The taxonomy and host specificity of Russula species of the section Ingratae and subsection Foetentinae at Dawyck Botanic Garden.

Anna Bazzicalupo 26th August 2011

Thesis submitted in partial fulfilment for the MSc in the Biodiversity and Taxonomy of Plants

2 3

ABSTRACT

In this study, using laboratory based techniques, the accuracy of species identification carried out in the field for the section Ingratae Quél. (sensu Romagnesi) and subsection Foetentinae Meltz. Zvár. of the genus Russula Pers. (Russulales, Basidiomycota) is investigated. Samples from the RBGE herbarium were used. ITS rDNA sequences from the samples were determined and different methods of analysis were used to produce molecular trees. Spore ornamentation was observed using light microscopy and SEM. The study found that the subsection Foetentinae constitute a monophyletic group and that spore ornamentation reflected well the clades in the molecular trees. A few taxa, placed in this section in previous treatments were found to be related to other Russula species. Due to poor resolution, not all clades could be assigned a species name. The names on the herbarium labels were not consistent with the morphological or molecular characters, indicating that field characters had not been effective in identifying the species consistently. The study strongly suggests that spore ornamentation is a good character in discerning species in the Ingratae. The study also looked at host specificity of Ingratae collected at Dawyck Botanic Garden (Scotland). Sampling and taxonomic problems are identified and discussed.

4

Acknowledgements

I would like to thank my supervisors: Dr. Stephan Helfer, Prof. Roy Watling and Dr. Rebecca Yahr, for their insight, feedback and dedicated work. I would like to thank Dr Michelle Hollingsworth, Ruth McGregor and Frieda Christie for their technical help in the lab and SEM, and Graham Hardy for helping me dig out obscure literature. Also I would like to thank Nev Kilkenny for providing me, when he could, with fresh specimens of the Foetentinae.

5

CONTENTS

1. INTRODUCTION 7 1.1 The genus Russula, the section Ingratae and the subsection Foetentinae 7 1.2 Molecular studies of Russula 10 1.3 The Ecology of Russula at Dawyck Botanic Garden 12

2. PROJECT AIMS 14

3. TAXONOMIC ACCOUNT 15

4. MATERIALS & METHODS 25 4.1 Molecular Analyses 25 4.1.1 Taxon Sampling 25 4.1.2 Nucleic acid preparation, amplification and sequencing 25 4.2 Phylogenetic Analysis 28 4.3 Morphology 29 4.3.1 Light Microscopy 29 4.3.2 SEM 30 4.4 Fresh specimens from Dawyck Botanic Garden 30

5. RESULTS 31 5.1 Results of the molecular analysis 31 5.2 Morphological characters and their distribution on the molecular trees 32 5.3 Fresh specimens collected at Dawyck Botanic Garden 50

6. DISCUSSION 51 6.1 Considerations on datasets 51 6.2 Outgroups and excluded species 51 6.3 The Foetentinae 53 6.4 Pileipellis as a useful diagnostic character 55 6.5 Nomenclature issues 56 6.6 Exotic and native associations of the Foetentinae 57

7. SPECIMENS SEEN 59

8. CONCLUSION 61

9. CITED LITERATURE 63

LIST OF FIGURES

1. Schematic representation of a Romagnesi key 9 2. One of the most parsimonious trees 33 3. Strict Consensus tree 34 4. Neighbour Joining tree 35 5. Maximum Likelihood tree 36 6

6. Structures of the pileipellis compared with drawings 38 7. Spore ornamentation and herbarium specimen labels 39 8. SEM spore ornamentation of Fellinae and R. farinipes 40 9. SEM spore ornamentation of the R. sororia group 41 10. SEM spore ornamentation of the R. illota group 41 11. SEM spore ornamentation of the R. pectinatoides/R. praetervisa group 42 12. SEM spore ornamentation of group A (Foetens) 43 13. SEM spore ornamentation of group B (Laurocerasi or Grata) 45 14.SEM spore ornamentation of group C (Pectinata) 46 15. Schematic drawing of spore ornamentation found in the study 48 16. R. foetens collected at Dawyck Botanic Garden 50 17. Group A from the molecular trees 54

LIST OF TABLES

1. Specimens used in the molecular analysis 26 2. Information on sequences taken from Genbank and UNITE databases 27 3. ITS Primers and references 27 7

1. INTRODUCTION

1.1 The genus Russula, the section Ingratae, and the subsection Foetentinae

The family Russulaceae (Lotsy) is comprised of two main genera: Russula Pers. and Lactarius Pers., in addition to several minor genera. The family is characterised by having sphaerocysts (round cells as opposed to filamentous cells) in the trama, which give the carpophores the characteristic crumbly consistency; and amyloid spore ornamentation, by which the starch in the ornamentation of the spores will stain black-purplish with Melzer’s iodine solution (Kränzlin, 2005). The genus Russula is distinguished from Lactarius by the lack of latex excretion and the presence of sphaerocysts in the trama of the lamellae (Singer 1975). The genus Russula Pers. ex S.F. Grey was first described by Persoon based on R. lutea (Hudson ex Fr.) or R. emetica (Schaeff. ex Fr.) Pers. ex S.F. Grey. The number of species in the genus is unknown and varies according to the source consulted, 275 fully recognised according to Singer (1975). Numbers of species have been given in regional context, such as 85 species described for the Pacific Northwest (Woo, 1989), or 135 for Switzerland (Kränzlin, 2005), but the total number of species is a rough estimate of 750 ca. (Rinaldi et al., 2008). This genus is distributed worldwide, but while taxonomic treatments were mainly European (Persoon, 1801; Fries, 1874; Quélét, 1888; Britzelmayr, 1893; Barbier, 1907; Massee, 1902; Bataille, 1908; Maire, 1910; Ricken, 1915; Melzer & Zvara, 1927; Crawshay, 1930; Konrad & Josserand, 1934; Singer, 1926, 1932; Lange, 1940; Schaeffer, 1952; Romagnesi, 1967; Bon, 1989; Reumaux, Bidaud & Moënne-Loccoz, 1996; Sarnari, 1998), but there have been treatments of the genus in North America (Peck, 1906; Burlingham, 1915; Singer, 1957; Bills & Miller, 1984), Africa (Heim, 1938; Buyck, 1989), and South America (Pegler & Singer, 1980; Buyck, 1988). Maire (1910) summarises the main attempts to organise the genus Russula, by Persoon, Fries, Quélet, Bataille and Massee. He suggests that the most natural classification of Russula was given by Fries, who classified regarding all characters known at his time with the same weight; he also states that the most artificial classification was formulated by Quélet and Bataille who put much emphasis, without an adequate explanation by the authors, on the colour of the spores character. Maire (1910) organised the key morphological characters in: macroscopic, microscopic and chemical. 8

The genus Russula is easily identified by amateurs, identification problems arise when trying to distinguish the species within the genus. The genus is divided in sections or sometimes subgenera. Romagnesi (1967) adopted two subgenera, eight sections and 34 subsections; Singer (1975) eight sections, 34 subsections, not same as Romagnesi (1967); Sarnari (1998) six subgenera, 17 sections and 28 subsections. Even though they are different classifications, overall the groups are generally similar, following certain morphological characters (Miller & Buyck, 2002). The section treated in this study is the Ingratae Quél. as understood by Romagnesi (1967).

The section Ingratae was first described by Quélét (1888); this section has been treated over the century several times, (Maire, 1910; Melzer & Zvara, 1927; Singer, 1932; Shaeffer, 1933; Heim, 1938), for the purposes of this study the Ingratae sensu Romagnesi (1967) will be considered as a starting point. Even though there have been later treatments (e.g. Bon, 1989), they have not changed radically from Romagnesi’s treatment. Romagnesi groups the Ingratae because of characteristics that are unusual in the genus, such as their fragrant nature (from foetid to Benzaldehyde – smelling of almonds and marzipan); with a light coloured spore print, which is variable, from pure white (following chromatic keys by Crawshay a, Romagnesi Ia) to cream (Crawshay c, Romagnesi IIb). According to Singer (1975), who does not follow Romagnesi’s classification for the whole genus, but generally does for this section, the Ingratae are characterised by grey, brown, ochraceous buff or melleous, lemon yellow, or greenish cream colour (or a combination of these colours) of the carpophore. Usually characterised by an acrid taste (of which some sweet varieties can be distinguished according to Romagnesi, 1967), with often a foetid, nauseating, pungent or Benzaldhyde odour. The Type species for this section is R. foetens Pers. ex Fr. (Singer, 1975). Like the genus, the section Ingratae has been treated differently over the years by different authors, and taxonomic treatments never stabilised completely. Until recently, this section was divided into two subsections: the Foetentinae Meltz. Zvár. and the Fellinae Meltz. Zvár; this is the treatment that Shaeffer (1935) gives the section, he places this section under the category of white- spored russulas. Romagnesi (1967) includes the subsections Foetentinae and Fellinae in the Ingratae as well. This treatment was still used in 2003 and 2005 by Cazzoli, for an amateur-oriented explanation of the genus; however, Bon (1989)’s taxonomic treatment removed the Fellinae from the section and divided the Ingratae into Foetentinae and Pectinatinae. The Foetentinae sensu Romagnesi, which is the closer focus of this study, were described by Melzer and Zvara (1927) with the characteristic of having: no velar remnant present; a pileus of dull colours, ochraceous or pallid; a smell of nitrobenzene, oily, camembert cheese, fish, iodoform, or malt; the margin of the 9 pileus pectinate sulcate to tuberculate sulcate and distinctly subacute to acute; macrocystidia often gloeocystidioid (Singer, 1975). The type species for the subsection Foetentinae is again R. foetens Pers. ex Fr.. The repeated changing of the classification of Russula and its sections is possibly an indication of the difficulty in finding morphological characters that are consistent and work well throughout the group. In 1930, Crawshay examined spore ornamentation in Russula by staining them with Melzer’s iodine solution; he suggested that the infrageneric relationships could be settled by classifying them by spore ornamentation. Even though this character has not been proved to be helpful in classifying the genus, it is a character that has been widely used and is useful in the literature, when dealing with taxa inside smaller sections. Studies have used Scanning Electron Microscope (SEM) techniques to investigate in more depth the spore ornamentation of Russula (Bills & Miller, 1984; Lebel & Tonkin, 2007). In the case of the Foetentinae, as understood by Romagnesi (1967), the species were usually separated at first because of their smell and taste (foetid, of benzaldehyde; acrid, mild, nauseous, sweet), their pileus colour (ochraceous with red, grey or brown shades), their size. And within those groups the next characters used to separate the taxa usually are the spore ornamentation and size, and the appearance of the pileipellis structures. For example the diagram below (Fig 1) shows the way the key separates the group Foetens (Romagnesi, 1967).

Bitter Black = R. illota Pronounced spore Cream: smell almonds: edge ornamentation = gills Same colour as rest: R. laurocerasi spore ornemamentation Foetens group: Less pronounced Spore colour spore ornamentation Foetid, nauseous: -ve = R. foetens KOH = R. fragrantissima +ve = R. subfoetens White = R. farinipes Figure 1: schematic and simplified representation of the key produced by Romagnesi (1967) for the group Foetens of the Foetentinae. This is an example of how the characters have been used to divide species for identification.

These characters are used in Romagnesi (1967) but also in Einhellinger (1985). They are summarised for each taxonomic name in the diagnostic notes section of the species’ Taxonomic Account (3).

This genus is notorious for the difficulties in taxonomic issues, the recognition of varieties and species concept have not only changed over time, but they change geographically across landmasses (e.g. North America and Europe). This problem has been reported and recognised in a 10 study by Smith & Lebel (2001), where several species from the Pacific Northwest were identified using different keys, concluding that the identification of russulas is challenging and there are no consistent characters throughout different treatments. The difficulties are exacerbated by the issues in the nomenclature of the subsection, which have also changed several times in the past century (Miller & Buyck, 2002). Molecular analysis has been used as a new tool in aid of difficulties such as those encountered in Russula, to add a set of data on which to base classifications. This sort of studies have been carried out at the genus level in Russula and have shed some light on the morphological characters that reflect an evolutionary difference in species (Miller & Buyck, 2002; Eberhardt, 2002).

1.2 Molecular Studies on Russula

Molecular analyses have become a powerful tool in investigating the taxonomic relationships of species (Bellemain et al., 2010). The genus Russula has been placed using molecular analyses of the nuclear 5.8S, ITS2 and large-subunit rDNA genes by Miller et al. (2001) within the family Russulaceae forming a monophyletic group with Lactarius; Miller et al. (2001) found Lactarius to be branching out of Russula, making the latter not monophyletic. However, this conclusion was based on a poorly supported branch in the study, and also contradicted by Eberhardt & Verbeken (2004) who found high support values for the sister relationship of Lactarius and Russula as two monophyletic clades with a common ancestor. Within the genus Russula DNA sequence analysis has been applied in several studies, but for the understanding of this study, special highlight should go to investigating: the genus in Europe (Miller & Buyck, 2002); the correspondence with sporocarp features and mycorrhizal anatomy (Eberhardt, 2002); and the genus in an ecological context (Gelm et al., 2010). Miller & Buyck (2002) took ribosomal DNA sequences from the internal transcribed spacer (ITS) ITS1, 5.8S and ITS2 regions, the study established phylogenetic positions and relationships among species of Russula representing infrageneric taxa described from Europe. In the study the molecular results were compared with the treatments of Russula species in works that summarise generally the recent taxonomic history of the genus in Europe; these were by Romagnesi (1967), Singer (1975) and Sarnari (1998). The results of the molecular analysis did not support several of the groups delineated in the traditional taxonomy, and furthermore they are not clustered, and appear in several places on the molecular tree. The Foetentinae are somewhat of an exception, as 11 some of them seem to group phylogenetically together in a monophyletic group excluding only a few taxa and separate from the Fellinae. Miller and Buyck (2002) acknowledge that much of the problem with this group resides in the nomenclature of the genus, with an abundance of names for similar infrageneric taxa, which come from a long history of taxonomy of this group in Europe. This indicates the need for an up-to- date monograph of the genus. Eberhardt (2002) found that Russula was divided into four clusters, one of them being the Foetentinae. She summarised that the Foetentinae are set apart from Heterophyllidia subgenus by the species’ extracellular yellowish to brownish pigmentation, their taste, odour, fruiting body appearance and according to Beenken (2001 as cited in Eberhardt, 2002) in respect to the formation of ladder-like structures in the rhizomorphs. Foetentinae seem to have derived from the subgenus Heterophyllidia, this molecular result is supported morphologically by the positive or negative reaction to cresyl blue stain of the hyphae (especially dermatocystidia at the base of the cystidia in the hymenium). The inclusion of Russula fellea (Fr.) Fr. and Russula ochroleuca Pers. (Fellinae sensu Romagnesi) in the subgenus Russula as understood by Sarnari (1998) cluster (and therefore not in the Foetentinae or Ingratae group) is supported by the anatomy of the mycorrhizal mantles, featuring polygonal cells in the outer and middle mantle layers. R. fellea shares features with the subsection Foetentinae (such as the location of the pigments), and has been placed as a transition between the group Russula and the Foetentinae in Bon (1989) and Sarnari (1998), however, this was not supported in the analysis (Eberhardt, 2002). In the case of R. ochroleuca, its delimitation in Sarnari’s (1998) section Viscidinae in Russula, because of its lack of dermatocystidia in the pileipellis, the presence of encrusted hyphae, a pale spore print, acrid taste, is adequately supported by the molecular data. Molecular data therefore have informed taxonomy and reinforced some morphological characters used for classification that previously have been largely ignored. Molecular analyses have also been used in the investigation of ecological relationships and environmental surveying and barcoding (Anderson & Cairney, 2004; Chase & Fay, 2009). Anderson & Cairney in 2004 suggested the possibilities of using molecular tools in order to answer ecological questions, and since then many studies have been carried out on the subject, some of them involving ectomycorrhizas such as those of Russula. Studies have shown a habitat-structured occurrence of Russula species using these tools. Gelm and colleagues (2010) used soil samples and some selected sporocarps to conduct an ecological and phylogenetic analysis; the study found habitat partitioning and variation in species assemblage of Russula across different plant communities. Pickles et al. 12

(2010) found through the collection of soil samples in a Scots pine plantation, the patchy distribution of ectomycorrhizal species in the soil surface organic horizon. The potential of these techniques could take the study of ecological relationships to another level of understanding, however, Bellemain et al. (2010) stress that there is a need to be careful in the choice of the method and protocol used in the molecular studies.

1.3 The ecology of Russula at Dawyck Botanic Garden

The genus Russula is an obligate ectomycorrhizal group of fungi, where the fungus forms a mantle around the host woody plant root. The relationship between trees and ectomycorrhizal fungi symbionts is mutualistic in that the trees will benefit by an increased motility and availability of nutrients stored in the soil, and the fungal partner will benefit by obtaining sugars from the tree through the root interface. At this scale the partnership seems relatively straight forward, however, field observations of this phenomenon suggest that ectomycorrhizal fungi have a key role in ecosystem functions (e.g. carbon cycling, nutrient and mineral cycling and linking forest trees in a common mycorrhizal network) (Courty et al., 2010). Frank (1885 as cited in Tendersoo et al., 2010) first described and defined mycorrhiza and ectomycorrhiza and their relationship with plants. Reports on the status of both fungal and plant partners covering most ecosystems and continents have been published. Brundrett (2009 as cited in Tendersoo et al., 2010) have estimated, based on taxonomic evidence, that only 2% of the land woody plants’ mineral nutrient uptake happens through the action of ectomycorrhizal symbionts. However, most of the economically and ecologically important forest tree families (Pinaceae, Fagaceae, Betulaceae, Nothofagaceae, Myrtaceae, Dipterocarpaceae), which dominate woodland communities across the globe, are dependant for sapling establishment and growth on the formation of ectomycorrhizal associations, possibly suggesting that the figure of 2% of nutrient uptake may be an underestimate and that nutrient uptake is not the only interaction between the woody species and the ectmycorrhizas (Terndersoo et al., 2010). Since russulas of temperate regions are considered to be obligate ectomycorrhizal forming fungi, with hosts ranging from conifers such as Pinus L., Larix Mill., Pseudotsuga Carr., Picea L., Abies Mill., Tsuga Carr., members of the Fagales and have also been reported to form associations with Tilia L. sp. (Singer, 1975), their important role as ectomycorrhizal symbionts has been documented not only in arctic alpine (Richardson, 1970; Gardes & Bruns, 1996; Kernaghan & 13

Currah, 1998), but also in tropical regions (Buyck et al., 1996). Russula species composition has been shown to vary not only with the above-ground host composition, but also with the age of the canopy stand (Gelm et al., 2010). The association preference therefore reflects where and when species of Russula may be found in a given habitat. Species of the subsection Foetentinae and section Ingratae have been recorded at Dawyck Botanic Garden. Dawyck Botanic Garden is part of the Royal Botanic Garden Edinburgh, it is situated south of the capital city and covers 64 acres (Watling, 2010). Since 1994 Dawyck Botanic Garden has had fruiting fungal records for macrofungi, and related them to the tree species of reputed associated ectomycorrhizal hosts (Watling, 2004). The data gathered from this long-term and extensive recording found that some species of ectomycorrhizal fungi associate preferentially with certain hosts (e.g. Lactarius blennius (Fr.) Fr. and R. fellea with beech), or are more promiscuous and associate with a wide range of hosts (e.g. the genus Amanita (Fr.) Fr. or R. ochroleuca). Interestingly, there have also been recordings of unusual associations between local fungi and exotic species that have been introduced in the garden (e.g. Pseudotsuga menziesii (Mirb.) Franco found to be associated as well as many other ectomycorrhizal species of fungi, with R. laurocerasi var. fragrans Romagn., R. ochroleuca and R. subfoetens Wm. G. Sm. of the section Ingratae) (Krivstov et al., 2003). Concerns about the accuracy of the identification of russulas in ecological studies have been expressed (Smith & Lebel, 2001), and considerations have been made on the time that it takes to identify a species of Russula. Dawyck Botanic Garden is a unique place and of international importance in terms of mycological research (Watling, 2004) and for the purpose of this project a place to investigate the accuracy of field recording and host specificity of the section Ingratae.

14

2. PROJECT AIMS

In this study taxa from the section Ingratae of the genus Russula were investigated using dry herbarium material and some fresh material. The study entailed gathering molecular (ITS sequences) and morphological data and comparing the results with available literature to attempt to test the following hypotheses: the section Ingratae and subsection Foetentinae constitute a taxonomic group according to morphological and genetic characters; and the subsection Foetentinae can be identified effectively using field characters. The study attempted to address these additional questions: Do morphological and genetic characters explain systematic relationships between the species within the Ingratae sensu Romagnesi? Are there useful morphological characters that distinguish taxonomic groups within the Foetentinae? What sort of ectomycorrhizal association does this group have at Dawyck Botanic Garden? A summary of the taxonomy and nomenclature is also presented in the next chapter (3).

15

3. TAXONOMIC ACCOUNT

This chapter will cover the species in the section Ingratae sensu Romagnesi (1967). The synonyms and references are according to Index Fungorum and Legon et al. (2005). Each taxon was investigated and compared with available literature. As mentioned in the Introduction (1.1), the nomenclature and taxonomy of this section is challenging and was changed by several authors over the past century; there was, therefore, an attempt to report the more confusing events in the “Taxonomic Notes” sections below. The information on the description of the fungus and their ecology are taken from personal observations, specimen labels and information from the literature mentioned above. Specimens seen are not mentioned in this chapter and are preferentially mentioned later (chapter 7. SPECIMENS SEEN) when groups are recognised. The names in bold are the ones considered for this investigation, for completeness other taxa from the section are included which were not investigated in this study and are marked with an asterisk. Types are mentioned when information was available (Sarnari, 1998). Britzelmayr’s original drawings were not lectotypified by Bresinsky et al (1980), they are listed, but their lectotypification is discouraged for reasons discussed later on. Measures of macromorphological characters are not included because most of the specimens used in this study were dry herbarium material, and therefore their size variation are thought to possibly be largely skewed towards smaller samples which are preferable for herbarium storage.

Foetentinae Melzer & Zvara; Group FOETENS

Russula farinipes Rom. apud Britz., Mém. Soc. Linn. Normandie 9: 239 (1893) [Index Fungorum] OR Bot. Centralbl. 15-17: 17 (1893) [Legon et al. (2005)]; Melz., Atlas Holu., 192 (1945); Romagn., Les Russules d'Europe et d’Afrique du Nord, 327 (1967); Bresinsky, Stangl & Einhellinger, Z. Mykol. 46(2): 135 (1980); Bon, Docums Mycol., 8(no.70-71): 14 (1988). Type – as reported by Sarnari (1998): Lectotype (obligatory but not designated) t. 515 f. 106 Britz. (no material). Epitypes n°55-136 Her. Romagnesi 61-60 (PC) [Romagnesi Typus Russ. Eur.: 329, 1967] Syn: Russula simillima sensu Lange (FlDan 5: 66 & pl. 186) Russula subfoetens sensu Rea, C., Brit. Basidiom. (1922)

16

Diagnostic notes: generally very similar to R. fellea, with a light brown, ochraceous pileus of the same colour as the stipe. The key characters differentiating them is the colour of the spore print, that in R. farinipes is pure white (Romagnesi a), whereas R. fellea has a ivory spore print (Romagnesi very pale b).

Ecology: On soil. Mixed deciduous woodland, in grassy patches or solitary trees in parkland. Associated with Betula, Fagus or Quercus spp. (Legon et al. 2005).

Taxonomic notes: Bresinsky’s identified drawing of Britzelmayr’s: Britz. 485, 17 Mödishofen, Diedorf, 6.10.1881. There are two more drawings of Britzelmayr’s that are called R. farinipes, but Bresinsky et al. (1980) recognised them as: 495, 50a Teisendorf, 6.9.1890, being not in fact R. farinipes, but R. pectinata; and another R. farinipes 515, 106 Teisendorf, Buchenwald, 31.7.1892. Russula subfoetens sensu Rea (1922) was described as having pure white spore print.

Russula foetens (Pers.) Pers., Observ. mycol. (Lipsiae) 1: 102 (1796); Rea, C., Brit. Basidiom., 464 (1922); Craws., Spor. Orn. Russ., 139 (1930); Singer, R., Beihefte zum Botanischen Centralblatt, XLIX (2): 319 (1932); Melz., Atlas Holu., 191 (1945); Romagn., Les Russules d'Europe et d’Afrique du Nord, 332 (1967); Shaffer, Mycol., 64(5): 1009 (1972); Bresinsky, Stangl & Einhellinger, Z. Mykol. 46(2): 135 (1980); Bon, Docums Mycol., 8(no.70-71): 12 (1988) Type – as reported by Sarnari (1998): Lectotype (obligatory but not designated) t. 292 Buillard 1788 Herb. France (Agaricus piperatus) Syn: Agaricus foetens Pers., Observ. mycol. (Lipsiae) 1: 102 (1796) Basionym: Agaricus foetens Pers. 1796

Diagnostic notes: pileus reddish ochraceous. No reaction to KOH. Spores large (8 !m ca.) with large isolated warts. Smell foetid (with possible hint of benzaldehyde), taste acrid and persistent.

Ecology: On soil. Old deciduous woodland. Associated with Fagus or Quercus spp. (sometimes with Betula) (Legon et al. 2005).

17

Taxonomic notes: Britzelmayr drawing identified by Bresinsky: Britz. 485, 18 Augsburg

Russula fragrantissima Romagn., Les Russules d'Europe et d’Afrique du Nord,: 350; Shaffer, Mycol., 64(5): 1044 (1972); Bon, Docums Mycol., 8(no.70-71): 14 (1988) Type – in Herb. Romagnesi: 52-173 Syn: Russula laurocerasi var. fragrantissima (Romagn.) Bon, Docums Mycol. 17(no. 65): 56 (1986)

Diagnostic notes: pileus reddish ochraceous. Spore ornamentation with ridges and wings, but not as pronounced as R. grata. Strong smell of benzaldehyde.

Ecology: On soil. Mixed deciduous woodland.

Russula grata Britz., Ber. Naturhist. Augsburg 9: 239 (1898) [Index Fungorum] Bot. Centralbl. 15-17: 17 (1893) [Legon et al. (2005)]; Bresinsky, Stangl & Einhellinger, Z. Mykol. 46(2): 135 (1980); Bon, Docums Mycol., 8(no.70-71): 13 (1988); Rauschert, "eská Mykol. 43(4): 198 (1989) Syn: Russula laurocerasi Melz., "as. #esk. houb. 2: 243 (1920); Shaffer, Mycol., 64(5): 1039 (1972); Russula foetens var. grata (Britz.) Singer, Beih. bot. Zbl., Abt. 2 49(2): 320 (1932) Russula foetens subsp. laurocerasi (Melz.) Jul. Schäff., Z. Pilzk. 17(2): 51 (1933) Russula foetens var. laurocerasi (Melz.) Singer, Annls mycol. 40(1/2): 73 (1942) Russula subfoetens var. grata (Britz.) Romagn., Les Russules d'Europe et d’Afrique du Nord: 340 (1967) Russula grata var. laurocerasi (Melz.) Rauschert, "eská Mykol. 43(4): 198 (1989)

Diagnostic notes: pileus reddish ochraceous. Spore ornamentation with ridges and highly pronounced wings. Strong smell of benzaldehyde.

18

Ecology: On soil. Mixed deciduous woodland and in old beech woods. Associated with Fagus, Betula and Quercus spp. (Legon et al. 2005).

Taxonomic notes: The interpretation of R. grata prior to Bresinsky and collegues 1980’s work was according to Singer, who used the name “grata” to describe a variety of R. subfoetens which had a mild taste. Bresinsky et al. based on the drawing and the knowledge (from a note) of the specimen smelling of sweet almonds, decided that the species described by Melzer in 1920 as R. laurocerasi (which smells of almonds) was in fact R. grata described by Britzelmayr in 1898. Drawing of Britzelmayr identified by Bresinsky: Britz. 510, 92 Teisendorf, feuchte Schlucht, 7.8.1892 als R. grata Britz. 1893 – 520, 120 Gailenberg bei Hindelang, 5.9.1894 als R. grata Britz. 1893. Sarnari (1998) reports type information as: Neotype, Romagnesi Herb. N°63-95, however, Romagnesi does not mention the neotypification of R. laurocerasi.

Russula illota Romagn., Bull. Mens. Soc. Linn. Lyon 23: 112 (1954); Romagn., Bull. Mens. Soc. Linn. Lyon 23: 112 (1954); Romagn., Les Russules d'Europe et d’Afrique du Nord, 350 (1967); Bresinsky, Stangl & Einhellinger, Z. Mykol. 46(2): 136; (1980) Bon, Docums Mycol., 8(no.70-71): 13 (1988). Type – Romagnesi Herb. N° 51-76

Diagnostic notes: pileus reddish ochraceous. Spore ornamentation with ridges and pronounced warts. Key distinguishing character is the blackening (purple black) of the edge of the gills.

Ecology: On soil. Woodland associated with deciduous trees or conifers (Legon et al. 2005).

Russula laurocerasi var. fragrans Romagn., Les Russules d'Europe et d’Afrique du Nord: 344 (1967); Bon, Docums Mycol., 8(no.70-71): 13 (1988) Type – Romagnesi Herb. N° 57-52 Syn: R. fragrans Romagn., Bull. Mens. Soc. Linn. Lyon 23: 112 (1954)

19

Diagnostic notes: pileus reddish ochraceous. Spores with strong ornamentation. Strong smell of benzaldehyde. Distinguishing character as a variety is the sweet taste as opposed to mild or acrid.

Taxonomic notes: Shaffer (1972) mentions that this name is not validly published, he does not say why, the reason is that there is no mention of basionym in Les Russules d’Europe et l’Afrique du Nord (Kuyper & Vuure 1985); in 1985 Kuyper & Voore make this a validly published name by mentioning the first publication (Bull. Mens. Soc. Linn. Lyon 23: 112 (1954)) and its basionym calling it: R. laurocerasi var. fragrans (Romagn.) Kuyper & Voore (1985). This species according to Romagnesi is characterised by being a sweet variety of R. laurocerasi. The problem arises when in 1980 Bresinsky et al. made a new combination based on drawings by Britzlemayr, saying that R. laurocerasi sensu Melz. is synonymous with R. grata sensu Britzelmayr (which give priority to the name Britzlemayr gave the fungus), if it were felt that R. laurocerasi var. fragrans (Romagn.) Kuyper & Voore (1985) was after all, a synonym of R. grata Britz., then a new combination would have to be made with a description.

Russula subfoetens Wm. G. Sm., J. Bot., Lond. 11: 337 (1873); Smith, W.G., Outlines of British Fungology, 253; Rea, C., Brit. Basidiom., 466 (1922); Singer, R., Beihefte zum Botanischen Centralblatt, XLIX (2): 321 (1932); Romagn., Russules d'Europe Afr. Nord, 336 (1967); Bresinsky, Stangl & Einhellinger, Z. Mykol. 46(2): 141; Shaffer, Mycol., 64(5): 1048 (1972); Bon, Docums Mycol., 8(no.70-71): 12 (1988). Type – as reported by Sarnari (1998): Neotype Romagnesi Herb. n° 55-47 Syn: Russula foetens var. subfoetens (W.G. Sm.) Massee, British Fungus-Fl. (London) 3: 70 (1893); Singer, R., Beihefte zum Botanischen Centralblatt, XLIX (2): 311 (1932)

Diagnostic notes: pileus reddish ochraceous. Spores small (6 x 5 !m ca.) with small isolated warts. Positive KOH reaction. Smell different, not foetid, but not of benzaldehyde.

Ecology: On soil. Old mixed deciduous woodland. Associated with Fagus and Quercus spp. and less with Corylus (Legon et al. 2005).

Taxonomic notes: There is a drawing by Britzelmayr mentioned in Bresinsky et al. (1980) (523, 127 Teisendorf, 31.7.1892) which was called originally R. foetens, and later modified to R. 20 subfoetens, with a note about it having a “burned flour” smell to it. Bresinsky et al. wonder if it should stay with R. foetens, but surely the “burned flour” smell is not “foetid” but more subtle, hence the appropriate species epithet “subfoetens”.

Foetentinae; Group PECTINATA

Russula pectinatoides Peck, Bull. N.Y. St. Mus. Nat. Hist. 116: 43 (1907) [Index Fungorum] Rep. (Annual) New York State Mus. Nat. Hist. 116: 43 (1907). [Legon et al. (2005)]; Romagn., Les Russules d'Europe et d’Afrique du Nord, 364 (1967); Bresinsky, Stangl & Einhellinger, Z. Mykol. 46(2): 139; Shaffer, Mycol., 64(5): 1028 (1972); Bon, Docums Mycol., 8(no.70-71): 15 (1988) Lectotype – NY State Museum t. 105, f 6-10. NY Albany Co., Menands, Aug. 1906, NYS (Shaffer 1972, Mycologia, 64 (5): 1032. Syn: Russula consobrina var. pectinatoides (Peck) Singer, Hedwigia 66: 206 (1926) Russula pectinata sensu NCL (1960), Rayner (1985); fide Checklist of Basidiomycota of Great Britain and Ireland (2005)

Diagnostic notes: Pileus brownish ochraceous. Spores broadly elliptic with some interconnections between warts. Romagnesi (1967) splits the species is varieties with bear different isolation of warts.

Ecology: On soil. Deciduous woodland or with solitary trees in parkland and gardens (Legon et al. 2005).

Taxonomic notes: Species described in North America, see R. preatervisa taxonomic notes (it should be mentioned that Shaffer (1972) in one of the drawings of the spores has some connections between the warts of the ornamentation, possibly indicating more variation than thought). Bresinsky et al. (1980) mentions a specimen of R. pectinata from Britzelmayr (Britz. 495, 50b Schätzling, 16.9.1888) and calls R. pectinatiodes Peck possibly sensu Singer.

21

Russula praetervisa Sarnari, Monog. del genere Russula in Europa 1: 463 (1998). Holotype: 97/812, in Herb. IB. (Sarnari, 1998) Syn: Russula pectinatoides fide Legon et al. (2005)

Diagnostic notes: Pileus brownish ochraceous. Spores broadly elliptic with interconnections between warts.

Ecology: On soil. Mixed deciduous woodland. Associated with Tilia spp., Betula spp. and Fagus (Legon et al. 2005).

Taxonomic notes: Sarnari (1998) bases his decision to separate the European concept of R. pectinatoides Peck from the North American concept on mainly spore ornamentation character. The North American material is characterised by spores with isolated warts, while the Mediterranean material is different in that it has thin connections in between the warts, thus he made the new combination R. preatervisa Sarnar.. The validity of this difference will be discussed later on.

Russula sororia Fr., Epicr. syst. mycol. (Upsaliae): 359 (1838); Crawshay, Spore Ornamentation of Russulas, 132 (1930); Singer, R., Beihefte zum Botanischen Centralblatt, XLIX (2): 3173 (1932); Romagn., Les Russules d'Europe et d’Afrique du Nord, 357 (1967); Bon, Docums Mycol., 8(no.70-71): 16 (1988). Type – as reported by Sarnari (1998): Lectotype Sarnar. Design. T.19 f.7 of Larber 1929, Sui Funghi Saggio Generale. Epitype – n°62-104 Romagnesi Herb. 61-60. Syn: Russula consobrina var. sororia (Fr.) Fr, Epicr. syst. mycol. (Upsaliae): 359 (1838) Russula livescens var. sororia (Fr.) Quél., Fl. mycol. France (Paris): 345 (1888) Russula pectinata var. sororia (Fr.) Maire, Mém. Soc. Sci. Nat. Maroc. 45: 54 (1937) Russula consobrina var. intermedia Cooke, Handb. Brit. Fungi, 2nd Edn: 329 (1889)

Diagnostic notes: mat pileus. Pale ochraceous colour. Spores large with isolated not pronounced warts.

22

Ecology: On soil. Oak woods or mixed deciduous woodland. Associated with Quercus spp. (Legon et al. 2005).

Felleinae Melzer & Zvara

Russula fellea (Fr.) Fr., Epicr. syst. mycol. (Upsaliae): 354 (1838) [1836-1838] t. 173, fig. 2.; Rea, C., Brit. Basidiom., 464 (1922); Crawshay, Spore Ornamentation of the Russulas, 140 (1930); Singer, R., Beihefte zum Botanischen Centralblatt, XLIX (2): 314 (1932); Melz., Atlas Holu., 188 (1945); Romagn., Les Russules d'Europe et d’Afrique Nord, 377 (1967); Bresinsky, Stangl & Einhellinger, Z. Mykol. 46(2): 135; Bon, Docums Mycol., 8(no.70-71): 17 (1988). Syn: Agaricus felleus Fr., Syst. mycol. (Lundae) 1: 57 (1821) Russula ochracea fide Checklist of Basidiomycota of Great Britain and Ireland (2005)

Diagnostic notes: pileus, gills and stipe of the same uniform colour, usually brown, ochraceous. Distinguishing feature from R. fellea is the spore print is ivory to cream-coloured and not pure white.

Ecology: On soil (often acidic). Mixed deciduous or old beech wood. Associated with Fagus (rarely reported with Quercus spp.) (Legon et al. 2005).

Taxonomic notes: The table mentioned above (t.173 fig.2) not mentioned as lectotype, so lectotypification unsure. Bresinsky’s identified drawing by Britzelmayr: Britz. 521, 128 Gabelbach, 22.9.1891 (493, 44 Teisendorf, 17.8.1888).

Russula ochroleuca (Pers.) Fr., Epicr. syst. mycol. (Upsaliae): 358 (1838); Rea, C., Brit. Basidiom., 465 (1922); ); Crawshay, Spore Ornamentation of Russulas, 131 (1930); Singer, R., Beihefte zum Botanischen Centralblatt, XLIX (2): 311 (1932); Melz., Atlas Holu., 189 (1945); Romagn., Les Russules d'Europe et d’Afrique du Nord, 379 (1967); Bresinsky, Stangl & Einhellinger, Z. Mykol. 46(2): 139; Bon, Docums Mycol., 8(no.70-71): 17 (1988); Rauschert, "eská Mykol. 43(4): 200 (1989) Syn: 23

Agaricus ochroleucus Pers., Syn. meth. fung. (Göttingen) 2: 443 (1801) Russula citrina Gillet, Les Hyménomycètes ou description de tous les champignons (fungi) qui croissent en France (Alençon): 5 (1874) Russula granulosa Cooke, Grevillea 17(no. 82): 40 (1888)

Diagnostic notes: pileus bright yellowish ochre. Spore print cream (Romagnesi b).

Ecology: On soil. Woodland. Associated with a large range of deciduous and conifer trees (Legon et al. 2005).

Taxonomic notes: Britzelmayr’s drawing identified by Bresinsky: Britz. 524, 129 Mödishofen, 21.9.1891.

Species from this section that were not included in this study:

*R. amoenolens Romagn., Bull. mens. Soc. Linn. Lyon 21: 111 (1952).

*R. pectinata (Bull.) Fr., Epicr. syst. mycol.:358 (1838) Agaricus pectinatus Bull. R. pectinatoides sensu NCL and sensu Rayner (1985)

*R. insignis (Quél.) Quél., Compt. Rend. Assoc. Franç. Avancem. Sci. Assoc. Sci. France 16(2): 588 (1888). Russula pectinata var. insignis Quél., Fl. Mycol. France. 346 (1888) Russula livescens var. depauperata J.E. Lange, Dansk. Bot. Ark. 4(12): 35 (1926) Mis.: Russula livescens sensu Lange (FlDan 5: 66 & pl. 185A) Mis.: Russula pectinatoides sensu NCL and sensu Reyner (1985)

*R. consobrina (Fr.) Fr., Epicr. syst. mycol.: 359 (1838) Agaricus consobrinus Fr., Observ. Mycol. 2:195 (1818) Russula sororia (sensu Checklist of British and Irish Basidiomycota)

24 25

4. MATERIALS AND METHODS

4.1 Molecular analyses

4.1.1 Taxon sampling The taxonomic treatment of Romagnesi (1976) was used to delimit taxa sampled in the sections Foetentinae and Fellinae. Because of conflicting taxonomic treatments, species, which have been included as members of these subsections, have varied. Nine species from the subsection Foetentinae were available for analysis and in addition two species of the subsection Fellinae were included. All are listed in the Taxonomic Account section (1.4) of the Introduction. Some fresh material became available only later in the project (end of July to mid August 2011), and thus could not be used to produce molecular data, but was included in morphological comparisons. The region of the nuclear ribosomal DNA used for examination of species was the ITS. The combined alignment included nine taxa from the subsection Foetentinae; two taxa from the subsection Felleinae as ingroups. Based on preliminary analyses and other published phylogenies (Eberhardt 2002; Miller & Buyck 2002) R. nobilis Velen. and Lactarius blennius were considered outgroups. Most of the sequences from the ingroups derive from British species recorded at Dawyck Botanic Garden. Sequences from the GenBank and UNITE databases were also included in the analysis. Because of the particular topology of the tree found in Eberhardt & Verbeken (2004), three species of Lactarius were used as outgroups, L. blennius was sequenced in the lab, while sequences for the other taxa (L. camphoratus (Bull.) Fr. and L. tabidus Fr.) were taken from the GenBank and UNITE databases. Tables 1 & 2 report all taxa used in the analysis with corresponding collection, EDNA, GenBank, and UNITE accession numbers.

4.1.2 Nucleic acid preparation, amplification and sequencing A total of 44 specimens were used for extraction, representing 14 species, of these 35 were successfully sequenced and reported in Tables 1 & 2. Initial homogenisation of <100!g of fungal material was done using a mixer mill. DNA extraction followed Doyle & Doyle (1990), with two modifications: the samples were initially incubated in 500!l 2x CTAB extraction buffer, and the DNA precipitation step used 300!l of ice cold isopropanol. The targeted regions were amplified from purified DNA by using combinations of primer pairs described in the literature: ITS1-F/ITS4B, internal primers ITS2/ITS3, ITS1 and ITS5. Sequences and references are reported in Table (3). 26

Table 1 Species and specimens used for the molecular phylogenetic study of the subsection Foetentinae of Russula including collector, collector number, date of collection, EDNA (Edinburgh DNA bank number), and herbarium where the specimen is deposited (E=Edinburgh, K=Kew).

Taxon Collector coll. # Date EDNA Herbarium Lactarius blennius Watling WAT 27746 22/9/01 EDNA11-0021893 E Russula farinipes Watling WAT 29568 25/8/08 EDNA11-0021749 E R. farinipes Watling WAT 7617 4/9/70 EDNA11-0022362 E R. fellea Kungu 16/10/02 EDNA11-0021887 E R. fellea Munro WAT 22491 ott-90 EDNA11-0022367 E R. fragrantissima Watling WAT 28114 21/9/02 EDNA11-0021882 E R. fragrantissima Kilkenny NK 39 25/8/08 EDNA11-0021883 E R. fragrantissima Kelly 93582 19/8/01 EDNA11-0022368 K R. fragrantissima Kibby 124876 7/8/04 EDNA11-0022369 K R. grata Watling WAT 30091 4/9/10 EDNA11-0021895 E R. grata Watling WAT 30016 31/8/10 EDNA11-0021880 E R. grata Bauar WAT 20159 set-87 EDNA11-0022366 E R. illota Watling WAT 30084 4/9/10 EDNA11-0021752 E R. illota Watling WAT 13267 18/8/79 EDNA11-0022363 E R. ochroleuca Watling WAT 28111 29/9/02 EDNA11-0021889 E R. ochroleuca Munro WAT 20075 18/10/87 EDNA11-0022356 E R. ochroleuca Watling WAT 11329 13/10/75 EDNA11-0022357 E R. pectinatoides Cohen 190972 8/6/02 EDNA11-0021748 E R. pectinatoides Watling WAT 26655 25/10/95 EDNA11-0022358 E R. pectinatoides Watling WAT 27602 7/7/01 EDNA11-0022359 E R. praetervisa Watling WAT 30003 1/8/10 EDNA11-0021884 E R. praetervisa Overall 166093 13/7/09 EDNA11-0022371 K R. praetervisa Betts 157904 3/8/06 EDNA11-0022370 K R. sororia Watling WAT 28186 28/9/02 EDNA11-0021754 E R. sororia Orton 3098 21/8/67 EDNA11-0022364 E R. subfoetens Watling WAT 30128 31/8/10 EDNA11-0021885 E R. subfoetens Overall 127041 24/8/04 EDNA11-0022373 K partial sequences L. blennius Watling WAT 27497 18/9/00 EDNA11-0021894 E R. farinipes Watling WAT 19252 16/8/80 EDNA11-0022361 E R. fellea Watling WAT 27437 10/11/00 EDNA11-0021888 E R. foetens Storey 47560 6/9/79 EDNA11-0022355 E R. foetens Murray WAT 19954 27/7/87 EDNA11-0021881 E R. nobilis Watling WAT 27820 29/9/99 EDNA11-0021892 E R. sororia Oligott WAT 16572 ?87 EDNA11-0021753 E R. subfoetens Watling WAT 30129 31/8/10 EDNA11-0021886 E

27

Table 2 Species and specimens of sequences downloaded from Genbank and UNITE online databases used for molecular phylogenetic analysis.

GenBank Accession # Collected from Reference L. blennius EF493301.1 Sweden Nygren et al. 2008 L. blennius EF493303.1 Sweden Nygren et al. 2008 R. farinipes DQ421983.1 unknown Unp. Eberhardt R. farinipes AY061675.1 EU Miller & Buyck 2002 R. fellea AY061676.1 EU Miller & Buyck 2002 R. fellea AF418616.1 Germany Eberhardt 2002 R. foetens AF230895.1 Spain Calonge & Martin 2000 R. foetens AY061677.1 EU Miller & Buyck 2002 R. foetens FJ845427 BC Canada Kranabetter et al. 2009 R. foetens AF418613.1 Germany Eberhardt 2002 R. illota DQ422024.1 unknown Unp. Eberhardt R. pectinatoides DQ422026.1 unknown Unp. Eberhardt R. pectinatoides JF273538.1 China Unp. Ding R. pectinatoides EU819534.1 WI, USA Palmer et al. 2008 R. sororia AB211275.1 Japan Nara 2006 Taxon UNITE # Deposited L. camphoratus UDB000326 Germany L. camphoratus UDB000885 Sweden L. tabidus UDB000108 Denmark L. tabidus UDB000385 Sweden R. foetens UDB000061 Denmark R. foetens UDB002424 UK R. grata UDB000004 Denmark R. ochroleuca UDB000772 Denmark

Table 3 Primers used in PCR reactions. Table adapted from Vilgalys lab, Duke University website (http://www.biology.duke.edu/fungi/mycolab/primers.htm).

ITS1 TCCGTAGGTGAACCTGCGG White et al, 1990 ITS1-F CTTGGTCATTTAGAGGAAGTAA Gardes & Bruns, 1993 ITS2 GCTGCGTTCTTCATCGATGC White et al, 1990 ITS3 GCATCGATGAAGAACGCAGC White et al, 1990 ITS4B CAGGAGACTTGTACACGGTCCAG Gardes & Bruns, 1993 ITS5 GGAAGTAAAAGTCGTAACAAGG White et al, 1990 28

PCR reactions were conducted on a Tetrad2 BioRad Peltier Thermal Cycler machine, following the recipe and protocol of RBGE labs, and contained 10x NH4 Buffer, 2mM of dNTP,

50mM MgCl2, 10!M of each primer and 0.125 Units of Biotaq Polymerase. Cycling conditions were: 90 seconds at 94°C for denaturation, followed by 35 amplification cycles (35 seconds at 95°C 60 seconds at 55°C; 45 seconds at 72°C); and a final 10 minute extension at 72°C. After amplification the product was held at 4°C, until it could be processed further. A fraction of the amplified DNA was analysed by Gel electrophoresis using the SYBR safe stain. The gel was viewed using a Syngene Gene Genius machine with Genesnap software. Products of amplification were purified by ExoSAP IT (GE Healthcare). The reaction contained 5!l of PCR product and 2!l of ExoSAP IT, the mixture was incubated at 37°C for 15 minutes, followed by heating at 80°C for 15 minutes to inactivate the enzyme. A sequencing PCR reaction was performed on the purified amplification products with BigDye Mix and 5x sequencing Buffer with primers for the ITS region, ITS1-F, ITS1, ITS2, ITS3, ITS4B and ITS5. The sequencing PCR consisted of 25 cycles of: 30 seconds at 95°C, 20 seconds at 50°C, 4 minutes at 60°C, afterwards the product was stored in the -20°C freezer until taken for sequencing. Sequencing was carried out by means of a ABI model 3730 DNA Sequencer at the Genepool facility (Univ. of Edinburgh).

4.2 Phylogenetic analysis

The sequences obtained were manually edited and checked in Sequencer 5.0 for ambiguities in forward and reverse primers by comparing chromatograms. The sequences were then imported as Fasta files into the program Mega (Kumar et al., 2004) with additional sequences from Genbank and UNITE databases (http://www.ncbi.nlm.nih.gov/genbank/; Abarenkov et al., 2010; http://unite.ut.ee/) summarised in Table 1 & 2, these were aligned using Muscle and then manually edited. Ambiguous regions were excluded using the online program GBlocks (Castresana, 2000, http://molevol.cmima.csic.es/castresana/Gblocks_server.html), using default settings, except allowing for smaller final blocks. A Parsimony heuristic search was carried out in PAUP 4.0 (Swofford, 2002). Random addition sequence had 10000 replicates. The Tree-bisection-reconnection (TBR) algorithm was used for branch swapping. All characters were weighed equally, and gaps were treated as missing data. The parsimony bootstrap used simple addition sequence. A Maximum Likelihood (ML) and Neighbour Joining (NJ) analysis were carried out in PAUP 4.0, the alignment data was checked with Modeltest (Posada & Candrall, 1998) to find the 29 most appropriate model of substitution to run the ML analysis. The output confirmed a GTR+G model with heterogeneity across sites within the sequence. The model was set to do 100 independent runs. Support for the estimated phylogenies was given by running a bootstrap analysis (Felsenstein 1985). These were calculated using parsimony and NJ settings (TBR branch swapping and saving one tree per replicate).

4.3 Morphology

4.3.1 Light Microscopy To observe spore ornamentation and size, a gill from a specimen was removed and put onto a microscope glass slide, in a drop of water. This was done in order to observe mature spores, which, being mature, would more readily detached into the water. The peril of observing immature spores is that the ornamentation could not be fully developed yet and the size of the spore not fully achieved, compromising the appearance of the spore ornamentation and the spore size. The gill was removed and the spores in the drop of water were then stained with Melzer’s Iodine (1924) solution, which stains the starch of the spore ornamentation. This way the ornamentation was easier to recognise for the contrast of a dark purple-black against a light background. The spores were measured not including ornamentation (Crawshay, 1930), and measurements were taken for width and length. 20 spores from 18 specimens that were used in the molecular analysis were measured for length and width. In order to observe the structures of the pileipellis, a character described in the literature (Romagnesi, 1967; Bon, 1989), a small section of the pileipellis was shaved off the dry sample with a razor. The dry material was allowed to re-hydrate. Re-hydration was tried with Clemeçon’s solution (Stubbe et al., 2008), however, water was found to be just as effective, and then the tissue was stained with cotton blue. The tissue was then observed under a light microscope for pileipellis structures. In some instances, late in the project, it was possible to observe the pileipellis of fresh material. Informative slides of the pileipellis and of the spores were made semi permanent by mounting them with glycerine. Light microscopy was carried out mainly on a Zeiss Axioskop, photographs were taken with an Axiocam MRc5 mounted on the microscope and edited using Axiovision software.

30

4.3.2 SEM Gill fragments from 33 of the specimens that were used for phylogenetic work were loaded onto stubs and coated in platinum using the EMITECH K575x sputter coater. The platinum coating was performed following the manufacturer’s manual (Quorum Technologies): the pump used Argon gas and the machine settings were: target type: noble; sputter current: 25mA; sputter time: 1:30 minutes. Scanning electron microscopy was carried out on a LeoSupra 55VP model, with Zeiss SmartSEM software for the imaging. Working distance from the stub was set at 6mm constantly to avoid image inconsistencies, and the electron high tension (EHT) was set to 5.00kV, which was high enough to provide a good image, but not so high to electrically charge the specimen. Two standard magnifications were used: 5000x and 16000x, in order to make photographs of the spores comparable in size. An initial experiment was carried out and uncoated stubs were observed with the SEM. Slightly different settings of the EHT (4.00kV), the image was not very different, but the coating did improve the ability to focus in depth, so coating of specimens was used for the rest of the study.

4.4 Fresh specimens from Dawyck Botanic Garden

On a collecting trip in mid August, several carpophores were gathered and taken back to the lab. In the field notes were made on the location, smell and taste of the mushrooms. Also information was noted on which woody species they appeared to be associated with (closest tree or which tree the fruiting bodies were at edge of the canopy of). In the lab: spore colour was noted by taking a spore print; spore ornamentation was observed by staining with Melzer solution; and reaction to KOH solution, were noted. Based on this information names were given to the specimens according to Romagnesi (1967).

31

5. RESULTS

5.1 Results of the Molecular Analysis

In the Parsimony analysis, out of 512 characters, 290 were found to be constant. 192 characters were informative for the analysis and 30 were not. 5082 most parsimonious trees were produced. Consistency and Retention Indices (CI & RI) indicated a discreet amount of homoplasy, and the support of the groups by the characters was not high (CI=0.1 and RI=0.5). One of the most parsimonious trees (Fig. 2) summarises the major findings of this analysis. The names on the herbarium labels create some confusion, which is probably the result of the difficulty in identifying the species and the complex nomenclatural problems, especially when it comes to the subsection Foetentinae. However, if the subsection Foenetinae is considered as a whole, they form a monophyletic group, which is well supported by bootstrap values. This analysis does not seem to support the presence in the group of taxa included in previous treatments (of the Foetentinae: R. farinipes, R. sororia, and the Fellinae: R. ochroleuca and R. fellea). The bootstrap analysis found a value of 94% support value for the branch of this clade, which in this study will be considered and this study treats as the Foetentinae (marked in Fig. 2). In the figure are highlighted the clades found in the trees; the resolution at the species level is very poor. Within the Foetentinae clade the resolution is again poor, there are taxa that group together (such as R. illota), and groups can be identified, which were named A, B & C. The strict consensus tree (Fig. 3) shows more clearly where the resolution is lost in the group, i.e. where several of the taxa form polytomies. However, because of the features of the trees generated it is safe to assume that the monophyly of Foetentinae is not contradicted by any of the outside groups, and within the Foetentinae the “illota” clade and the “pectinatoides/praetervisa” clade do not contradict each other. The Neighbour Joining (NJ) analysis produced a tree (Fig. 4) that was in topology very similar to the ones produced by the Parsimony analysis. Inconsistencies were found in the inclusion of some terminal taxa of the “sororia” small group, which seems to be overall ambiguously placed. In this analysis the Foetentinae clade, which still stands solidly, includes R sororia 2 EDNA11- 0021753 and R praetervisa 2 EDNA11-0022370, which were not included in the clade formed under the parsimony principle. The ambiguous positions of R foetens 2 EDNA11-0022355 and R foetens 1 EDNA11-0021881, may possibly be due to the fact that only partial sequences could be obtained from those samples (see Table 1). There are no other obvious contradictions, 32 two clades (A & B) that were expressed as polytomies in the strict consensus tree appear in this analysis, form groups that include the same samples in both the parsimony and NJ analysis. The relationships between the clades within the Foetentinae are contrasting and sister group relationships cannot be recognised comparing the parsimony and neighbour joining trees.

In the Maximum Likelihood (ML) analysis, 5 trees were retained out of 100 runs, with the best tree scoring -3163.10050 for likelihood. Again, in this analysis the Foetentinae are strongly supported by a long, robust branch as a monophyletic group (see Fig. 5). Within the group, the clades of “illota” and “pectinatoides/praetervisa” are sisters as in the parsimony analysis and are well supported. Clade A appears as a group again, but clade B does not. Some of the Group B elements cluster together (e.g. R grata 2 EDNA11-0021895 and R grata 1 EDNA11-0021880, and R fragrantissima 1 EDNA11- 0021882), and all together are in an early branching position, and their branch lengths are relatively short, thus implying less change in comparison to the other clades. The Foetentinae, as marked in the phylograms, were supported with a 94% parsimony and a 95% NJ bootstrap values.

5.2 Morphological characters and their distribution on the molecular trees

The structures of the pileipellis from dry material were very difficult to observe. While certain general morphology could be observed, the material was too difficult to prepare in a way that the differences could be quantified. Figure 6 compares aniline blue (cotton blue) staining pictures and Romagnesi’s drawings (Fig. 6 A1, B1, C1) to emphasise the idea that picture matching and recognising differences in shape of hairs in the pileipellis is hard for the inexperienced eye, especially when the quantifiable characters (such as measurements) overlap; apart from groups that were far apart (see the difference in the image between R. farinipes and R. illota Fig.6A&B), the differences in pileipellis within the Foetentinae were not as striking as the differences found for example in the spore ornamentation.

When spores were observed under the light microscope and the SEM, distinct spore ornamentations were detected and captured in photography. The problem of inconsistency of the names given to the specimens and the morphology observed arose, for example in the case of R. 33

C

F o A e t e n t B i n a e pectinatoides/ praetervisa

illota

sororia

farinipes

fellea

ochroleuca

Figure 2 One of most parsimonious trees from the analysis of the ITS region with BS values of 85% or more. The clades were named to refer to them in relation to other trees and discussion of the morphology. Some were called after the taxa, three of them were given letters because of their uncertain identity and resolution. 34

C

F o pectinatoides/ e praetervisa t e n t i n a e

illota

sororia

Figure 3 Strict consensus parsimony tree. It presents three of the same groups (illota, pectinatoides/praetervisa and C) as the parsimony (Fig1), NJ (Fig.3) and ML (Fig 4) trees, but presenting polytomies where branches are unresolved. 35

C

B

A

illota

pectinatoides/ praetervisa

fellea

ochroleuca

sororia

farinipes

Figure 4 The Neighbour Joining, BS values 75% and above are reported on the branches that are thought to be key clades. The tree is consistent with most of the other analyses and shows the same groups of taxa arising. T here are inconsistencies (see the position of R. nobilis within R. fellea) that indicate that the results of this method should be taken cautiously. 36 C

A

pectinatoides/ praetervisa

illota

B

sororia

farinipes

fellea

ochroleuca

Figure 5 The maximum likelihood tree with the best likelihood score. The branch lengths are proportional to the rate of change in the branch. The groups that were identified in the parsimony and NJ analyses (Fig. 1 & 3) are present in this tree and are indicated by the clades. The difference with the other two trees is group B, that in this analysis does not hold as a group. 37 grata and R. fragrantissima (Fig. 7). These inconsistencies caused by unclear diagnostic characters, and ever confusing taxonomy and nomenclature, are going to be in part explained bby molecular trees coupled with the morphology (spore ornamentation). The spore ornamentation types are presented and organised below according to the molecular trees, molecular and morphological characters generally agreed. The spore ornamentations of the taxa that were not included in the Foetentinae are also reported: R. farinipes, R. fellea, R. ochroleuca (Fig 8 A-C) and R. sororia (Fig. 9). R. illota (Fig. 10) forms a distinct group, identified usually by macroscopic characters and not as much by the spore ornamentation, which resembles a less pronounced version of group B (Fig.12). However, it appears to be consistent within the group and therefore spore ornamentation appears to be a useful character. Spore size recorded ranged: 4.7-7.5 x 5.7-8.1 !m and averaged 6.4 x 5.2 !m. Bootstrap values were 99% using parsimony and 100% using NJ. According to herbarium label information, one of the specimens in this group was associated with Quercus L.. R. pectinatoides/praetervisa (Fig. 11) also forms a distinct group, again usually identified by macroscopic characters. Spore ornamentation ranges from isolated to connected warts, and provides useful insights in the discussion of the treatment of this one or two species sensu Sarnari. Spore size recorded ranged: 4.9-7.4 x 6.1-8.6 !m and averaged 6.2 x 7.7 !m. Bootstrap values were 99% for both parsimony and NJ analyses. Specimens in this group were associated with Pseudotsuga, Quercus robur L. and Tilia (two specimens). Group A (Fig. 12) has a range of spore morphology characterised by isolated warts with the exception of R fragrantissima 4 EDNA11-0022369, which usually branches early in the clade and, as shown in the image 12C, has strong ridged connections. This suggests that Group A is probably the group that Romagnesi refers to as Foetens. This group is usually split on the basis of a combination of taste, odour and spore size, while it is united by the isolated-wart spore ornamentation. Spore sizes recorded ranged: 6.2-8.6 x 7.4-13.6 !m and averaged 7.9 x 9.4 !m. Bootstrap values were below 60%. Specimens in this group were associated with Fagus sylvatica L., Betula L., Abies procera Redhar., Pseudotsuga and broadleaved woods in general. Group B (Fig. 13) is the least supported group, in the ML analysis completely breaks down but the samples are all early branching. The spore ornamentation is distinctive and very different from those of the other groups except for “illota”. The striking spore ornamentation suggests that this is the group that includes taxa from the Stirpe that Romagnesi calls Laurocerasi. This Stirpe has nomenclatural issues that will be discussed later, and is usually split into species through taste, spore and ornamentation size characters but is united by the smell of benzaldehyde.

38

Figure 6 comparison of pileipellis structures seen under the light microscope (x40) and drawings of Romagnesi (1967). (A, A1: R. farinipes; B, B1 R. illota; C, C1 R. pectinatoides/praetervisa). T his illustrates the sort of “picture matching” that is done in order to identify or confirm a species. Because of the limited time there was for the project, it was challenging for inexperienced eyes to catch the differences, even when dealing with fresh material ( C ). 39

A

Figure 7 SEM photographs of Spores at 16000x magnification, at a working distance of 6mm, EHT of 5.00. An example of how the the name on the label does not reflect a consistency in morphology. This is because of the difficulty in discerning species in this section and also when the specimens were identified and what the species concept was at that time. A & B have the same name and C & D have the same name, however, A & C and B & D have much closer spore oramentation than A & B and C & D. A) R grata 2 EDNA11-0021895 and B) R grata 3 EDNA11-0022366 C) R fragrantissima 1 EDNA11-0021882 and D) R fragrantissima 2 EDNA11-0021883 40

Figure 8 Spores at 5000x (left) and 16000x (right) magnification, at a working distance of 6mm, EHT of 5.00. Specimen names: A) R farinipes 2 EDNA11-0022361; B) R fellea 2 EDNA11-0022367; C) R ochroleuca 2 EDNA11-0022356. Because of the standard settings, the size of the spores at the same magnification is directly comparable. 41

Figure 9 Group sororia. SEM photograph of spores at 16000x magnification, at a working distance of 6mm, EHT of 5.00. Spore ornamentation described by Moser (1978) as “flat warts”. Specimen names: A) R pectinatoides 1 EDNA11-0021748; B) R sororia 3 EDNA11-0021754.

Figure 10 Group illota. SEM photographs of spores at 16000x magnification, at a working distance of 6mm, EHT of 5.00. Spore ornamentation with developed ridges. Specimen names: A) R illota 2 EDNA11-0022363; R illota 1 EDNA11-0021752. 42

Figure 11 Group pectinatoides/praetervisa. SEM picture of spores at 5000x (left) and 16000x (right) magnification, at a working distance of 6mm, EHT of 5.00. Spore ornamentation variable from isolated warts to warts with many connections, and in between (A) spores with both kinds of ornamentation. Specimen names: A) R praetervisa 3 EDNA11-0022371; B) R subfoetens 2 EDNA11-0022373; C) R pectinatoides 3 EDNA11-0022359. 43

Figure 12 Group A (Foetens) SEM photographs of spores at 5000x (left) and 16000x (right) magnification, at a working distance of 6mm, EHT of 5.00. Spore ornamentation in this group characterised by isolated warts. Specimen names: A) R grata 3 EDNA11-0022366; B) R subfoetens 3 EDNA11-0021886; plus R fragrantissima 4 EDNA11-0022369, which branches just before the group in all trees (Fig. 1-4). It is also characterised by a different spore ornamentation (with more pronounced connection ridges). 44

Figure 12 (caption next page) 45

Figure 13 Group B (Laurocerasi or Grata) SEM photographs of spores at 5000x (left) and 16000x (right) magnification, at a working distance of 6mm, EHT of 5.00. Spore ornamentation with falanges. Specimen names: A) R grata 2 EDNA11-0021895; B) R grata 1 EDNA11-0021880; C) R foetens 1 EDNA11-0021881; D) R fragrantissima 1 EDNA11-0021882; E) R fragrantissima 3 EDNA11-0022368. 46

Figure 14 Group C SEM photograph of spores at 5000x (left) and 16000x (right) magnification, at a working distance of 6mm, EHT of 5.00. Spore ornamentation different, probably reflecting two separate taxa in this group. Specimen names: A) R sororia 3 EDNA11-0022364; B) R pectinatoides 2 EDNA11-0022358. 47

Spore size ranged: 7.4-11.1 x 7.5-10.7 !m and averaged 8.8 x 10 !m. The group as a whole had bootstrap values below 60%, however, the NJ analysis gave a 78% bootstrap value for a smaller group within of 78%, this group included specimens: R fragrantissima 1 EDNA11-0021882; R grata 1 EDNA11-0021880; R grata 2 EDNA11-0021895; R subfoetens 1 EDNA11-0021885. Specimens in group B were reported to be associated with Fagus and mixed woodland. Group C (Fig. 14) is composed of two specimens that group together in all the trees, even though they show some degree of distance (i.e. their sequences are not identical). The spore sizes reported ranged: 4.9-7-4 x 6.2-8.6 !m and averaged 6.2 x 7.7 !m. The bootstrap value for the parsimony analysis was of 85%, the group was split in a different way in the NJ tree, but clustered nonetheless. Either of the names given to the specimens (R. sororia and R. pectinatoides) could not correspond to this group because: first, the taxon R. sororia sits outside the Foetentinae in all the phylogenies and the specimens of the group “sororia” are consistent morphologically with the species concept of R. sororia and not with that of group C; second, the taxon R. pectinatoides groups together (pectinatoides/praetervisa) and does not seem to be related to Group C. When the spores of the two specimens were looked at, they did not look the same, indicating that the two specimens are apparently two different taxa. The literature (Romagnesi, 1967; Bon, 1989; Kibby, 2010) was consulted for possible taxa that are part of the Foetentinae but had not been sampled. The spore ornamentation found in the specimens could be matched in the literature with the spore ornamentation of R. amoenolens or R. pectinata for R sororia 3 EDNA11-0022364 and with that of R. insignis for R pectinatoides 2 EDNA11-0022358. To check if it was reasonable to think that the two specimens were misidentifications of the species listed above, their ITS sequences were blasted using the GenBank and the UNITE databases. Below are reported the first two hits of the search that had associated taxonomic names: R pectinatoides 2 EDNA11-0022358: UNITE – R. amoenolens UDB000343 (Score 1134; E =0.0); R. livescens UDB000894 (Score 751; E = 0.0) GenBank – R. cf. pectinata HQ604835 (Query coverage (QC)=100; E = 0.0; Max ident (MI)= 98%); R. cerolens HQ604830 (QC=100; E=0.0; MI=98%) R sororia 3 EDNA11-0022364: UNITE – R. amoenolens UDB000343 (Score 547; E =e-157); R. foetens UDB0002424 (Score 436; E = e-123) GenBank – R. amoenolens GU222264 (QC=100; E = 9e-144; MI=100); R. pectinata AY061706 (QC=100; E = 9e-144; MI=100) 48

These names will be discussed in more detail later, however, it is important to point out that except for the name R. foetens, all the other names belong to the group that Romagnesi (1967) calls Pectinata. The sequence information on these two specimens in conjunction with their spore ornamentation and with their grouping together and aside from the other groups in the molecular trees, gives a strong indication that these samples belong to the group Pectinata of the Foetentinae and they may not have been sampled intentionally. Specimens in this group were associated with Pseudotsuga.

Spore ornamentations are summarised in Figure 15, where are represented the main types that have been recognised in the study and their variation.

A1 B1 C1

A2 B2 C2

A3 B3 C3

Figure 15 Schematic representation of types of spores and their variation within groups identified in the study. A1-3 Associated with group B, with strong ornamentation with ridges and wings, which vary in size, spores are round but can also vary in size. B1-3 spores associated with group C and the pectinatoides and praetervisa group, where ornamentation has been used to determine species. This drawing shows how the interconnections can vary in density. C1-3 associated mainly with group A, isolated warts can be pronounced or not and can have some slight connections. Scale bar of 5!m ca.

In addition to the characters investigated in this study, there are other macroscopic, olfactory and gustatory characters that help in understanding the delimitations of the groups as found in the molecular analysis, these are discussed in full in the next chapter (6).

49

5.3 Fresh specimens collected at Dawyck Botanic Garden

Several specimens were collected at Dawyck Botanic Garden in mid August ’11 (Fig 16 A&B). Once examined in the lab and keyed out using Romagnesi (1967), three species and one variety were found to be represented. R. foetens: spores large, spore ornamentation with large isolated warts. No yellow reaction to KOH. Smell with a hint of marzipan, and acrid long-lasting taste. Collected under Ostrya Scop.. R. grata: rounds spores (diameter 8 !m ca.) with strong spore ornamentation. Strong smell of benzaldehyde. Collected under the birch and under beech. R. subfoetens: small spores (6 x 5 !m ca.) with isolated warts (some with few connections); KOH positive. A different smell - not necessarily foetid, but definitely not the strong benzaldehyde, and very acrid persistent taste. Collected under beech, oak and Pseudotsuga. R. subfoetens var. grata sensu Romagnesi: spores round (diameter 8 !m ca.) with network- like interconnections and some spores with pronounced ornamentation; positive KOH; smells as R. subfoetens. Collected under Pseudotsuga. There were also collections of R. ochroleuca and R. fellea. R. ochroleuca was found under Pseudotsuga and Beech. R. fellea was found three times under beech and just the once under Pseudotsuga, however, nearby there was a young beech tree. Because of time restraints further visits and analyses were not possible to carry out, making this data very limited. Carpophores found appeared to be grazed upon by insects and maybe larger animals, making these fruiting bodies very ephemeral and the visit just a snapshot of what the community of this group could be at Dawyck Botanic Garden.

50

Figure 16 R. foetens found at Dawyck Botanic Garden in mid August 2011, near the visitor centre under Pseudotsuga menziensii. 51

6. DISCUSSION

6.1 Considerations on Datasets

Since the first implementation of molecular datasets, there have been discussions on their strength as sets of data on their own but also on how the results obtained relate to morphology- based classifications. The discussions become more complicated when several dataset are available and different ways of analysing them are possible: separately (Miyamoto & Fitch, 1995) or as a combined dataset (Hillis, 1987), each method having its advantages and disadvantages (Huelsenbeck, 1996). Morphology, biochemistry, cytology, physiology and ecology have been tools used in order to classify organisms; for taxonomic classification of species, up until molecular datasets have started to come into use, morphology was the most commonly used form. Morphological classification built a framework that molecular analyses can further resolve and support, by integrating the data and making the analyses more accurate (Scotland et al., 2003, Olmstead & Scotland, 2005). In this study the datasets gathered were not combined in the same analysis. However, different principles were used to analyse the DNA sequence data such as parsimony, maximum likelihood and neighbour joining; additionally, another set of data (morphology) was collected on the same specimens. The different nature of the methods used in the analyses and the results telling similar stories, strongly suggest that the systematic organisation that the data are giving are reasonably sound.

6.2 Outgroups and the Excluded Species

As a choice of outgroups for the analysis, L. blennius, a species occurring in Dawyck Botanic Garden (Krivstov et al., 2003), L. tabidus and L. camphoratus were chosen. Even though Lactarius as a genus has been reported to be not the ideal outgroup for the genus Russula for reasons mentioned in the Introduction (1.2) and discussed in Miller & Buyck (2002), Lebel & Tonkin (2007), for the purpose of this study it was considered an adequate choice because of the data presented in Eberhardt & Verbeken (2004), where Russula and Lactarius form sister groups. Some taxa that were traditionally included in the Ingratae were found not to belong to the Foetentinae (sensu auct.) in this study. In the cases of R. farinipes, R. fellea and R. ochroleuca, this 52 distinction supports previous molecular studies (Miller & Buyck, 2002; Eberhardt, 2002), but, in the case of R. sororia, it is a new finding. These taxa are discussed below. R. farinipes was traditionally placed within the Ingratae probably because of the colour (ochraceous brown) of the pileus. This treatment was used up until very recently (Bon, 1989, Sarnari, 1998). This study suggests, supporting other molecular studies (Miller & Buyck, 2002) that R. farinipes does not belong to this group, and is more related to other taxa R. pallidospora (Miller & Buyck, 2002). The main morphological character that R. farinipes exhibits, that is different from the rest of the Foetentinae and the Ingratae is a white spore print as opposed to a cream-coloured spore print. This character was considered by Maire (1910) not a natural character on which classification should be based, but with the support of molecular data, it is possible to say, without knowing why, that it is a good character that indicates species’ relatedness in the taxa considered here. R. fellea, being very similar in appearance to R. farinipes, with a uniform colour on the pileus and stipe, but with different spore prints (R. fellea pale cream and R. farinipes pure white), was probably placed in the Ingratae for similar reasons; R. ochroleuca has a bright yellowish ochraceous pileus and a white stipe, but otherwise is morphologically very similar to R. fellea, in the spore ornamentation and pileipellis incrustations. Einhellinger (1985) had already moved the Fellinae away from the Foetentinae and closer to the Emeticinae and so did Bon (1989). This study supports this view by placing them near R. nobilis (former R. mairei), which belongs to the subgenus Russula as understood by Bon (1989) and Sarnari (1998). This is supported by other molecular studies (Miller & Buyck, 2002; Eberhardt, 2002), and morphologically by the presence of incrustations in the pileipellis structures, which they have in common with other members belonging to the Emeticinae as understood by Romagnesi (1967). R. sororia has always been placed within the Foetentinae, this is the first study in which this species does not appear to belong to this group. The position is not clear from the molecular trees produced here, but is not included in the Foetentinae group in any of the analyses. Despite never (before this study) being excluded from the Foetentinae or Ingratae, there is indication that it should be separated from them on the basis of the morphology and of some comments in the literature, especially Legon et al. (2005). R. sororia is characterised by a mat pileus and by much paler colours than those of the Foetentinae. Legon et al. (2005) suggest its synonymy with R. consobrina, a North American and continental Europe species, which was placed in the Fellinae by Romagnesi (1967) and Bon (1989), and in the Citrinae by Einhellinger (1985). The difference between these two taxa according to Romagnesi (1967) is mainly the spore ornamentation, with isolated warts in R. sororia and with many interconnections in R. consobrina. Unfortunately R. sororia was never molecularly 53 analysed outside this study, however, there is strong indication from the present molecular data, from the morphology and from some suggestion in the literature that the present treatment of this taxon is reasonable. 6.3 The Foetentinae

The study suggests the existence of a monophyletic group, the Foetentinae. The molecular result, obtained with three different methods of sequences analysis is supported by macroscopic characters of this group such as: some strong scent ranging from foetid and nauseating to smell of benzaldehyde; a cream-coloured spore print; a hollow stipe like other russulas, but in this group it bears characteristic pocket-like holes; and a shiny pileus (Shaeffer 1952). The molecular study, supported to an extent by morphological characters, showed the species and species groups in this subsection clustered, these species and groups are discussed below. The group in the molecular tree “illota” (R. illota as understood by Romagnesi, 1967) is clearly defined, with high support from the molecular data. Morphologically this species is identified through an easy character detectable in the field: the edge of the gills is blackish purple. Its relationship to the rest of the Foetentinae is not clear – as most of the relationships in this group – but it has no nomenclatural or taxonomic issues and is an unambiguous species. The group “pectinatoides/praetervisa” clusters together with support from the molecular methods. Morphologically, this group varies widely in the ornamentation of the spores, which go from isolated warts to reticulate (i.e. network-like interconnections) as illustrated in Fig. 15 B1, 2 & 3. R. pectinatoides was first described in North America by Peck. In his notes Peck mentions the spores having isolated warts. Because of this, Sarnari (1998) in his monograph of Russula in Europe, makes a new species R. praetervisa, that would be the Mediterranean equivalent of R. pectinatoides, identical in every way to R. pectinatoides, but different in the interconnected spore ornamentation. This distinction, which could separate the North American ones from the European ones, does not seem to hold in this study, and also in the literature, interconnections of the spore ornamentation are reported in Shaffer’s (1972) drawings of R. pectinatoides, in his treatment of the Foetentinae in North America. In the present SEM study it was noted that the spore ornamentation of R. pectinatoides is variable in a single individual (Fig 11A) where the same gill was found to bear spores with connections and isolated warts sitting next to each other. Another thing to consider is the possibility that the type specimen designated by Peck could be at one end of the range of variation in the species. Here it is suggested that the variation in R. pectinatoides and R. praetervisa be investigated further (morphologically and molecularly on both American and European 54 specimens); the results from this study, however suggest that the specimens used for this study constitute one group and not two distinct ones, and bear both kinds of spore ornamentation. Group A was associated morphologically with the group Romagnesi (1967) calls Foetens. This group includes taxa such as R. foetens and R. subfoetens. The difference between these two species resides in the reaction to KOH and in spore characters, such as large spores with pronounced isolated warts in R. foetens (Fig 12A) and smaller spores with weaker ornamentation in R. subfoetens (Fig 12B) (Romagnesi 1967). These characters are consistent in supporting this group, and it was possible, using these diagnostic features, to identify representatives of these two species collected at Dawyck Botanic Garden. This group appeared in all the trees produced, however, it was not strongly supported by bootstrap values. The lack of consistent molecular resolution within the group suggests that the different spore ornamentation and the reaction to KOH do not define the limits of species and therefore evolutionary entities, even though there is a difference in morphology. This problem could be elucidated by the use of additional molecular markers to increase the resolution, aiding the decision to whether these two morphologically distinct entities represent one species with a broad concept or two distinct species. At the base of the group there is in all the produced trees, the specimen depicted in Fig. 12C (specimen R fragrantissima 4 EDNA11-0022369). The spore ornamentation does not conform to the rest of the group, and coherently, the molecular data shows some degree of difference, by placing it always as an early branching taxon to the group (Fig. 2, 4, 5 and 17). R. subfoetens var. grata is the only example in the group Foetens, described by Romagnesi (1967) to bear some similarity (very round spores with ridges in a reticulate fashion, similar to the spore ornamentation of R. grata) to the specimen R fragrantissima 4 EDNA11-0022369 suggesting that the latter is possibly not a variety of R. subfoetens but a species in its own right.

a b

c

Figure 17 Foetens group (A) of the molecular trees showing R fragrantissima EDNA11 0022369 specimen always as early branching in this group. a) the parsimony tree; b) NJ tree; and, c) ML tree. 55

Group B is the group that is least supported by molecular characters, but shows a strikingly different spore ornamentation (Fig 13), which is consistent throughout the group for all the specimens. This type of spore ornamentation can be associated with members of Romagnesi’s (1967) Laurocerasi stirpe R. laurocerasi (now known as R. grata) and R. fragrantissima. The name R. grata was previously associated with a fungus that had mild taste, hardly any smell and small elliptical spores with isolated warts, this was presented in Künher & Romagnesi (1953). The species concept of R. grata changed in 1980 when Bresinsky et al., examining drawings by Britzelmayr, identified the drawing with the name R. grata as what was referred then to as R. laurocerasi. This change was based on a watercolour of the fungus and a note that indicated the smell of sweet almonds and a mild taste. A mild taste could indicate that the drawing referred to what Romagnesi (1967) called R. laurocerasi var. fragrans. Spore ornamentation is one of the key characters in the identification of the Ingratae and is (obviously) not featured or deductible in the drawing, making this shift premature. From the molecular analysis there is no indication on the relationships within this group. The separations suggested by Romagnesi (1967), on the basis of characters such as taste and smell do not seem to consistently reflect separations in this group. Because most of the identifications of the material that was used in this study were done in the field through smell and taste, spore size and ornamentation characters, it seems that these characters were not always consistently detectable. This problem is not limited to groups A and B and there are some inconsistencies of names that extend to other species that are part of the Ingratae, an example are the specimens that were called group C. Group C is a group that is thought to be misidentifications of specimens that belong to the group that Romagnesi (1967) called Pectinata, including R. amoeloens, R. insignis and R. pectinata. This is supported by the appearance of the spore ornamentation and the comparison of the ITS sequences with the ones on GenBank and UNITE websites as shown in the Results (5.2). The position of this group is consistent with previous literature: Miller & Buyck (2002) in their analysis found R. amoenolens to have an early branching position in the Foetentinae and a similar indication comes from the analysis carried out by Eberhardt (2002), thus strengthening the suggestion that those two specimens are indeed part of the group Pectinata as understood by Romagnesi (1967).

56

6.4 Pileipellis as a Useful Diagnostic Character

Even though, their differences do not seem to be as striking as the spore ornamentation from the drawings found in the literature, one of the morphological characters that could have been also useful in understanding relationships within the Ingratae is the features of the pileipellis structures (Romagnesi, 1967; Bon, 1989). This study did not investigate in depth the features of the pileipellis, because of the nature of the material available (see Results 5.2). The molecular study was carried out only on dry herbarium specimens and this is not ideal for the morphological study of these structures, therefore, even though in a collecting trip fresh material was observed, the data were not reported because they cannot be related to the molecular trees produced on the herbarium specimens. It is suggested that in the future the work be carried out on fresh material on which both morphological and molecular analyses can be conducted, or with specimens that have detailed notes on these microscopic features.

6.5 Nomenclature Issues

The study found difficulty in giving names to specimens and thus restricted its diagnosis/conclusions to assigning specimens to groups. This problem was dealt with when types were mentioned and described, as in the case of R. pectinatoides, where considerations on the type specimen being possibly at the edge of the range of the species have been made. In most other cases the type material is not only not available for observation, but some species, especially the ones described by Britzelmayr, do not appear to have been properly typified (e.g. R. grata). The older protologues of the species also do not present much of a description to work with, especially when characters that are thought now to be key to the identification are not mentioned. This is the reason why the lectotypification of the original drawings of Britzelmayr’s is discouraged: if the spore ornamentation is an important feature to diagnose species, then a drawing of a fruiting body would not be helpful in delimiting the species. To obtain that – the delimitation of a species, however, typification of a specimen is necessary. Article 9.2 of the Botanical Code of Nomenclature states:

“[…]A lectotype is a specimen or illustration designated from the original material as the nomenclatural type […], if no holotype was indicated at the time of publication, or if it is missing, or if it is found to belong to more than one taxon. […]”

57

Therefore the rightful lectotypes of these species described by Britzelmayr are those drawings by Britzelmayr, however inconvenient that may be. Information was not available on the existence of physical specimens for these species collected by Britzelmayr, but before the illustrations are made authoritative, it would be helpful to search for possible specimens to lectotypify.

6.6 Exotic and Native Associations of Foetentinae

The data available were not enough to make statements about the host specificity of the Foetentinae at Dawyck Botanic Garden. There is indication in previous studies of the possibility that fungi in a setting in which they are exposed to exotic species of plants, will start forming unexpected ectomycorrhizal associations (Krivstov et al., 2003). In this study it was not possible to assess this point clearly. There was no clear trend in the associations recorded that agreed with the species delimitation, and it could be speculated that the Foetentinae are not a highly specialised ectomycorrhizal group when given the opportunity. However, this notion should be taken cautiously because of the limited sample number and the nature of the data that do not directly link the fruiting body to the host tree as they work under the assumption that the carpophore is associated with the nearest host, or to the more likely host if close by. A more rigorous method of collecting these data would be that of sampling roots and investigating the direct association with the fungus, as it was done in Allen et al. (2003).

58 59

7. SPECIMENS SEEN

List of specimens (with names kept as the herbarium label) seen that can be assigned to groups: R. illota R. illota, Watling, R., WAT30084, E. 25/8/1986 Comrie, Perthshire. EDNA11-0021752 R. illota, Watling, R., WAT13267, E. 18/8/1979 Starloch, Perthshire. EDNA11-0022363

R. pectinatoides and R. praetervisa R. praetervisa, Overall, 166093, K. 13/7/2009, Hampstead Heath, London. EDNA11-0022371 R. subfoetens, Overall, 127041, K. 24/8/2004, Golders Hill Park, Hampstead Heath, London. EDNA11-0022373 R. praetervisa, Watling, R., WAT30003, E. 1/8/2010, Dawyck Botanic Garden (Swiss Bridge). EDNA11-0021884 R. pectinatoides, Watling, R., WAT27602, E. 7/7/2001, Dawyck Botanic Garden (car park). EDNA11-0022359

Group A Foetens(species: R. foetens, R. subfoetens) R. subfoetens, Watling, R., WAT30129, E. 31/8/2010 Dawyck Botanic Garden (vista). EDNA11- 0021886 R. grata, Bauar, WAT20159, E. 9/1987, Ormskirk, Lancashire. EDNA11-22366 R. fragrantissima, Kilkenny, NK39, E. 5/8/2008, Dawyck Botanic Garden (Rhododendron walk). EDNA11-0021883 R. fragrantissima, Kibby,124876, K. 7/8/2004, New Forest, Cadnams, South Hempshire EDNA11- 0022369

Group B Grata/Laurocerasi (species: R. grata, R. fragrantissima) R. fragrantissima, collected by Watling, R., WAT28114, E. 21/9/2002, Duns Castle, East Lothian. EDNA11-0021882 R. grata, collected by Watling, R., WAT30016, E. 31/8/2010, Dawyck Botanic Garden (Rhododendron Walk). EDNA11-0021880 R. grata, collected by Watling, R., WAT30091, E. 4/9/2010, Comrie, Perthshire. EDNA11-0021895 R. subfoetens, collected by Watling, R., WAT30128, E. 31/8/2010, Dawyck Botanic Garden (Rhododendron Walk). EDNA11-0021885 60

R. fragrantissima, collected by Kelly, 93582, K. 19/8/2001, Ashridge, Hertfortshire. EDNA11- 0022368

Group C Pectinata (species: R. pectinata, R. amoenolens, R. insignis) R. sororia, collected by Orton, 3098, E. 21/8/1967, Gomshall, Surrey. EDNA11-0022364 R. pectinatoides, collected by Watling, R., WAT26655, E. 25/10/1995, Dawyck Botanic Garden. EDNA11-0022358

R. farinipes R. farinipes, Watling, R., WAT19252, E. 16/81980 (no location) EDNA11-0022361

R. ochroleuca R. ochroleuca, Watling, R., WAT11329, E. 13/10/1075, Inchlanarg, Loch Lomond, Stirlingshire. EDNA11-0022357 R. ochroleuca, Munro, WAT20075, E. 18/10/1987, Clackmannanshire. EDNA11-0022356 R. ochroleuca,Watling, R., WAT28111, E. 29/9/2002, Dawyck Botanic Garden. EDNA11-0021889

R. fellea R. farinipes, Watling, R., WAT29568, E. 25/8/2008, Dawyck Botanic Garden (Rhododendron Walk). EDNA11-0021749 R. fellea, Watling, R., WAT27437, E. 10/11/2000, Dawyck Botanic Garden, Heron Wood (Sanctuary). EDNA11-0021888 R. fellea, Kungu, E. 16/10/2002. Saltoun Wood, East Lothian. EDNA11-0021887 R. fellea, Munro, WAT22491, E. 8/1990 (no location). EDNA11-0022367

R. sororia R. pectinatoides, Cohen, 190972, E. 8/6/2002, Campertown Country Park, Dundee. EDNA11- 0021748 R. sororia, Watling, R., WAT28186, E. 28/9/2002, Duns Castle, Berwickshire. EDNA11-0021754

Two specimens were not consistent with the same groups in the phylogenies, but according to their spore morphology, it would seem 1) would belong in Group A, and 2) in Group B. R. foetens, Storey, 47560, E. 6/9/1979, England. EDNA11-0022355 R. foetens, Murray, WAT19954, E. 27/7/1987, Scotland. EDNA11-0021881 61

8. CONCLUSION

This study has investigated the section Ingratae and subsection Foetentinae of the genus Russula. It was concluded that there is strong indication of the monophyly of the group Foetentinae; this delineation removed from this subsection taxa that were included in previous treatments of the group (e.g. R. farinipes and R. sororia). Thus it is accepted that the Foetentinae form a natural group supported by molecular and morphological characters. The group featured several morphotypes in spore ornamentation which grouped together in the molecular trees produced. However, only R. illota and R. pectinatoides could positively be allocated names, the other groups were not resolved enough to be able to identify distinct entities and therefore were left as groups of what could be one or several species. There was no insight either on the relationships within the Foetentinae except for the early branching position of the group Pectinata (group C). Spore ornamentation was revealed to be a good character in grouping taxa within the Ingratae, however, Russula as a genus cannot be separated by the spore ornamentation. It was also shown that to effectively identify species it is necessary to record microscopic characters (e.g. spore ornamentation) and that field characters, such as smell and taste, are often not consistently detectable enough to identify the species in the Ingratae. It was not possible to assess ectomycorrhizal associations between the Ingratae and woody hosts. There is some indication that the Ingratae at Dawyck Botanic Garden will form exotic associations that wouldn’t occur in a natural environment, however, this is speculation because the data collected do not directly link the fungus to the host and therefore work under the assumption that the closes tree is the host of the fungus. If further work should be carried out, it is suggested it should include: i) a molecular analysis including more DNA regions and samples to increase the resolution in the molecular trees to possibly help elucidate some of the species delimitations and relationships; ii) the investigation of additional morphological characters that may be relevant in identifying the species (e.g. the structures of the pileipellis; taste and smell characters quantified chemically); iii) the use of a more rigorous method to investigate the host ectomycorrhizal associations, possibly using root samples and extracting the fungal DNA from them. In conclusion, this study has shown the Foetentinae are a group supported by morphological and molecular characters. Species inside this group are hard to discern and some characters used in the past for identification, such as smell or taste, are not easily detected in a consistent way. These characters nonetheless could reflect differences in chemistry that have not been discovered yet. 62

Spore ornamentation characters, reaction to chemicals and general macromorphological characters are useful in identifying morpho-taxa, but as of yet, it was not possible to delimit species this way. This study has shown that the identification of the species of this group is not always possible using field characters, and that the specimens need to be examined in a laboratory setting; therefore future ecological studies, to be accurate in recording these species, need to take this into consideration. 63

9. CITED LITERATURE

Abarenkov K, Nilsson RH, Larsson K, Alexander IJ, Eberhardt U, Erland S, Høiland K, Kjøller R, Larsson E, Pennanen T, Sen R, Taylor AFS, Tedersoo L, Ursing BM, Vrålstad T, Liimatainen K, Peintner U, Kõljalg U. 2010. The UNITE database for molecular identification of fungi - recent updates and future perspectives. New Phytologist 186(2): 281 – 285

Allen TR, Millar T, Berch SM, Berbee ML. 2003. Culturing and Direct DNA Extraction Find Different Fungi from the Same Ericoid Mycorrhizal Roots. New Phytologist 160(1): 255-272.

Anderson I, Cairney J. 2004. Diversity and ecology of soil fungal communities: increased understanding through the application of molecular techniques. Environmental Microbiology 6(8): 769-779.

Anynomous. GenBank. http://www.ncbi.nlm.nih.gov/genbank/ 22 August 2011

Anonymous. Index Fungorum. http://www.indexfungorum.org/, 22 August 2011.

Anonymous. 2007. International Code of Botanical Nomenclature (Vienna Code). Regnum Vegetabile 146. A.R.G. Gantner Verlag KG.

Anonymous. Quorum Technologies Ltd., Sputter Coating Technical Brief. Available online at: http://www.quorumtech.com/ 16 August 2011]

Anonymous. Sequencher® version 5.0 sequence analysis software, Gene Codes Corporation, Ann Arbor, MI USA. http://www.genecodes.com 22 August 2011

Barbier M. 1908 [1907]. Description synthétique des Russules de France. Bulletin de la Société mycologique del la Cote-d’Or 3: 1-45.

Bataille F. 1908. Flore monographique des astérosporés. Lactaires & Russules. Mémoires. Société d’Emulation du Doubs 8: 163-260.

Beeken L. 2001. Russula densifolia Scr. Ex Gill. + Fagus sylvatica L. – Descriptions of Ectomycorrhizae 5: 147-155.

Bellemain E, Carlsen T, Brochmann C, Coissac E, Taberlet P, Kauserud H. 2010. ITS as an environmental DNA barcode for fungi: an in silico approach reveals potential PCR biases. BMC Microbiology 10: 189.

Bhudaria V, Miraz P, Kennedy R. 2010. Dual trypan-aniline blue fluorecscence staining methods for studying fungus-plant interactions. Biotechnic & Histochemistry 85(2): 99-105.

Bills GF, Miller OK. 1984. Southern Appalachian Russulas. I. Mycologia 76: 975-1002.

Blum J, 1962. Les Russules. Encyclopédie Mycologique – XXXII. Éditions P. Lechevalier. Paris. 186-197.

Bon M. 1988. Clé Monographique des Russules d’Europe. Documents Mycologiques 18 (71-72): 1- 125.

64

Bresinsky A, Stangl J, Einhellinger A. 1980. Beiträge sur Revision M. Britzelmayrs “Hymenomycenten aus Südbayern” 14. Die Gattung Russula unter besonderer Berücksichtigung ihrer Arten in der Umgebung von Augnsburg 46(2): 131-156.

Britzelmayr M. 1893. Botanisches Centralblatt 15-17:17.

Burlingham GS. 1915. Russula. North American Flora 9: 201-236.

Buyck B. 1988. Etude microscopique de specimens-type de Russules tropicales de la sous-section Diversicolores. Mycotaxon 33: 57-70.

Buyck B. 1990. Revision du Genre Russula Persoon en Afrique Centrale. PhD thesis Rijksuniversiteit Gent Faculteit Wetenschappen.

Buyck B, Thoen D, Watling R. 1996. Ectomycorrhizal fungi of the Guinea-Congo Region. Proceedings of the Royal Society of Edinburgh B 104: 313-333.

Castresana J. 2000. Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Molecular Biology and Evolution 17: 540-552.

Cazzoli P. 2003. Approccio al Genere Russula – I. Rivista di Micologia 2: 99 - 113.

Cazzoli P. 2005. Approccio al Genere Russula – IV. Rivista di Micologia 2: 99 - 112.

Chase M, Fay M. 2009. Barcoding of plants and fungi. Science 325: 682-683

Courty PE, Buée M, Diedhiou AG, Frey-Klett P, Le Tacon F, Rineau F, Turpault MP, Uroz P, Garbaye J. 2010. The role of ectomycorrhizal communities in forest ecosystem processes: New prospectives and emerging concepts. Soil Biology and Biochemistry 42: 679-698.

Crawshay R. 1930. The Spore Ornamentation of the Russulas. London, Baillière, Tindall & Cox.

Doyle JJ, Doyle JL. 1990. Isolation of plant DNA from fresh tissue. Focus 12:13-15.

Eberhardt U. 2002. Molecular kinship analyses of the agaricoid Russulaceae: correspondence with mycorrhizal anatomy and sporocarp features in the genus Russula. Mycological Progress 1(2): 201- 223.

Eberhardt U, Verbeken A. 2004. Sequestrate Lactarius species from tropical Africa: L. angiocarpus sp. nov. and L. dolichocaulis comb. nov.. Mycological Research 108(9): 1042-1052.

Einhellinger von A. 1985. Die Gettung Russula in Bayern. Hoppea, Verlag der Gesellschaft, Regensburg, Germany.

Felsenstein J. 1985. Confidence-limits on phylogenies – An approach using bootstrap. Evolution 39(4): 783-791.

Fries EM. 1836-1838. Epicrisis systematis mycologici: seu synopsis hymenomycetum. Uppsala.

Fries EM. 1874. Hymenomycetes Europaei. Berling, Uppsala.

65

Galli R. 2003. Le Russule: atlante pratico – monografico per la determinazione delle russule. 2nd ed. R. Galli.

Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity for basidiomycetes – application to the identification of mycorrhizae and rusts. Molecular Ecology 2: 113-118.

Gardes M, Bruns TD. 1996. Community structure of ectomycorrhizal fungi in a Pinus muricata forest: above- and below-ground views. Canadian Journal of Botany 74: 1572-1583.

Gelm J, Laursen GA, Herriott IC, McFarland JM, Booth MG, Lennon N, Nusbaum HC, Taylor DL. 2010. Phylogenetic and ecological analyses of soil and sporocarp DNA sequences reveal high diversity and strong habitat partitioning in the boreal ectomycorrhizal genus Russula (Russulales; Basidiomycota). New Phytologist 187: 494-507.

Heim R. 1938. Les Lactario.russulés du domaine oriental de Madagascar, essai sur la classfication et la phylogénie des Astérosporales. Prodrome à une flore mycologique de Madagascar et dependences I:196 (4).

Hillis DM. 1987. Molecular versus morphological approaches to systematics. Annual Review in Ecological Systematics 18: 23-42.

Kernaghan G, Currah RS. 1998. Ectomycorrhizal fungi at tree line in the Canadian Rockies. Mycotaxon, 69: 39-79.

Kibby G. 2011. The Genus Russula in Great Britain: with synoptic keys to species. G. Kibby.

Konrad P, Josserand M. 1934. Notes sur la classfication des Russules. Bulletin. Societe Mycologique de France, 50: 253-269.

Kränzlin F. 2005. Fungi of Switzerland. Vol. 6 Lactarius Russula. Verlag Mykologia, Postfach Switzerland.

Krivstov V, Watling R, Walker SJJ, Knott D, Palfreyman JW, Staines HJ. 2003. Analysis of fungal fruiting patterns at the Dawyck Botanic Garden. Ecological Modelling, 170: 393-406.

Kumar S, Tamura K, Nei M. 2004. MEGA 3: Integrated Software for Molecular Evolutionary Genetics Analysis and Sequence Alignment Briefings in Bioinformatics 5:150-163.

Künher R, Romagnesi H. 1953. Flore Analytique sed Champignons Supérieurs (Agarics, Boletes, Chanterelles). Masson et Cle, Editeurs.

Kuyper TW, Vuure M. 1985. Nomenclatural Notes on Russula. Persoonia, 12(4): 447-455.

Lange JE. 1940. Flora Agaricina Danica. Vol. 5 Recato, Copenhagen.

Lebel T, Tonkin J E. 2007. Australasian species of Macowanites are sequestrate species of Russula (Russulaceae, Basidiomycota). Australian Systematic Botany, 20: 355-381.

Legon NW, Henrici A, Roberts PJ, Spooner BM, Watling R. 2005. Checklist of the British and Irish Basidiomycota. Kew: RBG Kew.

66

Maire R. 1910. Classification dans le genre Russula. Bulletin de la Société Mycologique de France, 26: 49-125.

Massee G. 1902. European Fungus-Flora; Agaricaceae. Duckworth, London.

Melzer V. 1924. L’ornamentation des spores des Russules. Bulletin de la Société Mycologique de France, 40: 78-81.

Melzer V. 1945. Atlas Holubinek. Nakladatelsvi Kropac & Krucharsky, Praha.

Miller SL, McClean TM, Walker JF, Buyck B. 2001. A Molecular Phylogeny of the Russulales Including Agaricoid, Gasteroid and Pleuritoid Taxa. Mycologia, 93 (2): 344-354.

Miller S, Buyck B. 2002. Molecular phylogeny of the genus Russula in Europe with a comparison of modern infrageneric classifications. Mycological Research, 3: 259-276.

Miyamoto MM, Fitch WM. 1995. Testing species phylogenies and phylogenetic methods with congruence. Systemetic Biology, 44: 64-76.

Moser MM. 1978. Keys to Agarics and Boleti (Polyporales, Boletales, Agaricales, Russulales). Roger Philips, London. Pp 432-433.

Olmstead RG, Scotland RW. 2005. Molecular and Morphological Datasets. Taxon 54 (1): 7-8.

Peck CH. 1906. New York species of Russula. Report of the State Botanist. New York State Museum Bulletin, 116: 67-117.

Pegler DN, Singer R. 1980. New taxa of Russula in the Lesser Antilles. Mycotaxon, 12: 92-96.

Persoon CH. 1796. Observationes mycologicae. 1:102 (Lipsiae)

Persoon CH. 1801. Synopsis Methodica Fungorum. H. Dietrich, Göttingen.

Pickles B, Gennery D, Potts J, Lennon J, Anderson I, Alexander I. 2010. Spatial and temporal ecology of Scots Pine ectomycorrhizas. New Phytologist.

Posada D, Crandall KA. 1998. Modeltest: testing the model of DNA substitution. Bioinformatics 14 (9): 817-818.

Quélét L. 1888. Flore Mycologique de la France et des pays limitrophes. Octave Doin, Paris.

Reumaux P, Bidaud A, Moënne-Loccoz P. 1996. Russules rares ou méconnues. Fédération Mycolotique Dauphiné-Savoie, Marlioz.

Rea C. 1922. British Basidiomycetae, a handbook to the larger British Fungi. Cambridge University Press.

Ricken A. 1915. Die Batterpilze. Weigel, Leipzig.

Richardson MJ. 1970. Studies of Russula emetica and other agarics in a Scots pine plantation. Transactions of the British Mycological Society 55: 217-229. 67

Rinaldi AC, Comandini O, Kuyper TW. 2008. Ectomycorrhizal fungal diversity: separating the wheat from the chaff. Fungal Diversity 33:1-45.

Romagnesi H. 1967. Les Russules d’Europe et d’Afrique du Nord. Essai sur la valeur taxonomique spécifique des characters morphologiques et microchimiques des spores et des revêtements. Réimpression de l’édition Paris (Bordas) 1967, Strauss & Cramer GmbH, Germany. Pp. 325-382.

Rauschert S. 1989. Nomenklatorische Studien bei hoheren Pilzen I Russulales (Taublinge und Milchlinge). Ceska Mycologie 43 (4): 193- 209.

Sarnari M. 1998. Monografia Illustrata del genere Russula in Europa. Associazione Micologica Bresadola, Trento.

Scotland RW, Olmstead RG, Bennett JR. 2003. Phylogeny Reconstruction: The Role of Morphology. Systematic Biology, 52 (4): 539-548.

Shaeffer J. 1952. Russula-Monographie. Verlag Julius Klinkhardt, Bad Heilbrunn Obb., Regensburg, Germany

Shaffer RL. 1972. North American Russulas of the subsection Foetentinae. Mycologia 64(5): 1008-1053.

Singer R. 1926. Monographie der Gattung Russula. Hedwigia, 66: 206.

Singer R. 1932. Monographie der Gattung Russula. Beihefte zum Botanischen Centralblatt, 49 (2): 310-322.

Singer R. 1975. The Agaricales in Modern Taxonomy. 3rd ed. A.R. Gantner Verlag KG. FL-9490 VADUZ, Germany. Pp. 755-775.

Smith JE, Lebel T. 2001. A comparison of Taxonomic Keys to Species within the Genus Russula. McIlvainea, 15 (1): 9-22.

Smith WG. 1873. New British Fungi, The Journal of Botany British and Foreign (New Series, Vol. II; Vol XI of the entire work), 46 (11): 337.

Stubbem D, Nuytinck J, Verbeken A. 2008. Lactarius subgenus Plinthogalus of Malaysia. Fungal Diversity 32: 125-156.

Swofford DL. 2002. PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods). Version 4. Sinauer Associates, Sunderland, Massachusetts.

Tendersoo L, May TW, Smith ME. 2010. Ectomycorrhizal lifestyle in fungi: global diversity, distribution, and evolution of phylogenetic lineages. Mycorrhiza 20: 217-263.

Watling R. 2004. Dawyck Botanic Garden: the Heron Wood Cryptogamic Project. Botanical Journal of Scotland, 56 (2): 109-118.

Watling R. 2010. Ten Years in a Cryptogamic Sanctuary. Fungi 3(3)

68

White TJ, Bruns T, Lee S, Taylor JW. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. Pp. 315-322 In: PCR Protocols: A Guide to Methods and Applications, eds. Innis, Gelfand, M.A.D.H., Sninsky, J.J. & White, T.J. Academic Press, Inc., New York.

Woo B. 1989. Trial field key to the species of RUSSULA in the Pacific Northwest. Pacific Noertwest Key Council. http://www.svims.ca/council/Russul.htm#n700. 22.8.11