Genetics Society News

Total Page:16

File Type:pdf, Size:1020Kb

Load more

JULY 2015 | ISSUE 73 GENETICS SOCIETY NEWS In this issue The Genetics Society News is edited by Manuela Marescotti and items for future • Medal awarded issues can be sent to the editor, by email • Meetings to m.marescotti@brainwave-discovery. • Student and Travel Reports com. The Newsletter is published twice a year, with copy dates of July and January. Cover image from the Genetics Society forthcoming Autumn Meeting Building the brain: from genes to circuits and cognition A WORD FROM THE EDITOR A word from the editor Welcome to issue 73. We have an issue full of interesting mutations that over the years reports of various Society meetings transformed the teonsite into maize and Society funded activities, and made easier harvesting this plant. I thank all those who continue to The second article that I would contribute with their articles. like to mention here describes the In particular, I would like to draw impact of the “Communicate your your attention to two articles. The science” workshop on the career of first one regards the interview a young scientist two years after granted by Professor John Doebley attending it. This year, the third to Kat Arney in occasion of the 2015 edition of this workshop took place Genetics Society Spring Meeting. in the English countryside and it During this conference, he has had a great success. This event is been awarded the 2015 Genetics a moment where scientists with Society Mendel Medal. Interestingly, an interest in communicating Professor Doebley illustrates the science through a number of mass focus of his research; the fascinating media or in spreading the updates “genetic tour” of the commonly of their research in a clear way, known maize from its ancestor, can find useful advice given by teosinte. In fact, it seems that this professionals. thousand-years long path is the Read on and enjoy. result of a selection made by humans on this plant, according to their own Best wishes, convenience. As a result, the genetic Manuela Marescotti I would like to draw your attention to two articles. The first one regards the interview granted by Professor John Doebley to Kat Arney in occasion of the 2015 Genetics Society Spring Meeting. The second article describes the impact of the “Communicate your science” workshop on the career of a young scientist two years after attending it. 2 . GENETICS SOCIETY NEWS . ISSUE 73 Issue 73 . July 2015 For more details please contact: The Genetics Society C/o-Portland Customer Services Commerce Way Colchester CONTENTS CO2 8HP Switchboard: +44 (0)1206 796 351 Fax: +44 (0)1206 798 650 Email: [email protected] Meeting Announcements 4 - 7 Web: www.genetics.org.uk 2015 Autumn Meeting Regarding the information above: check out the Genetics External Meetings Diary Society website for the updated contact details. Sectional Interest Groups 8 The Genetics Society Journals Heredity Genetics Society Business 9 - 16 www.nature.com/hdy Genetics Society Meeting Report 24 - 25 Managing Editor: Professor Michael Bruford Heredity Editorial Office, Cardiff University, Cathays Park, Breeding for Bacon, Beer and Biofuels Cardiff, CF10 3AX , Wales Genetics Society Sponsored Events 26 - 35 Genes and Development 25th Mammalian Genetics and Development Workshop www.genesdev.org The UK/EU Dictyostelium Christmas Meeting 2014 Editor: T. Grodzicker, Genes & Development, Cold Spring XIIIth Annual UK Workshop on Archaea Harbor Laboratory Press, 500 Sunnyside Boulevard, Woodbury, New York, 11797, USA Features Committee members Travel Reports 43 - 52 Genome Informatics conference - Ensembl annotation President Prof Wendy Bickmore, University of Edinburgh workshop EMBO - EMBL Symposium on Cellular Heterogeneity Vice-Presidents American Society of Human Genetics 64th Annual meeting Prof Malcolm Logan, King’s College London Society for Neuroscience conference Prof Rebecca Oakey, King’s College London Prof Alison Woollard, University of Oxford International Plant & Animal Genome XXIII Conference 56th Annual Drosophila Research Conference Honorary Secretary European Society of Human Genetics Conference 2014 Dr Tanya Whitfield, University of Sheffield Epigenomics of Common Diseases 2014 Honorary Treasurer 7th International Symposium on the Biology of Vertebrate Prof. Anne Donaldson, University of Aberdeen Sex Determination Scientific Meetings Secretary World Congress of Reproductive Biology 2014 Mrs Dominique Kleyn, Bioindustry Association Kinetoplastid Molecular Cell Biology Meeting 28th Fungal Genetics Conference Newsletter Editor Keystone Symposia: DNA Replication and Recombination Dr Manuela Marescotti, The Brainwave-Discovery Ltd, Edinburgh 4th Annual Meeting of the International Society of Extracellular Vesicles Postgraduate Representative The Australasian Genomic Technologies Association 2014 Dr Kay Boulton, University of Edinburgh Conference Ms Lynsey Hall, University of Edinburgh Annual Meeting of the Association for Research in Vision Ordinary Committee Members and Ophthalmology Dr Kay Boulton, University of Edinburgh Keystone Symposium on Mitochondria, Metabolism and Dr Marika Charalambous, Queen Mary, University of London Heart Failure Prof Elizabeth Fisher, University College London Prof Richard Flavell, London Dr Jim Huggett, LGC, Teddington Heredity Fieldwork Grant Report 53 - 54 Prof Mark Jobling, University of Leicester from sexual to asexual reproduction Prof Judith Mank, University College London Dr Jonathan Pettitt, University of Aberdeen Training Grants 55 - 60 Dr Michael Simpson, King’s College London Genome assembly Dr Martin Taylor, University of Edinburgh Transit amplification in vertebrate cerebellum Dr Douglas Vernimmen, The Roslin Institute, University of Edinburgh Genomics Prof Eleftheria Zeggini, Wellcome Trust Genome Campus, Cambridge Studentship Reports 61 - 62 Design and Print Collaborate Agency Resistance to Anthelmintics in Nematodes www.collaborate.agency Single-cell analysis of genomic instability and chromosomal aneuploidies Advertising in Genetics Society News Born or made? represents an opportunity to reach a large community of professional geneticists. For rates please email [email protected] www.genetics.org.uk . 3 2015 Genetics Society Autumn Meeting Building the brain: from genes to circuits and cognition 19 – 20 November 2015, The Royal Society, London The aim of this conference is to discuss current progress on the Speakers genetics underlying the formation and function of the brain. In Pasko Rakic Yale, USA contrast to other contemporary conferences, a comparative and hence Detlev Arendt EMBL, Germany evolutionary perspective will be applied to review recent findings from Benny Hochner Hebrew University Jerusalem, Israel major phyla of the animal kingdom to uncover conserved or divergent Corinne Houart King’s College London, UK genetic mechanisms underlying the functional anatomy of the brain: Richard Benton University of Lausanne, Switzerland from genes to circuits and cognition. The program of invited speakers Rui M Costa Champalimaud Center for the Unknown, Lisbon comprises a balance of specialists using non-model as well as classical Gaia Tavosanis Center for Neurodegenerative Diseases, Bonn, Germany invertebrate and vertebrate model organisms. Speakers have been Gerhart Schratt Marburg, Germany chosen to cover the following areas: Sten Grillner Karolinska Institutet, Sweden Patrick Callaerts VIB Laboratory of Behavorial and Developmental Functional anatomy of the brain: Genetics and evolution: Genetics, Leuven Evolutionary origin of the central nervous system and of brain Liliana Minichiello University of Oxford, UK modules; comparative anatomy of the brain; cellular organisation Bruno Van Swinderen University of Queensland, Australia and cell number control; neural circuit topology; identification and Birte Forstmann University of Amsterdam, Netherlands visualization of circuits in action; experience-dependent structural Gene Robinson University of Illinois at Urbana-Champaign, USA plasticity and circuit remodelling. Dianne Newbury Wellcome Trust Centre for Human Genetics, Oxford Martin Heisenberg University of Wuerzburg, Germany Genetics of behaviour and cognition: Genes, cell lineages and the emergence of innate circuits and behaviors; adaptive motor Scientific Organisers behaviour; aggression and social behaviour; attention and decision Alicia Hidalgo University of Birmingham, UK making; genetics of language; learning and memory. Frank Hirth King’s College London, UK for registration, visit www.genetics.org.uk Published on behalf of The Genetics Society Published on behalf of The Genetics Society www.nature.com/hdy Published on behalf of The Genetics Society www.nature.com/hdy ThePublished essential on behalfresource of The Genetics Society The essential resource forThe geneticists, essential resource Thefor geneticists, essential resource keeping readers paper research your submit • keepingfor geneticists, readers paper research your submit • forkeeping geneticists, readers informedkeeping readers aboutpapers of the Publication Online Advance weekly • informed aboutpapers of the Publication Online Advance weekly • informedlatestkeeping genetics readers about the podcast Heredity latest genetics to access FREE • podcast Heredity informedlatest genetics about the to access FREE • researchlatest genetics with an research withe-alerts an Contents of Table FREE your for up sign • evolutionaryresearchlatest genetics withe-alerts perspective an Contents of Table FREE your for up sign • researchevolutionary withmore: perspective
Recommended publications
  • PREDICTD: Parallel Epigenomics Data Imputation with Cloud-Based Tensor Decomposition

    PREDICTD: Parallel Epigenomics Data Imputation with Cloud-Based Tensor Decomposition

    bioRxiv preprint doi: https://doi.org/10.1101/123927; this version posted April 4, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. PREDICTD: PaRallel Epigenomics Data Imputation with Cloud-based Tensor Decomposition Timothy J. Durham Maxwell W. Libbrecht Department of Genome Sciences Department of Genome Sciences University of Washington University of Washington J. Jeffry Howbert Jeff Bilmes Department of Genome Sciences Department of Electrical Engineering University of Washington University of Washington William Stafford Noble Department of Genome Sciences Department of Computer Science and Engineering University of Washington April 4, 2017 Abstract The Encyclopedia of DNA Elements (ENCODE) and the Roadmap Epigenomics Project have produced thousands of data sets mapping the epigenome in hundreds of cell types. How- ever, the number of cell types remains too great to comprehensively map given current time and financial constraints. We present a method, PaRallel Epigenomics Data Imputation with Cloud-based Tensor Decomposition (PREDICTD), to address this issue by computationally im- puting missing experiments in collections of epigenomics experiments. PREDICTD leverages an intuitive and natural model called \tensor decomposition" to impute many experiments si- multaneously. Compared with the current state-of-the-art method, ChromImpute, PREDICTD produces lower overall mean squared error, and combining methods yields further improvement. We show that PREDICTD data can be used to investigate enhancer biology at non-coding human accelerated regions. PREDICTD provides reference imputed data sets and open-source software for investigating new cell types, and demonstrates the utility of tensor decomposition and cloud computing, two technologies increasingly applicable in bioinformatics.
  • Manolis Kellis Piotr Indyk

    Manolis Kellis Piotr Indyk

    6.095 / 6.895 Computational Biology: Genomes, Networks, Evolution Manolis Kellis Rapid database search Courtsey of CCRNP, The National Cancer Institute. Piotr Indyk Protein interaction network Courtesy of GTL Center for Molecular and Cellular Systems. Genome duplication Courtesy of Talking Glossary of Genetics. Administrivia • Course information – Lecturers: Manolis Kellis and Piotr Indyk • Grading: Part. Problem sets 50% Final Project 25% Midterm 20% 5% • 5 problem sets: – Each problem set: covers 4 lectures, contains 4 problems. – Algorithmic problems and programming assignments – Graduate version includes 5th problem on current research •Exams – In-class midterm, no final exam • Collaboration policy – Collaboration allowed, but you must: • Work independently on each problem before discussing it • Write solutions on your own • Acknowledge sources and collaborators. No outsourcing. Goals for the term • Introduction to computational biology – Fundamental problems in computational biology – Algorithmic/machine learning techniques for data analysis – Research directions for active participation in the field • Ability to tackle research – Problem set questions: algorithmic rigorous thinking – Programming assignments: hands-on experience w/ real datasets • Final project: – Research initiative to propose an innovative project – Ability to carry out project’s goals, produce deliverables – Write-up goals, approach, and findings in conference format – Present your project to your peers in conference setting Course outline • Organization – Duality:
  • Prof. Manolis Kellis April 15, 2008

    Prof. Manolis Kellis April 15, 2008

    Chromosomes inside the cell Introduction to Algorithms 6.046J/18.401J • Eukaryote cell LECTURE 18 • Prokaryote Computational Biology cell • Bio intro: Regulatory Motifs • Combinatorial motif discovery - Median string finding • Probabilistic motif discovery - Expectation maximization • Comparative genomics Prof. Manolis Kellis April 15, 2008 DNA packaging DNA: The double helix • Why packaging • The most noble molecule of our time – DNA is very long – Cell is very small • Compression – Chromosome is 50,000 times shorter than extended DNA • Using the DNA – Before a piece of DNA is used for anything, this compact structure must open locally ATATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATA ATATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATA ATCCATATCTAATCTTACTTATATGTTGTGGAAATGTAAAGAGCCCCATTATCTTAGCCTAAAAAAACCTTCTCTTTGGAACTTTC ATCCATATCTAATCTTACTTATATGTTGTGGAAATGTAAAGAGCCCCATTATCTTAGCCTAAAAAAACCTTCTCTTTGGAACTTTC AATACGCTTAACTGCTCATTGCTATATTGAAGTACGGATTAGAAGCCGCCGAGCGGGCGACAGCCCTCCGACGGAAGACTCTCCTC AATACGCTTAACTGCTCATTGCTATATTGAAGTACGGATTAGAAGCCGCCGAGCGGGCGACAGCCCTCCGACGGAAGACTCTCCTC GCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACT GCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACT TTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATTAACGAATCAAATTAACAACCATAGGATG TTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATTAACGAATCAAATTAACAACCATAGGATG AATGCGATTAGTTTTTTAGCCTTATTTCTGGGGTAATTAATCAGCGAAGCGATGATTTTTGATCTATTAACAGATATATAAATGGAA
  • ENCODE Consortium Meeting

    ENCODE Consortium Meeting

    ENCODE Consortium Meeting June 17-19, 2008 Hilton Washington DC/Rockville Executive Meeting Center Rockville, Maryland PARTICIPANTS Bradley Bernstein Piero Carninci, Ph.D. Molecular Pathology Unit Leader Massachusetts General Hospital Functional Genomics Technology Team and 149 13th Street Omics Resource Development Unit Charlestown, MA 02129 Deputy Project Director (617) 726-6906 LSA Technology Development Group (617) 726-5684 Fax Omics Science Center [email protected] RIKEN Yokohama Institute 1-7-22 Suehiro-cho, Tsurumi-ku Ewan Birney Yokohama 230-0045 Joint Team Leader Japan Panda Group Nucleotides +81-(0)901-709-2277 Panda Coordination and Outreach [email protected] Panda Metabolism European Molecular Biology Laboratory Philip Cayting European Bioinformatics Institute Gerstein Laboratory Hinxton Outstation Department of Molecular Biophysics and Wellcome Trust Genome Campus Biochemistry Hinxton, Cambridge CB10 1SD Yale University United Kingdom P.O. Box 208114 +44-(0)1223-494 444, ext. 4420 New Haven, CT 06520-8114 +44-(0)1223-494 494 Fax (203) 432-6337 [email protected] [email protected] Michael Brent, Ph.D. Howard Y. Chang, M.D., Ph.D. Professor Assistant Professor Center for Genome Sciences Stanford University Washington University Center for Clinical Sciences Research, Campus Box 8510 Room 2155C 4444 Forest Park 269 Campus Drive Saint Louis, MO 63108 Stanford, CA 94305 (314) 286-0210 (650) 736-0306 [email protected] [email protected] James Bentley Brown Mike Cherry, Ph.D. Graduate Student Researcher Associate Professor Graduate Program in Applied Science and Department of Genetics Technology Stanford University Bickel Group 300 Pasteur Drive University of California, Berkeley Stanford, CA 94305-5120 Room 2 (650) 723-7541 1246 Hearst Avenue [email protected] Berkeley, CA 94702 (510) 703-4706 [email protected] Francis S.
  • Unweaving)The)Circuitry)) Of)Complex)Disease!

    Unweaving)The)Circuitry)) Of)Complex)Disease!

    Unweaving)the)circuitry)) of)complex)disease! Manolis Kellis Broad Institute of MIT and Harvard MIT Computer Science & Artificial Intelligence Laboratory Personal!genomics!today:!23!and!Me! Recombina:on)breakpoints) Me)vs.)) my)brother) Family)Inheritance) Dad’s)mom) My)dad) Mom’s)dad) Human)ancestry) Disease)risk) Genomics:)Regions))mechanisms)) Systems:)genes))combina:ons)) drugs) pathways) 1000s)of)diseaseHassociated)loci)from)GWAS) • Hundreds)of)studies,)each)with)1000s)of)individuals) – Power!of!gene7cs:!find!loci,!whatever!the!mechanism!may!be! – Challenge:!mechanism,!cell!type,!drug!target,!unexplained!heritability! GenomeHwide)associa:on)studies)(GWAS)) • Iden7fy!regions!that!coBvary!with!the!disease! • Risk!allele!G!more!frequent!in!pa7ents,!A!in!controls! • But:!large!regions!coBinherited!!!find!causal!variant! • Gene7cs!does!not!specify!cell!type!or!process! E environment causes syndrome G epigenomeX D S genome disease symptoms biomarkers effects Epidemiology The study of the patterns, causes, and effects of health and disease conditions in defined populations Gene:c) Tissue/) Molecular)Phenotypes) Organismal) Variant) cell)type) Epigene:c) Gene) phenotypes) Changes) Expression) Changes) Methyl.) ) Heart) Gene) Endo) DNA) expr.) phenotypes) Muscle) access.) ) Lipids) Cortex) Tension) CATGACTG! Enhancer) CATGCCTG! Lung) ) Gene) Heartrate) Disease) H3K27ac) expr.) Metabol.) Blood) ) Drug)resp) Skin) Promoter) Disease! ) Gene) cohorts! Nerve) Insulator) expr.) GTEx!/! ENCODE/! GTEx! Environment) Roadmap! Epigenomics/! Epigenomics!
  • Precision Medicine in Type 2 Diabetes and Cardiovascular Disease 31 August–1 September 2016 in Båstad · Sweden

    Precision Medicine in Type 2 Diabetes and Cardiovascular Disease 31 August–1 September 2016 in Båstad · Sweden

    Berzelius symposium 91 Precision Medicine in Type 2 Diabetes and Cardiovascular Disease 31 August–1 September 2016 in Båstad · Sweden Programme · General information · Lectures abstracts · Poster abstracts Generously supported by: PRECISION MEDICINE IN TYPE 2 DIABETES AND CARDIOVASCULAR DISEASE · 31 AUGUST–1 SEPTEMBER 2016 1 Berzelius symposium 91 Precision Medicine in Type 2 Diabetes and Cardiovascular Disease Purpose statement: Cardiovascular disease (CVD) and type 2 diabetes are devastating and costly diseases whose prevalence is increasing rapidly around the world, projected to exceed billions of people worldwide within the next deca- des. Although drug and lifestyle interventions are used widely to prevent and treat CVD and diabetes, neither is highly effective; for example, in high risk adults, intensive lifestyle intervention delays the onset of disease by roughly 3-years and with metformin by 18-months compared to placebo control interven- tion (Knowler et al, Lancet, 2009), with diabetes “prevention” being the excep- tion, rather than the rule. Moreover, whilst some patients respond very well to therapies, others benefit little or not at all, progressing rapidly through the pre-diabetic phase of beta-cell decline and later developing life-threatening complications such as retinopathy, nephropathy, peripheral neuropathy, and CVD. As such, there is an urgent need to develop innovative and effective prevention and treatment strategies. Human biology is complex and people differ in their genetic and molecular characteris- tics, which underlies the variable response to interventions and rates of disease progression. Thus, a huge, as yet unrealised opportunity exists to optimize the prevention and treatment of CVD and type 2 diabetes by tailoring therapies to the patient’s unique biology.
  • UNIVERSITY of CALIFORNIA RIVERSIDE RNA-Seq

    UNIVERSITY of CALIFORNIA RIVERSIDE RNA-Seq

    UNIVERSITY OF CALIFORNIA RIVERSIDE RNA-Seq Based Transcriptome Assembly: Sparsity, Bias Correction and Multiple Sample Comparison A Dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Computer Science by Wei Li September 2012 Dissertation Committee: Dr. Tao Jiang , Chairperson Dr. Stefano Lonardi Dr. Marek Chrobak Dr. Thomas Girke Copyright by Wei Li 2012 The Dissertation of Wei Li is approved: Committee Chairperson University of California, Riverside Acknowledgments The completion of this dissertation would have been impossible without help from many people. First and foremost, I would like to thank my advisor, Dr. Tao Jiang, for his guidance and supervision during the four years of my Ph.D. He offered invaluable advice and support on almost every aspect of my study and research in UCR. He gave me the freedom in choosing a research problem I’m interested in, helped me do research and write high quality papers, Not only a great academic advisor, he is also a sincere and true friend of mine. I am always feeling appreciated and fortunate to be one of his students. Many thanks to all committee members of my dissertation: Dr. Stefano Lonardi, Dr. Marek Chrobak, and Dr. Thomas Girke. I will be greatly appreciated by the advice they offered on the dissertation. I would also like to thank Jianxing Feng, Prof. James Borneman and Paul Ruegger for their collaboration in publishing several papers. Thanks to the support from Vivien Chan, Jianjun Yu and other bioinformatics group members during my internship in the Novartis Institutes for Biomedical Research.
  • Manolis Kellis Manolis Kellis (Kamvysselis) MIT Center for Genome Research Phone: (617) 452-2274 320 Charles St

    Manolis Kellis Manolis Kellis (Kamvysselis) MIT Center for Genome Research Phone: (617) 452-2274 320 Charles St

    Manolis Kellis Manolis Kellis (Kamvysselis) MIT Center for Genome Research Phone: (617) 452-2274 320 Charles St. Fax: (617) 258-0903 NE125-2164 web.mit.edu/manoli Cambridge MA 02142 [email protected] RESEARCH GOALS I am interested in applying computational methods to understanding biological signals. My specific interests are: (1) in the area of genome interpretation, developing comparative genomics methods to identify genes and regulatory elements in the human genome; (2) in the area of gene regulation, deciphering the combinatorial control of gene expression and cell fate specification, and understanding the dynamic reconfiguration of genetic sub-networks in changing environmental conditions; (3) in the area of evolutionary genomics, understanding the emergence of new functions, reconfiguration of regulatory motifs, and the coordinated evolution of functionally interconnected cellular components. My goal is to pursue academic research in these areas in an interdisciplinary way, working together with computer scientists and biologists. EDUCATION Massachusetts Institute of Technology 2000-2003 Doctor of Philosophy (Ph.D.) in Computer Science Dissertation title: Computational Comparative Genomics: Genes, Regulation, Evolution. Supervisors: Eric Lander and Bonnie Berger. Thesis earned MIT Sprowls award for best Ph.D. thesis in Computer Science Massachusetts Institute of Technology 1999-2000 Masters of Engineering (M.Eng.) in Electrical Engineering and Computer Science. Dissertation title: Imagina: A cognitive abstraction approach to sketch-based image retrieval Supervisor: Patrick Winston Massachusetts Institute of Technology 1995-1999 Bachelor of Science (B.S.) in Computer Science and Engineering Coursework includes Machine Learning, Robot Vision, Artificial Intelligence, Distributed Algorithms, Complexity, Probability, Statistics, Software Engineering, Programming Languages, Signal Processing, Computer Graphics, Microprocessor Design, Computer Architecture.
  • ENCODE: Understanding the Genome

    ENCODE: Understanding the Genome

    ENCODE: Understanding the Genome Michael Snyder November 6, 2012 Conflicts: Personalis, Genapsys, Illumina Slides From Ewan Birney, Marc Schaub, Alan Boyle Encyclopedia of DNA Elements (ENCODE) • NHGRI-funded consortium • Goal: delineate all functional elements in the human genome • Wide array of experimental assays • Three Phases: 1) Pilot 2) Scale Up 1.0 3) Scale up 2.0 The ENCODE Project Consortium. An Integrated Encyclopedia of DNA Elements in the Human Genome. Nature 2012 Project website: http://encodeproject.org The ENCODE Consortium Brad Bernstein (Eric Lander, Manolis Kellis, Tony Kouzarides) Ewan Birney (Jim Kent, Mark Gerstein, Bill Noble, Peter Bickel, Ross Hardison, Zhiping Weng) Greg Crawford (Ewan Birney, Jason Lieb, Terry Furey, Vishy Iyer) Jim Kent (David Haussler, Kate Rosenbloom) John Stamatoyannopoulos (Evan Eichler, George Stamatoyannopoulos, Job Dekker, Maynard Olson, Michael Dorschner, Patrick Navas, Phil Green) Mike Snyder (Kevin Struhl, Mark Gerstein, Peggy Farnham, Sherman Weissman) Rick Myers (Barbara Wold) Scott Tenenbaum (Luiz Penalva) Tim Hubbard (Alexandre Reymond, Alfonso Valencia, David Haussler, Ewan Birney, Jim Kent, Manolis Kellis, Mark Gerstein, Michael Brent, Roderic Guigo) Tom Gingeras (Alexandre Reymond, David Spector, Greg Hannon, Michael Brent, Roderic Guigo, Stylianos Antonarakis, Yijun Ruan, Yoshihide Hayashizaki) Zhiping Weng (Nathan Trinklein, Rick Myers) Additional ENCODE Participants: Elliott Marguiles, Eric Green, Job Dekker, Laura Elnitski, Len Pennachio, Jochen Wittbrodt .. and many senior
  • Co-Expression Networks Reveal the Tissue-Specific Regulation of Transcription and Splicing

    Co-Expression Networks Reveal the Tissue-Specific Regulation of Transcription and Splicing

    Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press Method Co-expression networks reveal the tissue-specific regulation of transcription and splicing Ashis Saha,1 Yungil Kim,1,6 Ariel D.H. Gewirtz,2,6 Brian Jo,2 Chuan Gao,3 Ian C. McDowell,4 The GTEx Consortium,7 Barbara E. Engelhardt,5 and Alexis Battle1 1Department of Computer Science, Johns Hopkins University, Baltimore, Maryland 21218, USA; 2Program in Quantitative and Computational Biology, Princeton University, Princeton, New Jersey 08540, USA; 3Department of Statistical Science, Duke University, Durham, North Carolina 27708, USA; 4Program in Computational Biology and Bioinformatics, Duke University, Durham, North Carolina 27708, USA; 5Department of Computer Science and Center for Statistics and Machine Learning, Princeton University, Princeton, New Jersey 08540, USA Gene co-expression networks capture biologically important patterns in gene expression data, enabling functional analyses of genes, discovery of biomarkers, and interpretation of genetic variants. Most network analyses to date have been limited to assessing correlation between total gene expression levels in a single tissue or small sets of tissues. Here, we built networks that additionally capture the regulation of relative isoform abundance and splicing, along with tissue-specific connections unique to each of a diverse set of tissues. We used the Genotype-Tissue Expression (GTEx) project v6 RNA sequencing data across 50 tissues and 449 individuals. First, we developed a framework called Transcriptome-Wide Networks (TWNs) for combining total expression and relative isoform levels into a single sparse network, capturing the interplay between the reg- ulation of splicing and transcription.
  • An Integrated Encyclopedia of DNA Elements in the Human Genome

    An Integrated Encyclopedia of DNA Elements in the Human Genome

    An integrated encyclopedia of DNA elements in the human genome The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation Dunham, Ian, Anshul Kundaje, Shelley F. Aldred, Patrick J. Collins, Carrie A. Davis, Francis Doyle, Charles B. Epstein, et al. “An Integrated Encyclopedia of DNA Elements in the Human Genome.” Nature 489, no. 7414 (September 5, 2012): 57–74. As Published http://dx.doi.org/10.1038/nature11247 Publisher Nature Publishing Group Version Author's final manuscript Citable link http://hdl.handle.net/1721.1/87013 Terms of Use Creative Commons Attribution-Noncommercial-Share Alike Detailed Terms http://creativecommons.org/licenses/by-nc-sa/4.0/ NIH Public Access Author Manuscript Nature. Author manuscript; available in PMC 2013 March 06. NIH-PA Author ManuscriptPublished NIH-PA Author Manuscript in final edited NIH-PA Author Manuscript form as: Nature. 2012 September 6; 489(7414): 57–74. doi:10.1038/nature11247. An Integrated Encyclopedia of DNA Elements in the Human Genome The ENCODE Project Consortium Summary The human genome encodes the blueprint of life, but the function of the vast majority of its nearly three billion bases is unknown. The Encyclopedia of DNA Elements (ENCODE) project has systematically mapped regions of transcription, transcription factor association, chromatin structure, and histone modification. These data enabled us to assign biochemical functions for 80% of the genome, in particular outside of the well-studied protein-coding regions. Many discovered candidate regulatory elements are physically associated with one another and with expressed genes, providing new insights into the mechanisms of gene regulation.
  • Manolis Kellis Manolis Kellis (Kamvysselis) MIT Center for Genome Research Phone: (617) 452-2274 320 Charles St

    Manolis Kellis Manolis Kellis (Kamvysselis) MIT Center for Genome Research Phone: (617) 452-2274 320 Charles St

    Manolis Kellis Manolis Kellis (Kamvysselis) MIT Center for Genome Research Phone: (617) 452-2274 320 Charles St. Fax: (617) 258-0903 NE125-2164 web.mit.edu/manoli Cambridge MA 02142 [email protected] RESEARCH GOALS I am interested in applying computational methods to understanding biological signals. My specific interests are: (1) in the area of genome interpretation, developing comparative genomics methods to identify genes and regulatory elements in the human genome; (2) in the area of gene regulation, deciphering the combinatorial control of gene expression and cell fate specification, and understanding the dynamic reconfiguration of genetic sub-networks in changing environmental conditions; (3) in the area of evolutionary genomics, understanding the emergence of new functions, reconfiguration of regulatory motifs, and the coordinated evolution of functionally interconnected cellular components. My goal is to pursue academic research in these areas in an interdisciplinary way, working together with computer scientists and biologists. EDUCATION Massachusetts Institute of Technology 2000-2003 Doctor of Philosophy (Ph.D.) in Computer Science Dissertation title: Computational Comparative Genomics: Genes, Regulation, Evolution. Supervisors: Eric Lander and Bonnie Berger. Thesis earned MIT Sprowls award for best Ph.D. thesis in Computer Science Massachusetts Institute of Technology 1999-2000 Masters of Engineering (M.Eng.) in Electrical Engineering and Computer Science. Dissertation title: Imagina: A cognitive abstraction approach to sketch-based image retrieval Supervisor: Patrick Winston Massachusetts Institute of Technology 1995-1999 Bachelor of Science (B.S.) in Computer Science and Engineering Coursework includes Machine Learning, Robot Vision, Artificial Intelligence, Distributed Algorithms, Complexity, Probability, Statistics, Software Engineering, Programming Languages, Signal Processing, Computer Graphics, Microprocessor Design, Computer Architecture.