worms changed their phenotype from spastic paralysis to flaccid

paralysis. At this stage, the worms remained in paralysis, but relaxed. The average

motility of each worms during flaccid phase was less than five MMUs and significantly

different from untreated worms (Figure 3-6)

Figure 3-6 Motility of adult female B. malayi versus time in the presence and absence of 100 µM levamisole. In 10 min worms come under spastic paralysis which showed significant differences between untreated and treated worms. After 10 min worms gradually escape from spastic paralysis to flaccid paralysis and then stayed in flaccid stages for around 40 min (see blue line). (two-way ANOVA with Bonferroni post-hoc test, ***P < 0.001, **P < 0.01, *P < 0.05, n = 12).

We investigated changes in relative expression of nAChRs and compared to recovered worms. Worms under flaccid paralysis shows significant upregulations of Bma-unc-29 (Figure

3.7). This indicates upregulations of Bma-unc-29 alone do not rescue worms from paralysis but 42 rescued from spastic paralysis. Therefore, this suggests that, complete recovery and motility of worms exclusively rely on Bma-unc-38 upregulation. Furthermore, Bma-unc-29 subunit is β - subunit and does not form nAChR receptors by itself, it may need an α-subunit to enhance desensitization.

Figure 3-7 B. malayi incubated in 100 µM levamisole for 1 h, showed significant upregulation of Bma-unc-29. Gene expression of the different subunits of the L-, P-, M- and N- nAChRs showing upregulations Bma-unc-29. This suggest that upregulation of Bma-unc-29 alone do not rescue the worms from paralysis. (one-way ANOVA with Bonferroni post-hoc test, ***P < 0.001, **P < 0.01, *P < 0.05, n = 6 with 6 technical replicates).

3.5.5 Desensitization and relative expresssion in male B.malayi

We have investigated levamisole effects on motitliy in male worms. We ran the same experiments as we did in female worms. Worms were exposed to 100 µM of levamisole and 43 motiltiy was measured for 4 hours and relative expressions were assesed. Intially, Motitliy were similar to female worms and levamisole was very effective in male as in female worms. The first 20 minutes worms came under spastic paralysis followed by flaccid paralysis next 40 minutes (Figure 3.8). However, varation in motiltiy was observed at 4 hours, male worms did not compeletely recover. Motility of control and treated were significantly different at 4 hours.

In all observations, male worms did not recoved completely, in contrast female worms recovered completely at 4 hours. This indicates, levamisole is more effective in male worms than female and dthe egree of desensitzation in females was higher than male worms.

Figure 3-8 Motility of adult B. malayi male versus time in the presence and absence of 100 µM levamisole. The mean motility of the male worms shows that initially worms come under spastic paralysis and then progresses to flaccid paralysis; and then partially recovered at 4 hours. The degree of desensitization was not as robust as in female worms, we observed significant difference between control and treated worms. However, worms were motile. (two- way ANOVA with Bonferroni post-hoc test, *** P < 0.001, **P < 0.01, *P < 0.05, n = 12).

To investigate the degree of desensitization,we measured the relative expression change of male worms and we have observed significant upregulation of Bma-unc-38. This suggests that desenstization quickly happens in the presence of robust expression of Bma-acr-8.

Figure 3-9 Quantitative gene expression of nAChRs in male B. malayi after incubated for 4 h in 100 µM levamisole and partially recovered. Bma-unc-38 is significantly up-regulated suggests that an important role in recovery and motility. However, robust expression of Bma-unc-29 together with Bma-unc-38 may form a functional heteromeric receptors which responded to levamisole that may delay recovery (one-way ANOVA with Bonferroni post-hoc test, ***P < 0.001, **P < 0.01, *P < 0.05, n = 4 with three technical replicates).

Figure 3-10 Motility of adult male B. malayi versus time in the presence of 100 µM levamisole. Initially worms come under spastic paralysis which was significantly different from untreated worms. After 10 minutes worms gradually escape from spastic to flaccid paralysis and then stayed in flaccid for around 1 h. (see blue line). ( two-way ANOVA with Bonferroni post-hoc test ***P < 0.001, **P < 0.01, *P < 0.05, n = 12). 46

Figure 3-11 Expression of the different nAChR subunits after 1 h incubation in 100 µM levamisole. However, no statistical significance (one-way ANOVA with Bonferroni post-hoc test, ***P < 0.001, **P < 0.01, *P < 0.05, n = 9 with each three technical replicates).

3.6 Discussion

We have successfully described the effects of levamisole in male and female adult B. malayi using Worminator and qRT-PCR in vitro. The time course of motility and recovery were measured at different concentrations of levamisole. Different phenotype changes were measured and charactrerized and we proceeded to measure nAChR subunit gene expressions changes during post levamisole adminstration and compared to control worms. Investigation of desensitization to anthelmintics using adult B. malayi is the best model, and tractable to study motility and molecular pharmacology of their nAChRs. Essential part was to measure the motility of the worms at different time and charaterize the phenotypic changes to analyze the relative expression changes. 47

3.6.1 Interpretation of the Worminator assay

In vitro assays are the most efficient and cost-effective means of diagnosing and characterizing anthelmintic resistance in nematode populations. The Worminator system is a new computer analysis application , with a HD video that measures levamisole effects and provide informative dose response data. We have described motility of the female and male worms with time course during levamisole incubation. First, we have succesfully characterized the phenotypic change of worms during incubation at different levamisole concentrations.

It has been reported that motility of the adult B. malayi in the presence of levamisole dropped by 85 % in 5 and in 10 min, the worms were completely paralyzed. The motility of the worms however returned to near control values after 60 min in the drug [82]. Our study confirm, we are able to measure motility inhibtion during worms incubated at various concentrations ranging from 3 nM to 100 µM. At 10 nM levamisole inhibited motility by 50 % in 10 min, but the worms showed motility after one hour. Moreover, visual examination of the video showed that during the first minutes all worms immediately come under spastic paralysis at both low and high drug concentrations, then followed to flaccid and finally to recovery and their motility were similar to control worms around 4 hours. This suggests that levamisole is intially very potent and causes spastic paralysis, however the effect of levamisole significantly reduced with time.

Prior study reveals that levamisole acts directly on body wall muscle [124], and they provide new molecular evidence for localization of binding sites for levamisole, which opens L-

AChR ion channels in nematode muscle leading to depolarization, spastic muscle contraction, and paralysis [125],[126]. We have also observed phenotypic changes of the worms after incubation in levamisole that indicates one possible site of levamisole in B.malayi is neuromuscular junction. We have investigated the difference in phenotypic changes with time 48 courses in male and female. Our observation reveals that male worms are more susceptible than female worms to levamisole. The sensitivity differences of male and female to levamisole are complex to comprehend. This suggests nAChR expression varies in male and female after exposure to levamisole. Additional study is needed to assess gender based variation sensitivites that lead to gender based varation in desensitization.

Anthelmintic resistance may arise through a number of factors. The possibilites include desensitization or downregulation of nAChRs at the neuromuscular junction [58]. Agonist- induced endocytosis of receptors has been observed in mammalian tissue [122]. We have measured gene expression to quantify the nAChR subtype changes. Expresssion changes showed differences between male and female worms in most phenotype changes, this highlighted that expression pattern of other subunits may have a role in the desensitization.

Prevous study has reported that Bma-acr-26 was expressed in male muscle but not in female muscle [127]. However, our study showed expresssion of Bma-acr-26 in both male and female and the only variation was expression patterns. In all our observations, Bma-acr-26 expression level was higher in male than female. This suggests that Bma-acr-26 may also form another subtype receptor that binds to levamisole and delays recovery of the male worms. A study done in A. suum reaveals that ACR-26 shared key amino acid residues with loops that form the agonist binding sites with α-7 subunits, this suggested that ACR-26 might form homomeric nAChRs [128].

3.6.2 Gender based variation in desensitization

The Worminator assay and qRT-PCR results showed that variation in degree of desensitization between male and female worms during incubation in levamisole. Using

Worminator, female worms recovered quickly around 4 hours and their motility were equivalent to naive worms. In contrast, male worms did not completely recover at the same hour female 49 recovered. The gender biased difference in motility and desensitization could possibly be due to varation in relative expressions pattern of nAChRs, however senstivity to levamisole was similar in the first hour. We have observed difference in gene expression of subunits in male and female worms. In recovered female and male worms, Bma-unc-38 significantly upregulated and possibly accelerate the recovery of motility. This suggests desenstization of worms is mainly controlled by Bma-unc-38. To confirm the role of Bma-unc-38 in B. malayi we needed to run knock down of Bma-unc-38. Study has reported, worms exposed to Bma-unc-29 / Bma- unc-38 dsRNA significantly reduced their motitliy. These observations suggest that UNC-29 and/or UNC38 are essential for maintaining the motility phenotype. Moreover, sensitivity of levamisole also decreases after Bma-unc-29 and Bma-unc-38 knock down [123]. However, expression pattern of other subunits were different. These varations in relative expression of other subunits could be a reason for varation in degree of desensitization. A study in H. contortus has reported Hco-acr-8 is a key determinant of levamisole sensitivity for parasitic nematodes [64]. Our study shows that Bma-acr-8 expression of female was higher than male.

This indicates that Bma-acr-8 may have an important role in recovery of female worms, and play a pivotal role in vitro and in vivo in the composition and pharmacological properties of L-

AChRs from other parasitic nematodes. The potential modulation of levamisole sensitivity associated with Hco-acr-8 gene silencing was investigated in H. contortus L2 larvae using levamisole concentrations corresponding to the minimal efficient doses leading to reduction in motility. Strikingly, for both levamisole concentrations, Hco-acr-8 silenced larvae showed a reduction of levamisole sensitivity in comparison with the control larvae not subjected to silencing. This provides the first in vivo evidence for a key role of ACR-8 in the levamisole sensitivity of a parasitic nematode. Besides, robust Bma-acr-8 expression in female, the study 50 showed expression of Bma-acr-26 in male worms only [129]. However, our study recorded expresssion of Bma-acr-26 in male and female worms. The only variation was expression patterns in male worm were very robust which substantiate previous study performed in B. malayi [129]. In all our experiment, expression levels of male Bma-acr-26 were higher than female expression levels.

In most experiments, worms recovered around 4 hours, and recovery was strongly associated to Bma-unc-38. We have investigated relative expressions of Bma-acr-16 and Bma- acr-26 in male and female. Though, these are not subunits of nAChR that form the L-type receptor. Our study suggests, desensitization abundantly relies on Bma-unc-38 upregulation, but varation in desensitization may be also affected by the expression level of other subunits.

However further study is needed to confirm. Further investigations of Bma-acr-8 by dsRNA knock down in female worms may give additional information. In male worms, we observed robust upregulations of Bma-acr-26, whereas in female was not. These subunits may not directly involve in desensitization, but co-expression with other subunits may form another subtype receptor. Study had reported on B. malayi by knocked down acr16+unc-26 and they found that there was little effect on motility in contrast to knockdown of Bma-unc-38 / Bma- unc-29 [123].

In female worms under flaccid paralysis, we observed a siginificant upregulation of

Bma-unc-29 that did not rescue the worms from paralysis. This suggests that variation in motility and desensitization may be due to upregulation of Bma-unc-38. So far the role of Bma- unc-38 was studied in female worms but, we need to investigate the role of Bma-unc-29 and

Bma -acr-8 by dsRNA knock down in male worms as well. 51

Another possible causes of variation of resistance is pharmacokinetic differences in male and female. Change in drug metabolism, resulting in inactivation or activation, decrease or increase drug elimination; modification in drug distribution, reducing bioavailability to target tissues; and/or target gene amplification of the nAChR subunits in order to overcome drug action [130].

3.7 References

1. Prichard RK. Mode of action of anthelminthic thiabendazole in haemonchus-contortus. Nature. 1970;228(5272):684-+. doi: 10.1038/228684a0. PubMed PMID: WOS:A1970H740000053.

3. Lacey E. Mode of action of benzimidazoles. Parasitology Today. 1990;6(4):112-5. doi: 10.1016/0169-4758(90)90227-u. PubMed PMID: WOS:A1990DA15600006.

6. Martin RJ. Modes of action of anthelmintic drugs. Veterinary Journal. 1997;154(1):11-34. doi: 10.1016/s1090-0233(05)80005-x. PubMed PMID: WOS:A1997XL02900004.

11. Harder A, Holden-Dye L, Walker R, Wunderlich F. Mechanisms of action of emodepside. Parasitology research. 2005;97 Suppl 1:S1-S10. doi: 10.1007/s00436-005-1438-z. PubMed PMID: MEDLINE:16228263.

15. Hopla CE, Durden LA, Keirans JE. Ectoparasites and classification. Revue Scientifique Et Technique De L Office International Des Epizooties. 1994;13(4):985-1017. doi: 10.20506/rst.13.4.815. PubMed PMID: WOS:A1994QB92200002.

16. Zhang Z-Q, Hooper JNA, Van Soest RWM, Pisera A, Crowther AL, Tyler S, et al. Animal biodiversity: An outline of higher-level classification and taxonomic richness. Zootaxa. 2011;(3148):7- 237. doi: 10.11646/zootaxa.3148.1.3. PubMed PMID: WOS:000209467300001.

17. Johnston KL, Ford L, Taylor MJ. Overcoming the Challenges of Drug Discovery for Neglected Tropical Diseases: The A.WOL Experience. Journal of Biomolecular Screening. 2014;19(3):335-43. doi: 10.1177/1087057113511270. PubMed PMID: WOS:000330756600001.

18. Hotez PJ, Fenwick A, Savioli L, Molyneux DH. Rescuing the bottom billion through control of neglected tropical diseases. Lancet. 2009;373(9674):1570-5. doi: 10.1016/s0140-6736(09)60233-6. PubMed PMID: WOS:000265710300036.

19. Chan MS. The global burden of intestinal nematode infections - Fifty years on. Parasitology Today. 1997;13(11):438-43. doi: 10.1016/s0169-4758(97)01144-7. PubMed PMID: WOS:A1997YE09000011.

20. Fitzpatrick JL. Global food security: The impact of veterinary parasites and parasitologists. Veterinary Parasitology. 2013;195(3-4):233-48. doi: 10.1016/j.vetpar.2013.04.005. PubMed PMID: WOS:000322413300005.

21. Hotez PJ, Kamath A. Neglected Tropical Diseases in Sub-Saharan Africa: Review of Their Prevalence, Distribution, and Disease Burden. Plos Neglected Tropical Diseases. 2009;3(8). doi: 10.1371/journal.pntd.0000412. PubMed PMID: WOS:000269220900003. 53

22. Knopp S, Steinmann P, Hatz C, Keiser J, Utzinger J. Nematode Infections: Filariases. Infectious Disease Clinics of North America. 2012;26(2):359-+. doi: 10.1016/j.idc.2012.02.005. PubMed PMID: WOS:000305853100012.

23. Mak JW. Epidemiology of lymphatic filariasis. Ciba Foundation Symposia. 1987;127:5-14. PubMed PMID: WOS:A1987K911700002.

24. Wynd S, Melrose WD, Durrheim DN, Carron J, Gyapong M. Understanding the community impact of lymphatic filariasis: a review of the sociocultural literature. Bulletin of the World Health Organization. 2007;85(6):493-8. doi: 10.2471/blt.06.031047. PubMed PMID: WOS:000248813700015.

25. Fenwick A. The global burden of neglected tropical diseases. Public Health. 2012;126(3):233-6. doi: 10.1016/j.puhe.2011.11.015. PubMed PMID: WOS:000301376000017.

26. Nutman TB. Insights into the Pathogenesis of Disease in Human Lymphatic Filariasis. Lymphatic Research and Biology. 2013;11(3):144-8. doi: 10.1089/lrb.2013.0021. PubMed PMID: WOS:000324477300007.

27. Babu S, Nutman TB. Immunopathogenesis of lymphatic filarial disease. Seminars in Immunopathology. 2012;34(6):847-61. doi: 10.1007/s00281-012-0346-4. PubMed PMID: WOS:000310988000009.

28. Shenoy RK. Clinical and pathological aspects of filarial lymphedema and its management. Korean Journal of Parasitology. 2008;46(3):119-25. doi: 10.3347/kjp.2008.46.3.119. PubMed PMID: WOS:000259500600001.

29. Bandyopadhyay L. Lymphatic filariasis and the women of India. Social Science & Medicine. 1996;42(10):1401-10. doi: 10.1016/0277-9536(95)00288-x. PubMed PMID: WOS:A1996UM37300006.

30. Coreil J, Mayard G, Louis-Charles J, Addiss D. Filarial elephantiasis among Haitian women: social context and behavioural factors in treatment. Tropical Medicine & International Health. 1998;3(6):467-73. doi: 10.1046/j.1365-3156.1998.00238.x. PubMed PMID: WOS:000074449500007.

31. Gyapong M, Gyapong JO, Adjei S, Vlassoff C, Weiss M. Filariasis in northern Ghana: Some cultural beliefs and practices and their implications for disease control. Social Science & Medicine. 1996;43(2):235-42. doi: 10.1016/0277-9536(95)00365-7. PubMed PMID: WOS:A1996VA08300009.

32. Hawking F, Pattanayak S, Sharma HL. Periodicity of microfilariae .11. effect of body temperature and other stimuli upon cycles of wuchereria bancrofti brugia malayi b ceylonensis and dirofilaria repens. Transactions of the Royal Society of Tropical Medicine and Hygiene. 1966;60(4):497-+. doi: 10.1016/0035-9203(66)90275-6. PubMed PMID: WOS:A19668162400033.

33. El-Moamly AAR, El-Sweify MA, Hafez MA. Using the AD12-ICT rapid-format test to detect Wuchereria bancrofti circulating antigens in comparison to Og4C3-ELISA and nucleopore membrane filtration and microscopy techniques. Parasitology Research. 2012;111(3):1379-83. doi: 10.1007/s00436- 012-2870-5. PubMed PMID: WOS:000308112300049.

34. Rocha A, Braga C, Belem M, Carrera A, Aguiar-Santos A, Oliveira P, et al. Comparison of tests for the detection of circulating filarial antigen (Og4C3-ELISA and AD12-ICT) and ultrasound in diagnosis of lymphatic filariasis in individuals with microfilariae. Memorias Do Instituto Oswaldo Cruz. 2009;104(4):621-5. doi: 10.1590/s0074-02762009000400015. PubMed PMID: WOS:000269466900015. 54

35. Wattal S, Dhariwal AC, Ralhan PK, Tripathi VC, Regu K, Kamal S, et al. Evaluation of Og4C3 antigen ELISA as a tool for detection of bancroftian filariasis under lymphatic filariasis elimination programme. The Journal of communicable diseases. 2007;39(2):75-84. PubMed PMID: MEDLINE:18338684.

36. Melrose WD, Durrheim DD, Burgess GW. Update on immunological tests for lymphatic filariasis. Trends in Parasitology. 2004;20(6):255-7. doi: 10.1016/j.pt.2004.04.002. PubMed PMID: WOS:000222043100003.

37. Weil GJ, Ramzy RMR. Diagnostic tools for filariasis elimination programs. Trends in Parasitology. 2007;23(2):78-82. doi: 10.1016/j.pt.2006.12.001. PubMed PMID: WOS:000244396300011.

38. Cunningham J, Hasker E, Das P, El Safi S, Goto H, Mondal D, et al. A Global Comparative Evaluation of Commercial Immunochromatographic Rapid Diagnostic Tests for Visceral Leishmaniasis. Clinical Infectious Diseases. 2012;55(10):1312-9. doi: 10.1093/cid/cis716. PubMed PMID: WOS:000310374600012.

39. Weil GJ, Jain DC, Santhanam S, Malhotra A, Kumar H, Sethumadhavan KVP, et al. A Monoclonal antibody-based enzyme-immunoassay for detecting parasite antigenemia in bancroftian filariasis. Journal of Infectious Diseases. 1987;156(2):350-5. doi: 10.1093/infdis/156.2.350. PubMed PMID: WOS:A1987J144600014.

40. Wijegunawardana AD, Gunawardane NS, Hapuarachchi C, Manamperi A, Gunawardena K, Abeyewickrama W. Evaluation of PCR-ELISA as a tool for monitoring transmission of Wuchereria bancrofti in District of Gampaha, Sri Lanka. Asian Pacific Journal of Tropical Biomedicine. 2013;3(5):381-7. PubMed PMID: BCI:BCI201300265378.

41. Steel C, Golden A, Kubofcik J, LaRue N, de los Santos T, Domingo GJ, et al. Rapid Wuchereria bancrofti-Specific Antigen Wb123-Based IgG4 Immunoassays as Tools for Surveillance following Mass Drug Administration Programs on Lymphatic Filariasis. Clinical and Vaccine Immunology. 2013;20(8):1155-61. doi: 10.1128/cvi.00252-13. PubMed PMID: WOS:000322316800008.

42. Steel C, Kubofcik J, Ottesen EA, Nutman TB. Antibody to the Filarial Antigen Wb123 Reflects Reduced Transmission and Decreased Exposure in Children Born following Single Mass Drug Administration (MDA). Plos Neglected Tropical Diseases. 2012;6(12). doi: 10.1371/journal.pntd.0001940. PubMed PMID: WOS:000312910200013.

43. Taylor MJ. A new insight into the pathogenesis of filarial disease. Current Molecular Medicine (Hilversum). 2002;2(3):299-302. doi: 10.2174/1566524024605662. PubMed PMID: BCI:BCI200200350312.

44. Moore TA, Reynolds JC, Kenney RT, Johnston W, Nutman TB. Diethylcarbamazine-induced reversal of early lymphatic dysfunction in a patient with bancroftian filariasis: Assessment with use of lymphoscintigraphy. Clinical Infectious Diseases. 1996;23(5):1007-11. doi: 10.1093/clinids/23.5.1007. PubMed PMID: WOS:A1996VQ90600011.

45. Mand S, Debrah AY, Klarmann U, Batsa L, Marfo-Debrekyei Y, Kwarteng A, et al. Doxycycline Improves Filarial Lymphedema Independent of Active Filarial Infection: A Randomized Controlled Trial. Clinical Infectious Diseases. 2012;55(5):621-30. doi: 10.1093/cid/cis486. PubMed PMID: WOS:000307498300003. 55

46. Mand S, Pfarr K, Sahoo PK, Satapathy AK, Specht S, Klarmann U, et al. Macrofilaricidal Activity and Amelioration of Lymphatic Pathology in Bancroftian Filariasis after 3 Weeks of Doxycycline Followed by Single-Dose Diethylcarbamazine. American Journal of Tropical Medicine and Hygiene. 2009;81(4):702-11. doi: 10.4269/ajtmh.2009.09-0155. PubMed PMID: WOS:000270474000031.

47. Taylor MJ, Hoerauf A. A new approach to the treatment of filariasis. Current Opinion in Infectious Diseases. 2001;14(6):727-31. doi: 10.1097/00001432-200112000-00011. PubMed PMID: WOS:000172663200011.

48. Dembele B, Coulibaly YI, Dolo H, Konate S, Coulibaly SY, Sanogo D, et al. Use of High-Dose, Twice-Yearly Albendazole and Ivermectin to Suppress Wuchereria bancrofti Microfilarial Levels. Clinical Infectious Diseases. 2010;51(11):1229-35. doi: 10.1086/657063. PubMed PMID: WOS:000283850200003.

49. Ottesen EA, Duke BOL, Karam M, Behbehani K. Strategies and tools for the control/elimination of lymphatic filariasis. Bulletin of the World Health Organization. 1997;75(6):491-503. PubMed PMID: WOS:000072149000001.

50. Awadzi K, Gilles HM. Diethylcarbamazine in the treatment of patients with onchocerciasis. British Journal of Clinical Pharmacology. 1992;34(4):281-8. doi: 10.1111/j.1365-2125.1992.tb05632.x. PubMed PMID: WOS:A1992JT32600001.

51. Bhalla D, Dumas M, Preux P-M. Neurological manifestations of filarial infections. Handbook of clinical neurology. 2013;114:235-42. doi: 10.1016/b978-0-444-53490-3.00018-2. PubMed PMID: MEDLINE:23829914.

52. Changeux J-P. The Nicotinic Acetylcholine Receptor: The Founding Father of the Pentameric Ligand-gated Ion Channel Superfamily. Journal of Biological Chemistry. 2012;287(48):40207-15. doi: 10.1074/jbc.R112.407668. PubMed PMID: WOS:000311448800012.

53. Karlin A. Emerging structure of the nicotinic acetylcholine receptors. Nature Reviews Neuroscience. 2002;3(2):102-14. doi: 10.1038/nrn731. PubMed PMID: WOS:000173726300017.

54. Brown LA, Jones AK, Buckingham SD, Mee CJ, Sattelle DB. Contributions from Caenorhabditis elegans functional genetics to antiparasitic drug target identification and validation: Nicotinic acetylcholine receptors, a case study. International Journal for Parasitology. 2006;36(6):617-24. doi: 10.1016/j.ijpara.2006.01.016. PubMed PMID: WOS:000238551300002.

55. Unwin N. Refined structure of the nicotinic acetylcholine receptor at 4 angstrom resolution. Journal of Molecular Biology. 2005;346(4):967-89. doi: 10.1016/j.jmb.2004.12.031. PubMed PMID: WOS:000227187800003.

56. Corringer PJ, Bertrand S, Bohler S, Edelstein SJ, Changeux JP, Bertrand D. Critical elements determining diversity in agonist binding and desensitization of neuronal nicotinic acetylcholine receptors. Journal of Neuroscience. 1998;18(2):648-57. PubMed PMID: WOS:000071414200008.

57. Bouzat C. New insights into the structural bases of activation of Cys-loop receptors. Journal of Physiology-Paris. 2012;106(1-2):23-33. doi: 10.1016/j.jphysparis.2011.09.012. PubMed PMID: WOS:000305111000004. 56

58. Taly A, Corringer PJ, Guedin D, Lestage P, Changeux JP. Nicotinic receptors: allosteric transitions and therapeutic targets in the nervous system. Nature Reviews Drug Discovery. 2009;8(9):733- 50. doi: 10.1038/nrd2927. PubMed PMID: WOS:000269413100019.

59. Harrow ID, Gration KAF. Mode of action of the anthelmintics morantel, pyrantel and levamisole on muscle-cell membrane of the nematode ascaris-suum. Pesticide Science. 1985;16(6):662-72. doi: 10.1002/ps.2780160612. PubMed PMID: WOS:A1985AXH8500011.

60. Colquhoun L, Holdendye L, Walker RJ. The Pharmacology of cholinoceptors on the somatic muscle-cells of the parasitic nematode ascaris-suum. Journal of Experimental Biology. 1991;158:509-30. PubMed PMID: WOS:A1991FW63800029.

61. Qian H, Martin RJ, Robertson AP. Pharmacology of N-, L-, and B-subtypes of nematode nAChR resolved at the single-channel level in Ascaris suum. Faseb Journal. 2006;20(14):2606-+. doi: 10.1096/fj.06-6264fje. PubMed PMID: WOS:000242490700039.

62. Robertson AP, Clark CL, Burns TA, Thompson DP, Geary TG, Trailovic SM, et al. Paraherquamide and 2-deoxy-paraherquamide distinguish cholinergic receptor subtypes in ascaris muscle (vol 302, pg 853, 2002). Journal of Pharmacology and Experimental Therapeutics. 2002;303(2):888-. PubMed PMID: WOS:000178684800056.

63. Robertson AP, Puttachary S, Martin RJ. Single-channel recording from adult Brugia malayi. Invertebrate Neuroscience. 2011;11(1):53-7. doi: 10.1007/s10158-011-0118-1. PubMed PMID: WOS:000290964100006.

64. Fauvin A, Charvet C, Issouf M, Cortet J, Cabaret J, Neveu C. cDNA-AFLP analysis in levamisole- resistant Haemonchus contortus reveals alternative splicing in a nicotinic acetylcholine receptor subunit. Molecular and Biochemical Parasitology. 2010;170(2):105-7. doi: 10.1016/j.molbiopara.2009.11.007. PubMed PMID: WOS:000275224400007.

65. Holden-Dye L, Walker RJ. Anthelmintic drugs and nematicides: studies in Caenorhabditis elegans. WormBook : the online review of C elegans biology. 2014:1-29. doi: 10.1895/wormbook.1.143.2. PubMed PMID: MEDLINE:25517625.

66. Castro GA. Helminths structure classification growth and development. Baron, S (Ed) Medical Microbiology, Third Edition Xx+1340p Churchill Livingstone: New York, New York, USA; London, England, Uk Illus. 1991:1065-75. PubMed PMID: BCI:BCI199242091420.

67. Hotez PJ, Brindley PJ, Bethony JM, King CH, Pearce EJ, Jacobson J. Helminth infections: the great neglected tropical diseases. Journal of Clinical Investigation. 2008;118(4):1311-21. doi: 10.1172/jci34261. PubMed PMID: WOS:000254588600023.

68. Wang LJ, Cao Y, Shi HN. Helminth infections and intestinal inflammation. World Journal of Gastroenterology. 2008;14(33):5125-32. doi: 10.3748/wjg.14.5125. PubMed PMID: WOS:000259091000004.

69. Pink R, Hudson A, Mouries MA, Bendig M. Opportunities and challenges in antiparasitic drug discovery. Nature Reviews Drug Discovery. 2005;4(9):727-40. doi: 10.1038/nrd1824. PubMed PMID: WOS:000232340800021. 57

70. DiMasi JA, Hansen RW, Grabowski HG. The price of innovation: new estimates of drug development costs. Journal of Health Economics. 2003;22(2):151-85. doi: 10.1016/s0167- 6296(02)00126-1. PubMed PMID: WOS:000181521300002.

71. Evans AM, Martin RJ. Activation and cooperative multi-ion block of single nicotinic- acetylcholine channel currents of Ascaris muscle by the tetrahydropyrimidine anthelmintic, morantel. British Journal of Pharmacology. 1996;118(5):1127-40. doi: 10.1111/j.1476-5381.1996.tb15515.x. PubMed PMID: WOS:A1996UX11100006.

72. Martin RJ, Robertson AP, Buxton SK, Beech RN, Charvet CL, Neveu C. Levamisole receptors: a second awakening. Trends in Parasitology. 2012;28(7):289-96. doi: 10.1016/j.pt.2012.04.003. PubMed PMID: WOS:000306252200005.

73. Morgan S, Grootendorst P, Lexchin J, Cunningham C, Greyson D. The cost of drug development: A systematic review. Health Policy. 2011;100(1):4-17. doi: 10.1016/j.healthpol.2010.12.002. PubMed PMID: WOS:000289220800002.

74. Crump A, Omura S. Ivermectin, 'Wonder drug' from Japan: the human use perspective. Proceedings of the Japan Academy Series B-Physical and Biological Sciences. 2011;87(2):13-28. doi: 10.2183/pjab.87.13. PubMed PMID: WOS:000288185000001.

75. Geary TG. Ivermectin 20 years on: maturation of a wonder drug. Trends in Parasitology. 2005;21(11):530-2. doi: 10.1016/j.pt.2005.08.014. PubMed PMID: WOS:000233212900012.

76. Omura S. Ivermectin: 25 years and still going strong. International Journal of Antimicrobial Agents. 2008;31(2):91-8. doi: 10.1016/j.ijantimicag.2007.08.023. PubMed PMID: WOS:000253225400001.

77. Raeymaek.Ah, Allewijn FT, Vandenbe.J, Demoen PJA, Vanoffen.Tt, Janssen PAJ. Novel broad- spectrum anthelmintics . tetramisole and related derivatives of 6-arylimidazo 2,1-b)thiazole. Journal of Medicinal Chemistry. 1966;9(4):545-+. doi: 10.1021/jm00322a023. PubMed PMID: WOS:A19667902100023.

78. Thienpont D, Brugmans J, Abadi K, Tanamal S. Tetramisole in treatment of nematode infections in man. American Journal of Tropical Medicine and Hygiene. 1969;18(4P1):520-+. doi: 10.4269/ajtmh.1969.18.520. PubMed PMID: WOS:A1969D758900008.

79. Van Den Bossche H, Janssen PAJ. The biochemical mechanism of action of the anthelmintic drug tetramisole. Life Sci. 1967;6((16 Pt. 2)):1781-92. doi: 10.1016/0024-3205(67)90150-6. PubMed PMID: BCI:BCI19684900058182.

80. Robertson AP, Bjorn HE, Martin RJ. Resistance to levamisole resolved at the single-channel level. Faseb Journal. 1999;13(6):749-60. PubMed PMID: WOS:000079527200016.

81. Robertson SJ, Martin RJ. Levamisole-activated single-channel currents from muscle of the nematode parasite ascaris-suum. British Journal of Pharmacology. 1993;108(1):170-8. doi: 10.1111/j.1476-5381.1993.tb13458.x. PubMed PMID: WOS:A1993KF00100030.

82. Robertson AP, Buxton SK, Martin RJ. Whole-cell patch-clamp recording of nicotinic acetylcholine receptors in adult Brugia malayi muscle. Parasitology International. 2013;62(6):616-8. doi: 10.1016/j.parint.2013.03.008. PubMed PMID: WOS:000326423400026. 58

83. Sangster NC, Gill J. Pharmacology of anthelmintic resistance. Parasitology Today. 1999;15(4):141-6. doi: 10.1016/s0169-4758(99)01413-1. PubMed PMID: WOS:000079407100006.

84. Coles GC, Jackson F, Pomroy WE, Prichard RK, von Samson-Himmelstjerna G, Silvestre A, et al. The detection of anthelmintic resistance in nematodes of veterinary importance. Veterinary Parasitology. 2006;136(3-4):167-85. doi: 10.1016/j.vetpar.2005.11.019. PubMed PMID: WOS:000236342800001.

85. Geerts S, Gryseels B. Drug resistance in human helminths: Current situation and lessons from livestock. Clinical Microbiology Reviews. 2000;13(2):207-+. doi: 10.1128/cmr.13.2.207-222.2000. PubMed PMID: WOS:000086683500003.

86. Geerts S, Gryseels B. Anthelmintic resistance in human helminths: a review. Tropical Medicine & International Health. 2001;6(11):915-21. doi: 10.1046/j.1365-3156.2001.00774.x. PubMed PMID: WOS:000172100000011.

87. Sangster NC. Anthelmintic resistance: past, present and future. International Journal for Parasitology. 1999;29(1):115-24. doi: 10.1016/s0020-7519(98)00188-x. PubMed PMID: WOS:000077976900016.

88. Conway DP. Variance in effectiveness of thiabendazole against haemonchus contortus in sheep. American Journal of Veterinary Research. 1964;25(106):844-&. PubMed PMID: WOS:A19643710A00009.

89. Kaplan RM. Drug resistance in nematodes of veterinary importance: a status report. Trends in Parasitology. 2004;20(10):477-81. doi: 10.1016/j.pt.2004.08.001. PubMed PMID: WOS:000224257600005.

90. Gilleard JS. Understanding anthelmintic resistance: The need for genomics and genetics. International Journal for Parasitology. 2006;36(12):1227-39. doi: 10.1016/j.ijpara.2006.06.010. PubMed PMID: WOS:000241298800001.

91. Jabbar A, Iqbal Z, Kerboeuf D, Muhammad G, Khan MN, Afaq M. Anthelmintic resistance: The state of play revisited. Life Sciences. 2006;79(26):2413-31. doi: 10.1016/j.lfs.2006.08.010. PubMed PMID: WOS:000242565600001.

92. James CE, Hudson AL, Davey MW. Drug resistance mechanisms in helminths: is it survival of the fittest? Trends in Parasitology. 2009;25(7):328-35. doi: 10.1016/j.pt.2009.04.004. PubMed PMID: WOS:000268378200008.

93. Wolstenholme AJ, Fairweather I, Prichard R, von Samson-Himmelstjerna G, Sangster NC. Drug resistance in veterinary helminths. Trends in Parasitology. 2004;20(10):469-76. doi: 10.1016/j.pt.2004.07.010. PubMed PMID: WOS:000224257600004.

94. Shalaby HA. Anthelmintics Resistance; How to Overcome it? Iranian Journal of Parasitology. 2013;8(1):18-32. PubMed PMID: WOS:000317132200002.

95. Coles GC. Anthelmintic resistance - looking to the future: a UK perspective. Research in Veterinary Science. 2005;78(2):99-108. doi: 10.1016/j.rvsc.2004.09.001. PubMed PMID: WOS:000227005500001. 59

96. Leathwick DM, Hosking BC, Bisset SA, McKay CH. Managing anthelmintic resistance: Is it feasible in New Zealand to delay the emergence of resistance to a new anthelmintic class? New Zealand Veterinary Journal. 2009;57(4):181-92. doi: 10.1080/00480169.2009.36900. PubMed PMID: WOS:000268542900002.

97. Kohler P. The biochemical basis of anthelmintic action and resistance. International Journal for Parasitology. 2001;31(4):336-45. doi: 10.1016/s0020-7519(01)00131-x. PubMed PMID: WOS:000168419500003.

98. Bethony J, Brooker S, Albonico M, Geiger SM, Loukas A, Diemert D, et al. Soil-transmitted helminth infections: ascariasis, trichuriasis, and hookworm. Lancet. 2006;367(9521):1521-32. Epub 2006/05/09. doi: 10.1016/s0140-6736(06)68653-4. PubMed PMID: 16679166.

99. Hotez P. Hookworm and poverty. Ann N Y Acad Sci. 2008;1136:38-44. Epub 2007/10/24. doi: 10.1196/annals.1425.000. PubMed PMID: 17954674.

100. Hotez PJ. Neglected diseases and poverty in "The Other America": the greatest health disparity in the United States? PLoS Negl Trop Dis. 2007;1(3):e149. Epub 2007/12/28. doi: 10.1371/journal.pntd.0000149. PubMed PMID: 18160982; PubMed Central PMCID: PMCPMC2154393.

101. Hotez PJ. Neglected infections of poverty in the United States of America. PLoS Negl Trop Dis. 2008;2(6):e256. Epub 2008/06/26. doi: 10.1371/journal.pntd.0000256. PubMed PMID: 18575621; PubMed Central PMCID: PMCPMC2430531.

102. Khowawisetsut L, Sarasombath PT, Thammapalo S, Loymek S, Korbarsa T, Nochote H, et al. Therapeutic trial of doxycyclin plus ivermectin for the treatment of Brugia malayi naturally infected cats. Veterinary Parasitology. 2017;245:42-7. doi: https://doi.org/10.1016/j.vetpar.2017.08.009.

103. DeClercq D, Sacko M, Behnke J, Gilbert F, Dorny P, Vercruysse J. Failure of mebendazole in treatment of human hookworm infections in the southern region of Mali. American Journal of Tropical Medicine and Hygiene. 1997;57(1):25-30. doi: 10.4269/ajtmh.1997.57.25. PubMed PMID: WOS:A1997XM90700005.

104. Kopp SR, Kotze AC, McCarthy JS, Coleman GT. High-level pyrantel resistance in the hookworm Ancylostoma caninum. Veterinary Parasitology. 2007;143(3-4):299-304. doi: 10.1016/j.vetpar.2006.08.036. PubMed PMID: WOS:000244440500014.

105. Osei-Atweneboano MY, Eng JKL, Boakye DA, Gyapong JO, Prichard RK. Prevalence and intensity of Onchocerca volvulus infection and efficacy of ivermectin in endemic communities in Ghana: a two-phase epidemiological study. Lancet. 2007;369(9578):2021-9. doi: 10.1016/s0140-6736(07)60942- 8. PubMed PMID: WOS:000247354400026.

106. Aceves J, Erlij D, Martinez-Maranon R. The mechanism of the paralysing action of tetramisole on Ascaris somatic muscle. Br J Pharmacol. 1970;38(3):602-7. Epub 1970/05/01. doi: 10.1111/j.1476- 5381.1970.tb10601.x. PubMed PMID: 5445688; PubMed Central PMCID: PMCPMC1702578.

107. Reynoldson JA, Behnke JM, Pallant LJ, Macnish MG, Gilbert F, Giles S, et al. Failure of pyrantel in treatment of human hookworm infections (Ancylostoma duodenale) in the Kimberley region of North West Australia. Acta Tropica. 1997;68(3):301-12. doi: 10.1016/s0001-706x(97)00106-x. PubMed PMID: WOS:000071684300006. 60

108. Matthews JB. Anthelmintic resistance in equine nematodes. International Journal for Parasitology-Drugs and Drug Resistance. 2014;4(3):310-5. doi: 10.1016/j.ijpddr.2014.10.003. PubMed PMID: WOS:000347618400019.

109. Grando SA, Horton RM, Mauro TM, Kist DA, Lee TX, Dahl MV. Activation of Keratinocyte Nicotinic Cholinergic Receptors Stimulates Calcium Influx and Enhances Cell Differentiation. Journal of Investigative Dermatology. 1996;107(3):412-8. doi: https://doi.org/10.1111/1523-1747.ep12363399.

110. Robertson A, Puttachary S, Martin R. Single-channel recording from adult Brugia malayi2011. 53-7 p.

111. Robertson AP, Buxton SK, Martin RJ. Whole-cell patch-clamp recording of nicotinic acetylcholine receptors in adult Brugia malayi muscle. Parasitol Int. 2013;62(6):616-8. Epub 2013/04/09. doi: 10.1016/j.parint.2013.03.008. PubMed PMID: 23562945; PubMed Central PMCID: PMCPMC3744629.

112. Coghlan A. Nematode genome evolution. WormBook. 2005:1-15. doi: 10.1895/wormbook.1.15.1. PubMed PMID: 18050393.

113. Storey B, Marcellino C, Miller M, Maclean M, Mostafa E, Howell S, et al. Utilization of computer processed high definition video imaging for measuring motility of microscopic nematode stages on a quantitative scale: “The Worminator”. International Journal for Parasitology: Drugs and Drug Resistance. 2014;4(3):233-43. doi: https://doi.org/10.1016/j.ijpddr.2014.08.003.

114. Marcellino C, Gut J, Lim KC, Singh R, McKerrow J, Sakanari J. WormAssay: A Novel Computer Application for Whole-Plate Motion-based Screening of Macroscopic Parasites. PLOS Neglected Tropical Diseases. 2012;6(1):e1494. doi: 10.1371/journal.pntd.0001494.

115. Martin RJ.

116. Coles GC, East JM, Jenkins SN. The mechanism of action of the anthelmintic levamisole. General Pharmacology: The Vascular System. 1975;6(4):309-13. doi: https://doi.org/10.1016/0306- 3623(75)90030-0.

117. Lewis JA, Wu CH, Levine JH, Berg H. Levamisole-resistant mutants of the nematode Caenorhabditis elegans appear to lack pharmacological acetylcholine receptors. Neuroscience. 1980;5(6):967-89. Epub 1980/01/01. PubMed PMID: 7402460.

118. Lewis JA, Elmer JS, Skimming J, McLafferty S, Fleming J, McGee T. Cholinergic receptor mutants of the nematode Caenorhabditis elegans. The Journal of Neuroscience. 1987;7(10):3059. doi: 10.1523/JNEUROSCI.07-10-03059.1987.

119. Sangster NC, Riley FL, Collins GH. Investigation of the mechanism of levamisole resistance in trichostrongylid nematodes of sheep. International Journal for Parasitology. 1988;18(6):813-8. doi: https://doi.org/10.1016/0020-7519(88)90123-3.

120. Robertson AP, Bjorn HE, Martin RJ. Resistance to levamisole resolved at the single-channel level. Faseb j. 1999;13(6):749-60. Epub 1999/03/30. doi: 10.1096/fasebj.13.6.749. PubMed PMID: 10094935. 61

121. Ririe KM, Rasmussen RP, Wittwer CT. Product differentiation by analysis of DNA melting curves during the polymerase chain reaction. Analytical Biochemistry. 1997;245(2):154-60. doi: 10.1006/abio.1996.9916. PubMed PMID: WOS:A1997WK04100007.

122. John PAS, Gordon H. Agonists cause endocytosis of nicotinic acetylcholine receptors on cultured myotubes. Journal of Neurobiology. 2001;49(3):212-23. doi: 10.1002/neu.1076. PubMed PMID: WOS:000171825500005.

123. Verma S, Kashyap SS, Robertson AP, Martin RJ. Functional genomics in Brugia malayi reveal diverse muscle nAChRs and differences between cholinergic anthelmintics. Proceedings of the National Academy of Sciences of the United States of America. 2017;114(21):5539-44. doi: 10.1073/pnas.1619820114. PubMed PMID: WOS:000401797800066.

124. Richmond JE, Jorgensen EM. One GABA and two acetylcholine receptors function at the C. elegans neuromuscular junction. Nature Neuroscience. 1999;2(9):791-7. doi: 10.1038/12160. PubMed PMID: CABI:20013031304.

125. Puttachary S, Robertson AP, Clark CL, Martin RJ. Levamisole and ryanodine receptors (II): An electrophysiological study in Ascaris suum. Molecular and Biochemical Parasitology. 2010;171(1):8-16. doi: 10.1016/j.molbiopara.2009.12.006. PubMed PMID: WOS:000276442700002.

126. Martin RJ, Robertson AP. Control of Nematode Parasites with Agents Acting on Neuro- Musculature Systems: Lessons for Neuropeptide Ligand Discovery. Neuropeptide Systems as Targets for Parasite and Pest Control. 2010;692:138-54. PubMed PMID: WOS:000281690300007.

127. Li BW, Rush AC, Weil GJ. Expression of five acetylcholine receptor subunit genes in Brugia malayi adult worms. International Journal for Parasitology-Drugs and Drug Resistance. 2015;5(3):100-9. doi: 10.1016/j.ijpddr.2015.04.003. PubMed PMID: WOS:000367100600004.

128. Bennett HM, Williamson SM, Walsh TK, Woods DJ, Wolstenholme AJ. ACR-26: A novel nicotinic receptor subunit of parasitic nematodes. Molecular and Biochemical Parasitology. 2012;183(2):151-7. doi: 10.1016/j.molbiopara.2012.02.010. PubMed PMID: WOS:000303845400006.

129. Li B-W, Rush AC, Weil GJ. Expression of five acetylcholine receptor subunit genes in Brugia malayi adult worms. International Journal for Parasitology-Drugs and Drug Resistance. 2015;5(3):100-9. doi: 10.1016/j.ijpddr.2015.04.003. PubMed PMID: WOS:000367100600004.

130. Coles GC, Jackson F, Taylor MA, Wolstenholme AJ. Collaborating to tackle the problem of anthelmintic resistance. Veterinary Record. 2004;155(9):253-4. PubMed PMID: WOS:000223940600008.

20. Abdulla MH, Ruelas DS, Wolff B, Snedecor J, Lim KC, et al. Drug discovery for schisto-somiasis: Hit and lead compounds identified in a library of known drugs by medium-throughput phenotypic screening. PLoS Negl Trop Dis. 2009;3:e478. [PMC free article] [PubMed] [Google Scholar]

21. Hopkins AL, Witty MJ, Nwaka S. Mission possible. Nature. 2007;449:166–169. [PubMed] [Google Scholar]

22. Buckingham S, Sattelle D. Fast, automated measurement of nematode swimming (thrashing) without morphometry. BMC Neuroscience. 2009;10:84. [PMCfree article][PubMed] [Google Scholar] 62

CHAPTER 4. CONCLUSION AND FUTURE DIRECTIONS

4.1 Conclusion

Many of the currently available anthelmintics used to control parasitic nematode infections act on nematode ion channels. However, there are a limited number of these anthelmintics, and their repeated use has led to increasing worldwide reports of anthelmintic resistance development. Thus, there is an increased need for the development of alternative strategies to slow down or overcome the resistance problem. Resistance to anthelmintics is a major problem both for human and animal health in combating nematode infections, resulting in morbidity and even mortality. The nematode nervous system is a major target site for anthelmintic action, including the nAChR. Since there are many nAChR subunits in nematodes not currently acting as anthelmintic target sites, these remain potential target sites for new anthelmintics

The MS research has addressed two strategies by which resistance can be slowed or overcome. These include phenotypic characterization of B. malayi to levamisole with time courses and molecular analysis of desensitization and flaccid worms. In this study we have characterized motility at different times after incubation at different concentrations. Initially, levamisole quickly paralyzes the worms no matter the concentration was high or low. However, the paralysis was transient which stayed maximum for one hour. In one hour, two phenotype changes were observed: spastic paralysis and flaccid paralysis. Then after one hour, worms escaped from paralysis and gradual recovery and completely recovered at 4 hours.

We compared motility variation and phenotypic changes between male and female adult

B. malayi. The study has shown, motility of male and female was similar during pretreatment of levamisole. However, post treatment both male and female share same phenotypic changes which 63 come under spastic paralysis and then followed by flaccid paralysis. At 4 hours females quickly recover to normal motility whereas males showed partial recovery.

After we characterize phenotypic changes. We measured the relative expression change of the worms to quantify mRNA expression of the subunits using qRT-PCR. Firstly, the quantifications were done with female worms. In desensitized female Bma-unc-38 upregulation and in worms under flaccid paralysis Bma-unc-29 upregulation were measured respectively.

Desensitized male worms also showed up regulation of Bma-unc-38. The variation in male and female worms were upregulations of other nAChR subunits. During the recovery, in addition to

Bma-unc-38 upregulation, we found that expression of Bma-acr-8 and Bma-unc-29 were increased in female and male respectively.

The result suggested that co-expression of Bma-acr-8 with Bma-unc-38 may contribute to recovery of the worms from paralysis. In H. controuts, Hco-acr-8 has crucial role. But it needs to be investigated further in filaria. The importance of Bma-unc-29 was revealed from worms under flaccid paralysis. This subunit did not rescue worms from paralysis. The result was also substantiated in male worms, the expression increased but worms were not fully recovered. In contrast Bma-unc-29 expression in desensitized female, was not robust, but recovery was fast.

Finally, our results show that increased expression of Bma-unc-29 and Bma-unc-38 in male worms leads to a delay in recovery/desensitization. However, in female worms, we measured robust expression of Bma-unc-38 and Bma-acr-8 which worms were quickly recovered around one hour. Study has reported in vitro using Xenopus oocytes to determine the expression of nAChRs of A. suum. The successfully expressed these genes for the first time in vitro using

Xenopus oocytes. Expression of Asu-unc-29 and Asu-unc-38 together gave functional heteromeric receptors which responded to ACh, levamisole and nicotine but the relative sensitivity to 64 levamisole and nicotine depended on the ratio of the two genes injected into the oocytes. For example, when the ratio was 5:1 Asu-unc-38: Asu-unc-29, nicotine was a full agonist but the response to levamisole was reduced, an N-type receptor. When the ratio was reversed, levamisole became a full agonist while the response to nicotine was reduced, an L-type receptor. When only one gene was injected there was no receptor expression. When there are more Bma-unc-29 than

Bma-unc-38 L-type, then levamisole is effective, and worms delay recovering. Worms under flaccid paralysis recorded significant expression of Bma-unc-29 that indicates expression of this gene rescues worms from spastic paralysis to flaccid.

Finally, we have demonstrated the mechanism in which the hypothesis is substantiated that the receptors were dynamic otherwise the fold changes of the genes would be the same as control. In all phenotypic changes we measured persistent robust expression changes of essential genes Bma-unc-29 and Bma-unc-38. Significant expression of Bma-unc-38 has contributed in desensitized worms and rescue from paralysis to recovery. However, significant expression Bma- unc-29 play a role in rescue worms from spastic state to flaccid state. Our study also suggests that degree of desensitization was various not due to Bma-unc-38 only however, it could be due to other subunits as well.

We have investigated the gene expression changes of levamisole treated worms in B. malayi which was not explored before. Our experiments have provided information on the dynamic nature of the nAChR subtypes and how they interact during levamisole attack. We have determined the increase expression of levamisole receptor subunits and other subunits. These experiments have revealed how worms accommodate to levamisole attack and essential information for further study for drug development and discovery. 65

4.2 Future Directions

We would recommend more experiments be done in order to further confirm the function of the Bma-acr-8 and Bma-acr-26 in male and female worms using dsRNA

Knockdown of both genes. Then using Worminator video tracking system quantify and compare motility.

We would also recommend more experiments be done in order to further information on metabolism and bioavailability of the drugs to the worms directly and indirectly way.

Additional information is need on the fate of drug after worms incubated to the levamisole.

Using HPLC, we can measure the amount of levamisole at different time and get more information on the metabolites directly. Indirectly we can get additional information by measuring the amount of the available drugs after 4 h using fresh worm incubation in the same well that previously worm incubated. If the new worm incubated in the same well showed the same phenotypic changes that may indicates that the amount of unmetabolized drug is high.

However, if worm does not change the phenotype that indicates metabolism of the drugs may contribute in desensitization and recovery.