Characterisation of Calcium-Sensing Receptor Extracellular Ph

Characterisation of Calcium-Sensing Receptor

Extracellular pH Sensitivity and Intracellular

Signal Integration

A thesis submitted to the University of

Manchester for the degree of Doctor of

Philosophy (PhD) in the Faculty of Life Sciences.

2013

Katherine Louisa Campion CONTENTS PAGE

LIST OF FIGURES AND TABLES 9

ABBREVIATIONS 13

ABSTRACT 16

DECLARATION 17

ACKNOWLEDGEMENTS 19

CHAPTER 1 INTRODUCTION

1.1 Extracellular calcium homeostasis 21

1.1.1 Discovery of the parathyroid gland and its role in calcium homeostasis 21

1.1.2 Discovery of the calcium-sensing receptor its role in calcium homeostasis 22

1.2 Calciumsensing receptor structure 24

1.2.1 Extracellular domain 24

1.2.2 Venus flytrap and calcium binding domains 24

1.2.3 Glycosylation and the ECD 25

1.2.4 Dimerisation 26

1.2.5 Transmembrane domain 27

1.2.6 TMD extracellular loops 27

1.2.7 TMD Intracellular loops 28

1.2.8 Intracellular domain 29

1.3 Calciumsensing receptor tissue expression 30

1.3.1 Parathyroid gland 31

1.3.2 Kidney 32

1.3.3 Bone 35

1.3.4 Gastrointestinal system 35

1.3.5 Central and peripheral nervous system 36

1.3.6 Blood vessels 37

1.3.7 Developing lung 38

1.3.8 Other tissues 38

1.4 Calciumsensing receptor pharmacology 38

1.4.1 Orthosteric ligands 38

1.4.2 CaR allosteric modulators – aromatic amino acids 39

1.4.3 Allosteric CaR activators – Calcimimetics 40

1.4.4 Allosteric CaR inhibitors – Calcilytics 41

1.4.5 Effect of extracellular pH on CaR 41

1.5 Diseases of the calciumsensing receptor and parathyroid gland 46

1.5.1 Loss-of-function CaR mutations 46

1.5.2 Gain-of-function CaR mutations 48

1.5.3 Primary hyperparathyroidism 48

1.5.4 Secondary hyperparathyroidism 49

1.6 Calciumsensing receptor signalling 49

1.6.1 Phospholipase activation 50

1.6.1.1 Phospholipase C 50

1.6.1.2 Phospholipases A 2 and D 50

1.6.2 Protein kinase regulation 51

1.6.2.1 Protein Kinase C 52

1.6.2.2 Protein Kinase A 53

1.6.3 Mitogen-activated protein kinases 54

1.6.3.1 Extracellular-regulated protein kinase 54

1.6.3.2 p38 MAP kinase 55

1.6.3.3 C-Jun N-terminal kinase 55

1.6.4 Calcium-sensing receptor interacting proteins 55

1.6.4.1 Beta arrestin 55

1.6.4.2 Calmodulin 56

1.6.4.3 Potassium channels 57

1.6.4.4 14-3-3 proteins 57

1.6.4.5 Other interactions 58

1.7 Summary 58

1.8 Aims and objectives 59

CHAPTER 2 MATERIALS AND METHODS 60

2.1 Cell culture 61

2.2 Bovine parathyroid cell isolation and culture 61

2.3 Transient cell transfection 61

2.4 Preparation of cell lysates 62

2.5 Immunoblotting 62

2.6 Intracellular calcium imaging 63

2.7 SiteDirected Mutagenesis 63

2.7.1 Mutation primers 64

2.7.2 Sequencing primers 66

2.8 Microarray 67

2.9 ERK Assay 68

2.10 Protein references 68

2.11 Statistical analysis 68

CHAPTER 3: MODULATION OF CALCIUM-SENSING

RECEPTOR ACTIVITY BY EXTRACELLULAR PH 69

3.1 Introduction 70

3.2 Materials and Methods 70

3.3 Effect of albumin addition on extracellular pH sensitivity in CaRHEK cells and bovine parathyroid cells 70

3.4 Determination of the contribution of extracellular histidine

residues to calciumsensing receptor pH osensitivity 74

3.4.1 Confirmation of each CaR histidine mutant’s base sequence protein expression in HEK-293 cells. 74

3.4.2 Characterisation of the extracellular calcium sensitivity of the CaR histidine mutants expressed abundantly in HEK-293 cells. 75

3.4.3 Characterisation of the extracellular calcium sensitivity of the CaR histidine mutants CaR H41V and CaR H595V 92

3.4.4 Determination of the extracellular pH sensitivity of the CaR histidine mutants that respond to modest extracellular calcium concentrations. 95

3.4.5 Determination of the extracellular pH sensitivity of the CaR histidine mutants CaR H41V and CaR H595V . 110

3.4.6 Characterisation of the extracellular calcium and pH sensitivity of the CaR double histidine mutant, CaRH429V/H495V. 113

3.4.7 Characterisation of the extracellular calcium and pH

C482S sensitivity of the free cysteine mutant, CaR . 117

3.4.8 Summary 120

3.5 Discussion 121

3.5.1 The effect of altered extracellular pH on the CaR in a heterologous expression system 121

3.5.2 Potential effect of altered calcium binding to

albumin following changes in pH o 123

3.5.3 Potential contribution of extracellular histidine

residues to CaR pH o sensitivity 124

3.5.4 Extracellular pH sensitivity exhibited by the mGluRs 126

3.5.5 pH sensitivity of non-elemental agonists. 127

3.5.6 pH o sensitivity of CaR mutants 128

3.5.7 Physiological relevance of extracellular pH sensing 128

3.5.8 Summary 131

CHAPTER 4: CALCIUM-SENSING RECEPTOR

INTRACELLULAR SIGNALLING INTEGRATION 132

4.1 Introduction 133

4.2 Materials and Methods 133

4.3 Effect of increasing intracellular cAMP on CaR signalling in a heterologous expression system 133

4.3.1 Effect of forskolin addition during CaR-induced

2+ Ca i mobilisation 133

2+ 4.3.2 Effect of forskolin on CaR-induced Ca i mobilisation

2+ at sub-threshold Ca o concentrations 134

2+ 4.3.3 Effect of 1,9-dideoxyforksolin on CaR-induced Ca i

2+ mobilisation at subthreshold Ca o concentrations 136

2+ 4.3.4 Effect of forskolin on CaR-induced Ca i mobilisation

2+ at low Ca o concentration 138

2+ 4.3.5 Effect of forskolin on CaR-induced Ca i mobilisation as a function of concentration 138

2+ 4.3.6 Effect of forskolin on CaR-induced Ca i mobilisation as a function of extracellular calcium concentration 139

2+ 4.3.7 Effect of IBMX on CaR-induced Ca i mobilisation at

2+ subthreshold Ca o concentrations 141

4.3.8 Effect of forskolin cotreatment on CaR-induced ERK

phosphorylation 142

4.3.9 Effect of chronic phorbol ester pretreatment on

2+ 2+ Ca o–induced Ca i mobilisation 144

4.3.10 Effect of pertussis toxin pretreatment on

2+ 2+ Ca o–induced Ca i mobilisation 146

2+ 4.3.11 Effect of isoproterenol on CaR-induced Ca i

2+ mobilisation at subthreshold Ca o concentrations 149

4.4 Investigation of the role of protein kinase A in CaR signalling 153

4.4.1 Detection of protein kinase A activity using a motif-specific anti-PKA phospho-substrate antibody 153

4.4.2 Effect of protein kinase A inhibition

2+ and forksolin cotreatment on CaR-induced Ca i mobilisation

2+ at moderate Ca o concentration 155

4.4.3 Effect of protein kinase A inhibition

2+ and forksolin cotreatment on CaR-induced Ca i mobilisation

2+ at threshold Ca o concentration 158

4.4.4 Effect of PKA- and EPAC-selective cAMP analogues

2+ 2+ on Ca i mobilisation at moderate Ca o concentration 159

4.4.5 Characterisation of the CaR Ser-899 and Ser-900 mutants 162

2+ 2+ 4.4.6 Effect of forskolin on Ca o–induced Ca i mobilisation in CaR mutants lacking the PKA sites Ser-899 and Ser-900. 167

4.5 Discussion 169

4.5.1 The interaction between use of HEK-293 cells as a suitable model of CaR signalling 169

4.5.2 The involvement of cAMP and PKC signalling in parathyroid physiology 170

4.5.3 Effect of cAMP and CaR on the activation threshold

2+ for CaR-mediated Ca i mobilisation 171

4.5.4 Identification of possible cyclic AMP targets in lowering

2+ the agonist threshold for CaR-induced Ca i mobilisation 172

4.5.5 Effect of pertussis toxin on CaR-

2+ mediated Ca i mobilisation 172

4.5.6 Effect of endogenous stimulation of cAMP levels and

the potential physiological significance of this effect. 174

2+ 4.5.7 Effect of PKA inhibition on Ca o induced

2+ Ca i mobilisation 177

4.5.8 Functional consequence of mutating the PKA

consensus sites in CaR. 178

4.5.9 Possible mechanism of cAMP influence in CaR signalling 180

4.5.10 Relevance of CaR S899A functional data for the concept

of agonist-driven insertional signalling 181

4.5.11 Summary 184

CHAPTER 5: GENERAL DISCUSSION. 185

5.1 General discussion 186

5.2 Conclusions 188

REFERENCES 189

WORD COUNT 50,670

LIST OF FIGURES AND TABLES

Figure 1.1. Schematic overview of extracellular free-ionised calcium homeostasis. 31 Figure 1.2. Schematic of mineral reabsorption in the cortical thick ascending limb. 34

2+ Figure 1.3. Effect of pH o increase on CaR-induced Ca i mobilisation in CaR-HEK cells. 43

2+ Figure 1.4. Effect of pH o increase on CaR-induced Ca i mobilisation in bovine parathyroid chief cells 44 Table 1. CaR extracellular histidine conservation. 45 Figure 1.5. PyMOL model of the extracellular histidines, freecysteine and putative Ca 2+ binding regions 46 Figure 1.6. Schematic of CaR signalling 50 Table 2. Summary of thermal cycler protocol. 64

Figure 3.1. Effect of pH o on bovine parathyroid cells in the presence of 5% (w/v) albumin 72

Figure 3.2. Effect of pH o on CaR-HEK in the presence of 5% (w/v) albumin 73

Table 3.1. EC 50 values and relative maximal responses for the CaR histidine mutants versus wild-type. 77 Figure 3.3. Validation of the CaR mutant His134Val 78 Figure 3.4. Validation of the CaR mutant His192Val 79 Figure 3.5. Validation of the CaR mutant His254Val 80 Figure 3.6. Validation of the CaR mutant His312Val 81 Figure 3.7. Validation of the CaR mutant His338Val 82 Figure 3.8. Validation of the CaR mutant His344Val 83 Figure 3.9. Validation of the CaR mutant His359Val 84 Figure 3.10. Validation of the CaR mutant His377Val 85 Figure 3.11. Validation of the CaR mutant His413Val 86 Figure 312. Validation of the CaR mutant His429Val 87 Figure 3.13. Validation of the CaR mutant His463Val 88 Figure 3.14 Validation of the CaR mutants His463Val/His466Val 89 Figure 3.15. Validation of the CaR mutant His495Val 90 Figure 3.16. Validation of the CaR mutant His766Val 91 Figure 3.17. Concentration-effect curve for WT CaR 92

Figure 3.18. Validation of the CaR mutant His41Val 93 Figure 3.19. Validation of the CaR mutant His595Val 94

2+ 2+ Figure 3.20. The effect of pH o changes on Ca o-induced Ca i mobilisation for mutation CaR H134V 96

Figure 3.21. The effect of pH o changes on

2+ 2+ H192V Ca o-induced Ca i mobilisation for mutation CaR 97

Figure 3.22. The effect of pH o changes on

2+ 2+ H254V Ca o-induced Ca i mobilisation for mutation CaR 98

Figure 3.23. The effect of pH o changes on

2+ 2+ H312V Ca o-induced Ca i mobilisation for mutation CaR 99

Figure 3.24. The effect of pH o changes on

2+ 2+ H338V Ca o-induced Ca i mobilisation for mutation CaR 100

Figure 3.25. The effect of pH o changes on

2+ 2+ H344V Ca o-induced Ca i mobilisation for mutation CaR 101

Figure 3.26. The effect of pH o changes on

2+ 2+ H359V Ca o-induced Ca i mobilisation for mutation CaR 102

Figure 3.27. The effect of pH o changes on

2+ 2+ H377V Ca o-induced Ca i mobilisation for mutation CaR 103

Figure 3.28. The effect of pH o changes on

2+ 2+ H413V Ca o-induced Ca i mobilisation for mutation CaR 104

Figure 3.29. The effect of pH o changes on

2+ 2+ H429V Ca o-induced Ca i mobilisation for mutation CaR 105

Figure 3.30. The effect of pH o changes on

2+ 2+ H463V Ca o-induced Ca i mobilisation for mutation CaR 106

Figure 3.31. The effect of pH o changes on

2+ 2+ H463V/H466V Ca o-induced Ca i mobilisation for mutation CaR 107

Figure 3.32. The effect of pH o changes on

2+ 2+ H495V Ca o-induced Ca i mobilisation for mutation CaR 108

Figure 3.33. The effect of pH o changes on

2+ 2+ H766V Ca o-induced Ca i mobilisation for mutation CaR 109

Figure 3.34. The effect of pH o changes on

2+ 2+ H41V Ca o-induced Ca i mobilisation for mutation CaR 111

Figure 3.35. The effect of pH o changes on

2+ 2+ H595V Ca o-induced Ca i mobilisation for mutation CaR 112 Figure 3.36. Validation of the CaR mutant His429Val/His495Val 114

2+ Figure 3.37. The effect of pH o changes on Ca o-induced

2+ H429V/H495V Ca i mobilisation for mutation CaR 116 Figure 3.38. Validation of the CaR mutant Cys482Ser 118

2+ Figure 3.39. The effect of pH o changes on Ca o-induced

2+ C482S Ca i mobilisation for mutation CaR 119

Figure 3.40. Bar chart summarising the pH o sensitivity of all of the CaR histidine/cysteine mutants tested 120 Table 3.2. Conservation of histidine between CaR and mGluRs 127

2 + - Figure 4.1. Effect of forskolin in 3.5 mM Ca o induced

2+ Ca i-mobilisation 134

2 + Figure 4.2. Forskolin-induced increase in Ca i oscillations in

2+ threshold Ca o. 136 Figure 4.3. Calcium oscillations are not potentiated using the forskolin positive control 1,9-dideoxyforksolin. 137

2 + Figure 4.4. Forskolin-induced increase in Ca i oscillations in

2+ baseline Ca o. 138 Figure 4.5. Effect of increasing forskolin concentration on

2+ 2+ Ca i mobilisation in moderate Ca o. 139 Figure 4.6. Effect of forskolin on concentration–effect curve 140 Figure 4.7. IBMX-induced increase in calcium

2+ mobilisation in threshold Ca o 142

2+ Figure 4.8. Effect of Ca o and forskolin increase ERK phosphorylation. 144 Figure 4.9. Effect of chronic phorbol ester pretreatment on threshold intracellular Ca 2+ responses.146 Figure 4.10. Effect of pertussis-toxin on concentration–effect curve. 148 Figure 4.11. Foskolin induced intracellular calcium mobilisation with chronic pertussis treatment. 149 Figure 4.12. Effect of isoproterenol and NPS-2143

2+ 2+ on Ca o-induced Ca i mobilisation 150 Figure 4.13. Effect of isoproterenol and NPS-2143

2+ 2+ on Ca o-induced Ca o-mobilisation in CaR-HEK cells pretreated with pertussis toxin. 152 Figure 4.14. Immunoblot using a phospho-PKA

2+ consensus site antibody in a range of Ca o concentrations and forskolin treatment in CaR-HEK cells. 154

Figure 4.15. Effect of the PKA inhibitor KT5720

2+ 2+ on moderate Ca o-indiced Ca i mobilisation. 156 Figure 4.16. Effect of the PKA inhibitor H89

2+ 2+ on moderate Ca o-indiced Ca i mobilisation 157 Figure 4.17. Effect of the PKA inhibitor KT5720

2+ 2+ on subthreshold Ca o-indiced Ca i mobilisation. 158 Figure 4.18. Effect of the PKA inhibitor H89 on

2+ 2+ subthreshold Ca o-indiced Ca i mobilisation 159 Figure 4.19. Acute treatment of CaR-HEK cells in the

2+ presence of moderate Ca o (3 mM) with cAMP analogues 161 Figure 4.20. Chronic treatment of CaR-HEK cells in the

2+ presence of moderate Ca o (3 mM) with cAMP analogues 162

2+ Figure 4.21 Validation and Ca 0 sensitivity of the CaR mutants Ser899Ala and Ser900Ala 164

2+ Figure 4.22. Validation and Ca 0 sensitivity of the CaR mutants Ser899Asp and Ser900Asp 165

2+ Figure 4.23. Validation and Ca 0 sensitivity of the CaR mutants Ser899/900Ala and Ser899/900Asp 166

Table 4.1 EC 50 and maximal response by PKA mutants. 167 Figure 2.24. Effect of forskolin treatment

2+ in subthreshold Ca o 168 Table 4.2. Bovine parathyroid gland microarray data – expressed housekeeping proteins. 175 Table 4.3. Bovine parathyroid gland microarray data – expressed signal related proteins. 176 Table 4.4. Table of selected receptors from bovine microarray data. 177

ABBREVIATIONS

i. 1,25dihydroxyvitamin D3 ii. 1,9diFSK – 1,9 dideoxyforskolin iii. 6BnzcAMP N6 Benzoyladenosine 3', 5' cyclic monophosphate iv. 8pCPT2′OMecAMP pCPTcAMP v. AA – Arachidonic acid

vi. AACOCF 3 Arachidonyl trifluoromethyl ketone vii. AC – Adenylate cyclase viii. ACTH Adrenocorticotropic hormone ix. ADH – Autosomal dominant hypocalcaemia x. ADIS – Agonistdependent insertional signalling xi. AE2 – Anion exchanger 2 xii. AGAs – Aminoglycosides antibiotics xiii. APs – Adapter proteins xiv. APS – Ammonium persulphate xv. AQP2 –Aquaporin 2 xvi. BCECF 2',7'Bis(2Carboxyethyl)5(and6)Carboxyfluorescein xvii. Bovine parathyroid gland bPTG xviii. BLAST – Basic Local Alignment Search Tool

2+ xix. Ca i – Intracellular calcium

2+ xx. Ca o – Extracellular calcium xxi. cAMP – Cyclic adenosinemonophosphate xxii. CaR – Calcium sensing receptor xxiii. CCD – Cortical collecting duct xxiv. CCV – Clathrin coated vesicle xxv. CKD – Chronic kidney disease xxvi. COBALT Constraintbased Multiple Protein Alignment Tool xxvii. cTAL – cortical thick ascending limb xxviii. DAG – Diacylglycerol xxix. DCT – Distal convoluted tubule xxx. DEPC Diethylpyrocarbonate xxxi. DMEM Dulbecco’s minimum Eagle’s medium xxxii. DNA – Deoxyribonucleic acid xxxiii. ECD – Extracellular domain xxxiv. EDTA Ethylenediaminetetraacetic acid xxxv. EGTA Ethylene glycol tetraacetic acid xxxvi. EPAC Exchange protein directly activated by cAMP

xxxvii. ER – Endoplasmic reticulum xxxviii. ERK – Extracellular signalregulated kinase xxxix. FBS – Foetal Bovine Serum xl. FHH – Familial Hypercalcaemia Hypocalciuria xli. FRET – Fluorescence resonance energy transfer xlii. FSK Forskolin xliii. GABAbR – γ aminobutyric acid b receptor xliv. GI – Gastrointestinal xlv. GPCR – G proteincoupled receptor xlvi. GPR4 – Gproteincouple receptor 4 xlvii. HCN2 Hyperpolarisationactivated cyclic nucleotidegated ion channel 2 xlviii. HEK – Human embryonic kidney xlix. HRP Horseradish peroxidase l. IBMX 3isobutyl1methylxanthine li. ICD – Intracellular domain lii. IKCa – Intermediate conductance calcium activated potassium channel liii. IMCD – Inner medullary collecting duct liv. IP Inositol phosphate

lv. IP 3 – Inositol trisphosphate lvi. JNK cJun Nterminal Kinase lvii. KO – Knockout lviii. MCD – Medullary collecting duct lix. MDCK cells – MadinDarby canine kidney cells lx. MEK – Mitogenactivated protein kinase lxi. mGluR – Metabotropic glutamate receptor lxii. NCX – Sodiumcalcium exchanger lxiii. NEM NEthyl maleimide lxiv. NKCC2 – Sodium Potassium Chloride cotransporter isoform 2 lxv. NSHPT – Neonatal severe hyperparathyroidism lxvi. OGR1 Ovarian cancer G proteincoupled receptor 1 lxvii. OK cells – Opossum Kidney cells lxviii. PA – Phosphatidic Acid lxix. PBS – Phosphatebuffered saline lxx. PCT – Proximal convoluted tubule lxxi. PIP2 Phosphoinositol 4,5bisphosphate lxxii. PKA – Protein Kinase A lxxiii. PKB – Protein Kinase B

lxxiv. PKC – Protein Kinase C

lxxv. PLA 2 – Phospholipase A 2 lxxvi. PLC – Phospholipase C lxxvii. PMCA – Plasma membrane calcium ATPase lxxviii. PP Protein phosphatase lxxix. PP2A Protein phosphatase 2A lxxx. PT – Parathyroid lxxxi. PTH – Parathyroid hormone lxxxii. PTHrP – Parathyroid hormonerelated protein lxxxiii. PTx Pertussis Toxin lxxxiv. RIPA buffer – Radioactive immunoprecipitation assay buffer lxxxv. ROMK channel Renal outer medullary potassium channel lxxxvi. rtPCR Reverse transcriptase PCR lxxxvii. SDS Sodium dodecyl sulphate lxxxviii. SFO – Subfornical organ lxxxix. SHPT – Secondary hyperparathyroidism xc. siRNA – Small interfering ribosenucleicacid xci. SK4 – Calcium activated potassium channel 4 xcii. SKCa – Small conductance calciumactivated potassium channel xciii. SRE – Serum response element xciv. TMD – Transmembrane domain xcv. TPA/PMA – Phorbol ester xcvi. TRPC1 Transient receptor potential channel 1 xcvii. TRPV5 Transient receptor potential cation channel subfamily V member 5 xcviii. VFD – Venus flytrap domain xcix. VIP Vasoactive intestinal peptide c. VSMCs – Vascular smooth muscle cells

University: University of Manchester Name: Katherine Louisa Campion Degree title: Doctor of Philosophy (PhD) Thesis title: Characterisation of Ca 2+ -Sensing Receptor Extracellular pH Sensitivity and Intracellular Signal Integration. Date: August 2013 ABSTRACT 2+ Parathyroid hormone (PTH) secretion maintains free-ionised extracellular calcium (Ca o) homeostasis under the control of the calcium-sensing receptor (CaR). In humans and dogs, blood acidosis and alkalosis is associated with increased or suppressed PTH secretion respectively. Furthermore, large (1.0 pH unit) changes in extracellular pH (pH o) alter 2+ Ca o sensitivity of the CaR in CaR-transfected HEK-293 cells (CaR-HEK). Indeed, it has been found in this laboratory that even pathophysiological acidosis (pH 7.2) renders CaR 2+ 2+ less sensitive to Ca o while pathophysiological alkalosis (pH 7.6) increases its Ca o sensitivity, both in CaR-HEK and parathyroid cells. If true in vivo , then CaR’s pH o sensitivity might represent a mechanistic link between metabolic acidosis and hyperparathyroidism in ageing and renal disease. However, in acidosis one might speculate that the additional H+ could displace Ca 2+ bound to plasma albumin, thus increasing free-Ca 2+ concentration and so compensating for the decreased CaR responsiveness. Therefore, I first demonstrated that a physiologically-relevant concentration of albumin (5% w/v) failed to overcome the inhibitory effect of pH 7.2 or 2+ 2+ stimulatory effect of pH 7.6 on CaR-induced intracellular Ca (Ca i) mobilisation.

Determining the molecular basis of CaR pH o sensitivity would help explain cationic activation of CaR and permit the generation of experimental CaR models that specifically lack pH o sensitivity. With extracellular histidine and free cysteine residues the most likely candidates for pH o sensing (given their sidechains’ pK values), all 17 such CaR residues were mutated to non-ionisable residues. However, none of the resulting CaR mutants exhibited significantly decreased CaR pH o sensitivity. Even co-mutation of the two residues whose individual mutation appeared to elicit modest reductions (CaR H429V and H495V CaR ) failed to exhibit any change in CaR pH o sensitivity. I conclude therefore, that neither extracellular histidine nor free cysteine residues account for CaR pH o sensitivity.

Next, it is known that cytosolic cAMP drives PTH secretion in vivo and that cAMP 2+ 2+ potentiates Ca o-induced Ca i mobilisation in CaR-HEK cells. Given the physiological 2+ importance of tightly controlled PTH secretion and Ca o homeostasis, here I investigated the influence of cAMP on CaR signalling in CaR-HEK cells. Agents that increase 2+ 2+ cytosolic cAMP levels such as forskolin and isoproterenol potentiated Ca o-induced Ca i 2+ 2+ mobilisation and lowered the Ca o threshold for Ca i mobilisation. Indeed, forskolin 2+ lowered the EC 50 for Ca o on CaR (2.3 ± 0.1 vs. 3.0 ± 0.1 mM control, P<0.001). Forskolin also potentiated CaR-induced ERK phosphorylation; however protein kinase A activation appeared uninvolved in any of these effects. Pertussis toxin, used to block CaR- 2+ 2+ induced suppression of cAMP accumulation, also lowered the Ca o threshold for Ca i mobilisation though appeared to do so by increasing efficacy (E max ). Furthermore, mutation of the CaR’s two putative PKA consensus sequences (CaR S899 and CaR S900 ) to a 2+ non-phosphorylatable residue (alanine) failed to alter the potency of Ca o for CaR or attenuate the forskolin response. In contrast, phosphomimetic mutation of CaR S899 (to 2+ aspartate) did increase CaR sensitivity to Ca o. Together this suggests that PKA-mediated CaR S899 phosphorylation could potentiate CaR activity but that this does not occur 2+ following Ca o treatment in CaR-HEK cells. Together, these data show that cAMP 2+ 2+ regulates the Ca o threshold for Ca i mobilisation, thus helping to explain differential efficacy between CaR downstream signals. If true in vivo , this could help explain how multiple physiological signal inputs may be integrated in parathyroid cells. 16

DECLARATION

No portion of the work in this doctoral thesis has been submitted in any previous application of degree or other qualification at the University of Manchester or any other university or institute.

i. The author of this thesis (including any appendices and/or schedules to this thesis) owns certain copyright or related rights in it (the “Copyright”) and she has given The University of Manchester certain rights to use such Copyright, including for administrative purposes.

ii. Copies of this thesis, either in full or in extracts and whether in hard or electronic copy, may be made only in accordance with the Copyright, Designs and Patents Act 1988 (as amended) and regulations issued under it or, where appropriate, in accordance with licensing agreements which the University has from time to time. This page must form part of any such copies made.

iii. The ownership of certain Copyright, patents, designs, trademarks and other intellectual property (the “Intellectual Property”) and any reproductions of copyright works in the thesis, for example graphs and tables (“Reproductions”), which may be described in this thesis, may not be owned by the author and may be owned by third parties. Such Intellectual Property and Reproductions cannot and must not be made available for use without the prior written permission of the owner(s) of the relevant Intellectual Property and/or Reproductions.

iv. Further information on the conditions under which disclosure, publication and commercialisation of this thesis, the Copyright and any Intellectual Property and/or Reproductions described in it may take place is available in the University IP Policy (see www.campus.manchester.ac.uk/medialibrary/policies/interllectual property.pdf), in any relevant Thesis restriction declarations deposited in the University Library, The University Library’s regulations (see www.manchester.ac.uk/library/aboutus/regulations) and in The University’s policy on presentation of Theses.

ACKNOWLEDGMENTS

Firstly, thankyou to my supervisor Dr Donald Ward: thankyou; for taking a chance on me, for forgiving my blonde moments, and for giving me this life changing opportunity.

Thankyou to the others members of the Ward lab past and present for your advice and camaraderie. Miss Rebecca AtkinsonDell for helping me in my fledgling days and Dr Wanda McCormick who started the pH story and the platform for my PhD.

I would like to express my appreciation to my Advisor, Dr Kath Hinchliffe, for her advice, assistance, guidance and support.

Thank you to Dr Ed Nemeth for supplying the CaRHEK cells and Dr Jim Warwicker for his assistance with the CaR histidine modelling. I am also indebted to Dr Arthur Conigrave for his useful insight and ideas.

I appreciate the financial support from the BBSRC for allowing me to eat, sleep and travel to university every day.

Lastly thank you to my parents, sister and girlfriend without whom I couldn’t have managed to finish. And to my friends, for the hugs and brews, for listening to my presentations over and over, and for always knowing there was someone I could turn to.

Chapter 1

Introduction

1.1 Extracellular calcium homeostasis

The precise maintenance of extracellular calcium homeostasis is vital for human life given the wide array of fundamental physiological processes for which calcium is essential. Calcium is the primary inorganic cation in bone; it is involved in muscle contraction, neurotransmitter and hormone release, intracellular communication, DNA synthesis and enzyme activity (Brown & MacLeod, 2001). Deviation from normal calcium concentrations can cause hypercalcaemic arrhythmias and hypocalcaemic tetany and is linked to a number of chronic diseases including osteoporosis, kidney stone formation (nephrolithiasis) and vascular calcification, and, even to obesity, heart disease and hypertension (Hendy et al, 2009). As terrestrial mammals we rely on our diet as our fundamental source of calcium and upon the secretion of parathyroid hormone (PTH) as our primary mechanism for the maintenance of an appropriate plasma calcium concentration.

1.1.1 Discovery of the parathyroid gland and its role in calcium homeostasis

The parathyroid glands were first discovered by medical student Ivar Sandström in 1880. However their existence was largely dismissed and little research was conducted to determine their function. Interest returned in the 1900s when MacCallum and Voegtlin linked the removal of the parathyroid glands to tetany and disturbances in calcium homeostasis (MacCallum & Voegtlin, 1976). However, their findings were met with scepticism, as one scientist of the time remarked:

“For this scepticism there are perhaps two reasons: one, the difficulty of apprehending the fact of such small and insignificant bodies being charged with such great importance to the health of the human body…” (Brown, 1911).

The two main trains of thought were that the glands were either embryonic thyroid glands based on anatomical evidence, or, that they had a separate function concerning calcium and tetany, based on physiological and experimental evidence. Physicians began administering patients whole bovine parathyroid glands orally, or in an emulsion to cure tetany (Berkeley & Beebe, 1909; Halsted & Evans, 1907; MacCallum & Voegtlin, 1976). Another technique used was to place bovine, simian or human parathyroid glands under the skin (Mayo, 1909). In 1906, Silas Beebe described a “nucleoprotid” extract from the parathyroid glands that alleviated the symptoms on tetany and could be used multiple times (Beebe, 1906). His preparation is cited a number of times by different physicians who successfully

treated patients for tetany following removal of the parathyroids (Berkeley & Beebe, 1909). Following on from this in the 1920s, James Collip and others developed a stable, clinically viable parathyroid hormone preparation (Collip, 1925). His standardised solution made it possible for physicians to treat patients who had undergone parathyroidectomy or suffered from hypoparathyroidism.

Work continued examining the relationship between PTH, vitamin D, phosphorus and calcium homeostasis. It was understood that low calcium concentrations led to the secretion of PTH, however the exact mechanism was unclear (McLean, 1957). Development of radioimmunoassays and animal models with greater sensitivity allowed the discovery of the inverse relationship between freeionised calcium concentration and PTH secretion (Care et al , 1966; Sherwood et al , 1968; Sherwood et al , 1966).

By the 1970s and 80s it had been clearly established that the parathyroid glands play the central role in extracellular calcium homeostasis but it remained unclear how extracellular calcium fed back on the gland to suppress PTH secretion. It was noted that agonists of endogenously expressed Gαsprotein linked receptors, which increased cAMP, drove PTH secretion (Brown et al , 1977a; Brown et al , 1977b; Gardner et al , 1978). Although there was some evidence that a GPCR contributed to PTH secretion, the primary hypothesis was that a calcium channel was involved (Fitzpatrick et al , 1986b).

1.1.2 Discovery of the calcium-sensing receptor and its role in calcium homeostasis

The existence of a calciumsensing receptor was first postulated by LopezBarneo and Armstrong in the 1983 (LópezBarneo & Armstrong, 1983). This proposal was corroborated by Brown and Nemeth; collectively, their data showed that acute phorbol ester (PMA), an activator of protein kinase C (PKC), stimulated PTH

2+ secretion independently of cAMP and extracellular calcium (Ca o)(Brown et al , 1987; Brown et al , 1984; Nemeth & Scarpa, 1986). Therefore it was hypothesised that activation of PKC causes phosphorylation of an unknown factor resulting in

2+ PTH secretion. Increasing Ca o also increased inositol trisphosphate (IP 3) and diacylglycerol (DAG) levels and indicated the involvement of phospholipase C (PLC), almost certainly activated by a Gprotein coupled receptor (GPCR). The

2+ development of intracellular calcium (Ca i) indicators with greater spatial and

2+ temporal resolution enabled the observation that increases in Ca i were not

monophasic but transient followed by a sustained response and is indicative of intracellular calcium release rather than extracellular calcium influx (Nemeth & Carafoli, 1990; Nemeth & Scarpa, 1987; Nemeth et al , 1986). It was also observed that other divalent cations produced the same effect independently of calcium. These results indicated a cellsurface receptor capable of ‘sensing’ extracellular divalent cations (Brown, 1991). However, their conclusions were widely discredited and it was not until 1993 when the identity of the calciumsensing receptor (CaR) was discovered by Ed Brown and coworkers, in bovine parathyroid gland, that their work was endorsed (Brown et al , 1993). The expression and function of the CaR has since been extensively researched and it is now known to be not only involved in calcium homeostasis but a wide range of other cell functions (see section 1.3).

Fractionated bovine parathyroid mRNA isolated by Brown et al produced a 5.3 kilobase (kb) complementary DNA (cDNA) clone; capable of producing Gd 3+ activated Cl currents in Xenopus laevis oocytes (Brown et al , 1993). Currents were

2+ produced by activation of PLC, which initiated Ca i mobilisation, inturn stimulating Ca 2+ activated Cl channels. Sequencing the 5.3 kb cDNA revealed a 1085 amino acid membrane protein, coded in a 3255 bp open reading frame. Two years later the human CaR was cloned from parathyroid gland from a patient with primary hyperparathyroidism (Garrett et al , 1995). Human CaR is 1078 amino acids in length and shares 93% homology with bovine CaR. The majority of nonconserved amino acids are in the intracellular domain, inferring a difference in intracellular signalling. Bovine CaR has 9 Nlinked glycosylation and 4 PKC sites. Human CaR was predicted to have 11 glycosylation sites, 5 PKC consensus sites `sites and 2 protein kinase A (PKA) phosphorylation sites. The CaR has since been cloned in a number of other animals including chicken, rat, rabbit, dog and fish species (Butters et al , 1997; Diaz et al , 1997; Loretz et al , 2004; Naito et al , 1998; Nearing et al , 2002; Riccardi et al , 1995). The human CaR gene region was isolated to chromosome 3q13.321 using fluorescence in situ hybridisation (Janicic et al , 1995). The gene did not appear to hybridise anywhere else inferring that it is a single copy gene. Human CaR gene transcription appears to be under the control of two different promoters; the first upstream of exon 1A contains TATA and CAAT boxes whereas the second is between exons 1A and 1B and is GCrich. Having two separate promoters implies that the CaR gene could have tissuespecific transcription (Chikatsu et al , 2000).

1.2 Calcium-sensing receptor structure

The CaR is a member of family C of the GPCR superfamily of receptors, along with the γaminobutyric acid type B (GABAb) receptor, metabotropic glutamate (mGluR) receptors, the taste receptors, vomeronasal and orphan receptors (BraunerOsborne et al , 1999; BraunerOsborne et al , 2007; Hermans & Challiss, 2001; Romano et al , 1996; Wise et al , 1999). They exhibit classic GPCR structure with seven transmembrane domains (TMD), an internal Cterminus which binds G proteins but their most distinctive feature is a very large extracellular Nterminus domain (Brown et al , 1993).

1.2.1 Extracellular domain

The large human CaR extracellular domain (ECD) is 612 amino acids long and contains regions conserved between CaR and mGluRs (Garrett et al , 1995). The ECD contains the ligandbinding region, which is reminiscent of gramnegative bacteria periplasmic binding proteins (PBPs), and forms a bilobed Venus flytrap domain (VFD) (Felder et al , 1999; O'Hara et al , 1993; Ray et al , 1999; ReyesCruz et al , 2001; Silve et al , 2005). The ECD also has a cysteinerich region containing 20 conserved cysteines in the ECD and intracellular loops of the TMD (Hu et al , 2001; Ray et al , 1999).

1.2.2 Venus flytrap and calcium binding domains

Sequence alignment analysis showed that the mGluRs’ ECDs had considerable homology to the PBPs (O'Hara et al , 1993). Aligning the CaR and mGluR1 showed substantial homology between amino acids 36 to 513 in the ECD and the CaR was modelled on the PBPs (Ray et al , 1999). The VFD extends between amino acids 20 and 536 and contains the Ca 2+ binding regions. The VFD contains two globular lobes containing βsheets, connected by three stands (Ray et al , 1999). Ligand binding causes the lobes to twist and close, stabilising the confirmation of the protein (Felder et al , 1999). Nine highly conserved cysteines are present in the Nterminal domain, between the VFT and transmembrane domain (Bai, 2004).

One study showed that mutation of 14 of the 19 conserved cysteine residues in the ECD caused ER retention of the receptor (Fan et al , 1998). Mutation of the remaining 5 did not perturb the ability of the receptor to sense calcium (Fan et al ,

1998). Determining the Ca 2+ binding region has proven very complex due to the difficulty of crystallising the structure. Putative models of the calcium binding regions are based on computer algorithms employing the Xray structure of mGluR1. The CaR has a Hill coefficient of between 3 and 5, which implies cooperativity of binding of Ca 2+ ions. Silve and Huang both concluded independently that Ser147, Ser170, Asp190, Gln193, Tyr218, Phe270, Ser296 and Glu297 formed a Ca 2+ binding pocket (Huang et al , 2007b; Silve et al , 2005). Mutating each of these sites to either Ala or Lys caused a significant decrease in receptor maximal activity versus WT (Silve et al , 2005; Zhang et al , 2002b). In addition to this binding site Huang et al also reported two further putative Ca 2+ binding sites; Glu378, Glu379, Thr396, Asp398 and Glu399 located in lobe 1 of the VFD and site three, Glu224, Glu228, Glu229, Glu231 and Glu232 located in lobe 2 of the VFD (Huang et al , 2007b). Natural occurring mutations of two of these residues has been shown to cause disease; E228Q causes ADH (Conley et al , 2000) and Y218S causes FHH (Pearce et al , 1995).

1.2.3 Glycosylation and the ECD

Glycosylation is the posttranslational addition of sugar residues to the ECD and serves structural and functional roles in the CaR; it has been implicated in determining intracellular trafficking, cellsurface expression, facilitating protein folding and secretion (Fan et al , 1997). There are 11 predicted Nlinked glycosylation sites on the ECD of human CaR. Nine of these are conserved between species; in rat, bovine, and chicken the amino acid sites asparagines (Asn) 90, 130, 261, 287 446, 468, 488, 541 and 594 are all conserved (Ray et al, 1998). However Asn386 is not present in bovine CaR and Asn400 is not present in rat CaR. When human CaR underwent sitedirected mutagenesis of Asn594, 386 and 400 to glutamate, subsequent transient expression in HEK293 cells did not affect the electrophoretic mobility of the transfected receptor in HEK293 cells, inferring that these mutants are not efficiently glycosylated in this model. Sitedirected mutation and transient expression in HEK293 cells of Asn468, Asn488 and Asn541 of the sites caused a decrease in receptor mass increasing electrophoretic mobility (Ray et al , 1998). Mutation of at least 5 sites, Asn90, Asn130, Asn261, Asn287 and Asn446 caused severe loss of expression, most likely due to the endoplasmic reticulum retention of the proteins (Ray et al , 1998). There have been no clinical cases to date of mutations of Nlinked glycosylation sites which may indicate that although such mutations may

reduce cellsurface CaR expression the effect in vivo may be less severe and thus subclinical.

Under reducing conditions in electrophoresis, the apparent molecular weights of CaRimmunoreactive bands are ~120, ~140 and ~160kDa which represent the non glycosylated, high mannose and mature glycosylated forms of the receptor respectively (Bai et al , 1996). The 120kDa band corresponds to the predicted size of the CaR polypeptide and is rarely seen on western blots, except following glycosidase treatment (Bai et al , 1996), but was observed on immunoblots of renal tissue (Ward et al , 1998). The 140kDa high mannose protein represents the immature protein and is presumed not to reach the membrane (Bai et al , 1996), whereas the fully mature 160kDa appears to represent the functional CaR that does reach the cell membrane. Under nonreducing conditions, CaR immunoreactivity is also observed at ~280kDa and represents dimeric forms of the CaR (Bai et al , 1996; Bai et al , 1998a; Ward et al , 1998).

1.2.4 Dimerisation

It had previously been shown that mGluR5 exists on the cell membrane as a disulphidelinked homodimer (Romano et al , 1996). The dimerising region of mGluR5 was found to be in the first 17kDa region of the ECD, which contains four cysteine residues conserved between mGluR and CaR (Romano et al , 1996). As mentioned above, CaR also migrates electrophoretically as a dimer or higher order oligomer, i.e. ~240310 kDa (Bai et al , 1998a; Ward et al , 1998). Although Cys101 and Cys236 were initially identified as essential for dimerisation, it was subsequently shown that Cys129 and Cys131 confer dimerisation (Pace et al , 1999; Ray et al , 1999). Studying both of these pairs of cysteines, Zhang et al found that mutating 129 and 131 abolished dimerisation whereas mutating cysteines 101 and 236 reduced expression but not dimerisation (Zhang et al , 2001).

Ray et al determined by sitedirected mutagenesis that abolishing cysteines 129 and 131 resulted in a CaR that failed to dimerise but that was otherwise expressed normally and was still functional (Ray et al , 1999). Interestingly, mutating one or both cysteines rendered the receptor more sensitive to calcium and reduced its maximal response (Ray et al , 1999). Furthermore, human mutations adjacent to these cysteines exhibit gainoffunction appearing to confirm that homodimerisation actually lowers CaR sensitivity but to the physiologicallyrequired degree that

provides for effective calcium homeostasis (Ray et al , 1999). There is some evidence that the CaR can form heterodimers with other family C GPCRs. CaR and mGluR1α were coimmunoprecipitated from bovine brain and can form disulphide linkages in HEK293 cells but it remains to be confirmed whether this occurs in vivo or has any functional consequence (Chang et al , 2007; Gama et al , 2001).

1.2.5 Transmembrane domain

Hydropathy plot analysis of bovine CaR predicted seven membranespanning regions (Brown et al , 1993) and the human CaR TMD extends between amino acids 613 and 862 (Garrett et al , 1995). Interestingly, there are known mutations of the TMDs that cause both loss and gainoffunction in CaR, indicating the functional importance of the TMDs (Hendy et al , 2003; Hu et al , 2005; Nagase et al , 2002; Nakajima et al , 2009; Shiohara et al , 2004; Watanabe et al , 1998). For example, the substitution mutation Ser820Phe (in the sixth transmembrane domain) elicited a gainoffunction, but did not alter cell surface expression in a HEK293 cell model (Nagase et al , 2002). The transmembrane domains themselves can be divided into three; the extracellular loops, the intracellular loops and transmembranespanning regions.

Ray et al generated a series of truncated human CaRs in order to determine the importance of the TMDs and carboxyl terminus in determining expression (Ray et al , 1997b). CaR truncation at Thr706 in the second intracellular loop and Thr806 in the third intracellular loop resulted in a mutant protein that did not express in HEK293 cells. A receptor truncated at Thr865 which includes all seven transmembrane domains but not the carboxyl terminal had low level expression, but did not show any sensitivity to calcium (Ray et al , 1997b).

1.2.6 TMD extracellular loops

Studies using chimeras made from CaR and mGluR1 demonstrated that the transmembrane domains are critical for positive allosteric modulation by the calcimimetic R568 (see Section 1.4.3) (Hauache et al , 2000a; Hauache et al , 2000b). Replacing only the cysteinerich region with that from mGluR1 did not alter the ability of R568 to increase receptor sensitivity; however, substituting the membranespanning domain abolished the effect of R568 (Hauache et al , 2000b).

Hu et al then determined that mutating Glu837 to alanine in the third extracellular loop caused a decrease in receptor sensitivity, and unlike other inactivating mutations, could not be augmented by R568 (Hu et al , 2002). Mutating Glu837 to the similar amino acid aspartate did not affect sensitivity of the receptor to either the negative allosteric modulator NPS2143 (see 1.4.4) or the positive modulator R568, whereas, its mutation to lysine abolished sensitivity to either NPS2143 or R568 (Hu et al , 2005).

Brown et al first demonstrated that bovine CaR contained an ELEDE motif of negative amino acids on the second extracellular loop (Brown et al , 1993). The motif is also found in human CaRspanning amino acids 755759 (Garrett et al , 1995). Studying the effect of mutating the ELEDE motif in the second extracellular loop Hu et al discovered that mutating Glu767, Asp758 or Glu759 increased the sensitivity of the CaR (Hu et al , 2002). There are a number of possibilities for this observation; it is possible that the acidic residues maintain the receptor in an inactive confirmation and mutation facilitates activation, or, that they are directly involved in calcium binding. Ray et al also found that mutating Glu767 to alanine caused a gainoffunction mutation and had a significantly lowered CaR EC 50 (for PI hydrolysis) from 4.2 mM to 2.1 mM (Ray et al , 2004). However, mutating Asp758 or Glu759 did not affect EC 50 (Ray et al , 2004). However, there are no known novel mutations in this region causing either FHH or ADH; therefore the mutation of residues in this region may not be significant in vivo.

1.2.7 TMD Intracellular loops

To determine if amino acids in the TMD intracellular loops are vital for signalling, Chang et al sequentially mutated individual amino acids within the second and third intracellular loops (ICLs) (Chang et al , 2000). Mutating Phe707 to alanine significantly reduced the ability of the receptor to activate PLC in HEK293 cells, whereas mutating neighbouring amino acids did not (Chang et al , 2000). Interestingly, mutating Phe707 to the similar amino acid tryptophan restored some function to approximately 50% that of wildtype (WT) (Chang et al , 2000). Human CaR shares 6785% homology with the mGluRs, in the third intracellular loop (Chang et al , 2000). Mutation of Leu798, Phe802 and Glu804 to alanine, in the third ICL, caused significantly reduced receptor activity. Interestingly mutation of Leu798 to the closely related amino acid isoleucine restored receptor activity comparable to that of WT, whereas unrelated amino acid substitution did not restore

activity (Chang et al , 2000); inferring that the hydrophobic properties of this residue are critical for activity. Substitution of Phe802 to the related tyrosine again restored activity and substitution of Glu804 to aspartate or glycine produced results comparable to WT (Chang et al , 2000). Expression was unchanged for Leu798Ala and Phe802Ala but there was no detectable band at 160 kDa for Glu804Arg (Chang et al , 2000).

1.2.8 Intracellular domain

The ICDs represent the most diverse regions of the class C GPCRs, which allows for greater receptorspecific control of the various downstream signalling pathways. There are also relatively few clinical cases of ICD mutations resulting in either gain or lossoffunction. Indeed, there are three known polymorphisms in the ICD which are not associated with any significant pathology, which supports the idea that great amino acid variability is possible in the ICD than elsewhere without a resultant loss of receptor function (Eren et al , 2009; PerezCastrillon et al , 2006; Rubin et al , 1997; Toke et al , 2007; Vezzoli et al , 2007). Truncations of the Mozambique tilapia CaR show that approximately 100 amino acids in the ICD can be removed and the receptor still retains PLC activity and ERK activation (Loretz et al , 2004). Ray et al showed that truncation of human CaR at 865, or 874, caused a decrease in cell surface expression and loss of PLC activation (Ray et al , 1997b). One group did find that truncation at 866 was expressed, but it was necessary to transfect 10 times the amount of DNA for comparable expression levels, of bovine CaR (Chang et al , 2001). However, truncation at Thr888 had expression and PI hydrolysis comparable to WT (Ray et al , 1997b) this is compounded by Gama and Breitwieser who found that truncation at 886 did not affect Gα q/11 mediated signalling (Gama & Breitwieser, 1998). Therefore, there must be functioncritical residues between 874 and 888, indeed further sitedirected mutagenesis showed that substitution of 881883 with 3 alanine residues reduced CaR expression and decreased its maximal response by 60 70% compared to WT. Mutation of human CaR residues 875879 to alanine reduced

2+ expression and abolished sensitivity to Ca o up to 20 mM, indicating an amino acid in this region is critical for PLC activation (Ray et al , 1997b).

Chang et al used tandemalanine mutations in bovine CaR to determine the residues responsible for expression and PLC activation respectively (Chang et al , 2001). Mutating 879883 to alanine abolished PLC activation in full length bovine CaR but did not affect expression. Single sitedirected mutation of His880 and Phe882

reduced activation of PLC to 17% and 35% of WT response (Chang et al , 2001). Immunohistochemistry showed that although these mutants were translated they were not expressed at the membrane.

There are five putative PKC phosphorylation sites in human CaR (Garrett et al , 1995), including Thr646 on the first intracellular TMD loop and Ser794 on the third intracellular loop. The remaining three, Thr888, Ser895 and Ser915, are located on the ICD close to the juxtamembrane region. Mutation of Thr646 and

Ser794 to valine and alanine respectively, did not affect the EC 50 of the receptor (Bai et al , 1996; Bai et al , 1998b). Mutation of either Ser895 or Ser915 to alanine

2+ did elicit marginal increases in Ca o sensitivity compared to WT however, the mutation with the greatest effect by far, was the substitution of Thr888 to valine

2+ which resulted in a significant increase in CaR Ca o sensitivity an effect that was not significantly additive when comutated with either S895A or S915A (Bai et al , 1998b). Expression was not compromised for any of the mutations. Furthermore, acute treatment of WT CaR with the PKC activator PMA caused a rightward shift in

2+ receptor sensitivity. However, in the mutation Thr888Val Ca o sensitivity was partly

2+ inhibited and EC 50 was increased from 2.9 mM to 3.3 mM, for Ca i (Bai et al , 1998b). Phosphorylation of Thr888 will be discussed in detail later. Furthermore, there are also 2 putative PKA sites in the ICD at Ser899 and Ser900 and these will also be discussed fully later.

1.3 Calcium-sensing receptor tissue expression

The major physiological function of the CaR is the central coordination of extracellular free ionised calcium homeostasis, primarily via a suppression of PTH secretion. However, its expression in other tissues has been widely described. Initial Northern blot analysis showed that CaR was expressed not only in the parathyroid but also in a wide variety of tissues including the brain, thyroid and kidney (Aida et al , 1995; Brown et al , 1993; Riccardi et al , 1995). The CaR is functionally a calcium sensor however, it is reported that CaR can ‘sense’ other cations and Lamino acids (Conigrave et al , 2000). The receptor has since been identified in calciotropic and noncalciotropic tissues such as the gastrointestinal tract, blood vessels, bone and cartilage, breast tissue, spermatozoa and epidermis (Chang et al , 1999; Cheng et al , 1998; Dell'Aquila et al , 2006; House et al , 1997; Kameda et al , 1998; Mendoza et al ; Ray et al , 1997a; Weston et al , 2008). A great number of functional effects have been ascribed to the CaR; some of these will be detailed below.

1.3.1 Parathyroid gland

First postulated to be expressed in the parathyroid gland (LópezBarneo & Armstrong, 1983), CaR expression is fundamental to ensure calcium homeostasis. CaR is expressed on the chief cells and localised to caveolae (Chow et al ; Kifor et al , 1998). The CaR inhibits PTH secretion, through a currently unknown mechanism, thereby mediating calcium excreted by the kidneys, stored in bone and absorption from the gut (indirectly). CaR expressed in the gut, kidney and bone also contributes to calcium homeostasis (Figure 1.1). The CaR also contributes to the suppression of parathyroid chief cell hyperplasia; homozygous lossoffunction in the CaR is associated with parathyroid gland hyperplasia [reviewed in (Bai, 2004)]. Furthermore, culturing bovine parathyroid cells cultured ex vivo , is associated with a loss of CaR expression; which was synonymous with a decrease in CaR mRNA (Brown et al , 1995). Interestingly, it is an increase in intracellular cAMP which drives PTH secretion (Shoback et al , 1984); here the relationship between cAMP and the CaR is studied in detail (see Chapter 4).

Gut 1,25 dihydroxyvitaminD 3

Bone ↑Plasma Ca 2+ Kidney

PTH Parathyroid Glands PTH

Figure 1.1. Schematic overview of extracellular free ionised calcium homeostasis. Parathyroid hormone (PTH) released by the parathyroid glands acts on bone and the kidney to raise plasma free ionised calcium levels. Furthermore, the kidney catalyses the formation of the active form of 1,25 dihydroxyvitamin D 3, which acts on the gut to raise plasma freecalcium levels.

1.3.2 Kidney

The CaR is found throughout the kidney nephron, in both the cortical and medullary tubules. The CaR is expressed on the proximal convoluted tubule (PCT) apical membrane, ascending loop of Henle basolateral membrane, apical and basolateral membranes of the distal convoluted tubule (DCT) and cortical collecting duct (CCD) and the apical membrane of the medullary colleting duct (MCD) (Riccardi et al , 1998; Riccardi et al , 1996). The widespread expression is indicative of the importance of CaR expression in the kidney. Indeed, the CaR contributes to the maintenance of phosphate homeostasis, urinary acidification and concentration and mineral ion transport [reviewed by (Riccardi & Brown, 2010)].

In the PCT, calcium feedback controls CaR and vitamin D 3 activation. High luminal Ca 2+ concentration activates the CaR and has been reported to suppress 1α hydroxylase, which is the enzyme responsible for 1,25 dihydroxyvitaminD 3 generation (Bland et al , 1999; Maiti et al , 2008). These interactions show that calcium homeostasis is capable of finetuning and local control of calcium concentration.

The CaR also regulates Ca 2+ reabsorption in the cortical thick ascending loop of Henle (cTAL) (Figure 1.2). There, sodium is reabsorbed with potassium and two chloride ions via the NKCC2 transporter, across the apical membrane (Hebert et al , 1997). Chloride leaves the cTAL cells across the basolateral membrane through chloride channels, while the potassium is returned to the lumen through K + channels (ROMK) (Gamba & Friedman, 2009; Ward & Riccardi, 2002). Na + is then pumped out of the cell, against the gradient, across the basolateral membrane via the Na +K+ ATPase (Wang et al , 1997). Thus, reabsorption of Na + is the driving force for Ca 2+ paracellular reabsorption by generating a lumenpositive transepithelial gradient, down which Ca 2+ and Mg 2+ can move back into to the interstitium via a paracellular route (Hebert et al , 1997; Ward & Riccardi, 2002). High plasma Ca 2+ concentration will then activate the CaR on cTAL causing it to inhibit ROMK on the apical membrane slowing the recycling of K + therefore providing less luminal K + for NKCC2 and thus limiting the availability of Na + to generate the lumenpositive gradient (Wang et al , 1997; Wang et al , 1996; Ward & Riccardi, 2002). When luminal Ca 2+ concentration is high, inhibiting reabsorption further would minimise the risk of kidney stone formation (Brown & Hebert, 1995; Hebert et al , 1997).

CaR may also act by limiting cAMP and therefore AVPstimulated divalent ion uptake (Desfleurs et al , 1998). Paracellular Mg 2+ transport requires claudin16, an

integral gapjunction protein (Ikari et al , 2008). In MadinDarby canine kidney (MDCK) cells activation of CaR induces claudin16 degradation therefore also regulating Ca 2+ and Mg 2+ transport (Günzel et al , 2009; Ikari et al , 2008). NKCC2 is also able to transport NH4 + in substitution for K + across the apical membrane (Amlal et al , 1994; Farajov et al , 2008). Protons then leave the cell across the apical membrane via NHE or anion exchange (Capasso et al , 2002; Good et al , 2004).

In the DCT, CaR is present on both the apical and basolateral membranes (Riccardi et al , 1998). High urinary Ca 2+ concentrations in the DCT activates the CaR on the apical membrane opening epithelial Ca2+ channel transient receptor potential vanilloid member 5 (TRPV5) channels allowing calcium to be reabsorbed across the apical membrane (Topala et al , 2009). Calcium is chaperoned across the cell via calbindin D28K and is extruded across the basolateral membrane via the plasma membrane Ca 2+ ATPase (PMCA) and Na +/Ca 2+ exchanger (NCX) (Hoenderop et al , 2002). Activation of CaR on the basolateral membrane inhibits PMCA, inhibiting Ca 2+ extrusion (Hoenderop et al , 2002).

Apical Basolateral +ve -ve

CaR NKCC2

cPLA 2 ↑AA Cl - NHE2 Channel

ROMK Na 2+ /K + ATPase

Mg 2+ Ca 2+

Figure 1.2. Schematic of mineral reabsorption in the cortical thick ascending limb. The water impermeable thick ascending limb (cTAL) allows calcium and magnesium reabsorption via the generation of a lumenpositive transepithelial gradient (Hebert et al , 1997). The electroneutral bumetanide sensitive NKCC2 reabsorbs Na +, K + and 2Cl , the Na + and Cl exit via the Na +/K + ATPase and Cl channels respectively (Hebert et al , 1997). The K + ions are recycled across the apical membrane via the ROMK, generating the lumenpositive gradient. Calcium and magnesium and water are reabsorbed paracellularly. Activation of the CaR causes cPLA2 mediated AA production, which inhibits the ROMK, inhibiting further calcium reabsorption (Wang et al , 1997; Wang et al , 1996).

The CaR is expressed on both the apical and basolateral membranes in the cortical collecting duct (CCD) where it again colocalises with TRPV5 channels (Renkema et al , 2009). TRPV5 knockout mice exhibit polyuria and urinary acidification when exposed to CaR agonists (Renkema et al , 2009). This suggests that CaR protects against nephrolithiasis. In the inner medullary collecting duct (IMCD), CaR colocalises with aquaporin2 (AQP2), and its activation inhibits insertion of AQP2, decreasing water reabsorption (Procino et al , 2004; Ward et al , 1999).

1.3.3 Bone

Bone acts as a reservoir for calcium and is able to respond to fluxes in plasma calcium concentration rapidly and independently of PTH secretion (Dvorak & Riccardi, 2004). Chronic calcium imbalance, such as hypocalcaemia, can lead to bone remodelling and demineralisation. Expression of CaR has been widely reported in a number of osteoblast cell lines and human bone [reviewed in (Brown et al , 2004; Yamaguchi, 2008)]. Chang et al have shown that in a osteoblast cell line,

2+ 2+ increasing in Ca o cause IP 3 and Ca i increase (Chang et al , 1999). The possible functional role of CaR in osteoblasts was previously challenged by data showing that

2+ osteoblasts from CaR knockout mice retain their Ca osensitivity (Pi et al , 1999; Quarles et al , 1997). However, Chang and coworkers generated an osteoblast specific CaR null mouse that exhibits a severe bone phenotype (Chang et al , 2008). This group further showed that the original CaR knockout is a hypomorph and may retain some function which could explain the observations of Quarles and co workers (Brown & Lian, 2008).

1.3.4 Gastrointestinal system

CaR expression has been reported throughout the GI tract from the oesophagus to the colon (Bruce et al , 1999; Chattopadhyay et al , 1998; Justinich et al , 2008; Rutten et al , 1999) where it is a vital component in nutrient sensing and the secretory mechanism. As well as divalent cations, the CaR is also able to sense L amino acids (see Section 1.4.2) (Conigrave et al , 2000), suggesting that CaR may have a broader role in nutrient sensing. CaR expressed on the basolateral membrane of parietal cells causes proton extrusion from the cells by activation of H +/K + ATPase (Busque et al , 2005; Remy et al , 2007). Therefore, Lamino acid and cation concentrations in the plasma may jointly contribute to acid secretion in the GI tract (Conigrave & Brown, 2006). CaR may also modulate secretion by gastrinsecreting cells, where it is expressed on both the apical and basolateral membranes (Buchan et al , 2001; Dufner et al , 2005; Ray et al , 1997a). In the stomach, CaR has been found on gastrinsecreting cells, but not somatostatin or mucinsecreting cells (Cheng et

2+ al, 1999). Indeed, high Ca o concentration, or spermine exposure, causes a dose dependent increase in gastric acid secretion (Ray et al , 1997a).

Interestingly, the CaR is also expressed on the tongue where it has been suggested that the receptor forms heterodimers with the taste receptors (Conigrave &

Hampson, 2006; San Gabriel et al , 2009). Indeed, there is evidence that the CaR may contribute functionally to the enhancement of certain tastes (Maruyama et al, 2012; Ohsu et al). In the pancreas, CaR is expressed in rat both in the acinar and exocrine ductal cells where it has been suggested that CaR functions to reduce lithogenesis, a major cause of pancreatitis (Bruce et al , 1999), possibly by altering bicarbonate fluid secretion. This relates to the fact that high Ca 2+ concentrations in the ductal regions along with high bicarbonate concentrations can lead to the formation of calcium stones and blockage of the pancreatic ducts. CaR is also expressed on the apical membrane of the ductal cells where it may sense increasing Ca 2+ concentrations and stimulate fluid secretion leading to the dilution of ductal fluid reducing the likelihood of stones formation (Bruce et al , 1999). The fact that the ductal region is also alkali, due to the high bicarbonate concentrations, might be favourable as Quinn et al found that CaR is more sensitive alkali fluid (see Section 1.4.5) (Quinn et al , 2004).

1.3.5 Central and peripheral nervous system

Northern blot analysis of bovine samples revealed CaR expression in the cerebral cortex and cerebellum (Brown et al , 1993) and in situ hybridisation showed that the CaR is widely expressed throughout the rat brain (Rogers et al , 1997). Indeed, it is now well established that the CaR is expressed throughout the brain and central nervous system (Yano et al , 2004). Interestingly, the highest density of CaR expression was found in the subfornical organ (SFO), an area critical for electrolyte balance and modulation of drinking behaviour (Rogers et al , 1997). Washburn et al showed that spermine and R467, but not S467, caused neuronal depolarisation in rat subfornical organ (Washburn et al , 2000; Washburn et al , 1999). The SFO is circumventricular, meaning it is outside the bloodbrain barrier and therefore exposed to circulating molecules (Washburn et al , 1999). Thus, hypercalcaemia could activate the CaR inducing thirst and therefore prevent dehydration (Yano et al , 2004).

Chattopadhyay et al showed that CaR expressed in rat hippocampus was up regulated 1030 days postnatally and then its expression declined to the levels found in adult rat (Chattopadhyay et al , 1997). This postnatal increase suggests a role for CaR in development and it was hypothesised that CaR could mediate longterm potentiation (LTP) (Chattopadhyay et al , 1997). One possible mode of action could be via K + channels; Vassilev et al found that CaR agonists increase the open

probability of K + channels in hippocampal neurons in WT mice but not homozygous CaR knockout mice (Vassilev et al , 1997). Interestingly, amyloidβ peptides (Aβ) protein can increase CaR activity in CaRHEK cells and mice hippocampal neurons (Ye et al , 1997). This indicates that CaR could be involved in Alzheimer’s disease (AD) progression and degenerative loss of memory and cognitive function. Furthermore, CaR has been associated with an increase in AD susceptibility, particularly in patients without an APOE4 allele (Conley et al , 2009).

1.3.6 Blood vessels

A role for CaR in blood vessel contraction was first proposed by Bukoski and co workers and supported by data from Ohanian et al (Bukoski et al , 1995; Ohanian et al , 2005). CaR was shown to be expressed on the vascular endothelial cells of rat mesenteric arteries where activation by the calcimimetic, Calindol, causes hyperpolarisation of the cells by opening Ca 2+ sensitive small and intermediate conductance potassium channels (SKCa and IKCa) (Weston et al , 2005). These findings have been corroborated by immunoblot, immunoprecipitation of CaR and IKCa and knocking down the expression of CaR with siRNA (Weston et al , 2005). There is also evidence of CaR expression in the smooth muscle cells underlying the endothelium, and it has been hypothesised that such expression helps preserve the SMC phenotype (Alam et al, 2009). Indeed, vascular calcification is associated with decreased CaR expression in the vessels (Alam et al , 2009). Furthermore, in cultured VSMCs, overexpression of a dominant negative CaR increases mineralisation whereas calcimimetics ameliorate it (Alam et al , 2009). This could be of potential clinical importance in light of the possible benefit of calcimimetics against vascular calcification in rat models of chronic kidney disease (Ivanovski et al , 2009; Kawata et al , 2005). Disappointingly, the recent EVOLVE study only detected a nonsignificant 7% relative reduction in the incidence of major cardiovascular events following calcimimetic therapy in renal dialysis patients enlisted on an intentiontotreat trial. However, 23% of the placebo group were also given commercial Cinacalcet and the trial did report a significant decrease in the risk of calciphylaxis which represents one of the most lifethreatening complication of kidney disease (Perkovic & Neal, 2012).

1.3.7 Developing lung

Studies have shown that high extracellular calcium inhibits lung development in mouse embryos (Finney et al , 2008). Explanted lung tissue from E12.5 mice, were

2+ grown in culture in low (1.05 mM) or high (1.7 mM) Ca o; exposing the tissue to low calcium increased branching whereas high calcium or calcimimetic R568 had significantly less branching (Finney et al , 2008). Activation of CaR significantly decreases proliferation, and therefore branching, in mouse embryonic lung tissue (Finney et al , 2008). There was no significant difference in body or lung weight between WT and (/) mice embryos (Finney et al). Interestingly, although full length CaR was not expressed in the homozygous knockout mouse, an exon 5 splice variant mRNA was detected by RTPCR (Finney et al , 2011). This may compensate for the lack of full length CaR and prevent a more severe phenotype. The exon 5 splice variant is able to sense agonists such as Ca2+ and neomycin similarly to the WT CaR, but is only expressed when in the absence of fulllength receptor (Finney et al , 2011; Riccardi et al , 2009).

1.3.8 Other tissues

In addition, CaR expression has also been described in a variety of other tissues including mammary gland, keratinocytes, haematopoietic cells, spermatozoa and oocytes (Cheng et al , 1998; Dell'Aquila et al , 2006; House et al , 1997; Mendoza et al ; Oda et al , 1998; VanHouten et al , 2004). During pregnancy and lactation mRNA levels of CaR increase in the mammary gland and decrease following weaning (VanHouten et al , 2004). Heterozygous knockout mice ( +/) also had decreased CaR mRNA and decreased calcium content in their milk (Ardeshirpour et al , 2006). This evidence suggests that during pregnancy and lactation the mammary gland becomes capable of sensing extracellular calcium.

1.4 Calcium-sensing receptor pharmacology

1.4.1 Orthosteric ligands

Although termed the calciumsensing receptor, CaR is also capable of sensing a broad range of ligands including di and trivalent cations, Lamino acids and

2+ polyamines (BraunerOsborne et al, 2007). The CaR has a relatively modest Ca o sensitivity in the low millimolar range, with an EC50 of approximately 1.2 mM in vivo

(Brown & MacLeod, 2001). This represents one of the highest EC 50 values for any GPCR responding to its primary agonist, but appears ideal physiologically given the need for maintenanace of freeionised calcium concentrations ~1.2 mM (Brown &

2+ MacLeod, 2001). The CaR tends to be maximally activated at Ca o concentrations ≈5 mM and the steepness of the relationship is indicated by the Hill coefficient for

2+ 2+ Ca o concentration of 35, which permits the Ca omediated control of PTH secretion over a very narrow range (Brown & MacLeod, 2001).

Interestingly, the order of agonist potency for inositol metabolism in bovine parathyroid cells, reveals that calcium is not the most potent cation, the order of potency is as follows; Gd 3+ >La 3+ >Ca 2+ =Ba 2+ >Sr 2+ >Mg 2+ (Handlogten et al , 2000). The potency of the cationic ligands for the CaR depends on two factors; the charge of the ion and the ionic radii (Quinn et al , 1997). For ions with the same charge those with a greater radius have a greater potency and for ions of a similar size, those with a greater charge have a greater potency (Chang & Shoback, 2004; Quinn et al , 1997).

Produced in the gut and synaptic cleft in vivo , polyamines are potent orthosteric

2+ agonists of the CaR. The most potent is spermine which has an EC 50 for Ca o mediated CaR activation of 300 M (Quinn et al, 1997). Spermidine exhibits an EC 50 of 4 mM, whereas putrescine did not activate CaR at concentrations less than 10 mM (Quinn et al , 1997). Potency is linked to the number of amine groups in the ligand; spermine has the most at 4, with spermidine having 3 and putrescine only 2 (Chang & Shoback, 2004; Quinn et al , 1997). Therefore, like cations where the charge ratio determines potency, the number of amine groups can also determine potency.

1.4.2 CaR allosteric modulators – aromatic amino acids

The calcimimetic agent NPSR568 (see 1.4.3) is structurally similar to tyrosine and for this reason Conigrave et al investigated the effect of amino acids on CaR activation (Conigrave et al , 2000). Conigrave and coworkers found in stably

2+ transfected CaRHEK cells, that whereas moderately low Ca o concentrations (~1.5

2+ mM) did elicit some Ca i mobilisation, addition of some Lamino acids potentiated these responses (Conigrave et al , 2000). It has also been shown that the Lamino acids modestly potentiate ERK phosphorylation as well (Conigrave et al , 2007; Lee et al , 2007).

This effect of amino acids was stereoselective; Lamino acids were more potent than

2+ Damino acids (Conigrave et al , 2004). In 2.5 mM Ca o the potency of amino acids

was LPhe = LTrp= LHis ≥ LAla ≥ LSer – LPro = LGlu ≥ LAsp LPhe (Conigrave et al , 2000). The Lamino acids could also shift the concentration effect

2+ curve for calcium; for example 10 mM LPhe reduced the EC 50 of Ca o from 4.2 mM to 2.2 mM (Conigrave et al , 2000). Aromatic and aliphatic amino acids were more effective than positive branched amino acids (Conigrave et al , 2002). Lamino acids

2+ require a threshold Ca o concentration to activate the receptor however, this is not uniform; LAla is able to elicit responses in 0.5 mM whereas LPhe requires 0.75 mM (Conigrave et al , 2007).

The same group identified that Lamino acids bind to the VFD domain or exert their influence through the VFD and do not require the cysteinerich domain, transmembrane domain or Cterminus (Mun et al , 2004). Sequence analysis between the CaR and mGluR1 and analysis of the crystalline structure of mGluR1 showed that there are a number of conserved amino acids (Mun et al , 2005). Ser 169, 170 and 171 had previously been identified as critical for Lamino acid sensing (Zhang et al , 2002b), in addition to this residue the group identified Thr145 as being vital for Lamino acidsensing (Mun et al , 2005). Mutation of either Ser170 or Thr145 residue abolished or reduced CaR sensitivity to changes in LPhe and interestingly Thr145Ala abolished the receptor’s stereoselectivity (Mun et al , 2005).

1.4.3 Allosteric CaR activators - Calcimimetics

Before the identity of the CaR was identified, the search for an agonist had already begun and only two years after the receptor was cloned, the discovery of the calcimimetics R568 and R467 were published (Kronenberg & Fischer, 1995; Nemeth, 2006; Nemeth et al , 1998). Calcimimetics are phenylalkylamines and are

2+ only effective in the presence of Ca o. They reduce the calcium concentration necessary to elicit a response, causing a leftward shift for the concentrationeffect curve. The calcimimetics, NPS467 and NPS568 are stereoselective; the S enantiomer is ten to a hundred times less potent than the Renantiomer (Hammerland et al , 1998; Nemeth et al , 1998). Furthermore, R568 inhibits PTH release from bovine parathyroid cells dosedependently (Nemeth et al , 1998). The phenylalkylamines bind to a distinct site on the CaR to that of Ca 2+ ; Hu et al identified Glu837, at the top of the seventh TMD and third extracellular loop, as critical for R568 sensitivity (Hu et al , 2002; Zhang et al , 2002a). Calcimimetics have also been found to be able to rescue calcium responsiveness in previously

unresponsive CaR mutants; Zhang et al hypothesised that these compounds increase receptor affinity for G proteins or increase downstream signalling (Zhang et al , 2002a). Due to its ability to limit PTH secretion, NPS1493, or Cinacalcet (US), soon became an attractive prospect as a drug for hyperparathyroid conditions. It is now licensed as a treatment for secondary hyperparathyroidism and parathyroid cancer (Amgen, 2003; Nemeth et al , 2004).

1.4.4 Allosteric CaR inhibitors - Calcilytics

Sustained serum PTH levels are catabolic for bone formation, causing gradual but potentially pronounced demineralisation such as in primary hyperparathyroidism (Nemeth, 2002). In contrast, periodic or pulsatile PTH secretion is more physiological and causes anabolic bone turnover. The only way to harness this dual effect of PTH therapeutically at present is via daily PTH injections which is expensive and has compliance issues. Therefore, the need to develop a compound which could enhance physiological PTH release is significant. In contrast to the calcimimetic compounds which cause the receptor to become more sensitive and shift the concentrationeffect curve leftward, the calcilytics inhibit the CaR’s

2+ sensitivity to Ca o i.e. shifting the concentrationeffect curve to the right (Nemeth, 2002). High throughput screening yielded compounds which are structurally similar to the calcimimetics. One of the first calcilytics discovered was NPS2143. It was one of three such compounds discovered by highthroughput screening and chosen for its activity and selectivity; indeed it failed to inhibit other class C GPCRs. In stably transfected CaRHEK cells, NPS2143 causes a dosedependent right ward shift in the Ca 2+ concentrationeffect curve, without affecting maximal response (Nemeth et al , 2001). Consistent with this, NPS2143 also dosedependently increased PTH secretion from bovine parathyroid cells and infused rats (Nemeth et al , 2001).

Unfortunately, NPS2143 and its analogue Ronacaleret have not passed clinical trials for use in osteoporosis and bone repair due to other interactions and a lack of efficacy respectively. At the present time GlaxoSmithKline are beginning clinical trials using Ronacaleret to determine its affect at mobilising haematopoietic (CDC34 +) stem cells (GlaxoSmithKline, 2013).

1.4.5 Effect of extracellular pH on CaR

Modulation of receptors, channels and bacteria by protons are well documented (Bechinger, 1996; Chokshi et al , 2012; Clarke et al , 2000; Geierstanger et al , 1998; Horng et al , 2005; Muller et al , 2009; Zong et al , 2001). The interaction between pH and the parathyroid has been documented and speculated about for some time (Batlle et al , 1980; Chan & Bartter, 1980; Coe et al , 1975; Massry et al , 1974). Experiments in dogs show that metabolic acidosis significantly increases PTH release (Lopez et al , 2002). Interestingly, blood pH decreased by only 0.1 pH units significantly increase PTH secretion (Lopez et al , 2004). The reverse is also true with induced metabolic alkalosis in dogs significantly inhibiting PTH secretion independent from ionised calcium (Lopez et al , 2003).

Quinn et al showed, using a heterologous expression system, that nonphysiological

2+ changes in pH o significantly alter the potency of the CaR receptor for Ca o and

2+ Mg o (Quinn et al , 2004). In acidic conditions (pH 6.5), CaR sensitivity was

2+ reduced, as measured by Ca i mobilisation. The reverse was true in alkaline conditions (pH 8.5) where the sensitivity of the receptor was increased (Quinn et al ,

2004). Comparing concentrationeffect curves showed that increasing pH o

2+ correlated with a leftward shift of the Ca o curves. These results are corroborated by Doroszewicz et al who used Xenopus laevis oocytes, in a dual expression of the CaR and the calciumactivated potassium channel (SK4) to measure activation (Doroszewicz et al , 2005). As the activation of SK4 is not directly proportional to the

2+ + activation of CaR, the threshold Ca o concentration necessary to elicit K currents

2+ was analysed. In 1.8 mM Ca o significantly higher currents were observed in basic conditions (pH 8) than in acidic conditions (pH 6.5) (Doroszewicz et al , 2005).

Comparing normalised currents, the K m value, for halfmaximal activation, was significantly reduced in alkali conditions.

Previous experiments performed in this laboratory have shown that smaller,

2+ pathophysiological pH o changes (± 0.2 units) significantly altered CaRinduced Ca i mobilisation in CaRHEK cells and bovine parathyroid cells (Figures 1.3 and 1.4 respectively). Sensitivity of the CaR to pH o was also observed for other readouts of receptor activity. Thus, for example alkalosis potentiated ERK phosphorylation at a

2+ single Ca o concentration with acidosis inhibiting ERK phosphorylation. CaR activation also causes the activation of Rho leading to actin polymerisation in CaR

HEK cells (Davies et al , 2006). Thus, elevating pH o by 0.2 units potentiated the increase in actin polymerisation, with lowered pH o (7.2) inhibiting it. To further

demonstrate that this effect is due to the changes in CaR agonist sensitivity, as opposed to a change in intracellular pH (pH i), cells were loaded with the intracellular dye 2',7'Bis(2Carboxyethyl)5(and6)Carboxyfluorescein (BCECF).

Subsequent challenge of the CaRHEK cells with either +0.4 or 0.4 pH o changes did not affect pH i over the acute timescales tested (McCormick, 2008).

Ai 7.4 7.6 7.4 Bi pH o AUC min - 1 2+ 2.5 [Ca ]o 0.5 0.5 1.5 * mM

3 350/ 1.0 380 2 0.5

1 0 0 5 10 15 7.4 7.6 pH o Time (min )

Aii 7.4 7.4 Bii pH 7.2 o AUC min -1 2+ [Ca ]o 0.5 2.5 0.5 1.00 mM

2.0 0.75

350/ 380 0.50 ** 1.5

0.25

1.0 0 0 5 10 15 7.4 7.2 pH o Time (min )

2+ Figure 1.3. Effect of pH o increase on CaR-induced Ca i mobilisation in 2+ CaR-HEK cells. Ai and ii ) Representative trace showing Ca i changes (Fura2 ratio) in 2 single cells (orange, blue) or “global” cluster of cells (black) in response to 2+ elevated [Ca ]o (2.5 vs 0.5 mM control) at pH o 7.2 (ii) or 7.6 (i). Bi and ii ) Quantification of these changes presented as area under the curve / min. **P<0.01 *P<0.05 vs. first pH 7.4 treatment by paired ttest, N=4. Presented with the permission of Dr W. McCormick (McCormick, 2008).

7.6 A i 7.4 7.4 B i pH o -1 2+ 2.5 AUC min [Ca ]o 0.5 0.5 mM 3 * 1.5 350/ 380 1 2

0.5

1 0 7.4 7.6 0 5 10 15 pH o Time (min) A ii B ii 7.4 7.4 pH o 7.2 [Ca 2+ ] AUC min -1 o 2.5 mM 0.5 0.5 1 2.5

0.75 350/ 380 2 0.5 * 1.5 0.25

1 0 0 5 10 15 20 7.4 7.2 pH o Time (min)

2+ Figure 1.4. Effect of pH o increase on CaR-induced Ca i mobilisation in 2+ bovine Parathyroid chief cells. Ai and ii) Trace showing Ca i changes (Fura2 ratio) in 2 single cells (orange, blue) or “global” cluster of cells (black) in response to 2+ elevated [Ca ]o (2.5 vs 0.8 mM control) at pH o 7.2 (ii) or 7.6 (i). Bi and ii) Quantification of these changes shown as area under the curve / min. N=3. * = P<0.05 vs. initial pH 7.4 response by paired ttest. Presented with the permission of Dr W. McCormick (McCormick, 2008).

Histidine has been implicated as the residue responsible for pH sensitivity in a number of receptors, channels and bacteria, including the mGluRs (Levinthal et al, 2009). Although normally associated with disulphide bond formation and posttranslational modification, cysteine also has a pKa within the physiological

range and therefore a candidate for determining pH sensitivity (Quinn et al, 2004). The human CaR contains 16 extracellular histidines; 15 in the ECD and one in the second extracellular loop of the transmembrane domain (Table 1).

Human Bovine Rat Mouse Cat Dog 41 PI H FG PI H FG PI H FG PI H FG PI H FG PI H FG 134 SE H IP SE H IP SE H IP SE H IP SE H IP SE H IP 192 DE H QA DE H QA DE H QA DE H QA DE H QA DE H QA 254 IQ H VV IQQVV IQQVV IQQVV IQQVV IQQVV 312 YF H VV YF H VV YF H VV YF H VV YF H VV YF H VV 338 KV H PR KV H PR KV H PR KV H PR KV H PR KV H PR 344 SV H NG SV H NG SV H NG SV H NG SV H NG SV H NG 359 NC H LQ NC H LQ NC H LQ NC H LQ NC H LQ NC H LQ 377 RG H EE RG H EE RS H EE RS H EE RG H EE RG H EE 413 YT H LR YT H LR YE H LR YE H LR YT H LR YT H LR 429 IA H AL IA H AL IA H AL IA H AL IA H AL IA H AL 463/466 H LR H LN H LR H LN H LR H LN H LR H LN H LR H LN H LR H LN 495 NW H LS NW H LS NW H LS NW H LS NW H LS NW H LS 595 EN H TS EN H TS EN H TS ENYTS EN H TS EN H TS 766 TC H EG TC H EG TC H EG TC H EG TC H EG TC H EG

Table 1. CaR extracellular histidine conservation. Of the sixteen extracellular histidines all are conserved between species shown with the exception of His254 which is found only in human CaR and His595 which not present in mouse.

The histidines in the ECD were modelled (Dr Jim Warwicker, University of Manchester) using PyMOL software (Figure 1.5). The mutated histidine and cysteine CaRs were generated by sitedirected mutagenesis (see chapter 2 Materials and Methods). Having validated the mutation by sequencing the plasmid they were transiently transfected into wildtype HEK293 cells first validated by ascertaining their EC 50 and secondly to determine if they retained pH sensitivity (see Chapter 3).

Figure 1.5. PyMOL model of the extracellular histidines, free-cysteine and putative Ca 2+ binding regions. PyMOL model showing the predicted structure of a dimer of human CaR extracellular residues (Bramucci et al , 2012). Extracellular histidines (excluding His766 in the second extracellular loop) are shown in green, the single freecysteine in yellow and predicted Ca 2+ binding regions in red (Huang et al , 2007b).

1.5 Diseases of the calcium-sensing receptor and parathyroid gland

1.5.1 Loss-of-function CaR mutations

Familial hypercalcaemia hypocalciuria (FHH) is caused by a lossoffunction mutation to the CaR gene. There are over 100 documented accounts of mutations causing FHH found along the whole length of the protein (Hendy, 2003; Hendy et al , 2009) and many of these have been catalogued online (Hendy, 2003).

The condition is either hereditary autosomal dominant, or it arises from a dominant de novo mutation (AlvarezHernandez et al, 2003). Patients usually present with moderate hypercalcaemia and one or both of inappropriately low calciuria and

moderately high / inappropriately normal PTH levels. Subsequent genotyping is usually necessary to confirm the diagnosis (Heath, 1998). FHH can go unrecognised and the carrier may be asymptomatic, the severity of the disease depends upon the location of the mutation in the CaR gene (Hendy et al , 2009). Most mutations occur on the CaR locus on chromosome 3 however, some cases of FHH in families have been found on chromosome 19, the socalled Oklahoma variant (Lloyd et al , 1999). Also known as FHH type3, the genetic cause of this condition has recently been ascribed to mutations in adaptor protein2 (AP2) which is a key component of clathrincoated vesicles (CCVs) as required for clathrinmediated endocytosis (Nesbit et al , 2013).

Lossoffunction CaR mutations can manifest functionally in a number of ways; decreased expression of the CaR, decreased sensitivity of the receptor, disrupted intracellular signalling pathways or decreased transcription (Hendy et al, 2000). However, they all have the same outcome, reduced inhibition of PTH secretion. In support of this, heterozygous CaR knockout (/+) mice exhibit a similar phenotype to FHH. That is, they exhibit inappropriately high PTH levels and relative hypocalciuria resulting in elevated blood ionised calcium levels (Ho et al , 1995).

Homozygous inheritance of lossoffunction CaRs can result in neonatal severe hyperparathyroidism (NSHPT) and can be fatal at birth without surgical intervention [reviewed (Hendy et al , 2009)]. Normally due to consanguineous relations between two carriers of FHH, NSHPT can also be caused by two unrelated FHH genes, or a de novo mutation in an individual with FHH (Hendy et al , 2009). Infants may suffer from weakened bones prone to fracture and neurodevelopment problems (Hendy et al , 2000; Hendy et al , 2009). Removal of the parathyroid glands will correct the set point for calcium and the patient will have lifelong normal or mild hypocalcaemia. As for CaR knockout models of NSHPT, homozygous knockout mice (/) again exhibit a similar phenotype to NSHPT sufferers; that is, reduced growth and body weight, lethargy and decreased feeding, reduced bone mineral density and neonatal death (at ~day14) (Ho et al , 1995). Specifically these CaR null mice exhibit high blood concentrations of ionised calcium, inappropriately high PTH secretion and relative hypocalciuria. Furthermore, their parathyroid glands are enlarged and exhibit chief cells hyperplasia (Ho et al , 1995).

1.5.2 Gain-of-function CaR mutations

Gainoffunction mutations cause the phenotype of autosomal dominant hypocalcaemia (ADH) (Hendy et al , 2000). The setpoint of the receptor is left shifted so it is more sensitive to calcium and inhibits PTH secretion inappropriately (Hendy et al , 2000). Sufferers may have mildtomoderate hypocalcaemia (Pearce et al , 1996; Pollak et al , 1994). Like FHH, carriers may be asymptomatic depending on the severity of the mutation but may suffer from symptoms such as seizures or spasms (Hendy et al , 2000; Hendy et al , 2009). Treatment for hypocalcaemia generally involves use of calcium and vitamin D 3 supplementation, however this can cause complications in ADH patients such nephrolithiasis and nephrocalcinosis that can even lead to kidney failure (Hendy et al , 2009). Dozens of activating mutations have been reported in the literature (Hendy et al , 2000). They are clustered around amino acids 116 to 131 in the ECD where the receptor forms a dimer and also around the sixth and seventh TMD and third extracellular loop, which has been implicated in Lamino acid binding and transmission of conformational changes between the ECD and TMD (Hendy et al , 2009).

Barrter’s syndromes are a group of electrolyte imbalance diseases caused by a number of different receptors and channels (Thakker, 2004; Watanabe et al , 2002). Type V is caused by a gainoffunction mutation to the CaR (Thakker, 2004). The classical symptoms of Bartter’s syndrome are hypokalaemic alkalosis, hyperaldosteronism, hypereninaemia and also hypocalcaemia and hypercalciuria (Egbuna & Brown, 2008; Thakker, 2004). Type V Bartter’s is caused by a dominant gainoffunction mutation in the CaR (VargasPoussou et al , 2002; Watanabe et al , 2002); as previously discussed in the cTAL activation of CaR inhibits ROMK channels on the apical membrane. Constitutively active or overactive CaR would cause ROMK to become permanently inhibited. It is thought that the severity of the mutation causes Bartter's syndrome (Watanabe et al , 2002).

1.5.3 Primary hyperparathyroidism

Parathyroid gland adenomas and FHH can be clinically hard to distinguish and diagnose (Hendy et al , 2009). Parathyroid adenomas cause excessive PTH secretion and hypercalcaemia however patients will have hypercalciuria. Patients may present with kidney stones due to chronic hypercalciuria, osteomalacia and be prone to fractures, muscle weakness and pain, fatigue, depression and anxiety (Coker et al ,

2005). Where nephrolithiasis is first diagnosed, persistent hypercalcaemia should be considered a possible warning sign of primary hyperparathyroidism (PHPT) (Coker et al , 2005). Full parathyroidectomy should correct the symptoms and have normal or mild hypocalcaemia. Future treatment to correct any osteomalacia or kidney function may be necessary. In rare cases PHPT can be caused by an ectopic adenoma secreting hormone anywhere in the body which can be difficult to find and remove.

1.5.4 Secondary hyperparathyroidism

Secondary hyperparathyroidism has a complex aetiology; degenerating kidney function causes hyperphosphataemia and hypocalcaemia [reviewed in (Felsenfeld et al , 2007; Rodriguez et al , 2005)]. Decreasing kidney function leads to the inability to excrete excess phosphate and reabsorb calcium and inability to produce 1,25 dihydroxyvitaminD 3 (Felsenfeld et al, 2007). In chronic kidney disease, the increased phosphate and lack of calcitriol leads to parathyroid gland hyperplasia. Current therapies for SHPT initially includes calcitriol, however this is less effective in endstage renal disease, phosphate binders and the calcimimetic Cinacalcet are used (Rodriguez et al , 2005).

Chronic kidney disease is also associated with decreased bicarbonate reabsorption and which leads to acidosis. Senescence is also associated with secondary HPT and metabolic acidosis (Frassetto et al, 1996); possibly caused by declining renal function and failure to excrete excess phosphate and protons. It is possible therefore that increased PTH secretion via the pH osensitivity of the CaR might contribute to secondary HPT. Clinically, low bicarbonate concentration in predialysis patients has been associated with increased coronary artery calcification score subsequently (Oka et al , 2012). Since oral sodium bicarbonate supplementation has been shown to slow the rate of decline of renal function in CKD patients with low plasma bicarbonate concentrations then the effect of this cotherapy on the development of secondary hyperparathyroidism and vascular calcification might also be considered (de BritoAshurst et al , 2009).

1.6 Calcium-sensing receptor signalling

The CaR exhibits pleiotropic actions via promiscuous coupling to multiple heterotrimeric Gprotein subtypes including G q/11 , G 12/13 , G i/o and even G s in some breast and colon cancer cell lines (Ward, 2004; Ward & Riccardi, 2012). In this

section I will describe the variety of distinct signalling pathways induced by CaR activation.

CaR

PIP 2 Gα 12/13 Gα Gα i q PLC Rho P AC PI 3K ↓cAMP PLD DAG ↑PA PKC

p38 IP 3 Ca 2+ ERK IP 3R JNK cPLA 2

↑AA 2+ MAPKs Ca

Figure 1.6. Schematic of CaR signalling. CaR activation induces G i/o mediated adenylate cyclase (AC) inhibition and deceased cAMP; G 12/13 mediated phospholipase D (PLD) activation and phosphatidic acid (PA) production; G q/11 mediated activation of phospholipase C (PLC) which hydrolyses phosphatidylinositol 4,5bisphosphate (PIP 2) to inositol trisphosphate (IP 3) and diacylglycerol (DAG). IP3 binds to IP 3 receptors (IP3R) releasing intracellular calcium which activates protein kinase C (PKC ) with DAG. Activation of the MAP kinases extracellular regulated kinase (ERK), cjun aminoterminal kinase (JNK) and p38 kinase. Cytosolic phospholipase A2 (cPLA 2) activation leads to arachidonic acid (AA) production. Phosphatidylinositol 3 kinase (PI 3K) activation leads to PIP 2 formation.

1.6.1 Phospholipase activation

1.6.1.1 Phospholipase C

Before the CaR had been identified, a number of groups had already demonstrated PLC and PKC activation in bovine parathyroid cells in response to increasing extracellular calcium concentration (Brown et al , 1987; Brown et al , 1984; Hawkins et al , 1989; Lazarus et al ; Membreno et al , 1989; Nemeth et al , 1986; Shoback & McGhee, 1988). Furthermore, treatment with the PLC inhibitor U73122 has been

2+ shown to attenuate CaRinduced Ca i mobilisation and ERK phosphorylation (Godwin & Soltoff, 2002; Huang et al, 2002; Molostvov et al , 2008; Remy et al , 2007; Ward et al , 2002). Finally the product of PLCmediated inositol 4,5, bisphosphate (PIP 2) hydrolysis, inositol trisphosphate (IP 3), has been measured in CaRexpressing cells following exposure of the cells to CaR agonists (Chen et al ; Kifor et al , 1997) and other groups have used PI metabolism as a readout for CaR activity (Hu et al , 2000; Silve et al , 2005). Together, these studies indicate that CaR activation leads to the PLCmediated degradation of PIP 2 into IP 3 and DAG. In chronic CaR activation, depletion of PIP 2 would result in attenuated signalling therefore it is significant that phosphoinositol 4kinase (PI 4K) is also activated following CaR activation as this will help replenish PIP 2 levels, thus permitting continued PLC activity (Huang et al , 2002). Significantly, the importance of CaR mediated G q/11 activation in the regulation of PTH secretion was best demonstrated by Wettschureck et al who showed that mice with a parathyroidspecific knockdown of G αq on a Gα11 null background develop severe primary hyperparathyroidism and hypercalcaemia (Wettschureck et al , 2007). Together, this establishes that CaR activation induces the G q/11 /PLC pathway and this is of physiological importance for PTH secretion.

1.6.1.2 Phospholipases A2 and D

2+ In CaRHEK and bovine parathyroid cells, increasing Ca o concentration or addition of the CaRactivating aminoglycoside antibiotic neomycin, induces arachidonic acid (AA) release, effects which are susceptible to inhibition with general PLA2 inhibitor arachidonyl trifluromethyl ketone (AACOCF 3) (Handlogten et al , 2001; Kifor et al , 1997). Cytosolic PLA2 activation is stimulated by PKC and can also be blocked by the PLC inhibitor U73122 (Handlogten et al , 2001; Kifor et al , 1997).

Activation of CaR expressed in MDCK cells results in PLD activation resulting from

G12/13 –mediated activation of the monomeric G protein Rho (Huang et al , 2004). Then in CaRHEK cells, bovine parathyroid cells and MDCK cells, high extracellular calcium also stimulates the formation of phosphatidic acid (PA), which represents the principal product of PLD activity (Huang et al , 2004; Kifor et al , 1997). Furthermore, PKC has a stimulatory effect on PLD and increases its activity in acute treatments, whereas chronic treatment with PMA reduced CaRinduced PLD activity (Kifor et al , 1997).

1.6.2 Protein Kinase activation

1.6.2.1 Protein Kinase C

A number of groups demonstrated in the 1980s that PTH secretion could be increased in bovine parathyroid cells by the phorbol ester PMA, a known activator of PKC (Brown et al , 1984; Membreno et al , 1989; Nemeth et al , 1986). Furthermore,

2+ 2+ 2+ Ca o and Mg oevoked IP 3 formation and Ca i transients and increased in bovine parathyroid cells, which is indicative of PLC activation (Brown et al , 1987; Shoback et al , 1988).

In mGluR5, it has been proposed that the intracellular calcium oscillations this receptor elicited by the dynamic phosphorylation and dephosphorylation of an intracellular PKC site [reviewed in (Hermans & Challiss, 2001)]. Thus, as another class C GPCR with which this receptor shares homology, it is feasible that the CaR may share significant similarities in terms of its intracellular signalling.

CaR has five known putative PKC phosphorylation sites (Garrett et al, 1995). Work by Bai and coworkers demonstrated that mutation of Thr646 and Ser794 to

2+ alanine, did not alter CaR EC 50 for Ca o and thus are unlikely to be involved in any PKCmediated regulation of the CaR (Bai et al , 1998b). In contrast, mutation of Ser

2+ 895 and Ser915 both significantly reduced the EC 50 of Ca o for CaR however, the greatest reduction in EC 50 was observed when Thr888 was mutated (Bai et al , 1998b). Importantly, an individual who had suffered lifelong hypocalcaemia was found to have a T888M mutation in their CaR (Lazarus et al , 2011). This gainof function mutation results in chronic suppression of their PTH secretion and thus has led to a diagnosis of ADH. The significance of this study is that it confirms in humans the importance of Thr888 for the controlled inhibition of CaR activity in order to permit PTH secretion. It should be noted that I contributed to this study by

generating and validating the CaR T888M mutant and then expressing it in HEK293 cells for characterisation, including ERK activations assays, however this work will not be further described in this thesis (Lazarus et al , 2011).

Thus it would appear that phosphorylation of the PKC site CaR T888 (and possibly CaR S895 and CaR S915 ) effectively switches CaR off by uncoupling from, or somehow

T888 inhibiting further, Gq/11 / PLC activation. Furthermore, the extent of CaR phosphorylation in the cell at any given moment is determined by relative changes in PKC and protein phosphatase (PP) activity [reviewed in (Ward & Riccardi, 2012)]. That is, the PP1/PP2A inhibitor calyculinA prevents dephosphorylation of CaR T888

2+ causing suppression of CaRinduced Ca i mobilisation (Davies et al , 2007). Since the PP1 inhibitor tautomycin is without effect, our working hypothesis is that PP2A is the phosphatase responsible for CaR T888 dephosphorylation although this has not yet been confirmed using siRNA knockdown. That said however, the catalytic subunit of PP2A was found by dualantibody immunofluorescence to colocalise with pCaR T888 immunoreactivity (Davies et al , 2007). Significantly, I was further able to demonstrate that CaR activation induces PP2A activation in CaRHEK cells, again supporting the hypothesis that PP2A could be the CaR T888 phosphatase (McCormick et al , 2010). Again though, this work will not be further described in this thesis. The physiological significance of this is that in human PT cells, our collaborator Professor Conigrave (University of Sydney) found that calyculinA permitted PTH

2+ T888 secretion even under high Ca o conditions apparently by preventing CaR dephosphorylation and thus suspending CaR’s suppressive action on secretion (McCormick et al , 2010).

1.6.2.2 Protein Kinase A

There is little direct evidence of a role for PKA in regulation of CaR. However, Bosel et al found that use of the PKA inhibitor H89 modestly increased CaRinduced PI hydrolysis, this effect being additive to the effect of inhibiting PKC simultaneously; suggesting that the two pathways might converge (Bosel et al , 2003). Then in the pituitary cellline AtT20, the CaR drives PTHrP and ACTH secretion, effects that are inhibited by H89, however AtT20 cells represent one of the unusual instances whereby CaR actually couples to G αs to stimulate cAMP generation (Mamillapalli & Wysolmerski).

With regards the possible interaction between cAMP and CaR signalling, Gerbino et al reported that increasing intracellular cAMP levels while the CaR is mediating

2+ Ca i oscillations, causes an increase in the frequency of those oscillations. (Gerbino et al , 2005). However, whether the cAMP was acting at the level of the IP3R or the CaR itself was not clarified and there have been no further reports on this topic to date.

In fact, the human CaR contains two putative sites for PKA phosphorylation, at Ser 899 and Ser900 (Garrett et al , 1995) and thus one might speculate that the cAMP could be affecting the CaR itself, perhaps via PKAmediated phosphorylation. Therefore, here the functional roles of pseudophosphorylated and phosphornull Ser899 and Ser900 mutants were investigated in the current study. The role of Ser899 phosphorylation in the binding of 1433 proteins (section 1.6.4.4) has been investigated by Breitweiser and coworkers (Grant et al , 2011; Stepanchick et al , 2010) however, to date there are no reports on the consequence of mutating either CaR S899 or CaR S900 on receptor signalling.

1.6.3 Mitogen-Activated Protein Kinases

The mitogenactivated proteins kinases (MAPKs) are a family of protein kinases that are activated by dual phosphorylation on neighbouring tyrosine, serine/threonine residues. They are sometimes referred to as prolinedirected kinases as their consensus sequences include a proline upstream of the serine/threonine target site. They include the extracellular signalregulated kinase (ERK), cJun NKinases (JNKs) and p38 kinases (Ward, 2004).

1.6.3.1 Extracellular Regulated Protein Kinase

In various CaRexpressing cell models, agonists including Ca 2+ , Gd 3+, neomycin and spermine all increased ERK phosphorylation (Kifor et al , 2001; Ward et al , 2002; Yamaguchi et al , 2000). In parathyroid cells, CaRHEK cells and opossum kidney

(OK) cells ERK phosphorylation was found to be downstream of G i, PLC, and PKC (Kifor et al , 2001; Ward et al , 2002). Furthermore, Hobson et al reported that in CaRHEK cells, CaRinduced ERK activation can be inhibited by the PI3K inhibitors, wortmannin and LY294002 (Hobson et al , 2003). In human parathyroid cells ERK

is directly phosphorylated by mitogenactivated kinase (MEK); inhibition of MEK1 causes an apparent attenuation of PTH secretion (Corbetta et al , 2002).

In bovine and human parathyroid cells, CaR is associated with membrane caveolae

2+ (Kifor et al , 1998) and activation of CaR with high Ca o increased the phosphorylation of ERK in the caveolae (Kifor et al, 2003). Indeed, disturbance of the caveolae caused disruption of CaRmediated ERK phosphorylation in bovine PT cells (Kifor et al , 2003).

1.6.3.2 p38 MAP kinase

2+ In CaRHEK cells, high Ca o stimulates p38 kinase phosphorylation; likewise in the CaR expressing celllines H500 Leydig cells and MCETEE1 mouse osteoblast cells, CaR agonists induce p38 kinase phosphorylation (TfeltHansen et al , 2003; Yamaguchi et al , 2000). In CaRHEK cells inhibition of p38 decreased PTHrP secretion and Leydig H500 cells also decreased proliferation (MacLeod et al , 2003).

1.6.3.3 C-Jun N-terminal Kinase

High Ca 2+ and Gd 3+ induce JNK phosphorylation (Arthur et al , 2000; Chattopadhyay et al , 2004). Like the other MAPKs ERK and p38 kinase, PTHrP secretion is sensitive to the JNK inhibition in Leydig H500 cells (TfeltHansen et al , 2003). Furthermore, in calvarial osteoblastic cells, CaR agonists increased JNK phosphorylation while JNK inhibition using SP60012500125, significantly decreased proliferation (Chattopadhyay et al , 2004). Arthur et al have shown that in

2+ MDCK cells, high Ca oinduced JNK activation is decreased by inhibition of G i with pertussis toxin (PTx) (Arthur et al , 2000).

1.6.4 Calcium-sensing receptor-interacting proteins

1.6.4.1 Beta arrestin

βarrestins are involved in GPCR desensitisation and internalisation (Lorenz et al , 2007; Pi et al , 2005). Metabotropic GluRs are known to bind βarrestin and causing the receptors to causes desensitise and internalise: given the high level of homology between class C receptors it is likely they also bind βarrestin (Mundell et al , 2001).

One unique factor about CaR is their low level of desensitisation given that it is constitutively stimulated. Using RTPCR, βarrestin1 and 2 was found in human parathyroid glands (Pi et al , 2005) and we also find βarrestin1 in our bovine microarray (table 4.1). Measuring CaR activity in HEK293 cells with a luciferase reporter showed that cotransfection with wither βarrestin 1 or 2 caused a significant decrease in activity (Pi et al , 2005). βarrestin KO mice had significantly decreased basal levels of PTH and PTH was reduced in response to hypocalcaemia, interestingly though they had normal blood calcium levels indicating a level of compensation (Pi et al , 2005).

Lorenz et al showed that coexpression of the CaR and βarrestin1/2 significantly

2+ decreased IP formation in response to Ca o, whereas using siRNA to reduce β arrestin increased IP formation (Lorenz et al , 2007). Mutation of the 5 PKC phosphorylation sites on the CaR, or inhibition of PKC with GFX, rendered the receptor more sensitive to CaR agonists, and abolished the βarrestin sensitivity (Lorenz et al , 2007).

1.6.4.2 Calmodulin

The mGluR7a cterminus has also shown binding capabilities to calmodulin where it competes for binding to Gprotein βγ (O'Connor et al , 1999). Rey et al showed that CaRmediated oscillations induced by LPhe could be potentiated by calmodulin inhibitors (Rey et al , 2006). The same group suggested that this could be indicative of agonist dependent signalling however, we are not aware of the effects of calmodulin inhibitors other CaR agonists (Rey et al , 2006).

Using a calmodulin target database Huang et al predicted a calmodulin binding site on CaR between amino acids Phe881 and Val894, an area which shares homology with the mGluR7a binding region (Huang et al). Mutation at positions 1,8 and 14 in the motif to phosphomimetic amino acids rendered the CaR less sensitive with

2+ resultant increases in EC 50 s for Ca o (Huang et al , 2010). Mutation also caused an increase in agoniststimulated internalisation, suggesting a decrease in receptor stability at the membrane. Interestingly, the calmodulin inhibitor W7 caused an increase in receptor sensitivity and maximum response, inferring that calmodulin binding is negatively regulating the CaR (Huang et al , 2010).

1.6.4.3 Potassium channels

Yeast two hybrid screening showed that the CaR Cterminal interacts with the inwardly rectifying potassium channel Kir4.1 (Huang et al , 2007a). Expression in HEK293 cells showed that WT but not dominant negative CaR could co immunoprecipitate with Kir4.1 and Kir4.2, and immunohistochemistry in rat nephrons and HEK293 cells showed that they colocalised in the DCT (Huang et al , 2007a). Expression in Xenopus laevis oocytes showed that activation of WT CaR with Gd 3+ inhibited Kir4.1 and Kir4.2, and channel and receptors colocalised (Huang et al , 2007a) The same group went on to shows that CaR reduces Kir4.1 activity by reducing cell surface expression (Cha et al , 2011). The CaR, Kir4.1 and caveolin1 coimmunoprecipitated from HEK293 and rat kidney cortex cells, and using siRNA to reduce caveolin1 reversed the inhibition by the CaR (Cha et al , 2011).

1.6.4.4 14-3-3 proteins

1433 proteins are adapters or chaperones that are ubiquitously expressed; they have seven isoforms and have been linked to a range of signalling pathways and ndoplasmic reticulum (ER) retention (Arulpragasam et al , 2012; Breitwieser; Grant et al , 2011; Stepanchick et al , 2010). Two yeast linked hybridisation showed that CaR Cterminal can interact with two 1433 proteins theta (θ) and zeta (ζ). Over expression of either in CaRHEK cells decreased Rhomediated SRE activation but not ERK activation (Arulpragasam et al , 2012). This interaction was PKC independent and the 1433 consensus motif on the ICD is not required for 1433 θ interaction (Arulpragasam et al , 2012).

Breitwieser et al hypothesise that 1433 proteins mediate CaR ER retention, via Serine899 (Grant et al , 2011). Coimmunoprecipitation experiments show that mutation of Ser899 to alanine, increased interaction causing, whereas mutation to the phosphomimetic amino acid aspartate, caused decreased interaction and increased plasma membrane expression (Grant et al , 2011). The functional importance of Ser899 will be dealt with in chapter 4.

1.6.4.5 Other interactions

Filamin is a matrix protein that binds actin, but has also been shown to mediate intracellular signalling. Yeast twohybrid analysis and coimmunoprecipitation experiments have shown that CaR and filaminA directly associate (Awata et al , 2001; Pi et al , 2002). FilaminA and CaR colocalise in parathyroid cells and CaR HEK cells (Awata et al , 2001; Hjalm et al , 2001). By using a dominant negative filaminA Hjalm et al also showed that filaminA facilitates ERK phosphorylation and disruption decrease activation (Hjalm et al , 2001). Interestingly, Rey et al have shown that disruption of filaminA, G12, Rho or actin disrupt LPhe signalling; inferring a possibly mechanism for ligand specific signalling (Rey et al , 2005). In CaRHEK cells filamin was immunoprecipitated with CaR and also Rho; disruption of filaminA binding inhibited Rho mediated SRE activation (Pi et al , 2002).

Nonselective cation channels transport Na +, K + and Ca 2+ and are present in hippocampal neurons and HEK cells (Ye et al , 1996a; Ye et al , 1996b). Exposing these cells to CaR agonists, Ca 2+ , neomycin and spermine, increased the open probability of nonselective cation channels in CaRHEK cells and rat hippocampal neuronal cells (Ye et al , 1996a; Ye et al , 1996b). CaR activation is also linked to transient receptor potential canonical 1 (TRPC1) and voltage gated Ltype calcium channels (El Hiani et al, 2009a; El Hiani et al, 2006; El Hiani et al, 2009b; Parkash, 2008a; Parkash, 2008b; Topala et al, 2009).

1.7 Summary

It has been known for nearly a decade that the CaR is sensitive to large changes in pH o. In addition, experiments in dogs have revealed that metabolic acidosis or alkalosis directly potentiate or inhibit PTH secretion respectively. Work by this laboratory has shown that the CaR itself is sensitive to pathophysiological by relevant changes in pH o and can significantly alter PTH secretion in an ex vivo model. However in vivo , calcium and proton buffers (e.g. albumin) could potentially compensate for decreasing blood pH by releasing calcium. Thus, it is necessary to determine whether CaR retains its pH o sensitivity even in the presence of albumin.

Furthermore, the extracellular residue(s) responsible for mediating CaR pH o sensitivity have not been identified.

Regarding cAMP and the CaR, there is evidence that increasing intracellular cAMP concentration drives PTH secretion and thus oneway to stop excess secretion of

PTH would be if cAMP also activated the CaR thus inhibiting further PTH secretion. This would allow rapid, finecontrol of PTH secretion. Here feedback of cAMP on the CaR is examined by studying changes in Ca 2+ mobilisation following manipulations of cAMP levels or of putative PKA sites in the CaR ICD. Thus, both of the CaR’s two putative PKA phosphorylation sites were mutated in order to determine these residues’ influence, if any, on CaR signalling and cAMP responsiveness.

1.8 Aims and objectives

The overall aim of the project was to further understand the molecular mechanisms underlying the control of extracellular calcium homeostasis, with particular regards to the action and signalling of the calciumsensing receptor.

The specific objectives of the project were:

Objective 1: To determine the extracellular residue(s) responsible for CaR pH o sensitivity. This undertaking included the mutation of the sixteen extracellular histidine residues and single freecysteine residue sequentially, followed by transient expression in a heterologous expression system namely HEK293 cells (see Chapter 3).

Objective 2: To investigate whether chronic acidosis or alkalosis could be compensated for by changes in the buffering of calcium ions (see Chapter 3).

Objective 3: To determine the effect of increasing intracellular cAMP concentrations on calciumsensing receptor activation, with particular regard to the effects of cAMP

2+ on determining Ca o threshold concentrations (see Chapter 4).

Objective 4: To investigate the effect of mutation of the two putative PKA sites in the CaR carboxyl terminus on receptor function (see Chapter 4).

Chapter 2

Materials and Methods

2.1 Cell culture

Wildtype HEK293 cells were grown in Dulbeccos’ modified Eagle’s medium fortified with 10% foetal bovine serum (FBS) and split twice weekly by trypsinisation. HEK293 cells stably transfected with human CaR were maintained in DMEM, 10% FBS with 1mg/ml Hygromycin B for selectivity. Cells were kept in an

o incubator at 37 C with 5% CO 2 and not maintained beyond passage 35.

2.2 Bovine parathyroid cell isolation and culture

Bovine parathyroid glands were isolated from recently slaughtered cattle which were under thirty months and placed in collection buffer containing 141 mM NaCl, 5.3 mM KCl, 20 mM HEPES, 5 mM MgSO4 and 2 mM CaCl2 (pH 7.4). The glands were chilled during transportation. The glands had any excess fatty tissue removed and then injected and finely minced in calcium buffer containing 20 mM HEPES, 125 mM NaCl, 4 mM KCl, 0.5 mM MgCl2, 5.5 mM glucose and 0.5 mM CaCl 2 supplemented with 75ug/ml DNase I and 475U/ml collagenase type I. The minced parathyroid gland in the collagenase solution was shaken at 180 rpm for 20 min at 37 oC, then triturated and filtered using a 30 M monofilament filter cloth. This was repeated with any undigested tissue. The filtrate was centrifuged at 100rpm for 5 min at room temperature and the supernatant discarded. The pellet was resuspended in a 30% Percoll solution [30% (v/v) Percoll, 70% (v/v) 1.4 X collection buffer] and centrifuged at 18800g for 30 min at 15 oC. Excluding the bottom 1ml, the supernatant was removed and the pellet resuspended along with the remaining supernatant and cultured on to 13 mm glass coverslips coated with 0.01% (v/v) rat tail collagen type I in PBS. The bovine parathyroid cells were cultured in lowglucose (5.56 mM) DMEM supplemented with 10% heatinactivated FBS and

o (0.6U:0.6ug/ml) penicillinstreptomycin, at 37 C with 5% CO 2 and cultured for no more than 3 days.

2.3 Transient cell transfection

Transient transfections were performed using either FuGene6 or TransITLT1 reagents according to manufacturers’ instructions using approximately 60% confluent cells. Briefly, 3l transfection reagent was added to serumfree DMEM and incubated at room temperature for 5 minutes. 1g DNA vector was then added

left for a further 1530 minutes. The solution was then added to the cells dropwise. Cells were used experimentally within 72 hours of transfection.

2.4 Preparation of cell lysates

Cells were lysed using an appropriate volume of RIPA buffer; 12 mM HEPES (pH 7.6), 300 mM mannitol, 1 mM EGTA, 1 mM EDTA, 1% (v/v) TritonX 100, 0.1% (w/v) sodium dodecyl sulphate (SDS), 1 mM NaF, 250 M sodium pyrophosphate. 100 M sodium vanadate, 1.25 M pepstatin, 4 M leupeptin, 4.8 M PMSF and 1 mM Nethylmaleimide (NEM). Cells were first washed with icecold 1x PBS and incubated with RIPA buffer for 15 minutes before collection. All cell lysates were stored at 80 oC.

2.5 Immunoblotting

Cell lysates were diluted with 5X Laemmli buffer containing 320 mM Tris base (pH 6.8), 5% (w/v) sodium dodecyl sulphate, 25% (v/v) glycerol, 1% (w/v) bromophenol blue in the presence of 5% (v/v) βmercaptoethanol reducing agent in a 1:4 ratio and incubated at 85 oC (65 oC for CaR blots) for 3 mins. Samples were separated using SDSpolyacrylamide gels in running buffer containing 25 mM Tris, 192 mM glycine, 0.1% SDS.

Proteins were transferred electrophoretically on to 0.45 M nitrocellulose transfer membrane for 1 hour at 200 milliAmps in blotting buffer; 25 mM Tris, 200 mM glycine, 15% (v/v) methanol. The nonspecific binding sites on the membrane were blocked using TweenTBS buffer (15 mM Tris (pH 8.0), 150 mM NaCl, 0.1% (v/v) Tween 20) with 1% bovine serum albumin or 2% skimmed milk for (30 minutes at room temperature). Following this step the membrane was probed with primary antibody in TweenTBS (1 hour at room temperature). Before probing the membrane with secondary antibody the membrane was washed with TweenTBS (20 minutes). The horseradish peroxidase conjugated secondary antibody was either antimouse or antirabbit (1:5000 dilution) and incubated for 1 hour. Finally the membranes were washed TweenTBS (20mins) and developed using ECL chemiluminescence reagents as per the manufacturer’s instructions. Densitometry was performed for semiquantitative analysis of the immunoreactive bands.

2.6 Intracellular calcium imaging

Dualexcitation wavelength microfluorometry was carried out on cells cultured on 13 mm glass coverslips for between 2448 hours in DMEM with 10% FBS. They were loaded with 1 M FURA2AM in 1.2 mM Ca 2+ experimental buffer supplemented with 0.1% (w/v) BSA for 12 hours (room temperature in the dark). Experimental buffer contained in detail; 0.55.0 mM CaCl 2, 20 mM HEPES, 118125 mM NaCl, 0.5

o mM MgCl 2, 4 mM KCl and 5.5 mM glucose (warmed to between 2532 C). The pH was adjusted using NaOH and HCl solutions. The cells were mounted in a perfusion chamber and observed through a x40 oilimmersion lens on a Nikon Diaphot inverted microscope. Baseline conditions for HEK293 were measured in 0.5 mM

CaCl 2 and 0.8 mM CaCl 2 for bovine parathyroid gland (bPTG) cells. Images were collected using Metafluor Software and quantified using GraphPad Prism software.

2.7 Site-Directed Mutagenesis

QuikChange® Lightning Sitedirected mutagenesis of WT human CaR was undertaken in accordance with the manufacturers’ instructions (Stratagene). Primers were ordered from SigmaAldrich (UK). Briefly, 100 ng WT CaR plasmid was mixed with 50 ng forward and reverse mutant primers, buffer and enzyme.

The mix was placed in a thermal cycler and subjected to the temperature changes summarised in table 2. Following this the WT DNA was digested with DPN1 restriction enzyme for 5 minutes at 37 oC. The mutant plasmid DNA was then transformed in to XL10Gold® cells in accordance with manufacturers’ instructions. Briefly 2 l of mutant DNA was added to 40 l of XL10Gold cells and chilled on ice for 30 minutes. Cells were then heat shocked for 40 seconds in a 42 oC waterbath before being placed on ice for 2 minutes. 500 l of warmed NZY broth was added and then solution shaken at 37 oC for 1 hour. The transformed bacteria were spread on agar plates containing ampicillin (100 g/ml) and left overnight at 37 oC. Two colonies were then picked and grown in 3ml LBbroth for 8 hours and then transferred to 50ml LB broth containing ampicillin (200ug/ml) and left overnight at 37 oC shaking. The mutation was confirmed by sequencing the DNA using the University of Manchester inhouse service.

Cycles Temperature ( oC) Duration (Mins:Secs) 1 95 2:00 18 95 0:20 60 0:10 68 5:00 1 60 5:00

Table 2. Summary of thermal cycler protocol. To perform sitedirected mutagenesis, template wildtype plasmid, mutationcontaining primers, dNTPs, PCR buffer and enzyme were subjected to heating and cooling cycles to mutate the human CaR.

2.7.1 Mutation primers Below are the primers used to generate the sitedirected mutagenesis of human WT CaR.

His41Val Forward:5’CTTGGGGGGCTCTTTCCTATTGTTTTTGGAGTAGCAGCTAAAG3’ Reverse: 5’CTTTAGCTGCTACTCCAAAAACAATAGGAAAGAGCCCCCCAAG3’

His134Val Forward: 5'TTCTGCAACTGCTCAGAGGTCATTCCCTCTACGATTGC3' Reverse: 5’GCAATCGTAGAGGGAATGACCTCTGAGCAGTTGCAGAA3'

His192val Forward: 5'CATCCCCAATGATGAGGTCCAGGCCACTGCCATG3' Reverse: 5'CATGGCAGTGGCCTGGACCTCATCATTGGGGATG3'

His254Val Forward: 5'TGATGAGGAAGAGATCCAGGTTGTGGTAGAGGTGATTCAA3' Reverse: 5'TTGAATCACCTCTACCACAACCTGGATCTCTTCCTCATCA3'

His312Val Forward: 5'ATGCCTCAGTACTTCGTCGTGGTTGGCGGCAC3’ Reverse: 5'GTGCCGCCAACCACGACGAAGTACTGAGGCAT3'

His338Val Forward: 5'GAATTCCTGAAGAAGGTCGTTCCCAGGAAGTCTGTCCA3' Reverse: 5'TGGACAGACTTCCTGGGAACGACCTTCTTCAGGAATTC3'

His344Val Forward: 5'GAATTCCTGAAGAAGGTCGTTCCCAGGAAGTCTGTCCA3' Reverse: 5’TGGACAGACTTCCTGGGAACGACCTTCTTCAGGAATTC3'

His359Val Forward: 5'GGGAAGAAACATTTAACTGCGTCCTCCAAGAAGGTGCAAAAG3' Reverse: 5'CTTTTGCACCTTCTTGGAGGACGCAGTTAAATGTTTCTTCCC 3'

His377Val Forward: 5’GGACACCTTTCTGAGAGGTGTCGAAGAAAGTGGCGAC3' Reverse: 5'GTCGCCACTTTCTTCGACACCTCTCAGAAAGGTGTCC3'

His413Val Forward: 5'GACCCCTTACATAGATTACACGGTTTTACGGATATCCTACAATGTG3' Reverse: 5'CACATTGTAGGATATCCGTAAAACCGTGTAATCTATGTAAGGGGTC3'

His429Val Forward: 5'AGCAGTCTACTCCATTGCCGTCGCCTTGCAAGATATATAT3' Reverse: 5’ATATATATCTTGCAAGGCGACGGCAATGGAGTAGACTGCT3'

His463Val Forward: 5’CGTGGCAGGTCCTTAAGGTCCTACGGCATCTAAAC3’ Reverse: 5’GTTTAGATGCCGTAGGACCTTAAGGACCTGCCACG3’

His466Val Forward: 5’CAGGTCCTTAAGGTCCTACGGGTTCTAAACTTTACAAACAATATG 3’ Reverse: 5’CATATTGTTTGTAAAGTTTAGAACCCGTAGGACCTTAAGGACCTG3’

His495Val Forward: 5'ATTCCATCATCAACTGGGTCCTCTCCCCAGAGGATG3' Reverse: 5' –CATCCTCTGGGGAGAGGACCCAGTTGATGATGGAAT3'

His595Val Forward: 5’CTTCTGGTCCAATGAGAACGTCACCTCCTGCATTGCCAAG3’ Reverse: 5’CTTGGCAATGCAGGAGGTGACGTTCTCATTGGACCAGAAG3’

His766Val Forward: 5’CATCTTCATCACGTGCGTCGAGGGCTCCCTCATGG3’ Reverse: 5’CCATGAGGGAGCCCTCGACGCACGTGATGAAGATG 3’

Ser899Ala Forward: 5’TCCCGCAAGCGGGCCAGCAGCCTTG3' Reverse: 5'CAAGGCTGCTGGCCCGCTTGCGGGA3'

Ser899Asp Forward: 5'TCTCCCGCAAGCGGGACAGCAGCCTTGGAG3' Reverse: 5'CTCCAAGGCTGCTGTCCCGCTTGCGGGAGA3'

Ser900Ala Forward: 5'CCGCAAGCGGTCCGCCAGCCTTGGAGGC3' Reverse: 5'GCCTCCAAGGCTGGCGGACCGCTTGCGG3'

Ser900Asp Forward: 5'CCGCAAGCGGTCCGACAGCCTTGGAGGC3' Reverse: 5'GCCTCCAAGGCTGTCGGACCGCTTGCGG3'

2.7.2 Sequencing primers Below are the primers used to sequence the CaR mutants generated using the primers in section 2.7.1.

His41Val Forward 365 5’ GCAGAACCATGGCATTTTATAG 3’

His681Val and His192Val Forward 681 5’ CGTTTCTAAGGCCTTGGAAG 3’

His254Val and His312Val Forward 1001 5’ GCACAATTGCAGCTGATGAC 3’

His338Val and His344Val Forward 1322 5’ CCATTGGATTCGCTCTGAAG 3’

His359Val and His377Val Forward 1383 5’ CCATCCCAGGAAGTCTGTCCA 3’

His413Val and His429Val Forward 1509 5’ AAAGTGGCGACAGGTTTAGC 3’

His463Val and His466Val Forward 1642 5’ GTCTACTCCATTGCCCACG 3’

His496Val Forward 1781 5’ CAAACAATATGGGGGAGCAG 3’

His595Val Forward 1963 5’ AGTGGGTTCTCCAGGGA 3’

His766Val Forward 2212 5’GATCGCACTCACCCTCTTTG3’

Ser899Ala, Ser899Asp, Ser900Ala, Ser900Asp, Ser899/900Ala, Ser899Asp/Ser900Asp Forward 2906 5’ CATCGAGAGGAGGTGCGTTG3’

2.8 Microarray

Total RNA was extracted from bovine parathyroid glands using a RNeasy Lipid Tissue Midi Kit (Qiagen, UK) according to manufacturer’s protocol. Previous to extraction the glands had been kept in RNAlater solution (Qiagen) at room temperature. The RNA was run on an agarose gel to certify quality. Microarray was

carried out using GeneChip Bovine Genome Array (Affymetrix. High Wycombe, UK) at the University of Manchester inhouse service.

2.9 ERK Assay

CaRHEK cells were grown on 30 mm dishes in DMEM fortified to 10% FBS at 37 oC

o in 5% CO 2, for 2448 hours. The dishes were placed on heat blocks at 37 C in 0.5 mM calcium buffer for 20 minutes to equilibrate. They were then subjected to treatment in appropriate buffer for 5 minutes before being washed in ice cold PBS. Care was taken to ensure cells did not wash away. 150 l RIPA buffer was then added to the dish, which was kept on ice for 15 minutes. The cellular debris and buffer was collected and centrifuged at 15000 RPM for 10 minute. Samples were stored at 80 oC, until they were run on immunoblotted.

2.10 Protein references

Proteins used for comparative analysis were taken from GenBank® part of the NIH genetic sequence databank. GenBank® or NCBI references are as follows; Human CaR AAI12237.1, Bovine CaR NP_776427, Mouse AAD28371.1, Rat AAO59490.1, Dog ABD16381.1 and Cat NP_001158126.1. Metabotropic glutamate receptor 1 AAI36281.1 metabotropic glutamate receptor 4 isoform 1 NP_000832.1 metabotropic glutamate receptor 5 splice variant d AAT37960.1, metabotropic glutamate receptor 8 isoform b NP_001120795.1

2.11 Statistical analysis

N refers to the number of coverslips used per experiment or, in the case of immunoblot experiments N refers to the number of 30 mm dishes collected per variable. At least 2 cells, average 10 cells, were visuliased per coverslip. Data were analysed using GraphPad Prism (V5) and Microsoft excel. In order to determine the change in Fura2 ratio the area under the curve (trace line) were quantified using GraphPad Prism software. For experimental reasons the first minute of each experiment was excluded. Data is presented ± S.E.M and P values <0.05 were considered significantly different.

Chapter 3

Modulation of calcium-sensing receptor activity by extracellular pH

3.1 Introduction

In light of work by Quinn et al and more recent unpublished research in the current laboratory, it is clear that the CaR is sensitive to small changes in pH o in vitro (Quinn et al , 2004). However, two significant issues remain unresolved. The first is whether the abundance of albumin in the blood may counteract the acidsensitivity of the CaR given that it can increase its Ca 2+ binding capacity under alkaline conditions and liberates Ca 2+ under acid conditions. Therefore, it is necessary to determine whether the sensitivity of the CaR to pathophysiological changes in pH o is still observed in the presence of albumin at close to its physiological concentration in plasma. Then, another outstanding issue regards the identification of the amino acid residue(s) responsible for CaR pH o sensitivity which otherwise remains unknown. With extracellular histidine and (free) cysteine residues the amino acids whose sidechain pK values are closest to the physiological pH (7.357.4), these are arguably the most likely to confer pH o sensitivity on the CaR. As a result, I mutated all 16 extracellular histidines and 1 freecysteine to neutral residues to determine whether a reduction or loss of pH osensitivity results.

3.2 Materials and Methods

CaRHEK cells were cultured as described in (Chapter 2) section 2.1. Bovine PTG cells were isolated and cultured as detailed in section 2.2. Intracellular calcium imaging was performed as described in sections 2.6. Sitedirected mutagenesis was performed under the conditions described in section 2.7, using the primers from section 2.7. The receptor was sequenced in the mutated region to confirm identity of the mutant.

3.3 Effect of albumin addition on extracellular pH sensitivity in CaR- HEK cells and bovine parathyroid cells

Less than half of circulating ionised calcium is free ionised and thus able to be detected by the CaR in vivo . Of the remainder, the majority is bound to blood proteins such as albumin which has a blood concentration of 3550g/L (i.e. 3.55% w/v) (KraghHansen & Vorum, 1993). The binding of calcium to albumin in the blood is sensitive to blood pH such that under acidic conditions calcium is displaced from the albumin whereas under alkaline conditions more calcium binds. Therefore,

this may counteract the idea that pH o affects PTH secretion. That is, under acidic

2+ 2+ conditions CaR sensitivity to Ca o falls however the amount of free ionised Ca rises due to its release from albumin. Then under alkaline conditions, CaR

2+ 2+ sensitivity to Ca o rises however with less free ionised Ca available due to its binding to albumin.

2+ Thus, I examined this possibility by studying CaRinduced Ca i mobilisation in bovine parathyroid cells in the presence of 5% (w/v) bovine serum albumin (BSA)

2+ and during phases of elevated and lowered pH o. Exposing cells to 2.5 mM Ca o in

2+ the presence of 5% (w/v) BSA, induced Ca i oscillations that were significantly attenuated when pH o decreased from 7.4 to 7.2 (***P<0.001 by paired ttest, N≥4;

Figure 3.1). Similarly, increasing pH o from 7.4 to 7.6 significantly increased the response despite the presence of BSA (*P<0.05 by paired ttest, N≥4; Figure 3.1).

Therefore, the presence of albumin was insufficient to prevent changes in pH o from

2+ altering Ca o sensitivity in bovine parathyroid cells as before.

A ii AUC min -1 A i 7.6 7.4 7.4 *** pH o 0.4 2+ 2.5 [Ca ]o 3 (mM) 350/ 380 0.2 2

1 0 0 5Time (mins) 10 15 7.4 7.6 pH o B i B ii 7.4 7.2 7.4 pH o AUC min -1 2+ 2.5 [Ca ]o (mM) 1.4 0.2 350/ * 380 1.2 0.1

0 0 5 10 15 7.4 7.2 pH o Time ( mins )

Figure 3.1. Effect of pH o on bovine parathyroid cells in the presence of 2+ 5% (w/v) albumin. Panel Ai) Representative trace showing changes in Ca i (Fura2 ratio, 350/380 nm) in 2 single cells (orange and purple) and in a “global” 2+ cluster of cells (black), in response to 2.5 mM Ca o and following a temporary increase in pH o from 7.4 to 7.6. Quantification of the change in area under the curve/min (calculated as described in chapter 2 Materials & Methods) is shown as a bar graph in Aii. Panel B) As for panel A except with a decrease in pH o instead, from

7.4 to 7.2. *P<0.05, ***P<0.001 by paired ttest, N≥4.

In order to directly ascribe the pH o sensitivity to the CaR itself as opposed to another target on the parathyroid cell membrane, these experiments were then repeated in CaRHEK cells. Again it was found that the presence of 5% BSA failed to prevent the pH odependent change in CaR sensitivity. Lowering pH o by 0.2 units significantly

2+ decreased Ca i mobilisation, while increasing pH o by 0.2 units significantly

2+ increased Ca i mobilisation as before (*P<0.05 by paired ttest, N≥6; Figure 3.2).

A ii AUC min -1 A i * 7.6 7.4 7.4 pH o 0.08

3 2+ [Ca ]o (mM)

1.1 0.04 350/ 380 1

0.9 0 0 10 20 pH B i Time (mins) B ii 7.4 7.6 o 7.4 7.2 7.4 pH o AUC min -1

3 [Ca 2+ ] o * (mM) 0.08 1.25 350/ 380 1 0.04

0 5 10 15 Time (mins) 0 7.4 7.2 pH o

Figure 3.2. Effect of pH o on CaR-HEK in the presence of 5% (w/v) 2+ albumin. Panel A) representative trace showing changes in Ca i (Fura2 ratio, 350/380 nm) in 2 single cells (orange and purple) and in a “global” cluster of cells 2+ (black), in response to 3 mM Ca o and following a temporary increase in pH o from 7.4 to 7.6 (i). Quantification of the change in area under the curve/min is shown as a bar graph (ii). Panel B) As for panel A except with a decrease in pH o from 7.4 to 7.2.

*P<0.05 by paired ttest, N≥6.

3.4 Determination of the contribution of extracellular histidine residues to calcium-sensing receptor pH o-sensitivity

3.4.1 Confirmation of each CaR histidine mutant’s base sequence and protein expression in HEK-293 cells.

In the ECD and extracellular loops of the human CaR, 16 histidine residues were identified and mutated to valine by Lightning QuikChange SiteDirected Mutagenesis Kit (Agilent Technologies Inc. CA. USA) as described in detail in Section 2.7. All residues were mutated individually, with the exception of His466 which was comutated with His463 due to the close proximity of the residues. Successful introduction of each mutation to the CaR vector was confirmed by sequencing as (performed as described in Section 2.7) and is shown in each Panel A of Figures 3.33.16. These panels also show a 20 amino acid portion of the resulting predicted amino acid sequence. It was common to receive wildtype sequence back showing that the mutagenesis had not been successful and thus in a substantial number of cases alternate colonies were selected, or, the sequencing reaction was repeated and new colonies selected.

Next, in order to confirm that each CaR mutant protein could actually be expressed, each mutant was transiently transfected, with either Miras (Geneflow) or Fugene6 (Promega) detergents in a 3:1 ratio of reagent (l) to DNA (g), into HEK293 cells with the cells then lysed using modified RIPA buffer after 48 hours. The lysates were resolved by SDSPAGE and the membranes probed with either antiCaR monoclonal antibody (ADD), or, with antiβactin antibody as a loading control. The βactin loading controls for all of the mutants were similar to that of WT, indicating that protein loadings were equivalent throughout (Figures 3.43.17 panel B). The CaR immunoreactivity observed (under reducing conditions) in wildtype CaR transfected cells was consistent with that observed in this and other laboratories previously (McCormick et al 2010; Lazarus et al 2011) namely 140 and 160 kDa bands with higher molecular weight oligomers exhibited in some gels.

At least eight of the histidine mutants exhibited CaR immunoreactivity indistinguishable from wildtype CaRreactivity, namely, CaR H134V , CaR H192V , CaR H359V , CaR H377V , CaR H429V , CaR H463V , CaR H495V and CaR H766V (Panel B, Figures 3.3, 3.4, 3.9, 3.10, 3.12, 3.133.15 and 3.16). Mutants CaR H312V and CaR H413V exhibited reduced expression of both 140 and 160 kDa CaR proteins (Panel B, Figures 3.7 and 3.12), while mutants CaR H254V , CaR H344V and CaR H463V/H466V had slightly reduced 160

kDa bands and increased levels of 140 kDa (Panel B, Figures 3.5 3.8 and 3.13). In contrast, two CaR histidine mutants, namely CaR H41V and CaR H595V , expressed very poorly indeed with very little 160 kDa (mature) CaR exhibited and thus these are shown separately in Figures 3.18 and 3.19 and discussed in section 3.4.3.

3.4.2 Characterisation of the extracellular calcium sensitivity of the CaR histidine mutants expressed abundantly in HEK-293 cells.

In order to confirm the functional activity of each of the CaR mutants, HEK293 cells were transiently transfected with one of the mutants and then loaded with

2+ Fura2 and examined by epifluorescence microscopy. The effect of increasing Ca o

2+ concentration on the HEK293 cell Ca i concentration was then tested and where

2+ possible the Ca o concentrationdependency of each response was evaluated i.e. to

2+ establish the EC 50 for Ca o on each mutant CaR at pH 7.4. This was done to ensure that the receptors had neither lost nor gained any functional activity as a result of the mutation, since the subsequent pH experiments were substantially dependent on

2+ the Ca osensitivity being unaffected by each mutation.

Those fourteen CaR histidine mutants that expressed abundantly (i.e. not including

H41V H595V 2+ CaR and CaR ) were exposed to various concentrations of Ca o (0.510 mM) for 15 minutes and the changes in fluorescence ratio were quantified as area under the curve (AUC) per minute. All values were then normalised to the maximal response for the wildtype CaR in order that any deleterious effect of each mutation on either EC 50 or the maximal response could be detected. The only two exceptions to this strategy were mutants CaR H41V and CaR H595V which both exhibited low protein

2+ expression of the 160kDa CaR band, as well as little Ca i mobilisation in preliminary

2+ experiments (not shown) in response to modest Ca o concentrations and thus are discussed separately in section 3.4.3. For the remaining 14 CaR histidine mutants that did exhibit CaR immunoreactivity and responsiveness, the data are shown in Figures 3.33.16 with mutants arranged by location of the histidine residue in ascending order (i.e. from CaR H134V to CaR H766V ).

2+ For wildtype CaR, 1.5 mM Ca o exhibited little or no effect whereas there was a

2+ 2+ substantial response in 2.5 mM Ca o. With 3.5 mM Ca o, the CaR response was

2+ close to halfmaximal, reaching the full maximum at 10 mM Ca o. The calculated

2+ EC 50 for all wildtype CaR responses was 4.3 ± 0.3 mM Ca o (N=16; Figure 3.17, Table 3.1). Next, of those CaR mutants that exhibited equivalent CaR expression to

wildtype, namely CaR H134V (Figure 3.3), CaR H359V (Figure 3.9). CaR H377V (Figure

H463V H495V 2+ 3.10), CaR (Figure 3.13) and CaR (Figure 3.15), the Ca o concentration dependency was also comparable to wildtype CaR responses. That is, the sigmoidal curves were not shifted significantly to either left or right and the maximal responses were also unchanged.

Mutants CaR H192V (Figure 3.4), CaR H338V (Figure 3.7) and CaR H429V (Figure 3.12) did

2+ exhibit Ca o concentrationeffect curves that appeared rightshifted, however, the

H338V calculated EC 50 values were not significantly increased for CaR (Figure 3.7) and

H429V H192V CaR (Figure 3.12); only the EC 50 for CaR (Figure 3.4) was significantly increased relative to wildtype CaR (**P<0.01 by Oneway ANOVA, Dunnett’s post hoc test). In contrast, mutant CaR H766V (Figure 3.16) appeared to exhibit a left shifted concentrationeffect curve relative to wildtype CaR however, the resulting

H312V EC 50 was not significantly different. Mutant CaR (Figure 3.6) was unchanged in comparison to WT however, CaR H413V (with reduced expression of both CaR bands)

(Figure 3.11) appeared to exhibit leftward shifted curves though again the EC 50 values were not significantly from wildtype CaR. In those mutants that exhibited reduced expression of the 160 kDa band; CaR H463V/H466V (Figure 3.14) was slightly rightward shifted and CaR H254V (Figure 3.5) slightly leftward shifted, though again

H344V neither EC 50 value was significantly different from wildtype. CaR (Figure 3.8) was right was shifted and EC 50 was significantly altered (*P<0.05 by Oneway ANOVA Dunnett’s posthoc test P<0.05).

The important point to note from these data is that for the mutants described in this

2+ 2+ section, 3.5 mM Ca o elicited robust Ca i mobilisation that was largely oscillatory in

2+ 2+ nature at that Ca o concentration. As such, 3.5 mM Ca o was deemed a suitable concentration to employ in experiments testing the effect of the mutations on pH o sensitivity relative to wildtype CaR and the rationale for this is more fully described in the Discussion (section 3.5).

Mean SEM Mean vMax (%) SEM(%) N WT 4.3 0.3 96 18 16 His-134 4.3 0.3 89 18 6 His-192 7.6*** 1.0 114 15 5 His-254 3.9 0.6 87 21 6 His-312 3.3 0.5 77 8 5 His-338 5.7 0.1 156 16 4 His-413 3.9 0.4 79 6 5 His-344 6.1* 0.5 146 21 8 His-359 5.2 0.5 138 11 8 His-377 5.8 0.7 100 19 8 His-429 5.7 0.7 88 11 3 His-463 5.9 1.1 86 13 6 His-463/466 4.7 0.3 68 9 9 His-495 4.8 0.6 173 50 3 His-766 3.3 0.2 126 8 9

Table 3.1. EC 50 values and relative maximal responses for the CaR H192V H344V histidine mutants versus wild-type. The EC 50 values for CaR and CaR were significantly greater than for wildtype CaR (***P<0.001 and *P<0.05 respectively by Oneway ANOVA, Dunnett’s posthoc test). The remaining mutants had EC 50 values that were not significantly different from control and all of the receptor mutants exhibited maximal responsiveness that was not significantly different from wildtype CaR (KruskalWallis, Dunn’s multiple comparison test).

A H134V Primer : Forward: 5‘ TTCTGCAACTGCTCAGAG GT CATTCCCTCTACGATTGC3’

Confirmed Sequencing data : TTCTGCAACTGCTCAGAG GT CATTCCCTCTACGATTGC

Resulting Peptide sequence: wildtype NLDEFCNCSE HIPSTIAVVGA mutant NLDEFCNCSE VIPSTIAVVGA

B WT H134V kDa

CaR 160 140

45 β-actin

100 wild-type

% CaR activity H134V 50

0 0 2 4 6 8 10 [Ca 2+ ] (mM) o Figure 3.3. Validation of the CaR mutant His134Val. A) Forward primer used to generate the CaR H134V mutation, followed by i) inhouse sequencing data confirming identity of the resulting mutant vector and ii) the resulting predicted protein sequence. B) Representative CaR and βactin immunoblots obtained using lysates of HEK293 cells transiently transfected with either wildtype (WT) CaR or H134V 2+ CaR . C) Ca o concentrationeffect relationship for the same cells assayed for 2+ changes in Ca i (Fura2 ratio). Data were normalised against mean maximal WT response. N=6.

A H192V Primer: Forward: 5' CATCCCCAATGATGAG GT CCAGGCCACTGCCATG 3‘

Confirmed Sequencing data: CATCCCCAATGATGAG GT CCAGGCCACTGCCATG

Resulting Peptide sequence: wildtype SFLRTIPNDE HQATAMADIIE mutant SFLRTIPNDE VQATAMADIIE B kDa WT H192V

CaR 160 140

45 β-actin

C 100 wild-type % CaR activity H192V 50

0 0 2 4 6 8 10 [Ca 2+ ] (mM) o

Figure 3.4. Validation of the CaR mutant His192Val. CaR sequencing (A) and expression (B) data are shown for CaR H192V in the same way as described for H134V 2+ CaR in the legend to Figure 3.3 C) Ca o concentrationeffect relationship for the 2+ same cells assayed for changes in Ca i (Fura2 ratio). Data were normalised against mean maximal WT response. N=7.

A H254V Primer: Forward: 5' TGATGAGGAAGAGATCCAG GT TGTGGTAGAGGTGATTCAA 3‘

Confirmed Sequencing data: TGATGAGGAAGAGATCCAG GT TGTGGTAGAGGTGATTCAA

Resulting Peptide sequence: wildtype SQYSDEEEIQ HVVEVIQNSTA mutant SQYSDEEEIQ VVVEVIQNSTA

B kDa WT H254V

CaR

160 140

45 β-actin

C 100 % CaR H254V activity wild-type 50

0 0 2 4 6 8 10 [Ca 2+ ] (mM) o

Figure 3.5. Validation of the CaR mutant His254Val. CaR sequencing (A) and expression (B) data are shown for CaR H254V in the same way as described for H134V 2+ CaR in the legend to Figure 3.3 C) Ca o concentrationeffect relationship for the 2+ same cells assayed for changes in Ca i (Fura2 ratio). Data were normalised against mean maximal WT response. N=7.

A H312V Primer: Forward: 5' ATGCCTCAGTACTTC GT CGTGGTTGGCGGCAC 3‘

Confirmed Sequencing data: ATGCCTCAGTACTTC GT CGTGGTTGGCGGCAC

Resulting Peptide sequence: wildtype SSLIAMPQYF HVVGGTIGFAL mutant SSLIAMPQYF VVVGGTIGFAL B WT H312V kDa

CaR 160 140

45 β-actin

C wild-type 100 % CaR activity H312V 50

0 0 2 4 6 8 10 [Ca 2+ ] (mM) o Figure 3.6. Validation of the CaR mutant His312Val. CaR sequencing (A) and expression (B) data are shown for CaR H312V in the same way as described for H134V 2+ CaR in the legend to Figure 3.3 C) Ca o concentrationeffect relationship for the 2+ same cells assayed for changes in Ca i (Fura2 ratio). Data were normalised against mean maximal WT response. N=5.

A H338V Primer : Forward: 5' GAATTCCTGAAGAAGGTC GT TCCCAGGAAGTCTGTCCA 3‘

Confirmed Sequencing data: GAATTCCTGAAGAAGGTC GT TCCCAGGAAGTCTGTCCA

Resulting Peptide sequence: wildtype PGFREFLKKV HPRKSVHNGFA mutant PGFREFLKKV VPRKSVHNGFA

B WT H338V kDa

CaR 160 140

45 β-actin C H338V 120 % CaR activity wild-type 70

0 2 4 6 8 10 [Ca 2+ ] (mM) o Figure 3.7. Validation of the CaR mutant His338Val. CaR sequencing (A) and expression (B) data are shown for CaR H338V in the same way as described for H134V 2+ CaR in the legend to Figure 3.3 C) Ca o concentrationeffect relationship for the 2+ same cells assayed for changes in Ca i (Fura2 ratio). Data were normalised against mean maximal WT response. N=4.

A H344V Primer: Forward: 5' CGTTCCCAGGAA GT CTGTCCACAATGGT 3’

Confirmed Sequencing data: CGTTCCCAGGAA GT CTGTCCACAATGGT

Resulting Peptide sequence: wildtype LKKVHPRKSV HNGFAKEFWEE mutant LKKVHPRKSV VNGFAKEFWEE WT H344V B kDa

160 CaR 140

45 β-actin C 100 wild-type % CaR activity

50 H344V

0 0 2 4 6 8 10 [Ca 2+ ] (mM) o

Figure 3.8. Validation of the CaR mutant His344Val. CaR sequencing (A) and expression (B) data are shown for CaR H344V in the same way as described for H134V 2+ CaR in the legend to Figure 3.3 C) Ca o concentrationeffect relationship for the 2+ same cells assayed for changes in Ca i (Fura2 ratio). Data were normalised against mean maximal WT response. N=7.

A H359V Primer : Forward: 5' GGGAAGAAACATTTAACTGC GT CCTCCAAGAAGGTGCAAAAG 3‘

Confirmed Sequencing data: GGGAAGAAACATTTAACTGC GT CCTCCAAGAAGGTGCAAAAG

Resulting Peptide sequence: wildtype KEFWEETFNC HLQEGAKGPLP mutant KEFWEETFNC VLQEGAKGPLP

B WT H359V kDa

CaR 160 140

45 β-actin

C 150 H359V % CaR activity 100

wild-type 50

0 0 2 4 6 8 10 [Ca 2+ ] (mM) o

Figure 3.9. Validation of the CaR mutant His359Val. CaR sequencing (A) and expression (B) data are shown for CaR H359V in the same way as described for H134V 2+ CaR in the legend to Figure 3.3 C) Ca o concentrationeffect relationship for the 2+ same cells assayed for changes in Ca i (Fura2 ratio). Data were normalised against mean maximal WT response. N=8.

A H377V Primer: Forward: 5' GGACACCTTTCTGAGAGGT GT CGAAGAAAGTGGCGAC 3‘

Confirmed Sequencing data: GGACACCTTTCTGAGAGGT GT CGAAGAAAGTGGCGAC

Resulting Peptide sequence: wildtype PLPVDTFLRG HEESGDRFSNS mutant PLPVDTFLRG VEESGDRFSNS B WT H377V kDa

CaR 160 140

45 β-actin C 150 H377V % CaR activity 100

wild-type 50

0 0 2 4 6 8 10 [Ca 2+ ] (mM) o Figure 3.10. Validation of the CaR mutant His377Val. CaR sequencing (A) and expression (B) data are shown for CaR H377V in the same way as described for H134V 2+ CaR in the legend to Figure 3.3 C) Ca o concentrationeffect relationship for the 2+ same cells assayed for changes in Ca i (Fura2 ratio). Data were normalised against mean maximal WT response. N=8.

A H413V Primer: Forward: 5' GACCCCTTACATAGATTACACG GT TTTACGGATATCCTACAATGTG 3‘

Confirmed Sequencing data: GACCCCTTACATAGATTACACG GT TTTACGGATATCCTACAATGTG

Resulting Peptide sequence: wildtype SVETPYIDYT HLRISYNVYLA mutant SVETPYIDYT VLRISYNVYLA

B WT H413V kDa

CaR 160 140

β-actin 45

C H413V 100 % CaR activity wild-type

0 0 2 4 6 8 10 [Ca 2+ ] (mM) o Figure 3.11. Validation of the CaR mutant His413Val. CaR sequencing (A) and expression (B) data are shown for CaR H413V in the same way as described for H134V 2+ CaR in the legend to Figure 3.3 C) Ca o concentrationeffect relationship for the 2+ same cells assayed for changes in Ca i (Fura2 ratio). Data were normalised against mean maximal WT response. N=6.

A H429V Primer: Forward: 5' AGCAGTCTACTCCATTGCC GT CGCCTTGCAAGATATATAT 3‘

Confirmed Sequencing data: AGCAGTCTACTCCATTGCC GT CGCCTTGCAAGATATATAT

Resulting Peptide sequence: wildtype NVYLAVYSIA HALQDIYTCLP mutant NVYLAVYSIA VALQDIYTCLP B WT H429V kDa

CaR 160 140

-actin 45 β C 100 wild-type % CaR activity H429V 50

0 0 2 4 6 8 10 [Ca 2+ ] (mM) o Figure 3.12. Validation of the CaR mutant His429Val. CaR sequencing (A) and expression (B) data are shown for CaR H429V in the same way as described for H134V 2+ CaR in the legend to Figure 3.3 C) Ca o concentrationeffect relationship for the 2+ same cells assayed for changes in Ca i (Fura2 ratio). Data were normalised against mean maximal WT response. N=3.

A H463V Primer: FORWARD: 5'GTGGCAGGTCCTGAAGGTCCTACGGCATCTAAAC3' Confirmed Sequencing data: CGTGGCAGGTCCTTAAG GT CCTACGGCATCTAAAC Resulting Peptide sequence: wildtype KKVEAWQVLK HLRHLNFTNNMGEQ mutant KKVEAWQVLK VLRVLNFTNNMGEQ

B WT H463V kDa

160 CaR 140

45 β-actin C

100 wild-type % CaR activity

50 H463V

0 0 2 4 6 8 10 [Ca 2+ ] (mM) o Figure 3.13. Validation of the CaR mutant His463Val. CaR sequencing (A) and expression (B) data are shown for CaR H463V in the same way as described for H134V 2+ CaR in the legend to Figure 3.3 C) Ca o concentrationeffect relationship for the 2+ same cells assayed for changes in Ca i (Fura2 ratio). Data were normalised against mean maximal WT response. N=6.

A H463V/H466V Primer: Forward: 5' CAGGTCCT TAAG GT CCTACGG GT TCTAAACTTTACAAACAATATG 3‘

Confirmed Sequencing data: CAGGTCCT TAAG GT CCTACGG GT TCTAAACTTTACAAACAATATG Resulting Peptide sequence: wildtype KKVEAWQV LKHLR HLNFTNNMGEQ mutant KKVEAWQV LKVLR VLNFTNNMGEQ

B H463V/ WT H466V kDa

CaR 160 140

45 β-actin

C wild-type 100 % CaR activity 50 H463V/H466V

0 0 2 4 6 8 10 [Ca 2+ ] (mM) o Figure 3.14. Validation of the CaR mutant His463Val/His466Val. CaR sequencing (A) and expression (B) data are shown for CaR H463V/H466V in the same way H134V 2+ as described for CaR in the legend to Figure 3.3 C) Ca o concentrationeffect 2+ relationship for the same cells assayed for changes in Ca i (Fura2 ratio). Data were normalised against mean maximal WT response. N=9.

A H495V Primer: Forward: 5' ATTCCATCATCAACTGG GT CCTCTCCCCAGAGGATG 3‘

Confirmed Sequencing data: ATTCCATCATCAACTGG GT CCTCTCCCCAGAGGATG

Resulting Peptide sequence: wildtype LVGNYSIINW HLSPEDGSIVF mutant LVGNYSIINW VLSPEDGSIVF B WT H495V kDa

CaR 160 140

45 β-actin C 200 H495V % CaR activity 100 wild-type

0 0 2 4 6 8 10 [Ca 2+ ] (mM) o Figure 3.15. Validation of the CaR mutant His495Val. CaR sequencing (A) and expression (B) data are shown for CaR H495V in the same way as described for H134V 2+ CaR in the legend to Figure 3.3 C) Ca o concentrationeffect relationship for the 2+ same cells assayed for changes in Ca i (Fura2 ratio). Data were normalised against mean maximal WT response. N=3.

A H766V Primer: Forward: 5' CATCTTCATCACGTGC GT CGAGGGCTCCCTCATGG 3‘

Confirmed Sequencing data: CATCTTCATCACGTGC GT CGAGGGCTCCCTCATGG Resulting Peptide sequence: wildtype LEDEIIFITC HEGSLMALGF mutant LEDEIIFITC VEGSLMALGF B WT H766V kDa

CaR 160 140

45 β-actin

C H766V

100 % CaR activity wild-type 50

0 0 2 4 6 8 10 [Ca 2+ ] (mM) o

Figure 3.16. Validation of the CaR mutant His766Val. CaR sequencing (A) and expression (B) data are shown for CaR H766V in the same way as described for H134V 2+ CaR in the legend to Figure 3.3 C) Ca o concentrationeffect relationship for the 2+ same cells assayed for changes in Ca i (Fura2 ratio). Data were normalised against mean maximal WT response. N=9.

10 3.5 5 0.5 Ca 2+ 1.5 2.5 o 0.5 (mM) 1.6

380/ 350 1.2

0.8 0 5 10 15 20 Time (mins)

Figure 3.17. Concentration-effect curve for WT CaR. Representative trace of 2+ the Ca o concentrationeffect relationship for HEK293 cells transiently transfected 2+ with WT human CaR. assayed for changes in Ca i (Fura2 ratio) in single cells (orange and purple) and ‘global’ response (black). N=16.

3.4.3 Characterisation of the extracellular calcium sensitivity of the CaR histidine mutants CaR H41V and CaR H595V

As previously mentioned, the mutants CaR H41V and CaR H595V exhibited little or no

2+ 160kDa mature CaR immunoreactivity or responsiveness to moderate Ca o

H41V 2+ concentrations. Indeed, CaR failed to respond to any Ca o concentrations <20 mM even in the presence of the calcimimetic NPSR467, hereinafter called R467 (1 M) although transient calcium mobilisation was observed in the presence of 20

2+ H41V 2+ mM Ca o plus R467 (Figure 3.18). However, CaR did then elicit Ca i

2+ oscillations in 30 mM Ca o supplemented with 1 M R467.

H595V 2+ CaR did not respond to physiological concentrations of Ca o either but did

2+ 2+ exhibit Ca i oscillations in the presence of 5 mM Ca o supplemented with 1 M R

2+ 467 though still failed to reach its maximal response in 30 mM Ca o (Figure 3.19).

2+ As a result, it was not possible to determine the EC 50 values for Ca o for either CaR H41V or CaR H595V and thus subsequent experiments with these mutants were

2+ 2+ performed using 30 mM Ca o + 1 M R467, or, 5 mM Ca o + 1 M R467 respectively.

A H41V Primer: Forward: 5' CTTGGGGGGCTCTTTCCTATT GT TTTTGGAGTAGCAGCTAAAG 3‘

Confirmed Sequencing data: CTTGGGGGGCTCTTTCCTATT GT TTTTGGAGTAGCAGCTAAAG

Resulting Peptide sequence: wildtype DIILGGLFPI HFGVAAKDQDL mutant DIILGGLFPI VFGVAAKDQDL

WT H41V B kDa

CaR 160 140

45 β-actin R467 2+ C 30 [Ca ]o 10 20 0.5 5 (mM)

1.4 350/ 380

0 2 4 6 8 10 12 Time (mins)

Figure 3.18. Validation of the CaR mutant His41Val. A) Forward primer used to generate the CaR H41V mutation, followed by i) inhouse sequencing data confirming identity of the resulting mutant vector and ii) the resulting predicted protein sequence. B) Representative antiCaR and βactin immunoblots obtained using lysates of HEK293 cells transiently transfected with either wildtype (WT) H41V 2+ CaR or CaR . C) Ca o concentrationeffect relationship for the same cells assayed 2+ for changes in Ca i (Fura2 ratio). Data were normalised against mean maximal WT response. N=9.

A H595V Primer: Forward: 5‘ CTTCTGGTCCAATGAGAAC GT CACCTCCTGCATTGCCAAG 3‘

Confirmed Sequencing data: CTTCTGGTCCAATGAGAAC GT CACCTCCTGCATTGCCAAG Resulting Peptide sequence: wildtype CPDDFWSNEN HTSCIAKEIEF mutant CPDDFWSNEN VTSCIAKEIEF

B WT H595V kDa

CaR 160 140

45 βββ-actin

R-467 C 10 15 2+ 3 5 3 5 [Ca ]o 0.5 1.4 (mM) 350/ 380 1.2

1.0

0 5 10 15 20 Time (min) Figure 3.19. Validation of the CaR mutant His595Val. CaR sequencing (A) and expression (B) data are shown for CaR H595V in the same way as described for H41V 2+ CaR in the legend to Figure 3.18 C) Ca o concentrationeffect relationship for the 2+ same cells assayed for changes in Ca i (Fura2 ratio). Data were normalised against mean maximal WT response. N=9.

3.4.4 Determination of the extracellular pH sensitivity of the CaR histidine mutants that respond to modest extracellular calcium concentrations.

2+ Having identified 14 CaR histidine mutants capable of eliciting robust Ca i

2+ mobilisation in response to 3.5 mM Ca o, the effect of altering pH o was then examined in these mutant receptors. Specifically, the effect of 0.2 pH o unit changes

2+ 2+ on CaRinduced Ca i mobilisation, at a single Ca o concentration (3.5 mM) was tested for each mutant in turn. For wildtype CaR and all of the CaR mutants except

H41V H595V 2+ 2+ for CaR and CaR , increasing Ca o from 0.5 to 3.5 mM induced Ca i oscillations as before. Then decreasing the pH o from 7.4 to 7.2 attenuated the responses; oscillations were still observed however they tended to have lower amplitudes and reduced frequencies (quantification not shown). Next, increasing the

2+ 2+ pH o from 7.4 to 7.6 then potentiated the Ca i mobilisation induced by 3.5 mM Ca o; with oscillations increased in frequency and amplitude, or even changed into sustained responses. The pH o–dependent effects were then fully reversible, with a return to pH 7.4 causing a restoration of the original response. These data were then quantified and the change in the areaunderthecurve per min (AUC) for each CaR mutant compared to that of wildtype CaR both for acidosis and alkalosis conditions. This revealed that all of the CaR histidine mutants described here remained sensitive to pathophysiological changes in pH o. Representative traces for each of these 14 CaR mutants are shown in Figures 3.203.33 together with a bar chart showing the quantification of the relative effects of pathophysiological acidosis or alkalosis on CaR responsiveness.

A 7.4 7.6 7.4 7.2 7.4 pH o

3.5 2+ [Ca ]o 2 (mM) 350/ 380 1.5

0 5 10 15 20 B Time (mins)

% CaR 20 stimulation by Alkalosis 10

0 WT H134V 0

% CaR inhibition by Acidosis

-25

2+ 2+ Figure 3.20. The effect of pH o changes on Ca o-induced Ca i H134V H134V mobilisation for mutation CaR . A) Representative trace showing CaR 2+ transfected HEK293 cells stimulated with 3.5 mM Ca o and then exposed to pathophysiological changes in pH o. The trace shows two single cells (orange and purple) and the “global” response in the cell cluster (black). N=9. B) Quantification of the changes in AUC/min is shown as a bar chart.

A 7.4 7.4 7.6 7.4 7.2 pH o 3.5 2+ [Ca ]o 1.6 (mM) 350/ 380

1.2

0.8 0 5 10 15 20 Time (mins)

B 40 % CaR stimulation by Alkalosis 20

0 WT H192V 0 % CaR inhibition by Acidosis

-25

2+ 2+ Figure 3.21. The effect of pH o changes on Ca o-induced Ca i H192V H192V mobilisation for mutation CaR . A) Representative trace showing CaR 2+ transfected HEK293 cells stimulated with 3.5 mM Ca o and then exposed to pathophysiological changes in pH o. The trace shows two single cells (orange and purple) and the “global” response in the cell cluster (black). N≥6. B) Quantification of the changes in AUC/min is shown as a bar chart.

A 7.6 7.4 7.4 7.2 7.4 pH o

3.5 2+ [Ca ]o (mM) 2 350/ 380

1.5

0 5 10 15 Time (min) B % CaR 40 stimulation by Alkalosis 20

0 WT H254V % CaR 0 inhibition by Acidosis

-25

2+ 2+ Figure 3.22. The effect of pH o changes on Ca o-induced Ca i H254V H254V mobilisation for mutation CaR . A) Representative trace showing CaR 2+ transfected HEK293 cells stimulated with 3.5 mM Ca o and then exposed to pathophysiological changes in pH o. The trace shows two single cells (orange and purple) and the “global” response in the cell cluster (black). N≥6. B) Quantification of the changes in AUC/min is shown as a bar chart.

A 7.4 7.6 7.4 7.4 7.2 pH o 3.5 2+ [Ca ]o (mM) 2

350/ 380

0 5 10 15 20 Time (mins) B 40 % CaR stimulation by Alkalosis 20

0 WT H312V 0 % CaR inhibition by Acidosis -25

2+ 2+ Figure 3.23. The effect of pH o changes on Ca o-induced Ca i H312V H312V mobilisation for mutation CaR . A) Representative trace showing CaR 2+ transfected HEK293 cells stimulated with 3.5 mM Ca o and then exposed to pathophysiological changes in pH o. The trace shows two single cells (orange and purple) and the “global” response in the cell cluster (black). N=6. B) Quantification of the changes in AUC/min is shown as a bar chart.

A 7.4 7.6 7.4 7.4 7.2 pH o 3.5 2+ 350/ [Ca ]o 380 (mM)

1.5

1.0

0 5 10 15 Time (mins) B

% CaR 20 stimulation by Alkalosis 10

0 WT H338V 0

% CaR inhibition by Acidosis

-25

2+ 2+ Figure 3.24. The effect of pH o changes on Ca o-induced Ca i H338V H338V mobilisation for mutation CaR . A) Representative trace showing CaR 2+ transfected HEK293 cells stimulated with 3.5 mM Ca o and then exposed to pathophysiological changes in pH o. The trace shows two single cells (orange and purple) and the “global” response in the cell cluster (black). N=6. B) Quantification of the changes in AUC/min is shown as a bar chart.

100

A 7.6 7.4 7.2 7.4 7.4 pH o

3.5 2+ 2.5 [Ca ]o 350/ (mM) 380 2

1.5

1 0 5 10 15 20 25 Time (mins) B 75 % CaR stimulation by 50 Alkalosis

0 WT H344V 0 % CaR inhibition by -20 Acidosis -40

-60

2+ 2+ Figure 3.25. The effect of pH o changes on Ca o-induced Ca i H344V H344V mobilisation for mutation CaR . A) Representative trace showing CaR 2+ transfected HEK293 cells stimulated with 3.5 mM Ca o and then exposed to pathophysiological changes in pH o. The trace shows two single cells (orange and purple) and the “global” response in the cell cluster (black). N=6. B) Quantification of the changes in AUC/min is shown as a bar chart.

101

A 7.4 7.6 7.4 7.4 7.2 pH o 2+ 3.5 [Ca ]o (mM)

2 350/ 380

0 5 10 15 20 Time (min) B % CaR 20 stimulation by Alkalosis 10

0 WT H359V 0

% CaR inhibition by Acidosis -20

-40

2+ 2+ Figure 3.26. The effect of pH o changes on Ca o-induced Ca i H359V H359V mobilisation for mutation CaR . A) Representative trace showing CaR 2+ transfected HEK293 cells stimulated with 3.5 mM Ca o and then exposed to pathophysiological changes in pH o. The trace shows two single cells (orange and purple) and the “global” response in the cell cluster (black). N=6. B) Quantification of the changes in AUC/min is shown as a bar chart.

102

A 7.4 7.4 7.6 7.4 7.2 pH o

2+ 3.5 [Ca ]o (mM)

350/ 380

0 5 10 15 20 B Time (min) % CaR 30 stimulation by Alkalosis 20

0 WT H377V 0 % CaR inhibition by Acidosis -25

-50

2+ 2+ Figure 3.27. The effect of pH o changes on Ca o-induced Ca i H377V H377V mobilisation for mutation CaR . A) Representative trace showing CaR 2+ transfected HEK293 cells stimulated with 3.5 mM Ca o and then exposed to pathophysiological changes in pH o. The trace shows two single cells (orange and purple) and the “global” response in the cell cluster (black). N=7. B) Quantification of the changes in AUC/min is shown as a bar chart.

103

A 7.4 7.6 7.4 7.4 7.2 pH o

3.5 2+ [Ca ]o (mM) 2

350/ 380

0 5 10 15 Time (min) B 20 % CaR stimulation by Alkalosis 10

0 WT H413V 0

% CaR inhibition by Acidosis

-25

2+ 2+ Figure 3.28. The effect of pH o changes on Ca o-induced Ca i H413V H413V mobilisation for mutation CaR . A) Representative trace showing CaR 2+ transfected HEK293 cells stimulated with 3.5 mM Ca o and then exposed to pathophysiological changes in pH o. The trace shows two single cells (orange and purple) and the “global” response in the cell cluster (black). N=9. B) Quantification of the changes in AUC/min is shown as a bar chart.

104

A 7.4 7.6 7.4 7.4 7.2 pH o

3.5 2+ [Ca ]o 2.4 (mM)

350/ 380

1.6

0 5 10 15 Time (min) B 20 % CaR stimulation by Alkalosis 10

0 WT H429V 0

% CaR inhibition by Acidosis

-25

2+ 2+ Figure 3.29. The effect of pH o changes on Ca o-induced Ca i H429V H429V mobilisation for mutation CaR . A) Representative trace showing CaR 2+ transfected HEK293 cells stimulated with 3.5 mM Ca o and then exposed to pathophysiological changes in pH o. The trace shows two single cells (orange and purple) and the “global” response in the cell cluster (black). N=7. B) Quantification of the changes in AUC/min is shown as a bar chart.

105

A 7.6 7.4 7.4 7.4 7.2 pH o

3.5 2+ [Ca ]o 2 (mM) 350/ 380

1.5

0 5 10 15 20 Time (min) B 30 % CaR stimulation by 20 Alkalosis

0 WT H463V 0 % CaR inhibition by Acidosis -25

-50

2+ 2+ Figure 3.30. The effect of pH o changes on Ca o-induced Ca i H463V H463V mobilisation for mutation CaR . A) Representative trace showing CaR 2+ transfected HEK293 cells stimulated with 3.5 mM Ca o and then exposed to pathophysiological changes in pH o. The trace shows two single cells (orange and purple) and the “global” response in the cell cluster (black). N≥6. B) Quantification of the changes in AUC/min is shown as a bar chart.

106

A 7.4 7.6 7.4 7.4 7.2 pH o

3.5 2+ [Ca ]o 2 (mM)

350/ 380

0 5 10 15 Time (min) B % CaR 30 stimulation by Alkalosis 20

0 H463V WT /H466 0 V % CaR inhibition by Acidosis -25

2+ 2+ Figure 3.31. The effect of pH o changes on Ca o-induced Ca i H463V/H466V mobilisation for mutation CaR . A) Representative trace showing H463V/H466V 2+ CaR transfected HEK293 cells stimulated with 3.5 mM Ca o and then exposed to pathophysiological changes in pH o. The trace shows two single cells (orange and purple) and the “global” response in the cell cluster (black). N=7. B) Quantification of the changes in AUC/min is shown as a bar chart.

107

A 7.6 7.4 7.4 7.4 7.2 pH o 350/ 3.5 2+ 380 [Ca ]o 3 (mM)

0 5 10 15 20 Time (min) B 20 % CaR stimulation by Alkalosis 10

0 WT H495V % CaR 0 inhibition by Acidosis -15

-30

2+ 2+ Figure 3.32. The effect of pH o changes on Ca o-induced Ca i H495V H495V mobilisation for mutation CaR . A) Representative trace showing CaR 2+ transfected HEK293 cells stimulated with 3.5 mM Ca o and then exposed to pathophysiological changes in pH o. The trace shows two single cells (orange and purple) and the “global” response in the cell cluster (black). N≥8. B) Quantification of the changes in AUC/min is shown as a bar chart.

108

A 7.4 7.6 7.4 7.4 7.2 pH o 3.5 2+ [Ca ]o (mM) 1.6

350/ 380

0.8 0 5 10 15 20 25 Time (min) 30 B

% CaR 20 stimulation by Alkalosis 10

0 WT H766V 0

% CaR inhibition by Acidosis -15

-30

2+ 2+ Figure 3.33. The effect of pH o changes on Ca o-induced Ca i H766V H766V mobilisation for mutation CaR . A) Representative trace showing CaR 2+ transfected HEK293 cells stimulated with 3.5 mM Ca o and then exposed to pathophysiological changes in pH o. The trace shows two single cells (orange and purple) and the “global” response in the cell cluster (black). N=9. B) Quantification of the changes in AUC/min is shown as a bar chart.

109

Together, Figures 3.203.33 indicate that none of these histidine residues contribute significantly to CaR pH o sensitivity. It was noted however that the pH o sensitivities of CaR H429V and CaR H495V appeared marginally decreased and so these two residues are considered further in Section 3.4.6. Nevertheless, as single mutations the pH o sensitivity of CaR H429V and CaR H495V was not significantly different to wildtype CaR.

3.4.5 Determination of the extracellular pH sensitivity of the CaR histidine mutants CaR H41V and CaR H595V .

Next, the pH o sensitivities of the two remaining CaR histidine (i.e. the lossof

H41V H595V 2+ function) mutants were tested. For CaR and CaR , Ca i mobilisation was

2+ 2+ induced using 30 mM Ca o plus 1 M R467 or 5 mM Ca o plus 1 M R467 respectively followed by changes in pH o tested previously. However, as for the other

H41V mutants, decreasing pH o from 7.4 to 7.2 inhibited CaR responsiveness for CaR

H595V (Figure 3.34) and CaR (Figure 3.35) whereas increasing pH o from 7.4 to 7.6

2+ potentiated receptor responsiveness. The treatments necessary to induce Ca i mobilisation were supramaximal with respect to wildtype CaR, and thus are

2+ unsuitable for direct comparison to the effects of 3.5 mM Ca o (i.e. ~EC 50 ).

Therefore for these two mutants, the effects of changing pH o were compared to their prior responsiveness in pH 7.4. As a result, quantification of the changes in area

H41V H595V under the curve in response to changes in pH o reveal that both CaR and CaR

H41V H595V retain their pH o sensitivity (CaR ,**P<0.01 and CaR , *P<0.05 by paired ttest vs pH o 7.4). Therefore, I found no evidence that any of the 16 extracellular histidine residues contribute to the pH o sensitivity of CaR.

110

A 7.4 7.4 7.6 7.4 7.2 pH o 30 + R467 (1 M) 2+ [Ca ]o (mM) 350/ 380

1.5

0 5 10 15 20 B Time (min) 0.3 ** AUC/ min ** 0.2

0.1

0 7.4 7.2 7.4 7.6 pH o

2+ 2+ Figure 3.34. The effect of pH o changes on Ca o-induced Ca i H41V H41V mobilisation for mutation CaR . A) Representative trace showing CaR 2+ transfected HEK293 cells stimulated with 3.5 mM Ca o and then exposed to pathophysiological changes in pH o. The trace shows two single cells (orange and purple) and the “global” response in the cell cluster (black). N=9. B) Quantification of the changes in AUC/min is shown as a bar chart. **P<0.01 by paired ttest N=4.

111

A 7.6 7.4 7.4 7.4 7.2 pH o 5 +R467 (1 M) 2+ [Ca ]o (mM)

1.6

350/ 380

0.8 0 5 10 15 20 B Time (min) * 0.2 AUC * /min

0.1

0 7.4 7.2 7.4 7.6 pH o

2+ 2+ Figure 3.35. The effect of pH o changes on Ca o-induced Ca i H595V H595V mobilisation for mutation CaR . A) Representative trace showing CaR 2+ transfected HEK293 cells stimulated with 3.5 mM Ca o and then exposed to pathophysiological changes in pH o. The trace shows two single cells (orange and purple) and the “global” response in the cell cluster (black). N=9. B) Quantification of the changes in AUC/min is shown as a bar chart. *P<0.05 by paired ttest N=4.

112

3.4.6 Characterisation of the extracellular calcium and pH sensitivity of the CaR double histidine mutant, CaR H429V/H495V .

Having failed to identify a sole histidine residue as being responsible for CaR pH o sensitivity, I next comutated the two histidine residues that appeared to have

H429V produced the largest trend reductions in pH o sensitivity, namely CaR and CaR H495V (see Figure 3.36). The objective was to determine whether the combined trend reductions in pH o sensitivity could achieve statistical significance. Therefore, the vector containing the CaR H429V mutant was then mutated again using the primer introducing the CaR H495V mutation so as to produce CaR H429V/H495V . Successful introduction of the H495V mutation in CaR H429V was confirmed by sequencing (Figure 3.36 panel A). Next, the double mutant was transfected into HEK293 cells and its abundant expression confirmed by immunoblotting (Figure 3.36 panel B). Exposure of cells transfected with CaR H429V/H495V to increasing concentrations of

2+ 2+ 2+ Ca o again elicited a Ca o concentrationdependent increase in Ca i mobilisation with a calculated EC 50 value similar to wildtype CaR (5.0 ± 0.4 mM N=7 vs. 4.3 ± 0.3, N=16, NS; Figure 3.36 panel C).

113

A H429V Primer: Forward: 5' AGCAGTCTACTCCATTGCC GT CGCCTTGCAAGATATATAT 3‘ H495V Primer: Forward: 5' ATTCCATCATCAACTGG GT CCTCTCCCCAGAGGATG 3

Confirmed Sequencing data: ATTGCC GT CGCCTT....TCAACTGG GT CCTCTC

Resulting Peptide sequence: wildtype LAVYSIA HALQDI…YSIINW HLSPEDG mutant LAVYSIA VALQDI…YSIINW VLSPEDG H429V B WT H495V kDa

160 CaR 140

45 β-actin C

100 wild-type % CaR activity

H429V/H495V

0 0 2 4 6 8 10 [Ca 2+ ] (mM) o Figure 3.36. Validation of the CaR mutant His429Val/His495Val. A) Forward primer used to generate the CaR H429V/H495V mutation, followed by i) in house sequencing data confirming identity of the resulting mutant vector and ii) the resulting predicted protein sequence. B) Representative CaR and βactin immunoblots obtained using lysates of HEK293 cells transiently transfected with H429V/H495V 2+ either wildtype (WT) CaR or CaR . C) Ca o concentrationeffect 2+ relationship for the same cells assayed for changes in Ca i (Fura2 ratio). Data was normalised against mean maximal WT response. N=9.

114

Having validated the expression and responsiveness of CaR H429V/H495V , its sensitivity

2+ to pH o was then tested as before, in response to 3.5 mM Ca o. However, the pH o responsiveness of CaR H429V/H495V was not significantly different to that of wildtype

CaR (Figure 3.37). In fact, the mean responses to changes in pH o were marginally elevated suggesting that the marginal decreases seen for the individual mutations were not real and were merely due to experimental variability. With no other histidine mutants exhibiting any trend changes in pH o sensitivity, it was decided not to generate any further double histidine mutations.

115

A 7.4 7.4 7.6 7.4 7.2 pH o 3.5 2+ 2.0 [Ca ]o(mM)

350/ 380

1.5

1.0

0 5 10 15 20 Time (min)

B 20 % CaR stimulation by alkalosis 10

0 WT H429V/H495V 0

% CaR -15 inhibition by acidosis

-30

2+ 2+ Figure 3.37. The effect of pH o changes on Ca o-induced Ca i H429V/H495V mobilisation for mutation CaR . A) Representative trace showing H429V/H495V 2+ CaR transfected HEK293 cells stimulated with 3.5 mM Ca o and then exposed to pathophysiological changes in pH o. The trace shows two single cells (orange and purple) and the “global” response in the cell cluster (black). N=7. B) Quantification of the changes in AUC/min is shown as a bar chart.

116

3.4.7 Characterisation of the extracellular calcium and pH sensitivity of the free C482S cysteine mutant, CaR . Finally, having established that extracellular histidine residues are unlikely to contribute pH o sensitivity to the CaR, it was noted that the pK values of free cysteine sidechains (8.5) are also similar to the physiological pH and thus could contribute to pH o sensitivity. All but one of the extracellular cysteine residues in CaR are normally oxidised and involved in intra or intermolecular binding leaving only CaR C482S assumed to be free (Zajickova et al , 2007). As a result it was decided to mutate this residue and test its pH o sensitivity as before.

Sequencing of the resulting CaR C482S mutant confirmed successful introduction of the mutation (Figure 3.38 panel A) and its expression in HEK293 cells was confirmed by immunoblotting as before (Figure 3.38 panel B). Then exposure of

C482S 2+ cells transfected with CaR to increasing concentrations of Ca o resulted in

2+ concentrationdependent Ca i mobilisation with an EC 50 not significantly different to that for wildtype CaR (Figure 3.38 panel C).

117

A C482S Primer: Forward: 5' GGTGACCTTTGATGAG AG TGGTGACCTGGTGGG 3‘

Confirmed Sequencing data: GGTGACCTTTGATGAG AG TGGTGACCTGGTGGG

Resulting Peptide sequence: wildtype NMGEQVTFDE CGDLVGNYSII mutant NMGEQVTFDE SGDLVGNYSII

B WT C482S kDa

CaR 160 140

C 45 β-actin

100 wild-type % CaR activity 50 C482S

0 0 2 4 6 8 10 [Ca 2+ ] (mM) o

Figure 3.38. Validation of the CaR mutant Cys482Ser. A) Forward primer used to generate the CaR C482S mutation, followed by i) inhouse sequencing data confirming identity of the resulting mutant vector and ii) the resulting predicted protein sequence. B) Representative antiCaR and βactin immunoblots obtained using lysates of HEK293 cells transiently transfected with either wildtype (WT) C482S 2+ CaR or CaR . C) Ca o concentrationeffect relationship for the same cells assayed 2+ for changes in Ca i (Fura2 ratio). Data was normalised against mean maximal WT response. N=9.

118

C482S 2+ Thus, having confirmed the responsiveness of CaR to moderate Ca o challenge, the effect(s) of pathophysiological changes in pH o were tested on the mutant as

C482S 2+ before. However, the pH o responsiveness of CaR in the presence of 3.5 mM Ca o was not significantly different to that of wildtype (Figure 3.39).

A 7.6 7.4 7.4 7.2 7.4 pH o 3.5 2+ [Ca ]o (mM) 1.4

350/ 380

1.0

0 5 10 15 Time (min) B 30 % CaR stimulation 20 by Alkalosis 10

0 WT C482S 0 % CaR inhibition -15 by Acidosis

-30

-45

2+ 2+ Figure 3.39. The effect of pH o changes on Ca o-induced Ca i C482S C482S mobilisation for mutation CaR . A) Representative trace showing CaR 2+ transfected HEK293 cells stimulated with 3.5 mM Ca o and then exposed to pathophysiological changes in pH o. The trace shows two single cells (orange and purple) and the “global” response in the cell cluster (black). N=7. B) Quantification of the changes in AUC/min is shown as a bar chart. 3.4.8 Summary

119

Figure 3.40 below summarises the lack change in pH o responsiveness for any of the histidine or free cysteine residues examined.

% CaR stimulation by Alkalosis 80

0 429/ Mutation WT 134 192 254 312 338 344 359 377 413 429 463 463/ 495 766 Cys 466 495 0

-25

-50 % CaR inhibition by Acidosis

Figure 3.40. Bar chart summarising the pH o sensitivity of all of the CaR histidine/cysteine mutants tested. Percentage stimulation in alkalosis (pH 7.6, upper panel) normalised against initial response to CaR stimulation in pH 7.4. Analysis by Oneway ANOVA with Dunnett’s vs. WT p>0.05. The lower panel shows the equivalent responses to acidosis (pH 7.2), normalised against 1 st 7.4 exposure.

Analysis by Oneway ANOVA vs. WT p>0.05. The dotted line indicates the pH o induced stimulation and inhibition for wildtype CaR and is shown to aid comparison.

120

3.5 Discussion

3.5.1 The effect of altered extracellular pH on the CaR in a heterologous expression system

2+ It has been demonstrated previously that the potency of Ca o for CaR is affected by the ambient pH o. Quinn et al and Doroszewicz et al have both demonstrated that large i.e. 1 unit or greater changes in pH o significantly alter the CaR’s sensitivity (Doroszewicz et al , 2005; Quinn et al , 2004). However, human blood pH is maintained between 7.35 and 7.45 and since pH is a logarithmic scale then a 1.0 unit change in fact represents a tenfold change in proton concentration and such a change in blood pH would certainly be lethal (Edwards, 2008). This led us to ask whether the CaR would respond to smaller, pathophysiologically relevant changes in pH o. Metabolic acidosis and secondary hyperparathyroidism (SHPT) are common consequences of chronic kidney disease (CKD) and senescence and thus it is worth considering whether the current data may provide a mechanistic link between the two and thus a potential therapeutic intervention.

Experiments performed in this lab previously (Figures 1.3 and 1.4) showed that small, pathophysiologically relevant (0.2) pH o unit changes significantly alter CaR sensitivity; an increase in proton concentration causing the receptor to become less sensitive to cations, while alkalosis rendered CaR more sensitive. It was observed

2+ using the Ca i indicator FURA2 that pH o alters CaR sensitivity in stably transfected CaRHEK cells and bovine parathyroid cells (McCormick, 2008), an effect known to be mediated by activation of the G q/11 /PLC pathway. CaRinduced ERK phosphorylation and actin polymerisation were also pH osensitive (McCormick,

2+ 2008), indicating that this sensitivity is not limited to G q/11 mediated Ca i mobilisation, but appears to be true for a number of G proteincoupled signals downstream of the CaR. Although these findings do not eliminate the possibility that changing pH o acts upon other cellular targets simultaneously, the simplest explanation for the data is that the alterations in pH o act via a common mechanism, namely altered agonist potency at the CaR. Furthermore, that the same pH o effects are also seen in bovine parathyroid chief cells in which CaR is expressed endogenously further supports the idea that CaR is the principal mediator of the protoninduced modulation. Indeed there is data from the laboratory of our collaborator suggesting that PTH secretion may also be affected by alterations in pH o in cultured human parathyroid cells (unpublished results).

121

Furthermore, Lopez et al observed in dogs that when ionised calcium was clamped, metabolic acidosis in which blood pH was decreased from 7.41 to 7.26 induced a significant increase in PTH levels (Lopez et al , 2004; Lopez et al , 2002). Likewise, when blood pH was increased by metabolic alkalosis, by 0.22 pH units, PTH was significantly decreased (Lopez et al , 2003). There were no changes in plasma sodium, magnesium or phosphate levels during alkalosis or acidosis (Lopez et al , 2002; Lopez et al , 2003). During EGTAinduced hypocalcaemia, PTH levels returned to normal, in both groups. These experiments show that despite ionised calcium levels remaining unchanged, changes of ≈ 0.2 pH unit in the blood significantly affect PTH secretion. These whole animal experiments demonstrated the need for us to examine small pathophysiological (0.2 pH unit) changes in pH o in vitro , so as to determine the mechanism explaining their observations.

Similar results have been reported in other studies using human and animal models. Bichara et al found significant correlation between intact PTH levels and blood proton or bicarbonate concentration (Bichara et al , 1990). Then, in healthy humans and recurrent nephrolithiasis patients, acute acid load caused a transient increase in PTH within two hours that was reversed after four hours (Houillier et al , 1996). Serum total and ionised calcium concentrations were unchanged in controls and kidney stone patients (Houillier et al , 1996). Also, as we age, our GFR decreases and we become mildly acidotic and exhibit moderately increased PTH secretion (Frassetto & Sebastian, 1996; Frassetto et al , 1996). The link between CKD and metabolic acidosis is well established [reviewed in (Frassetto & Hsu, 2009; Kovacic & Roguljic, 2003; Kraut & Madias, 2011)]; impaired proximal tubule function leads to reduced H + secretion via the sodium proton exchanger NHE3 (Pereira et al , 2009).

Another issue to consider is whether by changing pHo, we are also altering pH i and thus somehow affecting CaR downstream signalling. However, further data from this lab (McCormick, 2008) has shown that using the pH isensitive dye BCECF, altering pH o does not alter pH i in CaRHEK or bovine PT cells, over this time scale; therefore the effect of the altered pH o must be mediated extracellularly. Quinn et al showed that preincubating cells in solutions at either pH 6.5 or 8.5 and then switching to the other pH caused a change in pH i that took 15 minutes to reach steadystate (Quinn et al , 2004). However, Quinn et al then went on to show that

2+ there was no significant difference in the subsequent EC 50 (for Ca o) between cells incubated in the test pH or preincubated in a buffer 2.0 pH units different (Quinn et al , 2004). This evidence (Quinn et al , 2004) together with the current data

122

suggests that pH o exerts its effect on the ECD of the CaR rather than by modifying intracellular signalling and could therefore be either influencing agonist binding, or causing a conformational change in the receptor.

The question remains though how the CaR responds to changes to pH o in vivo . Under physiological conditions, the CaR is exposed to multiple agonists and agonist buffering agents. In order to determine if buffering of Ca 2+ and H + could compensate for changes to pH o, we repeated the same experiments in the presence of 5% albumin.

3.5.2 Potential effect of altered calcium binding to albumin following changes in pH o

In the blood, calcium is found either freeionised or bound to a buffering agent, for example citrate, phosphate, or bicarbonate, with the majority being bound to albumin (Baker & Worthley, 2002; Oberleithner et al , 1982; Toffaletti et al , 1977). Acidosis could cause calcium to become displaced by protons, thus increasing the free calcium concentration; Wang et al in found whole blood sample from healthy humans, a 0.015 mM change in ionised Ca 2+ per pH unit per litre of albumin (Wang et al , 2002). These minute changes in free ionised calcium could theoretically compensate for the acidosis by increasing the agonist concentration in the blood.

However, in the current study, the presence of 5% (w/v) albumin, i.e. representing the physiological albumin concentration, failed to overcome the apparent pH o sensitivity of the CaR. Pathophysiologically relevant 0.2 pH unit (to 7.2 or 7.6)

2+ changes in pH o still caused a significant potentiation or inhibition of Ca i release

2+ respectively versus 7.4 at a single Ca o. This demonstrates that over this pH range the effect of changing pH o on CaR activity is still greater than any effect of calcium buffering and displacement. Although these experiments do not perfectly mimic the in vivo buffering of calcium in blood, it should still be noted that the concentration of albumin used (5%) is at the upper limit of albumin normally found in the blood (KraghHansen & Vorum, 1993).

KraghHansen & Vorum offer one explanation for this, they found that between pH 6.8 to 7.4 the calcium binding affinity of albumin was not altered significantly (KraghHansen & Vorum, 1993). At pH 7.7 and greater calcium binding is increased, so that at pH 8 there is a fourfold increase in the association constant (Kragh Hansen & Vorum, 1993). Interestingly, chronic metabolic acidosis is associated with

123

protein wasting and hypoalbuminaemia, the effect this has on ionised calcium concentration in the blood is unknown, however it might be expected that less calcium would be bound in this case (Ballmer et al , 1995).

3.5.3 Potential contribution of extracellular histidine residues to CaR pH o sensitivity

Proton sensitivity has been demonstrated in a large number of proteins and the amino acid residue most commonly responsible for such pH sensitivity over the physiological range is histidine (Ghanouni et al , 2000; Sekler et al , 1996; Zong et al , 2001). As discussed previously, the histidine sidechain has the pK (6.4) that is closest to the physiological range (7.357.45) and therefore is likely to be more deprotonated than protonated at a physiological pH. There are a number of pH sensitive membrane proteins whose protonsensitivity has been ascribed to extracellular histidine residues and these are reviewed briefly here.

For example, the anion exchange protein 2 (AE2) regulates cell volume, pH and Cl

+ by exchanging Na independently for Cl /CO 3 (Stewart et al , 2007). Using chimeras, Sekler et al identified a histidinerich motif in the cytoplasmic domain that confers pH sensitivity (Sekler et al , 1996). In 2007, Stewart et al demonstrated that using the histidine mutagen diethylpyrocarbonate (DEPC) it was possible to alter AE2 pH sensitivity (Stewart et al , 2007). The group identified two histidines in particular (His1144 and His1145) that were critical for exchanger pH sensitivity (Stewart et al , 2007). The idea that multiple histidine residues contribute to pH sensitivity could be shared by the CaR; as the CaR has multiple binding sites and exhibits cooperative agonist binding. Here the effect of mutating two residues, which showed reduced (but not significantly) sensitivity to pH o was assayed, but did not abolish pH o sensitivity.

Ovarian cancer Gprotein coupled receptor 1 (OGR1) and, the closely related, GPR4 have both been identified at proton sensors. Originally described as a sphingosylphosphorylcholine receptor, Ludwig et al demonstrated (by IP formation) at pH ≥7.8 OGR1 was completely inhibited, the receptor was maximally active at pH 6.8; interestingly, at pH<6.8 the receptor becomes inhibited (Ludwig et al , 2003).

Furthermore the group identified five histidine residues that confer pH o sensitivity (His17, 20, 84, 269 169). It was hypothesised that hydrogen bonds formed between the histidines stabilise the ECD inhibiting pHdependent activation. In

124

acidic conditions, protonation destabilises the complex, causing the residues to repel, and allowing for an active confirmation. OGR1 is expressed in bone and nervous system; both OGR1 and GPR4 are expressed in the lung and kidney.

The purinergic receptor (P2X 4) has a single histidine (His286) which confers pH sensitivity (Clarke et al , 2000). Similarly to the CaR, reducing pH o inhibits current amplitude while alkalosis increased it. Sequential mutation of the four extracellular histidines to alanine demonstrated that three have function similar to WT but mutation of His286 resulted in concentrationeffect relationships that were resistant to changes in pH o (Clarke et al , 2000).

These and other examples of histidine(s) rendering a protein pH o sensitive indicated the need to investigate the sixteen extracellular histidines in human CaR as putative

2+ mediators of pH o sensitivity. The CaR has at least three postulated Ca binding sites, clusters of negatively charged amino acids in the VFT domain. Modelling the histidine residues by this lab in conjunction with Dr J Warwicker (University of Manchester) showed that there are a number of histidine residues exposed in the VFT. We originally hypothesised that these histidines are most likely to determine pH sensitivity due to their ability to become protonated over the physiological pH range (Figure 1.4 and Table 1). Increasing the acidity of the experimental buffer would protonate the histidines which could change the conformation of the calcium binding sites.

Individual mutation of each of the 16 histidine residues in the ECD of human CaR demonstrated that none of the histidines individually contribute to pH sensitivity in the human CaR. Comutation of two histidines, CaR H429V and CaR H495V, whose responses were judged to be the most insensitive to pH o, still did not abolish pH

2+ sensitivity. The experiments were conducted at a single Ca o concentration (3.5 mM

2+ Ca o); it was decided that to be truly pH oinsensitive a mutant must not change

2+ sensitivity in the presence of increasing or decreasing pH o. Using a single Ca o concentration enabled us to compare receptors under the same conditions as they should all be activated to a similar degree. The two exceptions (CaR His41Val and CaR His595Val ) showed no 160kDa immunoblot band and did not respond to

2+ physiological Ca o and were dealt with separately in order to determine if they were pH o sensitive. A calcium concentration below the WTCaR EC 50 value was used, as preliminary experiments indicated that this would better allow us to compare both

2+ alkaline and acidic responses during the same experiment. Using a higher Ca o concentration made it difficult to perceive a change during alkalosis. The stimulation

125

by alkalosis is much smaller than the inhibition by acidosis; this may indicate that the receptor is more susceptible to inhibition by protonation, than potentiation by alkalosis. It may also reflect the fact that at pH 7.4 the histidine sidechain is already more likely to be deprotonated than protonated and therefore larger increases in

2+ pH o may be required to evoke changes in Ca i mobilisation equivalent in magnitude to the decrease in mobilisation elicited by lowering pH o.

In discussions with Dr Geoffrey Hendy (McGill University, Canada), it was realised that cysteine 482 is a free residue, which is unconserved in mammals and is not involved in inter or intramolecular binding, and therefore its –SH sidechain could also be susceptible to deprotonation over the physiological pH range (Zajickova et al , 2007). Furthermore, mutation of Cys482 did not disrupt PI hydrolysis or membrane expression (Fan et al , 1998; Ray et al , 1999). As a result, the pH sensitivity of this site was also investigated however its mutation to serine also failed to alter CaR pH osensitivity. For the remaining extracellular cysteine residues to have even a theoretical role in pH o sensitivity they would need to become spontaneously reduced under physiological conditions. However, there is no evidence to date that such reductions might occur and in any case extracellular conditions are generally much less reducing than intracellular conditions.

Thus together, the data presented in this thesis tend to suggest that neither the 16 extracellular histidine residues in CaR nor CaR C482 are responsible for the receptor’s pH o sensitivity. While it is possible that comutation of particular histidine residue combinations may prove more successful, comutation of the two histidines that did show the greatest promise failed to alter pH o sensitivity and therefore this does not appear a promising strategy to pursue, especially given the potential numbers of histidine combinations (including 240 possible paired combinations and 3,360 possible triple combinations).

3.5.4 Extracellular pH sensitivity exhibited by the mGluRs

With regards the homologous metabotropic glutamate receptor family, mGluR4a has also been shown to be sensitive to changes in pH o (Levinthal et al , 2009). Increasing acidity inhibits the receptor while alkalinity potentiates its agonist response. Levinthal et al hypothesised that as the inhibition could not be surmounted by increasing agonist concentration, the inhibition is noncompetitive, and therefore the pH sensitivity was rendered either by a separate proton binding

126

site or nonconserved region (Levinthal et al , 2009). In contrast, no pH osensitivity was found for mGluRs 1a, 5d or 8b. Nevertheless, with mGluR4a exhibiting pH o sensitivity I employed basic local alignment search tool (BLAST) and a constraint based multiple protein alignment tool (COBALT) to identify conserved sequences between the human CaR and mGluRs (1a, 4a, 5d and 8b) (table 3.2) (Altschul et al , 1990; Papadopoulos & Agarwala, 2007). Interestingly, one histidine residue was conserved between all 5 receptors, namely histidine 41, whereas a second residue histidine 429 was conserved only between human CaR and mGluRs 1a and 4a. However, none were shared exclusively between the pHsensitive receptors, CaR and mGluR4a. This suggests that histidine conservation cannot explain pH sensitivity between these class C GPCRs.

CaR mGluR1 mGluR4 mGluR5 mGluR8 41 PI H FG SV H HQ PV H -- SV H HQ PV H --- 429 IA H AL MA H GL MG H AL

Table 3.2. Conservation of histidine between CaR and mGluRs. The NIH Constraintbased multiple protein alignment tool (COBALT) was used to identify conserved histidine residues between Homo sapiens isoforms of CaR, mGluR1, 4, 5 and 8, with a 2 bit conservation setting. Histidine41 was conserved between all the receptors and histidine429 between only CaR, mGluR 1 and 4.

3.5.5 pH sensitivity of non-elemental CaR agonists.

Although the potency of elemental CaR agonists is not subject to pH omediated changes in their charge, the potencies of certain other CaR agonists may be influenced by pH o. For example, Quinn et al used the polycation spermine to stimulate the CaR, and pH o sensitivity was reversed; receptor sensitivity was propagated by acidosis and inhibited by alkalosis (Quinn et al , 2004). The same phenomenon was demonstrated using aminoglycoside antibiotics (AGAs) which appeared to reverse pH sensitivity (McLarnon et al , 2002). Specifically, McLarnon et al showed that the CaR potency of tobramycin, which has 5 amine groups, was left ward shifted by increasing acidity, (McLarnon et al , 2002). The ability of positive ionic charges to overcome the inhibition by acidity implies that either these agonists have a separate binding site which is not affected by pH or the positive effect on the agonists charge is greater than the negative effect on the receptor itself. It would be interesting to know the effect of pH on Lamino acids, as they have been show to use an alternative binding site and are able to undergo protonation. For example, L phenylalanine has only one free amine group that could be protonated, therefore it is

127

questionable whether the ionic strength could overcome the inhibition by pH o. As the Lamino acids bind to a different site pH may not affect activity.

3.5.6 pH o sensitivity of CaR mutants

In order to determine the site responsible for pH sensitivity, Quinn et al investigated the activities of five CaR mutants expressing activating mutations (Quinn et al , 2004). It was stated that the activating mutations that had the greatest decrease in

EC 50, were least affected by pH o whereas those mutations with EC 50 s closest to that for WTCaR were most affected by pH o. Quinn et al surmised that the increased activity of each mutant was due to increased pH sensitivity i.e. they would be more activated by alkalinity than would the WTCaR (Quinn et al , 2004) however no information about expression was presented with this study.

Interestingly, Quinn et al demonstrates that the mutation CaR C129F appears to be least affected by pH o, over the full experimental range (5.59.5) (Quinn et al , 2004). This site in the VFT is vital for dimerisation, and its mutation has previously been

2+ shown to cause a leftward shift in the Ca o concentrationeffect relationship (Ray et al , 1999; Zhang et al , 2001). Therefore, dimerisation and the close interaction of two

ECDs might participate in pH o sensitivity.

Quinn and coworkers also showed that mutating the same residue to different amino acids can drastically alter the outcome (Quinn et al , 2004). Mutation of glutamate 127 to lysine, which is positive at physiological pH, causes the greatest change in EC 50 , and is the most activating, however mutation E127 to alanine, which is nontitratable, is only moderately activating (Quinn et al , 2004). The act of mutating glutamate, a negatively charged amino acid, with anything but aspartate is likely to alter CaR activity. Valine and serine are both nontitratable and should not be influenced by changes in pH o, therefore they are good candidates for sitedirected mutagenesis of putative pH o sensitive residues. Nevertheless it should be noted that valine is ‘smaller’ than histidine and could change receptor conformation, or interactions with neighbouring amino acids.

3.5.7 Physiological relevance of extracellular pH sensing

As previously discussed, the discovery of specialised protonsensors (OGR1 and GRP4), had led to increased interest in pH homeostasis. A number of body systems

128

such as bone, the immune system and cardiovascular system are sensitive to fluctuations in blood pH and thus it is clear that proton homeostasis is vital to our health. The current study is part of a wider study proving for the first time that the pH o sensitivity of the CaR provides for pH osensitivity of the parathyroid gland itself.

The CaR is expressed in pancreatic exocrine acini and luminal ductal cells and endocrine islet of Langerhans (Bruce et al , 1999). It was suggested that in the luminal ducts, the CaR senses calcium released with pancreatic enzymes, which stimulates bicarbonate and ductal fluid secretion (Bruce et al , 1999; Racz et al ,

2+ 2002). Activation of the CaR by Ca o stimulates HCO 3 and fluid secretion

2+ neutralising and diluting the Ca o. This would protect against pancreatic stone formation and pancreatitis (Bruce et al , 1999; Racz et al , 2002). Furthermore, sufferers of FHH (inactivating CaR mutation), have a predisposition to pancreatic stone formation (Bruce et al , 1999). This would generate positive feedback and neutralise the acidic more efficiently and providing an antilithogenic benefit in the pancreas (Hegyi et al , 2011).

One site of CaR expression in the kidney is in the CCD, where it induces luminal proton secretion via the H +ATPase (Farajov et al , 2008). In the IMCD principal cells, the CaR limits vasopressininduced water reabsorption via AQP2 (Sands et al , 1997). In this context, pH sensitivity would appear to be counterproductive as secreting excess protons would decrease CaR sensitivity and therefore proton secretion, increasing the occurrence of kidney stones (Renkema et al, 2009). However, increasing proton concentration in the urine would also increase the free calcium concentration by dissolving calcium salts which could compensate for the acidosis and activate the CaR maintaining the nephrolithiasis protective mechanism.

Chronic metabolic acidosis is associated with chronic kidney disease, ageing and even a Western diet (Frassetto et al , 1996; Kopple et al , 2005; Kovacic & Roguljic, 2003; Lemann, 1999). In CKD and during senescence, reduced kidney function leads to gradual acidosis (see Introduction). There are also a number of acute causes of acidosis including; diarrhoea, diabetes mellitus and diuretics (Edwards, 2008). Renaldependent chronic metabolic acidosis is caused by decreased proton excretion and bicarbonate reabsorption. Bicarbonate is primarily reabsorbed in the PCT via an electroneutral process; carbonic acid is formed within the cells which dissociates to

+ H and HCO 3 . Protons leave the cells across the apical membrane via NH3, a sodium/proton exchanger; the bicarbonate and sodium then leave the cell across the basolateral membrane via the NBC2 (Pereira et al , 2009; Rodríguez Soriano, 2002).

129

Bicarbonate reabsorption is under the control of a number of factors including calcium and PTH concentration (Rodríguez Soriano, 2002). The inability to excrete protons in exchange for bicarbonate causes acidification.

Metaanalysis of twentysix studies found a positive correlation between age and blood proton concentration; and age dependent decrease glomerular filtration rate (GFR) (Frassetto & Sebastian, 1996; Frassetto et al , 1996). A Western diet may also facilitate acidosis, high vegetable to animal protein ratio diets are known to support acidosis (Frassetto & Kohlstadt, 2011; Kurtz et al , 1983). Vegetables are high in bicarbonates which reduces the net acid load, protecting against chronic acidosis. Interestingly countries with a high vegetable to animal protein diet had the lowest hip fracture incidence (Frassetto et al , 2000). Over time, low blood pH can cause bone decalcification, as the body compensates for the increased protons by releasing calcium salts.

The biggest reservoir of calcium in the body is bone. CKD is strongly associated with osteodystrophy, which causes bone demineralisation, osteopenia and metastatic calcification (Kovacic & Roguljic, 2003). Patients with CKD cannot catalyse the synthesis of 1,25 dihydroxyvitamin D3, which leads to hypocalcaemia and SHPT, in combination with metabolic acidosis these factors cause calcium to be reabsorbed from the bone (Cibulka & Racek, 2007; Kovacic & Roguljic, 2003). Vascular calcification in CKD patients affects the medial wall and tunica media artery walls (Goodman et al , 2004). This restricts the artery’s ability to stretch and respond to changes in blood pressure (Goodman et al , 2004). The process of bone demineralisation is mediated by osteoblasts and osteoclasts; culturing mouse osteoclasts and osteoblasts demonstrated that in acidic conditions, osteoblasts are inhibited while osteoclasts are activated (Krieger et al , 1992). According to the current hypothesis, the metabolic acidosis of CKD may further act to inhibit the parathyroid CaR and promote PTH secretion which would exacerbate SHPT and drive further bone demineralisation and vascular calcification. Interestingly, Oka et al have recently reported that prehaemodialysis bicarbonate blood concentrations are significantly associated with coronary artery calcification in haemodialysis patients (Oka et al , 2012). Therefore, it will be interesting to know whether treating acidosis more aggressively in haemodialysis than is the case at present might improve cardiovascular outcomes in CKD.

Like acidosis, metabolic alkalosis is also a serious pathology. Ingestion of large quantities of calcium and alkali can develop milkalkali syndrome (Felsenfeld &

130

Levine, 2006). Alkalosis has been shown to activate the CaR and suppress PTH secretion in dogs (Doroszewicz et al , 2005; Lopez et al , 2003; Quinn et al , 2004). In combination with hypercalcaemia, alkalosis would further suppress PTH secretion leading to hypoparathyroidism.

3.5.8 Summary

In conclusion, CaR activity is sensitive to pathophysiologically relevant (0.2 pH unit) changes in pH o which can affect PTH secretion. Albumin does not compensate for the increase in protons by increasing the free calcium concentration and none of the extracellular histidines or free cysteines are responsible for conferring pH sensitivity on CaR. Together, these observations may have relevance to a number of high incidence conditions that lead to chronic metabolic acidosis, including diabetes, hypertension and senescence. In combination with other factors, acidosis may increase PTH secretion and bone demineralisation potentially leading to vascular calcification and other complications. Knowledge of the progression of the disease may lead to improved therapeutics and improved prognosis.

131

Chapter 4

Calcium-sensing receptor intracellular signalling integration

132

4.1 Introduction

Although the involvement of PKC in CaR signalling has been well established (Bai et al , 1998b; Davies et al , 2007; Jiang et al, 2002; McCormick et al ; Racke & Nemeth, 1993), the function of the putative PKA sites and role of cAMP signalling in CaR function is less clear. In this chapter, the effects of cAMP and PKA modulators on

2+ Ca i mobilisation will be described and discussed. This will include determining the effects of mutating the putative PKA phosphorylation sites within CaR as well as altering Gimediated signalling.

4.2 Materials and Methods

CaRHEK cells were cultured as detailed in section 2.1. Intracellular calcium imaging (section 2.6), immunoblotting (section 2.5) and sitedirected mutagenesis (section 2.7) were performed as described in the sections named. Sitedirected mutagenesis employed the primers listed in section 2.7.1 and the resulting mutations were sequenced to ensure identity. If appropriate unconstrained sigmoidal dose response curve fitting was used.

4.3 Effect of increasing intracellular cAMP on CaR signalling in a heterologous expression system

2+ 4.3.1 Effect of forskolin addition during CaR-induced Ca i mobilisation

Gerbino et al published data which showed that in CaRHEK cells stimulating cAMP

2+ generation, using PGE2, enhanced sperminestimulated Ca i oscillations (Gerbino et al , 2005). To confirm and expand upon their findings, CaRHEK cells loaded with

2+ the ratiometric dye, Fura2, were first incubated in buffer containing 0.5 mM Ca o

2+ and then exposed to buffer containing 3.5 mM Ca o which resulted in the induction

2+ of Ca i oscillations. Cells were then treated with forskolin (FSK) (10 M) to activate adenylate cyclase (AC) and increase intracellular cAMP. Acute treatment with FSK

2+ caused a significant increase in Ca i mobilisation; observed as an increase in amplitude and frequency of the oscillations (Figure 4.1 panel A), that continued until

2+ Ca o and FSK were removed. Quantification of the change in fluorescence ratio revealed a significant increase in CaR activity upon addition of FSK (* P<0.05 vs. 3.5

2+ mM Ca o by paired ttest ; N=5; Figure 4.1 panel B).

133

3.5 2+ A 0.5 0.5 [Ca ]o FSK (mM) 1.7

350/ 380 1.3

0.9 0 5 10 15 Time (min) * B 3 AUC Min -1 1.5

0 FSK

2+ - 2+ Figure 4.1. Effect of forskolin in 3.5 mM Ca o induced Ca i- 2+ mobilisation. A) Representative trace showing the Ca i changes (Fura2 ratio) in two single cells (orange and purple) and “global” cluster (black) of CaRHEK cells. 2+ Cells were exposed to a single Ca o concentration (3.5 mM) followed by exposure to forskolin (10 M), B) Quantification of the change in area under the curve/min (as explained in section 2.11) following the addition of FSK.* P<0.05 by paired ttest, N = 5.

2+ 2+ 4.3.2 Effect of forskolin on CaR-induced Ca i mobilisation at sub-threshold Ca o concentrations

2+ 2+ In 3.5 mM Ca o, the G q/PLC pathway is activated initiating Ca i oscillations.

2+ However, at calcium concentrations that do not initiate Ca i oscillations (<2 mM), it is known that G 12/13 is active and Rho kinase is able to polymerise actin (Davies et al ,

2+ 2006). This would imply that there are Ca o concentrations capable of activating

2+ CaR signalling but not specifically Ca i mobilisation, and thus that the CaR is

2+ somehow prevented, or inhibited, from initiating Ca i oscillations. Therefore, it was

134

next determined whether increasing intracellular cAMP concentrations could permit

2+ 2+ the initiation of Ca i oscillations even at low (<2 mM) Ca o concentrations.

2+ Here, I will refer to ‘threshold’ Ca o concentrations as those which are the minimum

2+ necessary to elicit Gq/11 mediated,CaRinduced Ca i mobilisation, although it should be noted throughout that strictly speaking the true CaR threshold is lower given that

2+ CaRinduced actin polymerisation occurs at lower Ca o concentrations. Therefore

2+ my use of the term will relate to Ca i mobilisation unless otherwise stated. Then

2+ 2+ having defined the Ca o threshold concentration, I will also refer to the Ca o

2+ subthreshold concentration as being the highest Ca o concentration in which ≈95%

2+ of cells remain unresponsive, that is, that fail to mobilise Ca i.

Because of experimental variability between cells and buffers etc., it was necessary to

2+ determine empirically the Ca o threshold concentration for each coverslip. To

2+ achieve this, CaRHEK cells were exposed to decreasing Ca o concentrations in 0.2

2+ 2+ mM steps starting at 2 mM Ca o. In 2 mM Ca o it was normal to see ≈60% of cells

2+ 2+ exhibiting either transient or even oscillatory Ca i mobilisation. Reducing Ca o

2+ concentration to 1.8 or even to 1.6 mM decreased Ca i mobilisation until ≈95% of cells were unresponsive. Even then, baseline 350/380 ratios were modestly elevated relative to 0.5 mM however this is seen even in nontransfected HEK293 cells and thus is unlikely to be specifically CaRdependent (Nemeth, 2004). Having

2+ established the threshold Ca o concentration, cells were then returned to buffer

2+ containing 0.5 mM Ca O concentration in order to reequilibrate the cells for the experiment. After 35 minutes, the cells were then exposed to the empirical

2+ “subthreshold” Ca o concentration (usually either 1.6 or 1.8 mM) for at least 3 minutes during which time it was confirmed that ≈95% of cells remain unresponsive. At this point, addition of FSK (10 M) to the buffer resulted in

2+ 2+ significant Ca i mobilisation; (***P<0.001 vs. threshold Ca o by paired ttest, N=6;

Figure 4.2). This suggests that forskolin somehow increases CaRGq/11 sensitivity

2+ 2+ thus permitting Ca i mobilisation at subthreshold Ca o concentrations.

135

A subthreshold [Ca 2+ ] 0.5 0.5 o (mM) FSK

1.3 350/ 380 1.1

0.9 0 5 10 15 Time (min) B *** 0.2 AUC Min -1

0.1

0 FSK

2 + Figure 4.2. Forskolin-induced increase in Ca i oscillations in threshold

2+ 2+ Ca o. A) Representative trace showing the Ca i changes (Fura2 ratio) in two single cells (orange and purple) and global cluster (black) of CaRHEK cells. Cells exposed

2+ to a single Ca o concentration (threshold 1.61.8 mM) followed by forskolin (10 M) exposure, B) Quantification of the change in area under the curve/min following the addition of FSK. ***P<0.001 by paired ttest, N = 6.

2+ 4.3.3 Effect of 1,9-dideoxyforskolin on CaR-induced Ca i mobilisation at

2+ subthreshold Ca o concentrations

2+ In order to determine the specificity of the forskolin action on Ca o mobilisation, the experiment was repeated first using the inactive forskolin analogue, 1,9

2+ dideoxyforksolin. In the presence of subthreshold Ca o concentration, exposure to 10 µM 1,9dideoxyforksolin was without effect whereas subsequent exposure to 10

2+ µM forskolin significantly increased Ca i mobilisation as before (**P<0.01 by repeated measures ANOVA, Dunnett’s post test, N=8; Figure 4.3).

136

subthreshold 2+ A 0.5 0.5 [Ca ]o (mM) 1,9FSK FSK 1.4

350 1.2 /380 1

0.8 Time 0 5 10 15 (min) B ** 0.2 AUC Min -1 0.1

0 Subthreshold 2+ Ca o 1,9 Di-FSK FSK

Figure 4.3. Calcium oscillations are not potentiated using the forskolin inactive analogue 1,9-dideoxyforksolin . A) Representative trace of FURA2 2+ loaded CaRHEK cells, exposed to subthreshold Ca o and then 1,9 dideoxyforskolin (10 M) was added. This was then washed out and cells were returned to 2+ subthreshold Ca o only before being exposed to forskolin (10 M). B) Quantification of the changes in AUC following each treatment. Comparing the treatments showed a significant increase in AUC with forskolin (** P<0.01, Repeated measures ANOVA and Dunnett’s Post Hoc test. N=8).

137

2+ 2+ 4.3.4 Effect of forskolin on CaR-induced Ca i mobilisation at low Ca o concentration

2+ 2+ To determine whether forskolin stimulates Ca i mobilisation regardless of Ca o

2+ concentration, CaRHEK cells were next incubated in 0.5 mM Ca o concentration

2+ and then cotreated with 10 M forskolin. At this low Ca o concentration, forskolin

2+ was largely without effect (Figure 4.4). The transient rise in Ca i concentration seen in Figure 4.4 most likely represents a change artefact as this was not observed in the replicates.

2+ 0.5 [Ca ]o (mM) FSK

1.7 350/ 380 1.4

1.1

0.8 0 5 10 Time (min)

2 + Figure 4.4. Forskolin-induced increase in Ca i oscillations in baseline 2+ 2+ Ca o. A) Representative trace showing the Ca i changes (Fura2 ratio) in two single cells (orange and purple) and global cluster (black) of CaRHEK cells. Cells exposed 2+ to a single Ca o concentration (0.5 mM) followed by forskolin (10 M)

2+ 4.3.5 Effect of forskolin on CaR-induced Ca i mobilisation as a function of concentration

2+ To determine the concentration dependence of forskolin on CaRinduced Ca i

2+ mobilisation, CaRHEK cells were next incubated in 3 mM Ca o concentration and then exposed to increasing concentrations of forskolin (10 nM50 M). Forskolin

2+ elicited a significantly greater increase in CaRinduced Ca i mobilisation when used at 10 µM as opposed to 1 µM (*** P<0.001, N=4; Figure 4.5). Increasing the forskolin concentration further to 50 µM, was without additional effect (NS), confirming that 10 µM forskolin is the optimal drug concentration.

138

3 2+ 0.5 0.5 Ca o A (mM) 10 50 0.1 1 0 0.01 FSK (M) 1.5 350/ 380 1.3

1.1

0.9 Time 0 10 20 30 40 (min) B 130 * *

% of 110 baseline response 90

70 0 1 2 3 4 5 Log [FSK] (nM)

2+ Figure 4.5. Effect of increasing forskolin concentrations on Ca i 2+ mobilisation in moderate Ca o. A) Example trace of CaRHEK cells exposed to 2+ moderate Ca o (3 mM) followed by increasing forskolin concentration (10 nM50 M). Single cells (orange and purple) and ‘global’ response (black) lines. B) Data was normalised against zero forskolin results for each experiment. * P<0.05 by Oneway ANOVA vs. 10 nM forskolin; N=4. R² = 0.76.

2+ 4.3.6 Effect of forskolin on CaR-induced Ca i mobilisation as a function of extracellular calcium concentration

Next, to determine whether forskolin causes a general increase in CaR sensitivity to

2+ 2+ 2+ Ca o concentration, concentrationeffect curves were generated for Ca o on Ca i mobilisation in the presence or absence of 10 µM forskolin. In the presence of

2+ 2+ forskolin, there was a significant increase in Ca o potency for CaRinduced Ca i mobilisation (EC 50 , 3.0 ± 0.1 mM control, 2.3 mM ± 0.1 mM +forskolin; Figure 4.6)

139

as exhibited by a leftward shift in the concentrationeffect curve. However, forskolin

2+ 2+ did not alter the maximal response of the Ca o (at 5 mM) for Ca i mobilisation.

A i) control ii) Forskolin

2+ [Ca ]o(mM) 5 5 3 0.5 1.6 2 3 0.5 1.2 1.6 2 0.5 1.2 0.5 1.6 1.6 350/ 1.4 380 1.4

1.2 1.2

1 1 0 5 10 15 20 0 5 10 15 Time (min) B 100 % Max WT Response 50

0 0 1 2 3 4 5 [Ca 2+ ] (mM) o Figure 4.6. Effect of forskolin on concentration–effect curve. Panel A) example traces of i) Control CaRHEK cells or ii) Forskolin (10 M) treated CaR 2+ HEK cells exposed to increasing concentrations of Ca o (0.55 mM), orange and 2+ purple single cells and ‘global’ response to changes in Ca o. Panel B) Response to 2+ Ca o changes normalised against wildtype maximal response (wildtype – black, forskolin treated – orange). EC 50 was significantly leftward shifted 3.0 ± 0.1 mM control vs. 2.3 ± 0.1 mM P<0.05, N=6.

140

2+ 4.3.7 Effect of 3-isobutyl-1-methylxanthine on CaR-induced Ca i mobilisation at

2+ subthreshold Ca o concentrations

The simplest explanation for the actions of forskolin described in Sections 4.3.2 and 4.3.3 is that it increases intracellular cAMP levels and that this somehow lowers the

2+ 2+ CaR Ca o threshold for mobilising Ca i mobilisation. Another way of increasing intracellular cAMP concentration is to suppress its breakdown by inhibiting phosphodiesterases (PDEs), using xanthenes for example. Therefore, I next tested

2+ the effect of 3isobutyl1methylxanthine (IBMX) on CaRinduced Ca i mobilisation

2+ at subthreshold Ca o concentrations. As before, CaRHEK cells were exposed to

2+ their subthreshold Ca o concentration and then cotreated with the PDE inhibitor,

2+ IBMX (100 M). The IBMX significantly increased CaRinduced Ca i mobilisation

2+ 2+ at this subthreshold Ca o concentrations (***P<0.001 vs. threshold Ca o by paired

2+ ttest , N=8, Figure 4.7). Removal of IBMX resulted in the rapid return of Ca i concentration to baseline levels again. That IBMX broadly mimics the effect of FSK on CaR threshold responsiveness further supports the idea that cAMP somehow

2+ sensitises the CaR to Ca o.

141

subthreshold 2+ A 0.5 0.5 [Ca ]o (mM) IBMX

1.75 350/ 380 1.25

0.75 Time 0 5 10 (min) B ***

0.1 AUC Min -1

0 IBMX

Figure 4.7. IBMX-induced increase in calcium mobilisation in threshold 2+ 2+ Ca o. A) Example trace of Fura2 loaded CaRHEK cells exposed to 0.5 mM Ca o to 2+ 2+ establish baseline, this was increased to subthreshold Ca o, Ca i increased but no oscillations are observed. The PDE inhibitor IBMX (100 M) was then added 2+ 2+ inducing Ca i oscillations. B) Quantification of the change in AUC comparing Ca o only and addition of IBMX. IBMX significantly increased AUC. *** P<0.001 by paired ttest, N= 8.

4.3.8 Effect of forskolin cotreatment on CaR-induced ERK phosphorylation

Phosphorylation of the MAP kinase ERK by MEK is a well established readout of

CaR activation and is downstream not only of G q, but also G i (Kifor et al , 2001). As

2+ demonstrated above (section 4.3.2), increasing cAMP significantly increases Ca i

2+ mobilisation at Ca o concentrations ranging from subthreshold up to submaximal (~1.6~3 mM). It has been found by this laboratory (unpublished observation) and

2+ shown by Davey et al that the Ca o concentrationeffect relation for ERK

2+ phosphorylation is significantly rightward shifted in comparison to that for Ca i mobilisation (Davey et al , 2012). Therefore, in order to determine if the effect of

2+ cAMP is specific for Ca i mobilisation or also observed for other CaR effectors, the

142

2+ effect of FSK on Ca o–induced ERK phosphorylation was then studied. Firstly, to

2+ determine at which concentration of Ca o to test the FSK, CaRHEK cells were

2+ exposed to a range of Ca o concentrations from 0.55 mM and lysed with RIPA buffer and assayed for ERK phosphorylation using a phosphospecific antiERK antibody (pERK). The resulting pERK immunoblots showed little or no p42/44 kDa

2+ pERK immunoreactivity following exposure to 0.5, 1, 2 or 3 mM Ca o, whereas

2+ phosphoprotein bands were visible in lane with Ca o ≥4 mM (Figure 4.8).

2+ Therefore, it was decided that FSK would be tested in the presence of 3 mM Ca o to determine if FSK could elicit a response not caused by 3 mM alone.

2+ Accordingly, CaRHEK cells were exposed to 3 or 5 mM Ca o in the presence or

2+ absence of 10 µM FSK. As before, no pERK bands were detected in 3 mM Ca o in the absence of forskolin, whereas forskolin cotreatment did elicit ERK phosphorylation

2+ (*P<0.05, N=5; Figure 4.8). In contrast, the response to 5 mM Ca o was not elevated by forskolin cotreatment. Total ERK abundance was not elevated following

2+ 10min exposure to either forskolin or increased Ca o concentration (not shown). Together these data support the idea that increasing cAMP increases CaR sensitivity

2+ more generally and is not specific to Ca i mobilisation.

143

A 2+ kDa 0.5 2 3 4 5 Ca O (mM)

44 P-ERK 42

0.5 3.0 5.0 2+ B i Ca O (mM) kDa - - + - + FSK (10 M) 44 42 P-ERK

B ii 2×10 5 *

1x10 5

0 FSK

2+ Figure 4.8. Effect of Ca o and forskolin increase ERK phosphorylation. A, Representative immunoblot showing dosedependent ERK phosphorylation in 2+ increasing Ca o (0.5 5 mM) N=3. B I, Representative immunoblot showing addition 2+ of FSK in 3 mM and 5 mM Ca o. B ii) Quantification of the effects of forskolin on

ERK phosphorylation.* P<0.05 by paired ttest N=3. .

2+ 2+ 4.3.9 Effect of chronic phorbol ester pretreatment on Ca o–induced Ca i mobilisation

It is well established that overnight exposure of most cells to the phorbol ester PMA elicits downregulation of the classic and novel PKC isotypes thus permitting acute experiments to be undertaken in the presence or absence of these proteins. Specifically, it has been previously shown by this laboratory that such chronic

2+ exposure of CaRHEK cells to PMA increases CaR sensitivity to Ca o for the

2+ mobilisation of Ca i (Davies et al , 2007; Handlogten et al , 2001). As a result, the

2+ 2+ threshold concentration of Ca o for Ca i mobilisation is lowered following PMA pretreatment, presumably because there is less inhibitory phosphorylation by PKC on the CaR ICD including Thr888 (McCormick et al , 2010).

144

Thus, to determine whether the forskolin response occurs via PKC signalling, CaR HEK cells were chronically exposed to PMA (1 M , 18hours), and then treated with

2+ or without forskolin 10 M at a threshold Ca o concentration. Firstly, as expected

2+ 2+ PMA pretreatment lowered the threshold Ca o concentration necessary for Ca i mobilisation, to 1.4 mM in the experiment shown (Figure 4.9). It was noted that the

2+ 2+ Ca i responses of the PMApretreated cells to increased Ca o concentration were largely sustained in nature as opposed to the transient or oscillatory responses generally observed without PMA pretreatment. Next, for PMApretreated cells

2+ incubated in a threshold Ca o concentration, addition of forskolin resulted in a

2+ further elevation in Ca i mobilisation (**P<0.01 vs. nonPMA FSK treated cells, N=10; Figure 4.9). This effect was fully reversed upon removal of forskolin and

2+ elevated Ca o concentration. Therefore, PMA pretreatment failed to abolish the stimulatory effect of forskolin.

145

A subthreshold 2+ 0.5 0.5 [Ca ]o (mM) FSK

1.4 350/ 380 1.2

1.0 Time 0 5 10 15 (min) B *** 0.2 AUC Min -1

0.1

0 FSK

Figure 4.9. Effect of chronic phorbol ester pretreatment on threshold intracellular Ca 2+ responses. A) CaRHEK cells were pretreated for 16 hours 2+ with PMA (1 M) and exposed to forskolin (10 M) in a threshold Ca o changes in intracellular calcium were measured (FURA2 ratio),. Representative trace of two separate cells (orange and purple) and global cluster of cells (black). B, Addition of forskolin caused a significant increase in AUC /min compared to control. *** P<0.001 by paired ttest, N = 10.

2+ 2+ 4.3.10 Effect of pertussis toxin pretreatment on Ca o–induced Ca i mobilisation

CaR activation is known to result in G imediated inhibition of AC with a resulting reduction on cytosolic cAMP levels. Therefore, in experiments examining the effect

2+ of forskolin in CaRHEK cells at various Ca o concentrations, the cAMP levels will most likely be increased by the forskolin but inhibited by the G i activation resulting in a competitive interaction between the two components. To examine the likely

2+ contribution to Ca i mobilisation of cAMP suppression by CaRinduced G i activity, CaRHEK cells were pretreated overnight with pertussis toxin (PTx) as this is known to block G i signalling via ADPribosylation. Next, cells were exposed to increasing

146

2+ 2+ concentrations of Ca o and the resulting changes in Ca i mobilisation quantified (Figure 4.10) and compared to those from control cells not preexposed to PTx.

The resulting concentrationeffect curves were normalised against the average

2+ maximal response of control CaRHEK cells to high Ca o concentration. It was

2+ 2+ found that for PTXtreated cells, the E max for Ca o–induced Ca i mobilisation was significantly greater than for control cells (**P<0.01, 100% ± 14% cont. vs. 216% ±

2+ 21% PTx treated; N=8, Figure 4.10). In fact, the EC50 for Ca o was not significantly different in PTxtreated cells as compared to control cells (EC 50 3.0 mM ± 0.3 control vs. 1.9 mM ± 0.1 PTx treated) but because of the significantly elevated E max , the response to 1.6 mM was significantly greater in PTxtreated cells (*P<0.05 by oneway ANOVA. N≥4) than in control cells.

147

A i) control ii) PTx

2+ [Ca ]o(mM ) 5 3 5 2 3 0.5 1.6 2 0.5 1.2 1.6 0.5 1.2 2.5 0.5 2.0

350/ 2.0 380 1.5 1.5

1.0 1.0

0 10 20 0 10 20 Time (min) * B 200 % Max WT Response

100

0 1 2 3 4 5 2+ [Ca ]o(mM )

2+ Figure 4.10. Effect of pertussis-toxin on Ca o concentration–effect curve. Panel A) example traces of i) Control CaRHEK cells or ii) Pertussistoxin 2+ (100 ng/ml) treated CaRHEK cells exposed to increasing concentrations of Ca o 2+ (0.55 mM), orange and purple single cells and ‘global’ response to changes in Ca o. 2+ Panel B) Response to Ca o changes normalised against wildtype maximal response

(wildtype – black, pertussis toxin treated – orange). * P<0.05 EMAX by Oneway ANOVA N=8.

Then, to determine whether forskolin responses can be increased further by removing G imediated AC suppression, cells incubated overnight in the absence or

2+ presence of PTx were exposed to a threshold Ca o concentration and then additionally to 10 µM forskolin. Interestingly however, PTx pretreatment did not further increase the forskolin response as might have been expected (Figure 4.11). However, whether a lower i.e. submaximal forskolin concentration would have achieved an enhanced effect following PTx was not further tested.

148

A [Ca 2+ ] 0.5subthreshold 0.5 o (mM) 3 FSK

350/ 380 2

1 Time 0 5 10 15 (min) B 0.4

AUC Min -1

0.2

0 PTx FSK

Figure 4.11. Forskolin induced intracellular calcium mobilisation with chronic pertussis treatment. A) Representative trace showing CaRHEK cells treated with pertussis toxin (100ng/ml) for 16 hours, and then with forskolin (10 M). Changes in intracellular calcium mobilisation was measured as before (FURA2), two cells (orange and purple) and global cluster of cells (black) are depicted. B) Quantification of the change in calcium mobilisation as area under the curve/min. p>0.05 vs. control cells by Student’s ttest, N=6.

2+ 4.3.11 Effect of isoproterenol on CaR-induced Ca i mobilisation at subthreshold

2+ Ca o concentrations

Having shown that the drug forskolin can increase CaR sensitivity at subthreshold

2+ Ca o concentrations, it was then necessary to determine whether endogenous stimulation of cAMP generation elicits the same effect. For this, the βadrenoceptor agonist isoproterenol was used in order to induce Gsmediated AC activation and

2+ cAMP generation but with causing Ca i mobilisation.

149

2+ Fura2loaded CaRHEK cells were exposed to subthreshold Ca o concentrations, as previously described. Addition of isoproterenol (100 nM) then significantly

2+ 2+ increased Ca i mobilisation (**P<0.01 vs. threshold Ca o, N=5; Figure 4.12)

2+ increase in Ca i as measured by FURA2. To establish that this effect is due to the activation of the CaR and not to a direct effect of the isoproterenol, the calcilytic NPS2143 (1 M) was further added to the buffer and this significantly inhibited the CaR response (*P<0.05 vs. Iso. treatment.). Removal of isoproterenol returned the

2+ Ca i concentration baseline levels again.

A subthreshold 2+ 0.5 0.5 [Ca ]o (mM) Iso. 1.35 NPS2143 350/ 380 1.2

1.05

0.9 Time 0 5 10 15 (min) B ** 0.15 # AUC Min -1

0 Iso NPS. 2143

2+ 2+ Figure 4.12. Effect of isoproterenol and NPS-2143 on Ca o-induced Ca i mobilisation. A) Changes in calcium mobilisation were measured as previously described (FURA2) in CaRHEK cells were exposed to isoproterenol (100 nM) 2+ 2+ followed by NPS2143 (1 M ), in threshold Ca o. (* P<0.05 vs. Ca o alone. # P<0.05 isoproterenol vs. NPS2143 treatment by Oneway ANOVA Tukey’s posthoc test) N=6.

150

2+ 2+ Having shown in 4.3.10 that PTx can potentiate Ca oinduced Ca i mobilisation, the isoproterenol experiment was repeated in cells preexposed overnight to PTx

(100ng/ml) to attenuate CaRinduced Gi activation. Subsequent addition of

2+ 2+ isoproterenol in threshold Ca o concentrations significantly increased Ca i concentration (Figure 4.13) (**P<0.01 vs PTx treated control, N=6) as before. Then

2+ subsequent cotreatment with NPS2143 (1 µM) again significantly decreased Ca i (**P<0.01 vs. Iso. treated. N=6) completely abolishing the apparent response to isoproterenol. Therefore, cAMP generation via activation of endogenous G slinked receptors also potentiates CaR responsiveness. Further analysis showed that the isoproterenol responses were not significantly different between PTx treated (Figure

2+ 4.12) and untreated (Figure 4.13) cells in the presence of threshold Ca o concentrations (p>0.05. N≥5).

151

subthreshold 2+ A 0.5 0.5 [Ca ]o Iso. (mM) NPS2143 1.6 350/ 380 1.2

0.8 Time 0 5 10 15 (min) B ** 0.3

AUC Min -1 ## 0.15

0 PTx Iso NPS. 2143

2+ 2+ Figure 4.13. Effect of isoproterenol and NPS-2143 on Ca o-indiced Ca o- mobilisation in CaR-HEK cells pretreated with pertussis toxin. A) CaR HEK cells were pretreated with pertussis toxin (100 ng/ml) for 16 hours. Changes in calcium mobilisation was measured as previously described (FURA2) in CaRHEK cells were exposed to isoproterenol (100 nM) followed by NPS2143 (1 M), in 2+ threshold Ca o. B) Quantification of changes in calcium mobilisation as area under 2+ the curve/min (*P<0.05 vs. Ca o alone. # P<0.05 isoproterenol vs. NPS2143 treatment by Oneway ANOVA Tukey’s posthoc test; N=6).

152

4.4 Investigation of the role of protein kinase A in CaR signalling

4.4.1 Detection of protein kinase A activity using a motif-specific anti-PKA phospho-substrate antibody

2+ Having demonstrated a clear effect of cAMP on CaRinduced Ca i mobilisation, I next attempted to identify the subcellular target of the cAMP. The two main intracellular effectors for cAMP are PKA and EPAC as described in the Introduction. Indeed, the CaR has two putative PKA phosphorylation sites in its ICD which could therefore mediate a stimulatory effect of PKA directly on the receptor. Therefore, to

2+ determine whether PKA is being activated by forskolin and/or elevated Ca o concentration in CaRHEK cells, I employed a motifspecific antiPKA phospho substrate monoclonal antibody that detects proteins phosphorylated on the PKA sequence (RRXpS/pT). For this, CaRHEK cells were equilibrated in 0.5 mM

2+ Ca o–containing buffer for 20 minutes. The cells were then exposed to buffers

2+ containing 1.8, 3 or 5 mM Ca o in the presence or absence of FSK, for a further 5 minutes (Figure 4.14). Cells were then lysed with modified RIPA buffer and immunoblotted with the antiPKA phosphosubstrate antibody as described in Materials and Methods. Firstly, following 10min incubation in buffer containing 1.8

2+ mM Ca o the antibody detected a number of proteins on the 8% gel, most notably a 30 kDa protein as well as a range of proteins between 75 and 100 kDa (Figure 4.14). Cotreatment with forskolin then elicited an increase in the total phosphorylation of these PKA substrates (*P<0.05, N=5). This indicates therefore that 10 µM forskolin treatment in these cells results in acute PKA activation. Forskolin also increased PKA substrate phosphorylation (+156 ± 51%) in each of three experiments in which

2+ cells were cotreated with 3 mM Ca o instead (* P<0.05; N=3).

153

2+ A 0.5 1.8 3 5 1.8 Ca o (mM) FSK (10 M) kDa - - + - + - - +

75- 100

30 Bi * Bii * 1.2 x10 7 8x10 6 Pixel 8x10 6 Intensity 4x10 6 4x10 6

0 0 FSK FSK 2+ 2+ Ca o Ca 1.8 o 0.5 3 (mM) (mM) 5

Figure 4.14. Immunoblot using a phospho-PKA consensus site antibody 2+ in a range of Ca o concentrations and forskolin treatment in CaR-HEK cells. A, Representative immunoblot showing increased PKA phosphorylation in 2+ threshold and 3 mM Ca o upon addition of FSK. N≥3. B i) Bar graph comparing 2+ forskolintreated and untreated in 1.8 mM Ca o. *P<0.05 by Paired ttest, N=5. B ii) 2+ Bar chart comparing baseline (0.5 mM), moderate Ca o (3 mM) untreated and 2+ forskolin (10 M) treated and high Ca o (5 mM). *P<0.05 by Oneway ANOVA, N=3.

154

4.4.2 Effect of protein kinase A inhibition and forskolin cotreatment on CaR-

2+ 2+ induced Ca i mobilisation at moderate Ca o concentration

2+ Having established that forskolin potentiates CaRinduced Ca i mobilisation and elicits PKAmediated substrate phosphorylation, I then used PKAselective inhibitors to examine whether the positive functional effect of forskolin is PKA dependent. For this, cells were exposed to either the H89 (10 µM) or KT5720 (10 µM) which represents the most commonly used PKA inhibitors. With cells still

2+ exposed to the PKA inhibitors, the cells were then incubated in 2.8 mM Ca o and then finally cotreated with FSK (10 M). However, the responses to forskolin were not significantly suppressed in response to either KT5720 (10 M) (Figure 4.15) or H89 (10 M) (Figure4.16). Interestingly, although not specifically quantified there is

2+ some indication that KT5720 may have potentiated increased the Ca i mobilisation

2+ elicited by raising Ca o concentration however no such trend observation was made using H89 and thus this effect was not investigated further. Nevertheless, the experiment suggests that despite 10 µM forskolin activating PKA in these cells (Section 4.4.1), the resulting PKA activity may not account for the positive functional

2+ 2+ effect of forskolin on Ca oinduced Ca i mobilisation.

155

A KT 5720

2.8 2+ 0.5 0.5 [Ca ]o FSK (mM) 2

350/ 380 1.5

0 5 10 15 Time (min) B 0.6 AUC Min -1 0.4

0.2

0 KT5720

FSK

2+ Figure 4.15. Effect of the PKA inhibitor KT5720 on moderate Ca o- 2+ indiced Ca i mobilisation . A) Representative trace showing CaRHEK cells were 2+ exposed to 3 mM Ca o to having either been untreated or pretreated with (A) KT 5720 for 20 minutes, FSK (10 M) was then added. Two single cells (orange and purple) and global cluster of cells (black) are depicted. B) Quantification of the change in calcium mobilisation in area under the curve/min. p=0.28 by Student’s t test N=6.

156

A H89

2.8 2+ 0.5 0.5 [Ca ]o FSK (mM) 2 350/ 380

1.5

0 5 10 15 Time (min) B 0.3

0.2 AUC Min -1

0.1

0 H89

FSK

2+ Figure 4.16. Effect of the PKA inhibitor H89 on moderate Ca o-indiced 2+ Ca i mobilisation . A) Representative trace showing CaRHEK cells were exposed 2+ to 3 mM Ca o to having either been untreated or pretreated with (A) H89 for 20 minutes, FSK (10 M) was then added. Two single cells (orange and purple) and global cluster of cells (black) are depicted. B) Quantification of the change in calcium mobilisation in area under the curve/min. P=0.94 by Student’s ttest N=6.

157

4.4.3 Effect of protein kinase A inhibition and forskolin cotreatment on CaR-

2+ 2+ induced Ca i mobilisation at threshold Ca o concentration

Although PKA inhibition failed to significantly inhibit the forskolininduced

2+ 2+ potentiation of Ca oinduced Ca i mobilisation, it was considered necessary to also

2+ test the PKA inhibitor effects at subthreshold Ca o concentration as well. Again

2+ 2+ however, the forskolininduced decrease in Ca o threshold for Ca i mobilisation was unaffected by cotreatment with either KT5720 (Figure 4.17) or H89 (Figure 4.18)(P>0.05 by Oneway ANOVA, N≥6).

KT 5720 A subthreshold 2+ 0.5 0.5 [Ca ]o 1.6 FSK (mM) 350/ 380 1.4

1.2

1 Time 0 5 10 15 (min) B 0.2 AUC Min -1 0.1

0 KT 5720

FSK

2+ Figure 4.17. Effect of the PKA inhibitor KT5720 on subthreshold Ca o- 2+ indiced Ca i mobilisation . A) Representative trace showing CaRHEK cells were 2+ exposed to 3 mM Ca o to having either been untreated or pretreated with (A) KT 5720 for 20 minutes, FSK (10 M) was then added. Two single cells (orange and purple) and global cluster of cells (black) are depicted. B) Quantification of the change in calcium mobilisation in area under the curve/min. P>0.05 by Student’s t test N=6.

158

H 89 A

subthreshold 2+ 0.5 0.5 [Ca ]o FSK (mM)

1.4 350/ 380 1.2

1.0

Time 0 5 10 15 (min) B 0.15 AUC Min -1 0.1

0.05

0 H89

FSK

2+ Figure 4.18. Effect of the PKA inhibitor H89 on subthreshold Ca o- 2+ indiced Ca i mobilisation . A) Representative trace of CaRHEK cells were 2+ exposed to 3 mM Ca o to having either been untreated or pretreated with (A) H 89 for 20 minutes, FSK was then added, in 2 single cells (orange and purple) and’global’ response (black) . B) Comparing the FSK responses between untreated and treated cells showed no significant difference by paired ttest. N=6.

2+ 4.4.4 Effect of PKA- and EPAC-selective cAMP analogues on Ca i mobilisation at

2+ moderate Ca o concentration

Thus far, intracellular cAMP levels have been increased indirectly using agents such as FSK, IBMX or isoproterenol. Gerbino et al reported using a cellpermeable cAMP

2+ analogue (Sp8BrcAMP, 200 M) to enhance Ca i signalling in CaRHEK cells (Gerbino et al , 2005) and therefore, next I employed cellpermeable cAMP analogues reported to specifically activate either PKA or EPAC in order to determine

159

2+ whether the cAMP’s effects on Ca i mobilisation occur via either pathway. These included the cellpermeable cAMP analogues, 6Bnz cAMP, reported to selectively activate PKA (Roscioni et al , 2011), and, 8pCPT2′OMecAMP (pCPTcAMP), reported to be a selective activator for EPAC (Roscioni et al , 2011). In the first series of experiments using these cAMP analogues, CaRHEK cells were stimulated with 3

2+ mM Ca o buffer and then cotreated with either 100 µM 6Bnz cAMP, or 100 µM pCPTcAMP for at least 20mins. The choice of analogue concentration was based on their successful use in other laboratories reported previously (Dzhura et al , 2010; Harmati et al , 2011; Huang et al , 2008; Kang et al , 2005; Lo et al , 2011; Roscioni et

2+ 2+ al , 2011). However, in the current study no significant change in Ca o–induced Ca i mobilisation was observed in response to either the PKA or EPACselective cAMP analogues (Figure 4.19). To test whether the lack of analogue responsiveness was due to inadequate cellular uptake the next experiments employed a 1hour pre exposure of the cells (to 100 µM 6BnzcAMP or pCPTcAMP) to permit longer for the compounds to accumulate within the cells. Since this experimental design no longer permitted beforeandafter comparisons, a second series of cells not exposed to the analogues were also used as controls. However, as before there was no

2+ 2+ significant difference in Ca o–induced Ca i mobilisation between analoguetreated and untreated cells (Figure 4.20), despite the 1hour pretreatment.

160

A i A ii 1.3 1.3 350/ 380 1.15 1.15

1 1

Time 0 10 20 30 0 10 20 30 (mins) B ii B i 100 100 % AUC % AUC/ /min 75 min 75

50 50

25 25

0 0 6-Bnz-cAMP pCPT-cAMP Ca 2+ Ca 2+ o 3 o 3 (mM) (mM)

Figure 4.19. Acute treatment of CaR-HEK cells in the presence of 2+ 2+ 2+ moderate Ca o (3 mM). A i and ii) Changes in Ca oinduced Ca imobilisation 2+ was measured (FURA2) in CaRHEK cells were exposed to moderate Ca o (3 mM) following treatment with (i) 6BnzCcAMP (100 M) or (ii) cptcAMP (100 m) for 20 minutes, in 2 single cells (orange and purple) and ‘global’ response. B) Quantification of the changes in FURA2 ratio normalised against control response.

161

A 1.4 350/ 380 1.2

1 Time 0 5 10 15 (mins) B 0.15

AUC /min 0.1

0.05

0 Cont. 6Bnz pCPT cAMP cAMP Figure 4.20. Chronic treatment of CaR-HEK cells in the presence of 2+ moderate Ca o (3 mM). A) Representative traces of CaRHEK cells control (black line) or chronically exposed to 6BnzcAMP (100 m) (orange line) or (ii) cptcAMP (100 m)(purple line) for one hour. B) Quantification of the changes in area under the curve. NS by oneway ANOVA, N≥3.

Finally, despite failing to observe any effect of the PKA or EPACselective analogues

2+ 2+ 2+ on Ca o–induced Ca i mobilisation their effect on threshold Ca o was also tested. The rationale was that more subtle effects of the analogues may be observed at

2+ 2+ threshold Ca o concentration than at 3 mM Ca o. For this, CaRHEKs were exposed

2+ to 1.8 mM Ca o and then exposed to either 100 µM 6BnzcAMP, or, 100 µM pCPT

2+ 2+ cAMP. However, again, neither cAMPanalogue elicited Ca o–induced Ca i

2+ mobilisation at this threshold Ca o–concentration (not shown).

4.4.5 Characterisation of the CaR Ser-899 and Ser-900 mutants

Garrett et al predicted the presence of 2 PKA phosphorylation sites in the human CaR, at Ser899 and Ser900 (Garrett et al , 1995); the function of which have not been established. Having found no evidence that either pharmacological activation

162

2+ 2+ or inhibition of PKA modulates Ca o–induced Ca i mobilisation in CaRHEK cells, it was next decided to test whether mutating the two PKA consensus sites in the CaR ICD, serine899 or serine900, would alter CaR signalling. For this, the two putative PKA sites were mutated to either alanine (nonphosphorylatable) or to the phosphomimetic amino acid aspartate (as described in Materials and Methods).

Figure 4.21 panel A shows the successful introduction of the mutations into CaR resulting in CaR S899A and CaR S900A . The mutant proteins when expressed transiently in HEK293 cells exhibited CaR immunoreactivity consistent with wildtype CaR.

2+ 2+ Then the Ca o concentration (0.510 mM) effect relationship for Ca i mobilisation was tested for each mutant relative to wildtype CaR. However, there was no apparent difference in CaR sensitivity observed between CaR S899A , CaR S900A and wild type control. Specifically, there was no significant difference in the calculated EC 50 values or maximal responses of these mutant receptors relative to wildtype CaR (Table 4.1).

Next, figure 4.22 shows the equivalent experiments as above but for the phosphomimetic mutations CaR S899D and CaR S900D . Specifically, amino acid identity was confirmed by sequencing (Panel A) and protein expression equivalent to that of

2+ wildtype CaR was shown for (Panel B). When exposed to increasing Ca o

2+ S900D concentration the increase in Ca i mobilisation was equivalent in CaR relative

S899D 2+ to wildtype receptor, whereas CaR exhibited greater Ca o potency than in wild type CaR, with the significantly decreased EC 50 value (2.6 ± 0.1 mM vs 3.0 ± 0.1 mM control, P<0.05) shown in Table 4.1. In contrast, the maximal responses were unchanged between mutants and wildtype CaR (P>0.05 Emax WT 100 ± 10%. 93 ± 9%).

Finally, two separate dual PKA site CaR mutants were generated, the first where both residues were mutated to alanine (CaR S899A/S900A ) and the other in which the two sites were mutated to aspartate (CaR S899D/S900D). Again, DNA sequencing (Figure 4.23, panel A) and immunoblotting (panel B) confirmed the successful mutation and expression of the two mutants relative to wildtype CaR. When the action of these

2+ two double mutations on Ca i mobilisation were then tested, intriguingly they both exhibited heightened receptor responsiveness (panel C) as revealed by their

2+ significantly decreased EC 50 values for Ca o (Table 4.1).

S899D/S900D Specifically, CaR exhibited a significantly decreased EC50 , although no more than for CaR S899D alone (2.6 mM ± 0.1; P<0.01). Then CaR S899A/S900A also

163

2+ S899A exhibited decreased EC 50 for Ca o (2.6 mM ± 0.2; P<0.05) despite neither CaR nor CaR S900A exhibiting increased sensitivity (Table 4.1).

A S899A Primer : Forward 5'TCCCGCAAGCGG GCCAGCAGCCTTG3‘

Confirmed Sequencing data : TCCCGCAAGCGG GCCAGCAGCCTTG

Resulting Peptide sequence: wildtype LRRSNVSRKRSSSLGGSTGSTR mutant LRRSNVSRKR ASSLGGSTGSTR S900A Primer : Forward 5'CCGCAAGCGGTCC GC CAGCCTTGGAGGC3‘

Confirmed Sequencing data : CCGCAAGCGGTCC GC CAGCCTTGGAGGC

Resulting Peptide sequence: wildtype LRRSNVSRKRSSSLGGSTGSTR mutant LRRSNVSRKRS ASLGGSTGSTR B WT C kDa % CaR activity S900A 160 S899A 140 100

CaR wild-type

0 0 2 4 6 8 10 2+ [Ca ]o (mM)

45 β-actin

2+ S899A Figure 4.21 Validation and Ca o sensitivity of the CaR mutant CaR and CaR S900A . A) Forward Primer used to generate the mutation, sequencing of the mutation retrieved from inhouse service and the generated mutation in the CaR protein sequence. B) Representative immunoblot staining against totalCaR and β 2+ actin. C) Transiently transfected HEK293 cells were exposed to increasing Ca o 2+ (0.510 mM), changes in Ca i were measured (Fura2 ratio). Data was normalised against mean maximal WT response. N=6.

164

A S899D Primer : Forward 5'TCTCCCGCAAGCGG GA CAGCAGCCTTGGAG3‘

Confirmed Sequencing data : TCTCCCGCAAGCGG GA CAGCAGCCTTGGAG

Resulting Peptide sequence: wildtype LRRSNVSRKRSSSLGGSTGSTR mutant LRRSNVSRKR DSSLGGSTGSTR S900D Primer : Forward 5'CCGCAAGCGGTCC GA CAGCCTTGGAGGC3’

Confirmed Sequencing data : CCGCAAGCGGTCC GA CAGCCTTGGAGGC

Resulting Peptide sequence: wildtype LRRSNVSRKRSSSLGGSTGSTR mutant LRRSNVSRKRS DSLGGSTGSTR B

WT C % CaR kDa activity

160 CaR S899D S900D 140 100

50 wild-type

0 0 2 4 6 8 10 2+ [Ca ]o (mM)

45 βββ-actin

2+ S899D Figure 4.22. Validation and Ca o sensitivity of the CaR mutant CaR and CaR S900D . A) Forward Primer used to generate the mutation, sequencing of the mutation retrieved from inhouse service and the generated mutation in the CaR protein sequence. B) Representative immunoblot staining against i) TotalCaR and ii) βactin. C) Transiently transfected HEK293 cells were exposed to increasing 2+ 2+ Ca o (0.510 mM), changes in Ca i were measured (Fura2 ratio). Data was normalised against mean maximal WT response. N=6.

165

A SS899/900AA Primer : Forward 5'CTCCCGCAAGCGG GCC GCCAGCCTTGGAGGC3’

Confirmed Sequencing data : CTCCCGCAAGCGG GCC GCCAGCCTTGGAGGCTCC

Resulting Peptide sequence: wildtype LRRSNVSRKRSSSLGGSTGSTR mutant LRRSNVSRKR AA SLGGSTGSTR SS899/900DD Primer : Forward 5'CGTCTCCCGCAAGCGG GA CGA CAGCCTTGGAGGCTCC3’

Confirmed Sequencing data : CGTCTCCCGCAAGCGG GA CGA CAGCCTTGGAGGCTCC

Resulting Peptide sequence: wildtype LRRSNVSRKRSSSLGGSTGSTR mutant LRRSNVSRKR DD SLGGSTGSTR B WT

kDa C % CaR activity SS/DD 160 CaR 140 100 SS/DD

50 wild-type

0 0 2 4 6 8 10 2+ βββ-actin [Ca ]o (mM) 45

2+ Figure 4.23. Validation and Ca o sensitivity of the CaR mutant CaR S899A/S900A and CaR S899D/S900D l. A) Forward Primer used to generate the mutation, sequencing of the mutation retrieved from inhouse service and the generated mutation in the CaR protein sequence. B) Representative immunoblot staining against i) TotalCaR and ii) βactin. C) Transiently transfected HEK293 2+ 2+ cells were exposed to increasing Ca o (0.510 mM), changes in Ca i were measured (Fura2 ratio). Data was normalised against mean maximal WT response. N=6.

166

EC 50 ± SEM ( Max imum Response CaR Mutant N mM) (%) ± SEM Wild -type CaR 3.0 ± 0.1 100 ± 10 23 Ser -899 -Ala 3.0 ± 0.1 106 ± 15 9 Ser -899 -Asp 2.6 ± 0.1 * 93 ± 9 12 Ser -900 -Ala 3.2 ± 0.2 99 ± 7 8 Ser -900 -Asp 3.1 ± 0.2 111 ± 12 9 Ser -899/900 -Ala 2.6 ± 0.2 * 100 ± 8 10 Ser -899/900 -Asp 2.6 ± 0.1 ** 100 ± 10 13

Table 4.1 EC 50 and maximal response by PKA mutants. Mutants transiently 2+ expressed in HEK293 cells were exposed to increasing Ca o (0.510 mM) and normalised against average maximal WT response. Mutation of S899D, S899900A and S899900D had significantly reduced EC 50 s (*P<0.05, **P<0.01). No mutants had significantly altered maximal responses.

2+ 2+ 4.4.6 Effect of forskolin on Ca o–induced Ca i mobilisation in CaR mutants lacking the PKA sites Ser-899 and Ser-900.

Thus, having established that CaR mutants lacking the PKA sites Ser899 and Ser

2+ 2+ 900 still elicit robust Ca i mobilisation in response to elevated Ca o concentration, the effect of forskolin on these responses was then tested. The CaR S900A and CaR S900D single mutants were not specifically tested as these exhibited wildtype behaviour

2+ S899A/S900A S899D/S900D (Table 4.1) in response to Ca o, plus the CaR and CaR double mutants were both tested and which contain the same Ser900 mutations anyway. The objective of the experiments was to determine whether deletion of one or both sites could impair the stimulatory response to forskolin which would tend to indicate direct PKAmediated phosphorylation of the CaR ICD having a functional effect on

2+ Ca i mobilisation, as PKC does.

Therefore, the four remaining CaR PKAmutants (CaR S899A , CaR S899D , CaR S899A/S900A and CaR S899D/S900D ) were again transiently transfected into wildtype HEK293 cells

2+ and then exposed to threshold Ca o concentration and finally cotreated with

2+ forskolin (10 µM). However, the ability of forskolin to potentiate high Ca o–induced

2+ Ca i mobilisation in wildtype CaR was unaltered in any of the PKA site mutants examined (p>0.05, N≥4; Figure 4.24).

167

A 0.15

AUC/ 0.1 min

0.05

0 FSK(10 M) WT S899A S899D S899A/ S899D/ S900A S900D

B C 1.6 2 350/ 380 1.2 1.5

1 0.8 0 5 10 0 5 10 D Time (min) 2 E 2 350/ 380 1.5 1.5

1 1

0 5 10 0 5 10 Time (min)

2+ Figure 4.24. Effect of forskolin treatment in subthreshold Ca o. Panel A) Summary of the change in AUC/min for WT and transiently transfected with CaR S899A CaR S899D CaR S899A/S900A and CaR S899D/S900D . There is no significant difference following forskolin treatment. Panels B, C, D and E representative traces of CaR S899A CaR S899D CaR S899A/S900A and CaR S899D/S900D respectively showing single cells (orange 2+ and purple) and ‘global’ response (black) to subthreshold Ca O and forskolin (10 M) denoted by black bar (N≥4).

168

4.5 Discussion.

The interaction between intracellular cAMP and CaR signalling was studied using a heterologous expression system, namely CaRHEK cells. Increasing cytosolic cAMP enhanced intracellular calcium mobilisation and permitted CaR signalling in

2+ extracellular calcium concentrations that fail to elicit Ca i mobilisation i.e. “subthreshold” concentrations. While Gerbino et al had previously shown that

2+ cAMPelevating compounds could increase Ca i oscillation frequency in response to CaR activation, here I have shown for the first time that cAMP elevation can also

2+ 2+ lower the Ca o threshold for CaRinduced Ca i mobilisation and also that forskolin

2+ actually lowers the EC 50 for Ca o overall. Furthermore, I provide several lines of evidence casting doubt on the involvement of PKA itself in the stimulatory action of cAMP on CaR signalling and thus will describe possible alternative mechanisms of action.

4.5.1 Use of HEK-293 cells as a suitable model of CaR signalling

Regarding the use of CaRtransfected HEK cells in the current study it should be noted that CaRHEKs represent the most commonly used model of human CaR structure, pharmacology and signalling in the literature. At present we lack a suitable parathyroid culture model that would have permitted the repetition of many of the current experiments in more physiologicallyrelevant cells. Although we can in this laboratory obtain bovine parathyroid cells as a byproduct of the meat industry, the cell yield is currently too low for biochemical experiments. Also the bovine CaR lacks the PKA site(s) present in human CaR and thus is less suitable for these experiments. Further limitations for bovine PT experiments include variability of the preparation, downregulation of the CaR, contamination with nonchief cells (e.g. fibroblasts) and resistance to transfection.

In contrast, none of these issues apply to CaRHEK cells. Furthermore, PT and CaR HEK cells both exhibit similar responses to CaR agonists including PLCmediated

2+ IP 3 formation and (oscillatory) Ca i mobilisation, ERK activation, suppression of cAMP accumulation and the absence of membrane excitability (Gerbino et al , 2005; Kifor et al , 2001; McCormick et al , 2010). In addition, PKC activators and PP2A

T888 2+ inhibitors promote CaR phosphorylation and suppress CaRinduced Ca i mobilisation in both cell types. Nevertheless, while the current study sheds light on certain aspects of CaR signalling it will of course be necessary to then develop this

169

work in parathyroid cells and in humans, as done recently by this laboratory regarding CaR T888 phosphorylation in two studies I have contributed to (Lazarus et al , 2011; McCormick et al , 2010).

4.5.2 The involvement of cAMP and PKC signalling in parathyroid physiology

Mutation of several PKC phosphorylation sites within the CaR ICD, particularly Thr 888, modulates CaR signalling (Davies et al , 2007) and ultimately PTH secretion (Lazarus et al , 2011); however, in vivo it is an increase in cAMP which drives PTH release in the parathyroid gland (Brown & MacLeod, 2001). Indeed, before the CaR was discovered it was noted that activation of endogenouslyexpressed Gs–linked receptors such as with isoproterenol, dopamine or PGE 2, stimulated PTH secretion in bovine parathyroid cells (Brown et al , 1977a; Brown et al , 1977b; Gardner et al , 1978) and that this could be mimicked using the cAMP analogue dibutyryl cAMP (Shoback et al , 1984).

2+ In contrast, activation of G q/11 leads to Ca i mobilisation, which can be detected using Ca 2+ sensitive dyes such as FURA2, and is associated in PT cells with suppressed PTH secretion (Shoback et al , 1983; Shoback et al , 1984). Thus, here I investigated the intracellular crosstalk between these two signal pathways to see if they influence each other or remain discrete. In CaRHEK cells, exposure to

2+ moderate Ca o concentration elicits CaRmediated activation and the release of

GTPbound Gαq/11 which recruits PLC (Ward, 2004), in turn hydrolysing PIP 2 to IP 3

2+ and DAG. The IP 3 then binds to IP 3R on the ER causing Ca i mobilisation (Ward,

2+ 2004). DAG and Ca i together activate conventional PKCs, which can then phosphorylate the CaR at a number of sites, including Thr888, which is the primary site leading to inhibition of the receptor (Bai et al , 1998b; Davies et al , 2007). We hypothesise that phosphorylation triggers the activation of a protein phosphatase (most likely PP2A) to then dephosphorylate the receptor, allowing the activation of

Gq/11 again (Davies et al , 2007). This proposed cycle of phosphorylation dephosphorylation could explain the establishment and maintenance of oscillatory

2+ Ca i mobilisation. Higher agonist concentrations preferentially stimulate the PP2A action causing the CaR to be in a greater state of dephosphorylation thus permitting

2+ sustained Ca i mobilisation (McCormick, 2008). Gerbino et al reported that

2+ increasing cAMP, with isoproterenol, forskolin or VIP, enhanced Ca i oscillations and transition to sustained responses (Gerbino et al , 2005). Indeed, data reported here supports these findings in the first instance; namely that increasing cAMP

170

enhances intracellular calcium mobilisation, in moderate extracellular calcium (Figure 4.1).

2+ 4.5.3 Effect of cAMP on the activation threshold for CaR-mediated Ca i mobilisation

2+ It is interesting that the Ca o concentrationeffect curve for (G 12/13 mediated) actin polymerisation and membrane ruffling in CaRHEK cells is leftshifted with respect

2+ to (G q/11 mediated) Ca i mobilisation (EC 50 , 2.2 mM versus 3.1 mM respectively)

2+ (Davey et al , 2012; Gibbons et al , 2012). Significantly, 1.8 mM Ca o which is

2+ generally insufficient to elicit Ca i mobilisation or ERK activation in CaRHEK cells, is in fact able to induce actin polymerisation and other unpublished data from this laboratory) and also able to lower cAMP levels (Conigrave et al , 2012; Davies et al ,

2+ 2006). This suggests that instead of being inactive at ≈1.8 mM Ca o, the CaR is

2+ actually active but yet somehow specifically disabled from mobilising Ca i. The

T888 2+ current hypothesis is that CaR phosphorylation at these relatively low Ca o

2+ concentrations prevents CaRinduced Ca i mobilisation despite the receptor already

2+ coupling to actin polymerisation at these Ca o concentrations (Bai et al , 1998b; Davies et al , 2007; McCormick et al , 2010). In support of this, chronic phorbol ester

2+ pretreatment, which downregulates PKC, also leftward shifts the Ca o concentrationeffect curve (EC 50 , 2.2 mM vs 3.4 mM control; (Davies et al , 2007).

T888 2+ Interestingly, CaR phosphorylation is observed in 1.8 mM Ca o and appears

2+ 2+ maximal in 2 – 2.5 mM Ca o, i.e. concentrations close to the threshold for Ca i

2+ mobilisation (McCormick et al , 2010). It was also interesting that in ≈1.6 mM Ca o

2+ 2+ little or no Ca i mobilisation was observed and yet Ca i oscillations could be initiated by increasing cAMP levels (Figures 4.2). We would hypothesise therefore

2+ 2+ that the Ca o threshold for mobilising Ca i is increased by PKCmediated phosphorylation on CaR T888 but is somehow lowered by raising intracellular cAMP levels. That is, Figures 4.2, 4.3, 4.7, 4.10 and 4.12 show that increasing cAMP, with either forskolin (but not its inactive analogue 1,9dideoxy FSK), IBMX, pertussis

2+ 2+ toxin or isoproterenol, allowed Ca i mobilisation at lower Ca o concentrations.

2+ Indeed, forskolin was shown to elicit a leftwardshift in the Ca o concentration effect curve.

Having demonstrated in principle that cAMP lowers the threshold for CaRinduced

2+ Ca i mobilisation, it was then necessary to determine the mechanism of action of the cAMP. Firstly, we determined that the stimulatory effect of cAMP also applied to

171

2+ CaRinduced ERK activation (Figure 4.8). Specifically, it was shown that 3 mM Ca o which does not normally elicit significant ERK phosphorylation under control conditions, did elicit ERK activation in the presence of forskolin. Kifor et al was first to show that CaR activation elicits agonist concentrationdependent ERK phosphorylation / activation (Kifor et al , 2001) and further revealed that the effect can be partially inhibited by the PIP 2PLC inhibitor U73122. Therefore, it is possible

2+ that ERK phosphorylation is merely downstream of PLCmediated Ca i

2+ mobilisation and thus that cAMPelicited increases in CaRinduced Ca i mobilisation alone may be sufficient to explain the increased ERK activation. Nevertheless, although not investigated further, the effect of forskolin on ERK phosphorylation did at least confirm that other CaRmediated signals could be cAMPmodulated.

4.5.4 Identification of possible cyclic AMP targets in lowering the agonist threshold

2+ for CaR-induced Ca i mobilisation

The second messenger, cAMP has a plethora of regulatory and functional actions, including regulation of gene transcription, cell proliferation, differentiation and cell death (Antoni, 2012). With regards to GPCR signalling, cyclic AMP might influence

2+ Ca i concentrations via PKAmediated phosphorylation of IP 3 receptors and/or of the plasma membrane Ca 2+ ATPase PMCA (Bruce et al , 2002). Alternatively, the CaR also has two putative PKA sites (CaR S899 and CaR S900 ), whose phosphorylation / dephosphorylation could theoretically influence receptor responsiveness or even membrane localisation (Garrett et al , 1995). Another issue to consider is that the

CaR itself couples to G i/o in a number of different cell lines and tissues (Chang et al , 1998; Fitzpatrick et al , 1986a) and therefore will tend to lower cAMP levels as it becomes more active, complicating further our understanding of the interaction between cAMP and CaR signalling. As such it was necessary to systematically investigate these various possibilities so as to reveal the likely cause of cAMP induced CaR potentiation.

2+ 4.5.5 Effect of pertussis toxin on CaR-mediated Ca i mobilisation

The pertussissensitive heterotrimeric Gprotein G i/o suppresses AC action to lower cAMP production and this has been specifically shown for CaR in parathyroid chief cells and CaRHEK cells (Brown et al , 1990; Fitzpatrick et al , 1986b). Gerbino et al

172

showed that pertussis treatment reversed sperminemediated inhibition of PGE 2 cAMP increase (Gerbino et al , 2005). However, not all of the response was G i/o mediated as spermine was still capable of partially inhibiting cAMP increase following the pertussis treatment. This inferred that part of the response was likely

2+ mediated via a Ca isensitive AC such as AC 5 or 6.

2+ In the current study, overnight pertussis toxin pretreatment lowered the Ca o

2+ threshold for Ca i mobilisation though it appeared to do so more via increased

2+ efficacy given the significantly increased Ca o maximal responsiveness but

2+ unchanged EC 50 (Figure 4.10). In either case, removing G i/o , enhances Ca i

2+ mobilisation at threshold Ca o concentrations in a manner broadly similar to the positive effect of forskolin. Therefore, regardless of whether the elevated cAMP resulted from i) forskolin or isoproterenolinduced G αs activation, ii) IBMX suppression of cAMP breakdown or iii) PTxattenuation of Gαi/o signalling, the simplest explanation for these data is that higher intracellular cAMP levels somehow

2+ ‘prime’ the receptor for Ca i mobilisation and/or release it from a prevailing inhibitory signal.

In discussing the use of the various cAMPaltering compounds in this study, it should be noted that while I did not directly assay cAMP levels, Conigrave and co workers have recently employed a fluorescent cAMP reporter for this purpose. They demonstrated CaRinduced suppression of cAMP in CaRHEK cells and forskolin induced elevation of cAMP levels using conditions almost identical to those used here and similar results were also achieved by Gerbino and coworkers using a PKA based cAMP FRET reporter (Davey et al , 2012; Gerbino et al , 2005). Furthermore, I was able to demonstrate PKA action functionally using an antibody which detects phosphorylation of PKA consensus sites (known as a motifspecific PKA substrate phosphoantibody). With this, I demonstrated significantly increased PKA substrate phosphorylation in response to forskolin cotreatment following incubation in 1.8

2+ mM and 3 mM Ca o. These observations confirmed that forskolin treatment does indeed result in PKA activation but also lead us to consider whether the CaR itself may be a substrate for PKA.

2+ 2+ With regards the increase in maximal Ca i response elicited by high Ca o following PTx pretreatment (an observation that I could not find reported elsewhere previously) there are a number of possible explanations for this. Firstly, this apparent increase in CaR efficacy could indicate increased CaR membrane expression (see discussion of “ADIS” in Section 4.5.10), or to increased IP 3R activity

173

2+ permitting higher maximal Ca i mobilisation per se, or even to altered Gprotein stoichiometry. That is, assuming that the pleiotropic CaR is normally coupled to a mix of G i/o , G q/11 and G 12/13 proteins, then removal of functional G i/o proteins by PTx could permit greater coupling of the CaRs to the remaining G q/11 (and G 12/13 ) proteins

2+ and thus to heightened Ca i mobilisation (and cytoskeletal changes). However this possibility was not investigated further.

4.5.6 Effect of endogenous stimulation of cAMP levels and the potential physiological significance of this effect

It has been shown previously that cAMP can be increased in parathyroid cells and CaRHEK cells using agonists for receptors expressed endogenously in those cells (Brown et al , 1977a; Brown et al , 1977b; Gardner et al , 1978). Forskolin, PTx and IBMX elicit general, nonphysiological increases in cAMP levels. Therefore, I also employed isoproterenol to determine whether activation of endogenous G slinked

2+ 2+ receptors could also elicit a similar reduction in the Ca o threshold for Ca i mobilisation, as this would imply that signal crosstalk could actually influence CaR signalling in vivo . Gene microarray identified approximately 16,000 genes expressed in the bovine parathyroid gland; parathyroid hormone and the CaR were ranked 6 th and 570 th respectively (Table 4.2 and 4.4), tending to validate the microarray ranking as an initial indicator of the likelihood of robust gene expression in the cells.

Also indentified in the top 15,000 are a number of G scoupled receptors including histamine, nicotinic, adrenergic, dopamine and prostaglandin receptors. Beta adrenergic receptors couple to G s to activate AC and increase cAMP but do not activate the G q/11 pathway. The βadrenergic receptor agonist, isoproterenol,

2+ increased Ca i mobilisation in CaRHEKs exposed to threshold concentrations of

2+ 2+ Ca o (Figure 4.12). Despite the appearance of isoproterenolinduced Ca i mobilisation having occurred, cotreatment with the calcilytic, NPS2143, ablated the response demonstrating that the Gq/11 stimulation was entirely CaRmediated but

2+ that the activated β2R had somehow lowered the threshold of Ca o for CaRinduced

2+ Ca i mobilisation. A similar effect was observed when the experiment was repeated in cells pretreated with pertussis toxin, possibly due to the removal of the antagonistic G i/o effect (Figure 4.13). The potential significance of these observations

2+ is that in vivo , where Ca o concentrations are already partially activating for the

CaR, ligands for G slinked receptors that increase cAMP may also be able to

2+ modulate Ca i mobilisation and CaR activation. That is, the CaR appears able to

174

2+ integrate intracellular signalling between Ca i and cAMP concentrations. This could

2+ even represent a novel coincidence detector with modest Ca o concentrations combining with high intracellular cAMP levels from other receptors, to produce

2+ heightened CaRinduced Ca i mobilisation. In fact, given the physiological interplay

2+ between cAMP and Ca i concentrations in PTH secretion, it will be interesting to investigate whether similar observations can be made in cells expressing the CaR endogenously such as PT cells. It is also worth noting that most physiological experiments are conducted under the simplest conditions and with the fewest variables, however in vivo , cells are required to integrate multiple inputs at the same time. This model therefore represents one possible way of investigating such signal integration further.

Protein Gen e Title Mean Rank PTH Parathyroid Hormone 14607 6 Caveolin1 Caveolin 1 22kDa 5412 416 VEGFA Vascular endothelial growth factor A 3521 912

ARPP19 cAMP regulated phosphoprotein 19kDa 2890 1230 VEGFB Vascular endothelial growth factor B 1186 3555

Filamin A Filamin A alpha 727 5287 MEN1 Multiple endocrine neoplasia I 259 9342

βArrestin1 Arrestin beta 1 114 12181 Table 4.2. Bovine parathyroid gland microarray data – expressed housekeeping proteins. mRNA was extracted from two bovine parathyroid glands and underwent microarray analysis (see section 2.8.). Mean demonstrates the average signal from 2 sample. Rank of the top 16000 genes detected.

175

Protein Gene_Title Mean Rank PKA cAMP Protein kinase regulatory,_type_I,_alpha 8496 160 PP2 β Protein phosphatase 2 catalytic subunit beta 4848 528 EPAC12 Rho guanine nucleotide exchange factor 12 4770 540 ROCK1 Rho associated coiled coil containing protein kinase 1 3623. 868 PKD3 Protein kinase D3 3227 1045 PP1A Mg2+/Mn2+ dependent protein phosphatase 1A 2499 1508 EPAC3 Rho guanine nucleotide exchange factor (GEF)3 1165 3612 PP1A Protein phosphatase1 catalytic subunit alpha 924. 4393 EPAC2 Rho/Rac guanine nucleotide exchange factor 2 908 4466 PLC β4 Phospholipase C beta 4 884 4582 PP6 Protein phosphatase 6 catalytic subunit 805 4924 PKC ε Protein kinase C epsilon 757 5137 PDE8B Phosphodiesterase 8B 593 6082 AC 7 Adenylate cyclase 7 563 6282 PKC β Protein kinase C beta 536 6452 PKC η Protein kinase C eta 488 6835 AC 6 Adenylate cyclase 6 473 6947 PKC ζ Protein kinase C zeta 407 7523 PDE4B cAMP specific Phosphodiesterase 4B 372 7910 PKA cAMP dependent protein kinase catalytic alpha 307 8673 PDE12 Phosphodiesterase 12 276 9094 PLC δ1 Phospholipase C delta 1 185 10635 PDE8A Phosphodiesterase 8A 185 10638 PP4 Protein phosphatase 4 regulatory subunit 1 124 11945 AC 3 Adenylate cyclase 3 96 12616 PDE4A cAMP specific phosphodiesterase 4A 86 12896 PLA1 Phospholipase A1 member A 84 12951 AC 8 Adenylate cyclase 8 49 13923 PDE1B Calmodulin dependent phosphodiesterase 1B 38 14199

Table 4.3. Bovine parathyroid gland microarray data – expressed signal related proteins. mRNA was extracted from two bovine parathyroid glands and underwent microarray analysis (see section 2.8.). ‘Mean’ is the average signal from 2 samples. Rank of the top 16000 genes detected.

176

Protein Gene_Title Mean Rank CaR Calcium Sensing_Receptor 4648 570 TGFR Transforming growth factor beta receptor II 2598 1439 DopamineR Dopamine receptor D1 1753 2364 γGABAR α Gamma aminobutyric_acid (GABA)A receptor alpha 934. 4354 PGER4 Prostaglandin E receptor 4(EP4) 834. 4795 ProlactinR Prolactin receptor 714 5359 IP3R2 Inositol 1,4,5 triphosphate receptor, type_2 620 5909 IL17Ra Interleukin 17 receptor A 591 6095 βAdrenergicR Beta 2 Adrenergic receptor 502 6717 P2YR Gprotein coupled purinergic receptor P2 10 495 6772 P2XR Ligand gated ion channel purinergic receptor P2X 342 8259 PGFR2 Prostaglandin F2 eceptor negative_regulator 338 8308 S1 Sphingosine 1 phosphate receptor 2 335 8335 γGABAR B Gamma aminobutyric_acid_(GABA)B receptor 1 319 8520 EndothelinR Endothelin receptor type A 254 9418 ILR6 Interleukin 6 receptor 226 9884 ILR1 Interleukin 1 receptor type I 220 9978 FGFR Fibroblast growth factor receptor 4 202 10296 δNicotinicR Cholinergic receptor nicotinic delta 169 10975 H1 Histamine receptor H1 128 11839 IR Insulin receptor 120 12031 GHR Growth hormone receptor 110 12281 mGLUR7 Metabotropic glutamate receptor 7 92 12735 P2YR Gprotein coupled purinergic receptor_P2Y 13 62 13562 GPR5A G protein coupled r eceptor familyC group 5 member A 62 13582 PGFR Prostaglandin F receptor (FP) 52 13840 PTHR Parathyroid_Hormone_1_Receptor 38 14192

Table 4.4. Table of selected receptors from bovine microarray data. mRNA was extracted from two bovine parathyroid glands and underwent microarray analysis (see section 2.8.). Mean demonstrates the average signal from 2 sample. Rank of the top 16000 genes detected.

2+ 2+ 4.5.7 Effect of PKA inhibition on Ca o induced Ca i mobilisation

There are a number of possible intracellular targets for cAMP, but the most obvious of these is PKA. Thus, I next investigated whether the stimulatory effect of cAMP occurred via PKA activation. The effect of inhibiting PKA was determined using two PKA inhibitors, H89 and KT5720. Neither inhibitor decreased the effect of forskolin

2+ on Ca i mobilisation in either moderate (3 mM) or subthreshold (~1.6 mM) extracellular calcium concentrations. One possible explanation for the cAMP

2+ induced increase in CaRinduced Ca i mobilisation is PKAmediated phosphorylation of the IP 3 receptor whereby PKA sensitises the IP 3R to IP 3; (Bruce

177

et al , 2002). However, these data would tend to discount this given that the FSK effect is maintained despite the inhibited PKA activity.

Bosel et al demonstrated that cotreatment of CaR agonists with the PKA inhibitor H89, increased IP metabolism (Bosel et al , 2003). Interestingly, the same group showed that pretreatment with the PKC inhibitor GF109203X, and H89, had a greater effect than treatment with either inhibitor alone. They suggested that the PKC and PKA pathways converge to phosphorylate the receptor, or that the protein kinases act on downstream targets (Bosel et al , 2003). It should also be noted that I

2+ observed a basal increase in Ca i (p>0.05 by Oneway ANOVA) in the presence of a PKA inhibitor, KT5720 that was not seen with H89 which might suggest nonspecific actions of at least one of the compounds. Indeed, the Cohen laboratory have previously reported inhibitor selectivity issues with H89 and KT5720 proving capable of inhibiting other kinases (Davies et al , 2000).

One possible way to delineate downstream cAMP effectors is with the use of cyclic AMP analogues that specifically activate only PKA or EPAC. Previous groups have used cAMP analogues in various CaR studies and in a variety of cell lines to

2+ investigate changes in Ca i, membrane potential, cAMP and Cl flux (Cifuentes & Rojas, 2008; De Jesus Ferreira & Bailly, 1998; Gerbino et al , 2005; Kong et al , 2012). However, in the current study neither acute nor chronic application of PKA

2+ or EPACselective cAMP analogues consistently altered Ca i concentrations. Whether I had failed to achieve sufficient cellular accumulation of the cAMP analogues, or they lacked efficacy, could not be easily determined. It was therefore decided that to determine whether PKA modulates CaR signalling by directly phosphorylating the receptor, it would be necessary to mutate the putative PKA sites within the receptor.

4.5.8 Functional consequence of mutating the PKA consensus sites in CaR

Garrett et al identified two putative PKA sites in the human CaR at Ser899 and Ser 900. These consecutive residues appear part of a potential ERretention sequence, namely RKRSS (Garrett et al , 1995).

However, mutation of CaR S899 to a nonphosphorylatable alanine residue had no

2+ apparent effect on the ability of the receptor to mobilise Ca i (Figure4.21). Interestingly, phosphomimetic mutation of the site, CaR S899D , did exhibit a

2+ 2+ significant reduction in the EC 50 of Ca o for CaRinduced Ca i mobilisation.

178

Therefore any intracellular signal that can promote CaR S899 phosphorylation may

2+ indeed be able to increase CaR responsiveness at moderate Ca o concentrations. However, since the CaR S899A mutant exhibited wildtypelike behaviour, it can only be concluded that CaR S899 phosphorylation does not routinely occur following

2+ activation by Ca o or that if it does it has no functional consequence. Furthermore,

S899D 2+ even though CaR did exhibit heightened sensitivity to Ca o, neither mutant inhibited the stimulatory effect of forskolin (Figure 4.22) suggesting that it has no relevance to the current study.

With regards CaR S900 , neither mutation of this residue to either alanine or aspartate

2+ had any functional effect on receptor responsiveness to Ca o (Figure 4.21 and 4.22), or indeed to forskolin (Figure 4.24).

Interestingly, double mutation of both putative PKA sites to alanine did increase CaR sensitivity / responsiveness relative to wildtype CaR (discussed further in 4.5.10), however it failed to attenuate the forskolin response and thus tends to rule out a role for PKAmediated CaR phosphorylation following forskolin treatment (Figure4.24). Similarly, CaR S899D/S900D also exhibited increased CaR responsiveness relative to wildtype, with the effect no greater than for CaR S899D alone but most significantly failed to attenuate forskolin responsiveness.

Previous work by this laboratory and others has shown that phosphomimetic mutation of Thr888 (to aspartate or glutamate) inhibits receptor responsiveness while phosphonull mutation (e.g. to alanine or methionine) causes a leftward shift in CaR sensitivity (Bai et al , 1998b; McCormick et al , 2010) and thus to suppressed PTH secretion in man (Lazarus et al , 2011). Therefore, the techniques employed in the current study were capable of detecting changes in receptor responsiveness had

S899A S900A 2+ they occurred, however, the behaviour of CaR and CaR in response to Ca o was entirely unchanged from wildtype CaR behaviour. It should also be noted however that while Garrett et al predicted there being only two PKA sites in CaR, at Ser899 and Ser900, this does not preclude the possibility of there being further PKA sites elsewhere. Indeed, in the current laboratory we have identified an additional PKC site in CaR (unpublished observation) not originally predicted by Garrett et al (Garrett et al , 1995). That said, only a few of the remaining serine / threonine residues in the ICD are downstream of an arginine residue and thus the prospect of there being an alternative / additional PKA site in CaR appears relatively limited.

179

4.5.9 Possible mechanism of cAMP influence in CaR signalling

The data presented here demonstrates for the first time that increasing intracellular

2+ 2+ cAMP levels enables CaRinduced Ca i mobilisation in subthreshold Ca o

2+ concentrations. The working hypothesis is that there are lowtomoderate Ca o concentrations at which the CaR is able to signal via G 12/13 and G i/o , and yet unable to

2+ elicit Gq/11 mediated Ca i mobilisation. There appear two possible explanations for

T888 2+ this, the first is that PKCmediated CaR phosphorylation raises the Ca o

2+ threshold for Ca i mobilisation (Lazarus et al , 2011; McCormick et al , 2010). The second possibility is that G i/o activation decreases basal cAMP levels thus removing any potential stimulatory benefit of cAMP. It should be noted that these two possibilities are by no means mutually exclusive and in fact the latter could even potentiate the effect of the former. To clarify this issue it should be noted that I have

2+ shown experimentally that there are two ways to overcome the inhibition of Ca i

2+ mobilisation described above. The first is to further increase the Ca o concentration

T888 2+ which will cause PP2Amediated dephosphorylation of the CaR leading to Ca i mobilisation. The second is to increase intracellular cAMP levels to sensitise the CaR

2+ to the existing Ca o concentration, possibly by activation of a cAMPsensitive phosphatase leading again, to CaR T888 dephosphorylation. Further experiments will be necessary to determine the effect of forskolin on the phosphorylation state of

T888 2+ T888 CaR in threshold Ca o concentrations. If forskolin does elicit CaR dephosphorylation, this could indicate that it is acting via a cAMPsensitive phosphatase. This could be beneficial in tissues that have high basal levels of cAMP. It might even be noted that the setpoint for PTH secretion in vivo , is lower (≈1.21.4 mM) than for CaR’s EC 50 in vitro (3.0 mM) in HEK293 cells. With the PT cells expressing histamine, adrenergic, dopamine and prostanoid receptors there is ample opportunity for these cells to elevate cAMP levels close to the CaR. Therefore, to address this further it will be necessary to assess the effect of cAMPelevating agents on CaR T888 phosphorylation (McCormick et al , 2010).

It is also noteworthy that a number of other cAMPmediated proteins were detected in the microarray; including adenylate cyclases 3 and 8 which are stimulated by cAMP and thus also by PDE action. The transcription factors cAMPresponsive element binding (CREB) and cAMPresponsive element modulator (CREM) are both expressed in CaRHEK (unpublished microarray data). In this regard, Avlani et al recently reported that although CaR activation decreases cAMP, CaR dose dependently stimulates CREB phosphorylation via a PIPLC and PKC dependent manner (Avlani et al , 2013).

180

Regarding possible physiological interactions between CaR and cAMP signalling it should be noted that it has recently been shown in juxtaglomerular cells, that CaR elicits decreased cAMP accumulation, and, inhibits renin secretion, in a PLC dependent, G iindependent manner (OrtizCapisano et al , 2013). Cyclic AMP drives

2+ 2+ renin secretion via PLC; activation of the CaR with Ca o, stimulates Ca mobilisation, which inhibits cAMP synthesis via Ca 2+ sensitiveACs 5 and 6, inhibiting further renin secretion (Grünberger et al , 2006; OrtizCapisano et al , 2013). In parathyroid cells, cAMP stimulates PTH, via a currently unknown pathway. Thus, here we have shown that cAMP also stimulates CaR activation, which could feedback, limiting further cAMP via Ca 2+ sensitive ACs.

4.5.10 Relevance of CaR S899A functional data for the concept of agonist-driven insertional signalling

Agonistdriven insertional signalling (ADIS) is a theory proposed by the Breitwieser group as an alternative or complementary explanation for high cooperativity and lack of desensitisation demonstrated by CaR (Breitwieser; Grant et al, 2011). Simply put, activation of CaR with extracellular agonists drives further CaR trafficking to the plasma membrane with the possibility of enhanced signalling at the top of the

2+ Ca o concentrationeffect curve.

Some CaR gain or lossoffunction mutations are known to affect membrane expression, and decreased membrane expression is associated with FHH and non calciostatic diseases such as colon cancer, pancreatitis and epilepsy (Breitwieser; Grant et al, 2012; Grant et al, 2011; Stepanchick et al, 2010). Use of CaRactivating calcimimetics can rescue such mutants, increasing their membrane expression (White et al , 2009) and implying that agonist exposure will increase membrane expression.

The argininerich motif RXR controls endoplasmic reticulum retention in multiple membrane proteins and one such motif is located in the proximal Cterminus of CaR at Arg886 to Arg898 (Grant et al , 2011; Stepanchick et al , 2010). Mutation of this RKRmotif in CaR is known to cause both lossand gainoffunction mutations, which Stepanchick et al hypothesised were due to an alteration in plasma membrane expression (Stepanchick et al , 2010).

The RKRmotif is close to the PKC site Ser892 and putative PKA phosphorylation site Ser899. Stepanchick et al reported that mutation of the PKC site did not affect

181

membrane expression; whereas the mutant CaR S899D significantly increased membrane expression. CaR S899D was reported to exhibit increased abundance as a mature 160 kDa receptor, although this was not depicted with a loading control. In contrast, I did not observe an apparent difference in 160 kDa, mature CaR S899D expression but did observe increased sensitivity (Figure 4.22). However, as already stated there was no functional effect on CaR responsiveness of mutating CaR S899 to alanine.

Breitwieser and coworkers hypothesised that phosphorylation of Ser899 affected ER retention by influencing the binding of 1433 proteins. 1433 proteins are known to influence ER retention and may act directly or indirectly to influence CaR retention (Arulpragasam et al , 2012). Breitwieser et al show that CaR S899D significantly decreased coimmunoprecipitation between CaR and 1433, compared to WT (Grant et al , 2011; Stepanchick et al, 2011 ) whereas CaR S899A exhibited significantly increased 1433 coimmunoprecipitation (Grant et al , 2011). This suggests that phosphorylation of Ser899 decreases interaction between the CaR and 1433 allowing trafficking to the membrane. Using TIRF, Breitwieser and coworkers

2+ demonstrated Ca o concentrationdependent increases in WT CaR plasma

S899D 2+ membrane expression (Grant et al , 2011). CaR did not exhibit substantial Ca o dependent increases in PM expression although this might have been because CaR S899D was already exhibiting (near) maximal membrane expression that could not be further heightened by ADIS. Such an explanation might fit with the functional effect for CaR S899D observed in the current study. However, CaR S899A exhibited decreased maximal response to ADIS which was hypothesised to result from increased ER retention (Grant et al , 2011). Breitwieser et al concluded that CaR S899 finetunes ADIS possibly as one of a number of phosphorylation sites regulating this phenomenon (Breitwieser, 2012). However, in our hands CaR S899A exhibits responsiveness no different to the wildtype CaR. I would argue therefore that since pseudophosphorylation of CaR S899 did cause a positive functional effect (CaR S899D ), then permanently inhibiting that phosphorylation i.e. with CaR S899A , should have elicited the opposite effect, as is the case for CaR T888 mutations. Since it did not then the simplest explanation for the current data is that CaR S899A signals perfectly normally even if it alters ADIS and therefore it is possible that while ADIS is an important explanation for how the CaR avoids desensitisation, it may be less important for regulating CaR responsiveness for receptors already on the membrane. It should be noted however that while the responsiveness of CaR S899A and CaR S900A was no different to that for wildtype CaR, double mutation to

S899A/S900A 2+ CaR did in fact produce a significantly lower EC 50 for Ca o on CaRinduced

182

2+ Ca i mobilisation. Because of this, one might speculate that provided there is phosphorylation of either PKA site (899 or 900) the receptor is partially inhibited (either functionally or in terms of ADIS) and thus both phosphosites must be deleted to achieve an increase in CaR signal. However, there would be several arguments against this. The first is that the phosphomimetic mutants CaR S899D and

S899D/S900D CaR exhibit increased not decreased sensitivity. And secondly, in pharmacology it is usually understood that EC 50 changes reflect altered agonist binding whereas increased receptor availability instead elevates the E max (maximal response) without necessarily altering the sensitivity of individual receptors. In the

2+ current study, the PKA site mutations either increase Ca o agonist potency (lower

EC 50 ) or have no effect at all, but none of them alter E max , casting further doubt on the idea that ADIS, via Ser899 at least, increases total CaR responsiveness.

Breitwieser et al argue that it is not possible to determine if the steep relationship observed in a conventional cumulative concentrationeffect curve is due to agonist

2+ cooperativity or ADIS (Breitwieser, 2012). This is because increasing the Ca o concentration in a stepwise manner may also incorporate the effect of ADIS, increasing CaR membrane expression. However, comparing the concentrationeffect data for WT and CaR S899D shows that in 2 mM, the first point on the curve, the mutant is significantly more active. This timepoint would not allow for ADIS to have effect and therefore we can assume that this mutant is genuinely more functionally active. Thus, if CaR S899A is retained in the ER then given the ADIS hypothesis then we would have expected decreased CaR responsiveness, however, CaR S899A exhibited wildtypelike behaviour.

In order to demonstrate if CaR cooperativity is due to ADIS or not, it would be

2+ 2+ helpful to compare the Ca o concentrationdependency of CaRinduced Ca i

2+ mobilisation between cell exposed to cumulative Ca o concentrations, and, those

2+ 2+ challenged with elevated Ca o followed by a return to low Ca o again following each challenge. That is, the latter method should not be affected by cumulative ADIS although such a protocol is less physiological given that CaR is usually constantly exposed to agonist and such exposures change incrementally as blood calcium levels rise or fall but do not change dramatically. Furthermore if ADIS does increase signalling, then exposing CaRHEK cells to a single calcium concentration would increase calcium mobilisation over time; however, this has never been observed. The CaR is one of the few GPCRs that does not significantly desensitise and it is clear that the ADIS proposal by Breitwieser et al is an important development in

183

explaining that resistance to desensitisation (Breitwieser, 2012). However, whether ADIS also explains CaR cooperativity remains to be demonstrated.

4.5.11 Summary

In conclusion, the data presented here suggest that the human CaR is subject to previously unrecognised control by cytosolic cAMP. In extracellular calcium

2+ concentrations which do not elicit G q/11 mediated Ca i mobilisation, increasing

2+ cAMP permits, or augments, Ca i mobilisation. The results here show that it is unlikely that this is PKAmediated and thus might be better explained by CaR dephosphorylation by a protein phosphatase.

184

Chapter 5

General Discussion

185

5.1 General discussion

The ability of the CaR to sense nonphysiological changes in extracellular pH was demonstrated previously by Quinn et al however further investigation by this laboratory has revealed that pathophysiological pH o changes (± 0.2 unit) can also be detected by CaR (Quinn et al , 2004). An increase in pH o potentiates CaRinduced

2+ Ca i mobilisation, ERK phosphorylation and actin polymerisation while a more acidic pH o attenuates CaR signalling. Such pathophysiological changes can occur naturally during senescence, due it is thought to declining renal function, but develops more markedly in patients with renal failure. Since protons and calcium are subject to potential buffering by phosphate, albumin and carbonate it was important that I first demonstrated that the CaR’s pH osensitivity could still be observed in the presence of a physiological concentration of albumin (5%).

Next, I attempted to identify the molecular mediator of CaR pH o sensitivity with one or more of the extracellular histidine residues considered to be the most likely site(s) as shown in certain other membrane proteins and based on the pH osensitivity of their ionisable sidechain. However, sitedirected mutation of all sixteen extracellular histidines (including at least one double mutation) did not attenuate pH o sensitivity in any case. Although some mutations exhibited modest trend changes in pH o sensitivity, none of the responses were significantly different from WT behaviour. The free, extracellular cysteine residue was also mutated but this did not alter CaR pH o sensitivity either. As a result, I would conclude that clusters of glutamate and aspartate amino acids that form the putative calcium binding regions of the receptor would appear to be the most likely mediators of CaR pH o sensitivity.

Next, the relationship between CaR signalling and cytosolic cAMP was investigated. It has previously been noted that in comparison to CaRinduced actin

2+ polymerisation / membrane ruffling, the Ca o concentrationeffect relationship for

2+ 2+ Ca i mobilisation is rightward shifted. This suggests that at moderate Ca o concentrations (1.8 mM in this study) the CaR may be conformationally active and

2+ yet uncoupled from the mechanism of Ca i mobilisation. As a result, releasing the receptor from this inhibition may even contribute to the steepness of the agonist effect relationship.

I first confirmed the Gerbino et al observation that agents which increase cAMP

2+ concentrations also enhance Ca i mobilisation in CaRHEK cells (Gerbino et al , 2005). Next, I determined the consequence of increasing cAMP levels on the

2+ 2+ threshold Ca o concentration for Ca i mobilisation. Increasing cytosolic cAMP

186

concentration, with forskolin, isoproterenol, IBMX or pertussis toxin significantly

2+ increased CaRinduced Ca i mobilisation, triggering the initiation of oscillations, with forskolin also potentiating CaRmediated ERK phosphorylation. The potential importance of the isoproterenol observation is that activation of any G slinked GPCR

2+ in a CaRexpressing cell exposed to a moderate Ca o concentration could also result

2+ in altered Ca i mobilisation.

2+ One possible explanation for the positive effect of increasing cytosolic cAMP on Ca i mobilisation is via PKAmediated phosphorylation of the IP 3R. However, neither of the two PKA inhibitors used was able to attenuate the forskolin response. Furthermore, regarding the possible regulation of receptor function by PKA mediated phosphorylation on CaR S899 or CaR S900 , neither mutant overcame the

2+ positive effect of forskolin cotreatment on Ca i mobilisation. Thus, the simplest explanation of the current data is that increased cAMP concentration does not elicit

2+ its positive effect on CaRinduced Ca i mobilisation via PKA activation and thus it should be next investigated whether instead cAMP somehow stimulates the

T888 2+ dephosphorylation of CaR which could potentially release the restraint on Ca i

2+ mobilisation. However, possible potentiation of IP 3Rmediated Ca i release has not been ruled out by these data.

It should be noted however that phosphomimetic mutation of CaR S899 did

2+ 2+ significantly leftshift the Ca o concentrationeffect relationship for Ca i mobilisation which indicates that phosphorylation of this site may alter either function or even membrane localisation of the receptor. That said however, the function of the phosphonull mutant CaR S899A , was equivalent to WTCaR which

2+ suggests that the site does not become phosphorylated as Ca o concentration is

2+ increased as otherwise it should have caused a rightshift in the Ca o concentration effect relationship. If this conclusion is correct, then these data would argue against CaR S899 playing a functional role in ADIS. That is, even if CaR S899 does contribute to

2+ ADIS, it does not alter CaR signalling (Ca i mobilisation in this case) significantly.

2+ S899A In any case, that forskolinelicited an increase in Ca i mobilisation in both CaR and CaR S900A indicates that these putative PKA sites (in the WT receptor) do not mediate the positive effect of forskolin. It has been hypothesised by Breitwieser and coworkers that phosphorylation of Ser899 increases membrane expression; this could be supported by data presented here (Grant et al , 2011; Stepanchick et al , 2010). However, there is no functional loss from not phosphorylating this site (S899A), which suggests that this is not functionally relevant. Agonistdriven

187

insertional signalling (ADIS) proposes a solution for the lack of desensitisation and high degree of cooperativity. Evidence presented here suggests that Ser899 does not contribute to receptor function and mutation does not alter maximal receptor activation which suggests no alteration to efficacy. Furthermore if ADIS, and specifically S899A, did contribute to cooperativity then mutation would cause a decrease in activation. Breitwieser and coworkers demonstrated that in WT receptor

2+ increase Ca o increase plasma membrane expression ≈300 seconds; therefore in a single calcium concentration we would expect to see an increase in calcium mobilisation after this amount of time, however none has ever been observed here (Grant et al, 2011). One explanation which may explain this is that ADIS contributes to the maintenance of ‘signalling’ receptors on the membrane, but not to signal potentiation or cooperativity.

5.2 Conclusions

In conclusion, the data presented here have addressed two fundamental areas regarding CaR responsiveness. In the first case, I have shown that none of the CaR’s extracellular histidine or free cysteine residues are responsible for mediating extracellular pH sensitivity and that pathophysiological changes in pH o are not compensated for by buffering with albumin. With the eventual precise determination of CaR’s Ca 2+ binding sites, it will then become possible to test whether mutation of these residues (or local disruption of these clusters) attenuates the pH o sensitivity.

In the second case, I have revealed that increasing intracellular cAMP

2+ 2+ concentrations lowers the threshold Ca o concentration for CaRinduced Ca i mobilisation, at least in HEK293 cells. This raises the question then of whether this effect occurs in vivo in cells in which the CaR is expressed endogenously.

By better understanding how cAMP and CaR signalling is integrated, this will help us to determine the mechanism of PTH secretion and its homeostatic control. With the increasing incidence of osteoporosis and kidney disease these issues are not only of biological interest but of increasing clinical importance.

188

REFERENCES

Aida K, Koishi S, Tawata M, Onaya T (1995) Molecular cloning of a putative Ca(2+)-sensing receptor cDNA from human kidney. Biochem Biophys Res Commun 214: 524-529

Alam MU, Kirton JP, Wilkinson FL, Towers E, Sinha S, Rouhi M, Vizard TN, Sage AP, Martin D, Ward DT, Alexander MY, Riccardi D, Canfield AE (2009) Calcification is associated with loss of functional calcium-sensing receptor in vascular smooth muscle cells. Cardiovasc Res 81: 260-268

Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search tool. J Mol Biol 215: 403-410

Alvarez-Hernandez D, Santamaria I, Rodriguez-Garcia M, Iglesias P, Delgado-Lillo R, Cannata-Andia JB (2003) A novel mutation in the calcium-sensing receptor responsible for autosomal dominant hypocalcemia in a family with two uncommon parathyroid hormone polymorphisms. J Mol Endocrinol 31: 255-262

Amgen (2003) Cinacalcet: AMG 073, Calcimimetics--Amgen/NPS Pharmaceuticals, KRN 1493, NPS 1493. Drugs R D 4: 349-351

Amlal H, Paillard M, Bichara M (1994) Cl(-)-dependent NH4+ transport mechanisms in medullary thick ascending limb cells. Am J Physiol 267: C1607-1615

Antoni FA (2012) New paradigms in cAMP signalling. Mol Cell Endocrinol 353: 3-9

Ardeshirpour L, Dann P, Pollak M, Wysolmerski J, VanHouten J (2006) The calcium-sensing receptor regulates PTHrP production and calcium transport in the lactating mammary gland. Bone 38: 787-793

Arthur JM, Lawrence MS, Payne CR, Rane MJ, McLeish KR (2000) The calcium-sensing receptor stimulates JNK in MDCK cells. Biochem Biophys Res Commun 275: 538-541

Arulpragasam A, Magno AL, Ingley E, Brown SJ, Conigrave AD, Ratajczak T, Ward BK (2012) The adaptor protein 14-3-3 binds to the calcium-sensing receptor and attenuates receptor- mediated Rho kinase signalling. Biochem J 441: 995-1006

Avlani VA, Ma W, Mun HC, Leach K, Delbridge L, Christopoulos A, Conigrave AD (2013) Calcium-sensing receptor-dependent activation of CREB phosphorylation in HEK293 cells and human parathyroid cells. Am J Physiol Endocrinol Metab 304: E1097-1104

Awata H, Huang C, Handlogten ME, Miller RT (2001) Interaction of the calcium-sensing receptor and filamin, a potential scaffolding protein. J Biol Chem 276: 34871-34879

189

Bai M (2004) Structure-function relationship of the extracellular calcium-sensing receptor. Cell Calcium 35: 197-207

Bai M, Quinn S, Trivedi S, Kifor O, Pearce SH, Pollak MR, Krapcho K, Hebert SC, Brown EM (1996) Expression and characterization of inactivating and activating mutations in the human Ca2+o-sensing receptor. J Biol Chem 271: 19537-19545

Bai M, Trivedi S, Brown EM (1998a) Dimerization of the extracellular calcium-sensing receptor (CaR) on the cell surface of CaR-transfected HEK293 cells. J Biol Chem 273: 23605- 23610

Bai M, Trivedi S, Lane CR, Yang Y, Quinn SJ, Brown EM (1998b) Protein kinase C phosphorylation of threonine at position 888 in Ca2+o-sensing receptor (CaR) inhibits coupling to Ca2+ store release. J Biol Chem 273: 21267-21275

Baker SB, Worthley LI (2002) The essentials of calcium, magnesium and phosphate metabolism: part I. Physiology. Crit Care Resusc 4: 301-306

Ballmer PE, McNurlan MA, Hulter HN, Anderson SE, Garlick PJ, Krapf R (1995) Chronic metabolic acidosis decreases albumin synthesis and induces negative nitrogen balance in humans. J Clin Invest 95: 39-45

Batlle D, Hays S, Arruda JA, Kurtzman NA (1980) Parathyroid hormone dependent hypercalciuria in chronic metabolic acidosis. Adv Exp Med Biol 128: 515-522

Bechinger B (1996) Towards membrane protein design: pH-sensitive topology of histidine- containing polypeptides. J Mol Biol 263: 768-775

Beebe SP. (1906) The parathyroid gland, with demonstrations of the effects of hypodermic injections of parathyroid nucleoproteid after parathyroidectomy. Proc Soc Exp Biol Med , Vol. 4, p. 64.

Berkeley WN, Beebe SP (1909) A Contribution to the Physiology and Chemistry of the Parathyroid Gland. J Med Res 20: 149-173

Bichara M, Mercier O, Borensztein P, Paillard M (1990) Acute metabolic acidosis enhances circulating parathyroid hormone, which contributes to the renal response against acidosis in the rat. J Clin Invest 86: 430-443

Bland R, Walker EA, Hughes SV, Stewart PM, Hewison M (1999) Constitutive expression of 25-hydroxyvitamin D3-1alpha-hydroxylase in a transformed human proximal tubule cell

190

line: evidence for direct regulation of vitamin D metabolism by calcium. Endocrinology 140: 2027-2034

Bosel J, John M, Freichel M, Blind E (2003) Signaling of the human calcium-sensing receptor expressed in HEK293-cells is modulated by protein kinases A and C. Exp Clin Endocrinol Diabetes 111: 21-26

Bramucci E, Paiardini A, Bossa F, Pascarella S (2012) PyMod: sequence similarity searches, multiple sequence-structure alignments, and homology modeling within PyMOL. BMC Bioinformatics 13 Suppl 4: S2

Brauner-Osborne H, Jensen AA, Sheppard PO, O'Hara P, Krogsgaard-Larsen P (1999) The agonist-binding domain of the calcium-sensing receptor is located at the amino-terminal domain. J Biol Chem 274: 18382-18386

Brauner-Osborne H, Wellendorph P, Jensen AA (2007) Structure, pharmacology and therapeutic prospects of family C G-protein coupled receptors. Curr Drug Targets 8: 169- 184

Breitwieser GE (2012) Minireview: the intimate link between calcium sensing receptor trafficking and signaling: implications for disorders of calcium homeostasis. Mol Endocrinol 26: 1482-1495

Brown AJ, Zhong M, Ritter C, Brown EM, Slatopolsky E (1995) Loss of calcium responsiveness in cultured bovine parathyroid cells is associated with decreased calcium receptor expression. Biochem Biophys Res Commun 212: 861-867

Brown E, Enyedi P, LeBoff M, Rotberg J, Preston J, Chen C (1987) High extracellular Ca2+ and Mg2+ stimulate accumulation of inositol phosphates in bovine parathyroid cells. FEBS Lett 218: 113-118

Brown EM (1991) Extracellular Ca2+ sensing, regulation of parathyroid cell function, and role of Ca2+ and other ions as extracellular (first) messengers. Physiol Rev 71: 371-411

Brown EM, Carroll RJ, Aurbach GD (1977a) Dopaminergic stimulation of cyclic AMP accumulation and parathyroid hormone release from dispersed bovine parathyroid cells. Proc Natl Acad Sci U S A 74: 4210-4213

Brown EM, Chattopadhyay N, Yano S (2004) Calcium-sensing receptors in bone cells. J Musculoskelet Neuronal Interact 4: 412-413

Brown EM, Fuleihan G el-H, Chen CJ, Kifor O (1990) A comparison of the effects of divalent and trivalent cations on parathyroid hormone release, 3',5'-cyclic-adenosine

191

monophosphate accumulation, and the levels of inositol phosphates in bovine parathyroid cells. Endocrinology 127: 1064-1071

Brown EM, Gamba G, Riccardi D, Lombardi M, Butters R, Kifor O, Sun A, Hediger MA, Lytton J, Hebert SC (1993) Cloning and characterization of an extracellular Ca(2+)-sensing receptor from bovine parathyroid. Nature 366: 575-580

Brown EM, Hebert SC (1995) A cloned Ca(2+)-sensing receptor: a mediator of direct effects of extracellular Ca2+ on renal function? J Am Soc Nephrol 6: 1530-1540

Brown EM, Hurwitz S, Aurbach GD (1977b) Beta-adrenergic stimulation of cyclic AMP content and parathyroid hormone release from isolated bovine parathyroid cells. Endocrinology 100: 1696-1702

Brown EM, Lian JB (2008) New insights in bone biology: unmasking skeletal effects of the extracellular calcium-sensing receptor. Sci Signal 1: pe40

Brown EM, MacLeod RJ (2001) Extracellular calcium sensing and extracellular calcium signaling. Physiol Rev 81: 239-297

Brown EM, Redgrave J, Thatcher J (1984) Effect of the phorbol ester TPA on PTH secretion. Evidence for a role for protein kinase C in the control of PTH release. FEBS Lett 175: 72-75

Brown WH (1911) I. Parathyroid Implantation in the Treatment of Tetania Parathyreopriva. Ann Surg 53: 305-317

Bruce JI, Shuttleworth TJ, Giovannucci DR, Yule DI (2002) Phosphorylation of inositol 1,4,5- trisphosphate receptors in parotid acinar cells. A mechanism for the synergistic effects of cAMP on Ca2+ signaling. J Biol Chem 277: 1340-1348

Bruce JI, Yang X, Ferguson CJ, Elliott AC, Steward MC, Case RM, Riccardi D (1999) Molecular and functional identification of a Ca2+ (polyvalent cation)-sensing receptor in rat pancreas. J Biol Chem 274: 20561-20568

Buchan AM, Squires PE, Ring M, Meloche RM (2001) Mechanism of action of the calcium- sensing receptor in human antral gastrin cells. Gastroenterology 120: 1128-1139

Bukoski RD, Ishibashi K, Bian K (1995) Vascular actions of the calcium-regulating hormones. Semin Nephrol 15: 536-549

Busque SM, Kerstetter JE, Geibel JP, Insogna K (2005) L-type amino acids stimulate gastric acid secretion by activation of the calcium-sensing receptor in parietal cells. Am J Physiol Gastrointest Liver Physiol 289: G664-669

192

Butters RR, Jr., Chattopadhyay N, Nielsen P, Smith CP, Mithal A, Kifor O, Bai M, Quinn S, Goldsmith P, Hurwitz S, Krapcho K, Busby J, Brown EM (1997) Cloning and characterization of a calcium-sensing receptor from the hypercalcemic New Zealand white rabbit reveals unaltered responsiveness to extracellular calcium. J Bone Miner Res 12: 568-579

Capasso G, Rizzo M, Pica A, Di Maio FS, Moe OW, Alpern RJ, De Santo NG (2002) Bicarbonate reabsorption and NHE-3 expression: abundance and activity are increased in Henle's loop of remnant rats. Kidney Int 62: 2126-2135

Care AD, Sherwood LM, Potts JT, Aurbach GD (1966) Perfusion of the isolated parathyroid gland of the goat and sheep. Nature 209: 55-57

Cha SK, Huang C, Ding Y, Qi X, Huang CL, Miller RT (2011) Calcium-sensing receptor decreases cell surface expression of the inwardly rectifying K+ channel Kir4.1. J Biol Chem 286: 1828-1835

Chan JC, Bartter FC (1980) Effect of metabolic acidosis and alkalosis on the renal response to parathyroid hormone infusion in normal man. Adv Exp Med Biol 128: 167-172

Chang W, Chen TH, Pratt S, Shoback D (2000) Amino acids in the second and third intracellular loops of the parathyroid Ca2+-sensing receptor mediate efficient coupling to phospholipase C. J Biol Chem 275: 19955-19963

Chang W, Pratt S, Chen TH, Bourguignon L, Shoback D (2001) Amino acids in the cytoplasmic C terminus of the parathyroid Ca2+-sensing receptor mediate efficient cellsurface expression and phospholipase C activation. J Biol Chem 276: 44129-44136

Chang W, Pratt S, Chen TH, Nemeth E, Huang Z, Shoback D (1998) Coupling of calcium receptors to inositol phosphate and cyclic AMP generation in mammalian cells and Xenopus laevis oocytes and immunodetection of receptor protein by region-specific antipeptide antisera. J Bone Miner Res 13: 570-580

Chang W, Shoback D (2004) Extracellular Ca2+-sensing receptors--an overview. Cell Calcium 35: 183-196

Chang W, Tu C, Chen TH, Bikle D, Shoback D (2008) The extracellular calcium-sensing receptor (CaSR) is a critical modulator of skeletal development. Sci Signal 1: ra1

Chang W, Tu C, Chen TH, Komuves L, Oda Y, Pratt SA, Miller S, Shoback D (1999) Expression and signal transduction of calcium-sensing receptors in cartilage and bone. Endocrinology 140: 5883-5893

193

Chang W, Tu C, Cheng Z, Rodriguez L, Chen TH, Gassmann M, Bettler B, Margeta M, Jan LY, Shoback D (2007) Complex formation with the Type B gamma-aminobutyric acid receptor affects the expression and signal transduction of the extracellular calcium-sensing receptor. Studies with HEK-293 cells and neurons. J Biol Chem 282: 25030-25040

Chattopadhyay N, Cheng I, Rogers K, Riccardi D, Hall A, Diaz R, Hebert SC, Soybel DI, Brown EM (1998) Identification and localization of extracellular Ca(2+)-sensing receptor in rat intestine. Am J Physiol 274: G122-130

Chattopadhyay N, Legradi G, Bai M, Kifor O, Ye C, Vassilev PM, Brown EM, Lechan RM (1997) Calcium-sensing receptor in the rat hippocampus: a developmental study. Brain Res Dev Brain Res 100: 13-21

Chattopadhyay N, Yano S, Tfelt-Hansen J, Rooney P, Kanuparthi D, Bandyopadhyay S, Ren X, Terwilliger E, Brown EM (2004) Mitogenic action of calcium-sensing receptor on rat calvarial osteoblasts. Endocrinology 145: 3451-3462

Chen W, Bergsman JB, Wang X, Gilkey G, Pierpoint CR, Daniel EA, Awumey EM, Dauban P, Dodd RH, Ruat M, Smith SM Presynaptic external calcium signaling involves the calcium- sensing receptor in neocortical nerve terminals. PLoS One 5: e8563

Cheng I, Klingensmith ME, Chattopadhyay N, Kifor O, Butters RR, Soybel DI, Brown EM (1998) Identification and localization of the extracellular calcium-sensing receptor in human breast. J Clin Endocrinol Metab 83: 703-707

Cheng I, Qureshi I, Chattopadhyay N, Qureshi A, Butters RR, Hall AE, Cima RR, Rogers KV, Hebert SC, Geibel JP, Brown EM, Soybel DI (1999) Expression of an extracellular calcium- sensing receptor in rat stomach. Gastroenterology 116: 118-126

Chikatsu N, Fukumoto S, Takeuchi Y, Suzawa M, Obara T, Matsumoto T, Fujita T (2000) Cloning and characterization of two promoters for the human calcium-sensing receptor (CaSR) and changes of CaSR expression in parathyroid adenomas. J Biol Chem 275: 7553- 7557

Chokshi R, Matsushita M, Kozak JA (2012) Detailed examination of Mg2+ and pH sensitivity of human TRPM7 channels. Am J Physiol Cell Physiol 302: C1004-1011

Chow JY, Estrema C, Orneles T, Dong X, Barrett KE, Dong H Calcium-sensing receptor modulates extracellular Ca(2+) entry via TRPC-encoded receptor-operated channels in human aortic smooth muscle cells. Am J Physiol Cell Physiol 301: C461-468

Cibulka R, Racek J (2007) Metabolic disorders in patients with chronic kidney failure. Physiol Res 56: 697-705

194

Cifuentes M, Rojas CV (2008) Antilipolytic effect of calcium-sensing receptor in human adipocytes. Mol Cell Biochem 319: 17-21

Clarke CE, Benham CD, Bridges A, George AR, Meadows HJ (2000) Mutation of histidine 286 of the human P2X4 purinoceptor removes extracellular pH sensitivity. J Physiol 523 Pt 3: 697-703

Coe FL, Firpo JJ, Hollandsworth DL, Segil L, Canterbury JM, Reiss E (1975) Effect of acute and chronic metabolic acidosis on serum immunoreactive parathyroid hormone in man. Kidney Int 8: 263-273

Coker LH, Rorie K, Cantley L, Kirkland K, Stump D, Burbank N, Tembreull T, Williamson J, Perrier N (2005) Primary hyperparathyroidism, cognition, and health-related quality of life. Ann Surg 242: 642-650

Collip JB (1925) The Internal Secretion of the Parathyroid Glands. Proc Natl Acad Sci U S A 11: 484-485

Conigrave AD, Avlani VA, Christopoulos A, Mun HC (2012) Modulation of cAMP and cAMP- sensitive signaling by the calcium-sensing receptor. Bone 51: S22

Conigrave AD, Brown EM (2006) Taste receptors in the gastrointestinal tract. II. L-amino acid sensing by calcium-sensing receptors: implications for GI physiology. Am J Physiol Gastrointest Liver Physiol 291: G753-761

Conigrave AD, Franks AH, Brown EM, Quinn SJ (2002) L-amino acid sensing by the calcium- sensing receptor: a general mechanism for coupling protein and calcium metabolism? Eur J Clin Nutr 56: 1072-1080

Conigrave AD, Hampson DR (2006) Broad-spectrum L-amino acid sensing by class 3 G- protein-coupled receptors. Trends Endocrinol Metab 17: 398-407

Conigrave AD, Mun HC, Delbridge L, Quinn SJ, Wilkinson M, Brown EM (2004) L-amino acids regulate parathyroid hormone secretion. J Biol Chem 279: 38151-38159

Conigrave AD, Mun HC, Lok HC (2007) Aromatic L-amino acids activate the calcium-sensing receptor. J Nutr 137: 1524S-1527S; discussion 1548S

Conigrave AD, Quinn SJ, Brown EM (2000) L-amino acid sensing by the extracellular Ca2+- sensing receptor. Proc Natl Acad Sci U S A 97: 4814-4819

195

Conley YP, Finegold DN, Peters DG, Cook JS, Oppenheim DS, Ferrell RE (2000) Three novel activating mutations in the calcium-sensing receptor responsible for autosomal dominant hypocalcemia. Mol Genet Metab 71: 591-598

Conley YP, Mukherjee A, Kammerer C, DeKosky ST, Kamboh MI, Finegold DN, Ferrell RE (2009) Evidence supporting a role for the calcium-sensing receptor in Alzheimer disease. Am J Med Genet B Neuropsychiatr Genet 150B: 703-709

Corbetta S, Lania A, Filopanti M, Vicentini L, Ballaré E, Spada A (2002) Mitogen-activated protein kinase cascade in human normal and tumoral parathyroid cells. J Clin Endocrinol Metab 87: 2201-2205

Davey AE, Leach K, Valant C, Conigrave AD, Sexton PM, Christopoulos A (2012) Positive and negative allosteric modulators promote biased signaling at the calcium-sensing receptor. Endocrinology 153: 1232-1241

Davies SL, Gibbons CE, Vizard T, Ward DT (2006) Ca2+-sensing receptor induces Rho kinase- mediated actin stress fiber assembly and altered cell morphology, but not in response to aromatic amino acids. Am J Physiol Cell Physiol 290: C1543-1551

Davies SL, Ozawa A, McCormick WD, Dvorak MM, Ward DT (2007) Protein kinase C- mediated phosphorylation of the calcium-sensing receptor is stimulated by receptor activation and attenuated by calyculin-sensitive phosphatase activity. J Biol Chem 282: 15048-15056

Davies SP, Reddy H, Caivano M, Cohen P (2000) Specificity and mechanism of action of some commonly used protein kinase inhibitors. Biochem J 351: 95-105

de Brito-Ashurst I, Varagunam M, Raftery MJ, Yaqoob MM (2009) Bicarbonate supplementation slows progression of CKD and improves nutritional status. J Am Soc Nephrol 20: 2075-2084

De Jesus Ferreira MC, Bailly C (1998) Extracellular Ca2+ decreases chloride reabsorption in rat CTAL by inhibiting cAMP pathway. Am J Physiol 275: F198-203

Dell'Aquila ME, De Santis T, Cho YS, Reshkin SJ, Caroli AM, Maritato F, Minoia P, Casavola V (2006) Localization and quantitative expression of the calcium-sensing receptor protein in human oocytes. Fertil Steril 85 Suppl 1: 1240-1247

Desfleurs E, Wittner M, Simeone S, Pajaud S, Moine G, Rajerison R, Di Stefano A (1998) Calcium-sensing receptor: regulation of electrolyte transport in the thick ascending limb of Henle's loop. Kidney Blood Press Res 21: 401-412

196

Diaz R, Hurwitz S, Chattopadhyay N, Pines M, Yang Y, Kifor O, Einat MS, Butters R, Hebert SC, Brown EM (1997) Cloning, expression, and tissue localization of the calcium-sensing receptor in chicken (Gallus domesticus). Am J Physiol 273: R1008-1016

Doroszewicz J, Waldegger P, Jeck N, Seyberth H, Waldegger S (2005) pH dependence of extracellular calcium sensing receptor activity determined by a novel technique. Kidney Int 67: 187-192

Dufner MM, Kirchhoff P, Remy C, Hafner P, Muller MK, Cheng SX, Tang LQ, Hebert SC, Geibel JP, Wagner CA (2005) The calcium-sensing receptor acts as a modulator of gastric acid secretion in freshly isolated human gastric glands. Am J Physiol Gastrointest Liver Physiol 289: G1084-1090

Dvorak MM, Riccardi D (2004) Ca2+ as an extracellular signal in bone. Cell Calcium 35: 249- 255

Dzhura I, Chepurny OG, Kelley GG, Leech CA, Roe MW, Dzhura E, Afshari P, Malik S, Rindler MJ, Xu X, Lu Y, Smrcka AV, Holz GG (2010) Epac2-dependent mobilization of intracellular Ca(2)+ by glucagon-like peptide-1 receptor agonist exendin-4 is disrupted in beta-cells of phospholipase C-epsilon knockout mice. J Physiol 588: 4871-4889

Edwards SL (2008) Pathophysiology of acid base balance: the theory practice relationship. Intensive Crit Care Nurs 24: 28-38; quiz 38-40

Egbuna OI, Brown EM (2008) Hypercalcaemic and hypocalcaemic conditions due to calcium- sensing receptor mutations. Best Pract Res Clin Rheumatol 22: 129-148

El Hiani Y, Ahidouch A, Lehen'kyi V, Hague F, Gouilleux F, Mentaverri R, Kamel S, Lassoued K, Brule G, Ouadid-Ahidouch H (2009a) Extracellular signal-regulated kinases 1 and 2 and TRPC1 channels are required for calcium-sensing receptor-stimulated MCF-7 breast cancer cell proliferation. Cell Physiol Biochem 23: 335-346

El Hiani Y, Ahidouch A, Roudbaraki M, Guenin S, Brule G, Ouadid-Ahidouch H (2006) Calcium-sensing receptor stimulation induces nonselective cation channel activation in breast cancer cells. J Membr Biol 211: 127-137

El Hiani Y, Lehen'kyi V, Ouadid-Ahidouch H, Ahidouch A (2009b) Activation of the calcium- sensing receptor by high calcium induced breast cancer cell proliferation and TRPC1 cation channel over-expression potentially through EGFR pathways. Arch Biochem Biophys 486: 58-63

Eren PA, Turan K, Berber I, Canbakan M, Kara M, Tellioglu G, Bugan U, Sevinc C, Turkmen F, Titiz MI (2009) The clinical significance of parathyroid tissue calcium sensing receptor gene

197

polymorphisms and expression levels in end-stage renal disease patients. Clin Nephrol 72: 114-121

Fan G, Goldsmith PK, Collins R, Dunn CK, Krapcho KJ, Rogers KV, Spiegel AM (1997) N-linked glycosylation of the human Ca2+ receptor is essential for its expression at the cell surface. Endocrinology 138: 1916-1922

Fan GF, Ray K, Zhao XM, Goldsmith PK, Spiegel AM (1998) Mutational analysis of the cysteines in the extracellular domain of the human Ca2+ receptor: effects on cell surface expression, dimerization and signal transduction. FEBS Lett 436: 353-356

Farajov EI, Morimoto T, Aslanova UF, Kumagai N, Sugawara N, Kondo Y (2008) Calcium- sensing receptor stimulates luminal K+-dependent H+ excretion in medullary thick ascending limbs of Henle's loop of mouse kidney. Tohoku J Exp Med 216: 7-15

Felder CB, Graul RC, Lee AY, Merkle HP, Sadee W (1999) The Venus flytrap of periplasmic binding proteins: an ancient protein module present in multiple drug receptors. AAPS PharmSci 1: E2

Felsenfeld A, Levine B (2006) Milk alkali syndrome and the dynamics of calcium homeostasis. Clin J Am Soc Nephrol 1: 641-654

Felsenfeld AJ, Rodriguez M, Aguilera-Tejero E (2007) Dynamics of parathyroid hormone secretion in health and secondary hyperparathyroidism. Clin J Am Soc Nephrol 2: 1283-1305

Finney B, Wilkinson WJ, Searchfield L, Cole M, Bailey S, Kemp PJ, Riccardi D (2011) An exon 5-less splice variant of the extracellular calcium-sensing receptor rescues absence of the full-length receptor in the developing mouse lung. Exp Lung Res 37: 269-278

Finney BA, del Moral PM, Wilkinson WJ, Cayzac S, Cole M, Warburton D, Kemp PJ, Riccardi D (2008) Regulation of mouse lung development by the extracellular calcium-sensing receptor, CaR. J Physiol 586: 6007-6019

Fitzpatrick LA, Brandi ML, Aurbach GD (1986a) Calcium-controlled secretion is effected through a guanine nucleotide regulatory protein in parathyroid cells. Endocrinology 119: 2700-2703

Fitzpatrick LA, Brandi ML, Aurbach GD (1986b) Control of PTH secretion is mediated through calcium channels and is blocked by pertussis toxin treatment of parathyroid cells. Biochem Biophys Res Commun 138: 960-965

Frassetto L, Kohlstadt I (2011) Treatment and prevention of kidney stones: an update. Am Fam Physician 84: 1234-1242

198

Frassetto L, Sebastian A (1996) Age and systemic acid-base equilibrium: analysis of published data. J Gerontol A Biol Sci Med Sci 51: B91-99

Frassetto LA, Hsu CY (2009) Metabolic acidosis and progression of chronic kidney disease. J Am Soc Nephrol 20: 1869-1870

Frassetto LA, Morris RC, Sebastian A (1996) Effect of age on blood acid-base composition in adult humans: role of age-related renal functional decline. Am J Physiol 271: F1114-1122

Frassetto LA, Todd KM, Morris RC, Sebastian A (2000) Worldwide incidence of hip fracture in elderly women: relation to consumption of animal and vegetable foods. J Gerontol A Biol Sci Med Sci 55: M585-592

Gama L, Breitwieser GE (1998) A carboxyl-terminal domain controls the cooperativity for extracellular Ca2+ activation of the human calcium sensing receptor. A study with receptor- green fluorescent protein fusions. J Biol Chem 273: 29712-29718

Gama L, Wilt SG, Breitwieser GE (2001) Heterodimerization of calcium sensing receptors with metabotropic glutamate receptors in neurons. J Biol Chem 276: 39053-39059

Gamba G, Friedman PA (2009) Thick ascending limb: the Na(+):K (+):2Cl (-) co-transporter, NKCC2, and the calcium-sensing receptor, CaSR. Pflugers Arch 458: 61-76

Gardner DG, Brown EM, Windeck R, Aurbach GD (1978) Prostaglandin E2 stimulation of adenosine 3',5'-monophosphate accumulation and parathyroid hormone release in dispersed bovine parathyroid cells. Endocrinology 103: 577-582

Garrett JE, Capuano IV, Hammerland LG, Hung BC, Brown EM, Hebert SC, Nemeth EF, Fuller F (1995) Molecular cloning and functional expression of human parathyroid calcium receptor cDNAs. J Biol Chem 270: 12919-12925

Geierstanger B, Jamin M, Volkman BF, Baldwin RL (1998) Protonation behavior of histidine 24 and histidine 119 in forming the pH 4 folding intermediate of apomyoglobin. Biochemistry 37: 4254-4265

Gerbino A, Ruder WC, Curci S, Pozzan T, Zaccolo M, Hofer AM (2005) Termination of cAMP signals by Ca2+ and G(alpha)i via extracellular Ca2+ sensors: a link to intracellular Ca2+ oscillations. J Cell Biol 171: 303-312

Ghanouni P, Schambye H, Seifert R, Lee TW, Rasmussen SG, Gether U, Kobilka BK (2000) The effect of pH on beta(2) adrenoceptor function. Evidence for protonation-dependent activation. J Biol Chem 275: 3121-3127

199

Gibbons C, Davies S, Ward D. (2012) Abstract: Calcium-sensing receptor induces rapid rhomediated actin polymerization more potently than for phospholipase C-mediated signaling. J. Am. Soc. Nephrol.

GlaxoSmithKline. (2013) Study in Healthy Volunteers, to Evaluate the Safety, Efficacy and Dose Responses of SB-751689 (Ronacaleret). http://clinicaltrials.gov.

Godwin SL, Soltoff SP (2002) Calcium-sensing receptor-mediated activation of phospholipase C-gamma1 is downstream of phospholipase C-beta and protein kinase C in MC3T3-E1 osteoblasts. Bone 30: 559-566

Good DW, Watts BA, George T, Meyer JW, Shull GE (2004) Transepithelial HCO3- absorption is defective in renal thick ascending limbs from Na+/H+ exchanger NHE1 null mutant mice. Am J Physiol Renal Physiol 287: F1244-1249

Goodman WG, London G, Amann K, Block GA, Giachelli C, Hruska KA, Ketteler M, Levin A, Massy Z, McCarron DA, Raggi P, Shanahan CM, Yorioka N, Group VCW (2004) Vascular calcification in chronic kidney disease. Am J Kidney Dis 43: 572-579

Grant MP, Stepanchick A, Breitwieser GE (2012) Calcium signaling regulates trafficking of familial hypocalciuric hypercalcemia (FHH) mutants of the calcium sensing receptor. Mol Endocrinol 26: 2081-2091

Grant MP, Stepanchick A, Cavanaugh A, Breitwieser GE (2011) Agonist-driven maturation and plasma membrane insertion of calcium-sensing receptors dynamically control signal amplitude. Sci Signal 4: ra78

Grünberger C, Obermayer B, Klar J, Kurtz A, Schweda F (2006) The Calcium Paradoxon of Renin Release: Calcium Suppresses Renin Exocytosis by Inhibition of Calcium-Dependent Adenylate Cyclases AC5 and AC6. Circulation Research 99: 1197-1206

Günzel D, Amasheh S, Pfaffenbach S, Richter JF, Kausalya PJ, Hunziker W, Fromm M (2009) Claudin-16 affects transcellular Cl- secretion in MDCK cells. J Physiol 587: 3777-3793

Halsted WS, Evans HM (1907) I. The Parathyroid Glandules. Their Blood Supply and their Preservation in Operation upon the Thyroid Gland. Ann Surg 46: 489-506

Hammerland LG, Garrett JE, Hung BC, Levinthal C, Nemeth EF (1998) Allosteric activation of the Ca2+ receptor expressed in Xenopus laevis oocytes by NPS 467 or NPS 568. Mol Pharmacol 53: 1083-1088

200

Handlogten ME, Huang C, Shiraishi N, Awata H, Miller RT (2001) The Ca2+-sensing receptor activates cytosolic phospholipase A2 via a Gqalpha -dependent ERK-independent pathway. J Biol Chem 276: 13941-13948

Handlogten ME, Shiraishi N, Awata H, Huang C, Miller RT (2000) Extracellular Ca(2+)-sensing receptor is a promiscuous divalent cation sensor that responds to lead. Am J Physiol Renal Physiol 279: F1083-1091

Harmati G, Banyasz T, Barandi L, Szentandrassy N, Horvath B, Szabo G, Szentmiklosi JA, Szenasi G, Nanasi PP, Magyar J (2011) Effects of beta-adrenoceptor stimulation on delayed rectifier K(+) currents in canine ventricular cardiomyocytes. Br J Pharmacol 162: 890-896

Hauache OM, Hu J, Ray K, Spiegel AM (2000a) Functional interactions between the extracellular domain and the seven-transmembrane domain in Ca2+ receptor activation. Endocrine 13: 63-70

Hauache OM, Hu J, Ray K, Xie R, Jacobson KA, Spiegel AM (2000b) Effects of a calcimimetic compound and naturally activating mutations on the human Ca2+ receptor and on Ca2+ receptor/metabotropic glutamate chimeric receptors. Endocrinology 141: 4156-4163

Hawkins D, Enyedi P, Brown E (1989) The effects of high extracellular Ca2+ and Mg2+ concentrations on the levels of inositol 1,3,4,5-tetrakisphosphate in bovine parathyroid cells. Endocrinology 124: 838-844

Heath DA (1998) Clinical manifestations of abnormalities of the calcium sensing receptor. Clin Endocrinol (Oxf) 48: 257-258

Hebert SC, Brown EM, Harris HW (1997) Role of the Ca(2+)-sensing receptor in divalent mineral ion homeostasis. J Exp Biol 200: 295-302

Hegyi P, Maléth J, Venglovecz V, Rakonczay Z (2011) Pancreatic ductal bicarbonate secretion: challenge of the acinar Acid load. Front Physiol 2: 36

Hendy G. (2003) Calcium-sensing receptor database. Vol. 2010, pp. Calcium-sensing receptor mutation database.

Hendy GN, D'Souza-Li L, Yang B, Canaff L, Cole DE (2000) Mutations of the calcium-sensing receptor (CASR) in familial hypocalciuric hypercalcemia, neonatal severe hyperparathyroidism, and autosomal dominant hypocalcemia. Hum Mutat 16: 281-296

Hendy GN, Guarnieri V, Canaff L (2009) Calcium-sensing receptor and associated diseases. Prog Mol Biol Transl Sci 89: 31-95

201

Hendy GN, Minutti C, Canaff L, Pidasheva S, Yang B, Nouhi Z, Zimmerman D, Wei C, Cole DE (2003) Recurrent familial hypocalcemia due to germline mosaicism for an activating mutation of the calcium-sensing receptor gene. J Clin Endocrinol Metab 88: 3674-3681

Hermans E, Challiss RA (2001) Structural, signalling and regulatory properties of the group I metabotropic glutamate receptors: prototypic family C G-protein-coupled receptors. Biochem J 359: 465-484

Hjalm G, MacLeod RJ, Kifor O, Chattopadhyay N, Brown EM (2001) Filamin-A binds to the carboxyl-terminal tail of the calcium-sensing receptor, an interaction that participates in CaR-mediated activation of mitogen-activated protein kinase. J Biol Chem 276: 34880- 34887

Ho C, Conner DA, Pollak MR, Ladd DJ, Kifor O, Warren HB, Brown EM, Seidman JG, Seidman CE (1995) A mouse model of human familial hypocalciuric hypercalcemia and neonatal severe hyperparathyroidism. Nat Genet 11: 389-394

Hobson SA, Wright J, Lee F, McNeil SE, Bilderback T, Rodland KD (2003) Activation of the MAP kinase cascade by exogenous calcium-sensing receptor. Mol Cell Endocrinol 200: 189- 198

Hoenderop JG, Nilius B, Bindels RJ (2002) Molecular mechanism of active Ca2+ reabsorption in the distal nephron. Annu Rev Physiol 64: 529-549

Horng JC, Cho JH, Raleigh DP (2005) Analysis of the pH-dependent folding and stability of histidine point mutants allows characterization of the denatured state and transition state for protein folding. J Mol Biol 345: 163-173

Houillier P, Normand M, Froissart M, Blanchard A, Jungers P, Paillard M (1996) Calciuric response to an acute acid load in healthy subjects and hypercalciuric calcium stone formers. Kidney Int 50: 987-997

House MG, Kohlmeier L, Chattopadhyay N, Kifor O, Yamaguchi T, Leboff MS, Glowacki J, Brown EM (1997) Expression of an extracellular calcium-sensing receptor in human and mouse bone marrow cells. J Bone Miner Res 12: 1959-1970

Hu J, Hauache O, Spiegel AM (2000) Human Ca2+ receptor cysteine-rich domain. Analysis of function of mutant and chimeric receptors. J Biol Chem 275: 16382-16389

Hu J, McLarnon SJ, Mora S, Jiang J, Thomas C, Jacobson KA, Spiegel AM (2005) A region in the seven-transmembrane domain of the human Ca2+ receptor critical for response to Ca2+. J Biol Chem 280: 5113-5120

202

Hu J, Reyes-Cruz G, Chen W, Jacobson KA, Spiegel AM (2002) Identification of acidic residues in the extracellular loops of the seven-transmembrane domain of the human Ca2+ receptor critical for response to Ca2+ and a positive allosteric modulator. J Biol Chem 277: 46622-46631

Hu J, Reyes-Cruz G, Goldsmith PK, Spiegel AM (2001) The Venus's-flytrap and cysteine-rich domains of the human Ca2+ receptor are not linked by disulfide bonds. J Biol Chem 276: 6901-6904

Huang C, Handlogten ME, Miller RT (2002) Parallel activation of phosphatidylinositol 4- kinase and phospholipase C by the extracellular calcium-sensing receptor. J Biol Chem 277: 20293-20300

Huang C, Hujer KM, Wu Z, Miller RT (2004) The Ca2+-sensing receptor couples to Galpha12/13 to activate phospholipase D in Madin-Darby canine kidney cells. Am J Physiol Cell Physiol 286: C22-30

Huang C, Sindic A, Hill CE, Hujer KM, Chan KW, Sassen M, Wu Z, Kurachi Y, Nielsen S, Romero MF, Miller RT (2007a) Interaction of the Ca2+-sensing receptor with the inwardly rectifying potassium channels Kir4.1 and Kir4.2 results in inhibition of channel function. Am J Physiol Renal Physiol 292: F1073-1081

Huang SK, Wettlaufer SH, Chung J, Peters-Golden M (2008) Prostaglandin E2 inhibits specific lung fibroblast functions via selective actions of PKA and Epac-1. Am J Respir Cell Mol Biol 39: 482-489

Huang Y, Zhou Y, Wong HC, Castiblanco A, Chen Y, Brown EM, Yang JJ (2010) Calmodulin regulates Ca2+-sensing receptor-mediated Ca2+ signaling and its cell surface expression. J Biol Chem 285: 35919-35931

Huang Y, Zhou Y, Yang W, Butters R, Lee HW, Li S, Castiblanco A, Brown EM, Yang JJ (2007b) Identification and dissection of Ca(2+)-binding sites in the extracellular domain of Ca(2+)- sensing receptor. J Biol Chem 282: 19000-19010

Ikari A, Okude C, Sawada H, Sasaki Y, Yamazaki Y, Sugatani J, Degawa M, Miwa M (2008) Activation of a polyvalent cation-sensing receptor decreases magnesium transport via claudin-16. Biochim Biophys Acta 1778: 283-290

Ivanovski O, Nikolov IG, Joki N, Caudrillier A, Phan O, Mentaverri R, Maizel J, Hamada Y, Nguyen-Khoa T, Fukagawa M, Kamel S, Lacour B, Drüeke TB, Massy ZA (2009) The calcimimetic R-568 retards uremia-enhanced vascular calcification and atherosclerosis in apolipoprotein E deficient (apoE-/-) mice. Atherosclerosis 205: 55-62

203

Janicic N, Soliman E, Pausova Z, Seldin MF, Riviere M, Szpirer J, Szpirer C, Hendy GN (1995) Mapping of the calcium-sensing receptor gene (CASR) to human chromosome 3q13.3-21 by fluorescence in situ hybridization, and localization to rat chromosome 11 and mouse chromosome 16. Mamm Genome 6: 798-801

Jiang YF, Zhang Z, Kifor O, Lane CR, Quinn SJ, Bai M (2002) Protein kinase C (PKC) phosphorylation of the Ca2+ o-sensing receptor (CaR) modulates functional interaction of G proteins with the CaR cytoplasmic tail. J Biol Chem 277: 50543-50549

Justinich CJ, Mak N, Pacheco I, Mulder D, Wells RW, Blennerhassett MG, MacLeod RJ (2008) The extracellular calcium-sensing receptor (CaSR) on human esophagus and evidence of expression of the CaSR on the esophageal epithelial cell line (HET-1A). Am J Physiol Gastrointest Liver Physiol 294: G120-129

Kameda T, Mano H, Yamada Y, Takai H, Amizuka N, Kobori M, Izumi N, Kawashima H, Ozawa H, Ikeda K, Kameda A, Hakeda Y, Kumegawa M (1998) Calcium-sensing receptor in mature osteoclasts, which are bone resorbing cells. Biochem Biophys Res Commun 245: 419-422

Kang G, Chepurny OG, Rindler MJ, Collis L, Chepurny Z, Li WH, Harbeck M, Roe MW, Holz GG (2005) A cAMP and Ca2+ coincidence detector in support of Ca2+-induced Ca2+ release in mouse pancreatic beta cells. J Physiol 566: 173-188

Kawata T, Imanishi Y, Kobayashi K, Kenko T, Wada M, Ishimura E, Miki T, Nagano N, Inaba M, Arnold A, Nishizawa Y (2005) Relationship between parathyroid calcium-sensing receptor expression and potency of the calcimimetic, cinacalcet, in suppressing parathyroid hormone secretion in an in vivo murine model of primary hyperparathyroidism. Eur J Endocrinol 153: 587-594

Kifor O, Diaz R, Butters R, Brown EM (1997) The Ca2+-sensing receptor (CaR) activates phospholipases C, A2, and D in bovine parathyroid and CaR-transfected, human embryonic kidney (HEK293) cells. J Bone Miner Res 12: 715-725

Kifor O, Diaz R, Butters R, Kifor I, Brown EM (1998) The calcium-sensing receptor is localized in caveolin-rich plasma membrane domains of bovine parathyroid cells. J Biol Chem 273: 21708-21713

Kifor O, Kifor I, Moore FD, Jr., Butters RR, Jr., Cantor T, Gao P, Brown EM (2003) Decreased expression of caveolin-1 and altered regulation of mitogen-activated protein kinase in cultured bovine parathyroid cells and human parathyroid adenomas. J Clin Endocrinol Metab 88: 4455-4464

Kifor O, MacLeod RJ, Diaz R, Bai M, Yamaguchi T, Yao T, Kifor I, Brown EM (2001) Regulation of MAP kinase by calcium-sensing receptor in bovine parathyroid and CaR-transfected HEK293 cells. Am J Physiol Renal Physiol 280: F291-302

204

Kong S, Zhang C, Li W, Wang L, Luan H, Wang WH, Gu R (2012) Stimulation of Ca2+-sensing receptor inhibits the basolateral 50-pS K channels in the thick ascending limb of rat kidney. Biochim Biophys Acta 1823: 273-281

Kopple JD, Kalantar-Zadeh K, Mehrotra R (2005) Risks of chronic metabolic acidosis in patients with chronic kidney disease. Kidney Int Suppl : S21-27

Kovacic V, Roguljic L (2003) Metabolic acidosis of chronically hemodialyzed patients. Am J Nephrol 23: 158-164

Kragh-Hansen U, Vorum H (1993) Quantitative analyses of the interaction between calcium ions and human serum albumin. Clin Chem 39: 202-208

Kraut JA, Madias NE (2011) Consequences and therapy of the metabolic acidosis of chronic kidney disease. Pediatr Nephrol 26: 19-28

Krieger NS, Sessler NE, Bushinsky DA (1992) Acidosis inhibits osteoblastic and stimulates osteoclastic activity in vitro. Am J Physiol 262: F442-448

Kronenberg H, Fischer I (1995) Overview. Bone 17: S31-S32

Kurtz I, Maher T, Hulter HN, Schambelan M, Sebastian A (1983) Effect of diet on plasma acid-base composition in normal humans. Kidney Int 24: 670-680

Lazarus S, Pretorius CJ, Khafagi F, Campion KL, Brennan SC, Conigrave AD, Brown EM, Ward DT (2011) A novel mutation of the primary protein kinase C phosphorylation site in the calcium-sensing receptor causes autosomal dominant hypocalcemia. Eur J Endocrinol 164: 429-435

Lee HJ, Mun HC, Lewis NC, Crouch MF, Culverston EL, Mason RS, Conigrave AD (2007) Allosteric activation of the extracellular Ca2+-sensing receptor by L-amino acids enhances ERK1/2 phosphorylation. Biochem J 404: 141-149

Lemann J (1999) Relationship between urinary calcium and net acid excretion as determined by dietary protein and potassium: a review. Nephron 81 Suppl 1: 18-25

Levinthal C, Barkdull L, Jacobson P, Storjohann L, Van Wagenen BC, Stormann TM, Hammerland LG (2009) Modulation of group III metabotropic glutamate receptors by hydrogen ions. Pharmacology 83: 88-94

205

Lloyd SE, Pannett AA, Dixon PH, Whyte MP, Thakker RV (1999) Localization of familial benign hypercalcemia, Oklahoma variant (FBHOk), to chromosome 19q13. Am J Hum Genet 64: 189-195

Lo KW, Ashe KM, Kan HM, Lee DA, Laurencin CT (2011) Activation of cyclic amp/protein kinase: a signaling pathway enhances osteoblast cell adhesion on biomaterials for regenerative engineering. J Orthop Res 29: 602-608

Lopez I, Aguilera-Tejero E, Estepa JC, Rodriguez M, Felsenfeld AJ (2004) Role of acidosis- induced increases in calcium on PTH secretion in acute metabolic and respiratory acidosis in the dog. Am J Physiol Endocrinol Metab 286: E780-785

Lopez I, Aguilera-Tejero E, Felsenfeld AJ, Estepa JC, Rodriguez M (2002) Direct effect of acute metabolic and respiratory acidosis on parathyroid hormone secretion in the dog. J Bone Miner Res 17: 1691-1700

Lopez I, Rodriguez M, Felsenfeld AJ, Estepa JC, Aguilera-Tejero E (2003) Direct suppressive effect of acute metabolic and respiratory alkalosis on parathyroid hormone secretion in the dog. J Bone Miner Res 18: 1478-1485

Lorenz S, Frenzel R, Paschke R, Breitwieser GE, Miedlich SU (2007) Functional desensitization of the extracellular calcium-sensing receptor is regulated via distinct mechanisms: role of G protein-coupled receptor kinases, protein kinase C and beta- arrestins. Endocrinology 148: 2398-2404

Loretz CA, Pollina C, Hyodo S, Takei Y, Chang W, Shoback D (2004) cDNA cloning and functional expression of a Ca2+-sensing receptor with truncated C-terminal tail from the Mozambique tilapia (Oreochromis mossambicus). J Biol Chem 279: 53288-53297

Ludwig MG, Vanek M, Guerini D, Gasser JA, Jones CE, Junker U, Hofstetter H, Wolf RM, Seuwen K (2003) Proton-sensing G-protein-coupled receptors. Nature 425: 93-98

López-Barneo J, Armstrong CM (1983) Depolarizing response of rat parathyroid cells to divalent cations. J Gen Physiol 82: 269-294

MacCallum WG, Voegtlin C (1976) Nutrition classics. Bulletin of the Johns Hopkins Hospital 19:91-2; 1908. On the relation of the parathyroid to calcium metabolism and the nature of tetany. W.G. MacCallum and C. Voegtlin. Nutr Rev 34: 212-213

MacLeod RJ, Chattopadhyay N, Brown EM (2003) PTHrP stimulated by the calcium-sensing receptor requires MAP kinase activation. Am J Physiol Endocrinol Metab 284: E435-442

206

Maiti A, Hait NC, Beckman MJ (2008) Extracellular calcium-sensing receptor activation induces vitamin D receptor levels in proximal kidney HK-2G cells by a mechanism that requires phosphorylation of p38alpha MAPK. J Biol Chem 283: 175-183

Mamillapalli R, Wysolmerski J The calcium-sensing receptor couples to Galpha(s) and regulates PTHrP and ACTH secretion in pituitary cells. J Endocrinol 204: 287-297

Maruyama Y, Yasuda R, Kuroda M, Eto Y (2012) Kokumi substances, enhancers of basic tastes, induce responses in calcium-sensing receptor expressing taste cells. PLoS One 7: e34489

Massry SG, Kurokawa K, Arieff AI, Ben-Isaac C (1974) Editorial: Metabolic acidosis of hyperparathyroidism. Arch Intern Med 134: 385-387

Mayo CH (1909) VIII. The Parathyroid Question. Ann Surg 50: 79-83

McCormick W (2008) Characterisation of calcium-sensing receptor signalling and feedback regulation in endogenous expression systems. Doctor of Philosophy (PhD) Thesis, Faculty of Life Sciences, University of Manchester,

McCormick WD, Atkinson-Dell R, Campion KL, Mun HC, Conigrave AD, Ward DT (2010) Increased receptor stimulation elicits differential calcium-sensing receptor(T888) dephosphorylation. J Biol Chem 285: 14170-14177

McLarnon S, Holden D, Ward D, Jones M, Elliott A, Riccardi D (2002) Aminoglycoside antibiotics induce pH-sensitive activation of the calcium-sensing receptor. Biochem Biophys Res Commun 297: 71-77

McLean FC (1957) The parathyroid hormone and bone. Clin Orthop 9: 46-60

Membreno L, Chen TH, Woodley S, Gagucas R, Shoback D (1989) The effects of protein kinase-C agonists on parathyroid hormone release and intracellular free Ca2+ in bovine parathyroid cells. Endocrinology 124: 789-797

Mendoza FJ, Perez-Marin CC, Garcia-Marin L, Madueno JA, Henley C, Aguilera-Tejero E, Rodriguez M Localization, distribution, and function of the calcium-sensing receptor in sperm. J Androl 33: 96-104

Molostvov G, Fletcher S, Bland R, Zehnder D (2008) Extracellular calcium-sensing receptor mediated signalling is involved in human vascular smooth muscle cell proliferation and apoptosis. Cell Physiol Biochem 22: 413-422

207

Muller S, Gotz M, Beier D (2009) Histidine residue 94 is involved in pH sensing by histidine kinase ArsS of Helicobacter pylori. PLoS One 4: e6930

Mun HC, Culverston EL, Franks AH, Collyer CA, Clifton-Bligh RJ, Conigrave AD (2005) A double mutation in the extracellular Ca2+-sensing receptor's venus flytrap domain that selectively disables L-amino acid sensing. J Biol Chem 280: 29067-29072

Mun HC, Franks AH, Culverston EL, Krapcho K, Nemeth EF, Conigrave AD (2004) The Venus Fly Trap domain of the extracellular Ca2+ -sensing receptor is required for L-amino acid sensing. J Biol Chem 279: 51739-51744

Mundell SJ, Matharu AL, Pula G, Roberts PJ, Kelly E (2001) Agonist-induced internalization of the metabotropic glutamate receptor 1a is arrestin- and dynamin-dependent. J Neurochem 78: 546-551

Nagase T, Murakami T, Tsukada T, Kitamura R, Chikatsu N, Takeo H, Takata N, Yasuda H, Fukumoto S, Tanaka Y, Nagata N, Yamaguchi K, Akatsu T, Yamamoto M (2002) A family of autosomal dominant hypocalcemia with a positive correlation between serum calcium and magnesium: identification of a novel gain of function mutation (Ser(820)Phe) in the calcium-sensing receptor. J Clin Endocrinol Metab 87: 2681-2687

Naito T, Saito Y, Yamamoto J, Nozaki Y, Tomura K, Hazama M, Nakanishi S, Brenner S (1998) Putative pheromone receptors related to the Ca2+-sensing receptor in Fugu. Proc Natl Acad Sci U S A 95: 5178-5181

Nakajima K, Yamazaki K, Kimura H, Takano K, Miyoshi H, Sato K (2009) Novel gain of function mutations of the calcium-sensing receptor in two patients with PTH-deficient hypocalcemia. Intern Med 48: 1951-1956

Nearing J, Betka M, Quinn S, Hentschel H, Elger M, Baum M, Bai M, Chattopadyhay N, Brown EM, Hebert SC, Harris HW (2002) Polyvalent cation receptor proteins (CaRs) are salinity sensors in fish. Proc Natl Acad Sci U S A 99: 9231-9236

Nemeth EF (2002) The search for calcium receptor antagonists (calcilytics). J Mol Endocrinol 29: 15-21

Nemeth EF (2004) Calcimimetic and calcilytic drugs: just for parathyroid cells? Cell Calcium 35: 283-289

Nemeth EF (2006) Misconceptions about calcimimetics. Ann N Y Acad Sci 1068: 471-476

Nemeth EF, Carafoli E (1990) The role of extracellular calcium in the regulation of intracellular calcium and cell function. Cell Calcium 11: 319-321

208

Nemeth EF, Delmar EG, Heaton WL, Miller MA, Lambert LD, Conklin RL, Gowen M, Gleason JG, Bhatnagar PK, Fox J (2001) Calcilytic compounds: potent and selective Ca2+ receptor antagonists that stimulate secretion of parathyroid hormone. J Pharmacol Exp Ther 299: 323-331

Nemeth EF, Heaton WH, Miller M, Fox J, Balandrin MF, Van Wagenen BC, Colloton M, Karbon W, Scherrer J, Shatzen E, Rishton G, Scully S, Qi M, Harris R, Lacey D, Martin D (2004) Pharmacodynamics of the type II calcimimetic compound cinacalcet HCl. J Pharmacol Exp Ther 308: 627-635

Nemeth EF, Scarpa A (1986) Cytosolic Ca2+ and the regulation of secretion in parathyroid cells. FEBS Lett 203: 15-19

Nemeth EF, Scarpa A (1987) Rapid mobilization of cellular Ca2+ in bovine parathyroid cells evoked by extracellular divalent cations. Evidence for a cell surface calcium receptor. J Biol Chem 262: 5188-5196

Nemeth EF, Steffey ME, Hammerland LG, Hung BC, Van Wagenen BC, DelMar EG, Balandrin MF (1998) Calcimimetics with potent and selective activity on the parathyroid calcium receptor. Proc Natl Acad Sci U S A 95: 4040-4045

Nemeth EF, Wallace J, Scarpa A (1986) Stimulus-secretion coupling in bovine parathyroid cells. Dissociation between secretion and net changes in cytosolic Ca2+. J Biol Chem 261: 2668-2674

Nesbit MA, Hannan FM, Howles SA, Reed AA, Cranston T, Thakker CE, Gregory L, Rimmer AJ, Rust N, Graham U, Morrison PJ, Hunter SJ, Whyte MP, McVean G, Buck D, Thakker RV (2013) Mutations in AP2S1 cause familial hypocalciuric hypercalcemia type 3. Nat Genet 45: 93-97

O'Connor V, El Far O, Bofill-Cardona E, Nanoff C, Freissmuth M, Karschin A, Airas JM, Betz H, Boehm S (1999) Calmodulin dependence of presynaptic metabotropic glutamate receptor signaling. Science 286: 1180-1184

O'Hara P, Sheppard P, Thøgersen H, Venezia D, Haldeman B, McGrane V, Houamed K, Thomsen C, Gilbert T, Mulvihill E (1993) The ligand-binding domain in metabotropic glutamate receptors is related to bacterial periplasmic binding proteins. Neuron 11: 41-52

Oberleithner H, Greger R, Lang F (1982) The effect of respiratory and metabolic acid-base changes on ionized calcium concentration: in vivo and in vitro experiments in man and rat. Eur J Clin Invest 12: 451-455

209

Oda Y, Tu CL, Pillai S, Bikle DD (1998) The calcium sensing receptor and its alternatively spliced form in keratinocyte differentiation. J Biol Chem 273: 23344-23352

Ohanian J, Gatfield KM, Ward DT, Ohanian V (2005) Evidence for a functional calcium- sensing receptor that modulates myogenic tone in rat subcutaneous small arteries. Am J Physiol Heart Circ Physiol 288: H1756-1762

Ohsu T, Amino Y, Nagasaki H, Yamanaka T, Takeshita S, Hatanaka T, Maruyama Y, Miyamura N, Eto Y (2010) Involvement of the calcium-sensing receptor in human taste perception. J Biol Chem 285: 1016-1022

Oka M, Ohtake T, Mochida Y, Ishioka K, Maesato K, Moriya H, Hidaka S, Kobayashi S (2012) Correlation of coronary artery calcification with pre-hemodialysis bicarbonate levels in patients on hemodialysis. Ther Apher Dial 16: 267-271

Ortiz-Capisano MC, Reddy M, Mendez M, Garvin JL, Beierwaltes WH (2013) Juxtaglomerular cell CaSR stimulation decreases renin release via activation of the PLC/IP3 pathway and the ryanodine receptor. American Journal of Physiology - Renal Physiology 304: F248-F256

Pace AJ, Gama L, Breitwieser GE (1999) Dimerization of the calcium-sensing receptor occurs within the extracellular domain and is eliminated by Cys --> Ser mutations at Cys101 and Cys236. J Biol Chem 274: 11629-11634

Papadopoulos JS, Agarwala R (2007) COBALT: constraint-based alignment tool for multiple protein sequences. Bioinformatics 23: 1073-1079

Parkash J (2008a) Inflammatory cytokine signaling in insulin producing beta-cells enhances the colocalization correlation coefficient between L-type voltage-dependent calcium channel and calcium-sensing receptor. Int J Mol Med 22: 155-163

Parkash J (2008b) Tumor necrosis factor alpha inducing spatial interactions between calcium-sensing receptor and L-type voltage-dependent calcium channel. Ann N Y Acad Sci 1150: 320-322

Pearce SH, Trump D, Wooding C, Besser GM, Chew SL, Grant DB, Heath DA, Hughes IA, Paterson CR, Whyte MP, et al. (1995) Calcium-sensing receptor mutations in familial benign hypercalcemia and neonatal hyperparathyroidism. J Clin Invest 96: 2683-2692

Pearce SH, Williamson C, Kifor O, Bai M, Coulthard MG, Davies M, Lewis-Barned N, McCredie D, Powell H, Kendall-Taylor P, Brown EM, Thakker RV (1996) A familial syndrome of hypocalcemia with hypercalciuria due to mutations in the calcium-sensing receptor. N Engl J Med 335: 1115-1122

210

Pereira PC, Miranda DM, Oliveira EA, Silva AC (2009) Molecular pathophysiology of renal tubular acidosis. Curr Genomics 10: 51-59

Perez-Castrillon JL, Sanz A, Silva J, Justo I, Velasco E, Duenas A (2006) Calcium-sensing receptor gene A986S polymorphism and bone mass in hypertensive women. Arch Med Res 37: 607-611

Perkovic V, Neal B (2012) Trials in kidney disease--time to EVOLVE. N Engl J Med 367: 2541- 2542

Pi M, Hinson TK, Quarles L (1999) Failure to detect the extracellular calcium-sensing receptor (CasR) in human osteoblast cell lines. J Bone Miner Res 14: 1310-1319

Pi M, Oakley RH, Gesty-Palmer D, Cruickshank RD, Spurney RF, Luttrell LM, Quarles LD (2005) Beta-arrestin- and G protein receptor kinase-mediated calcium-sensing receptor desensitization. Mol Endocrinol 19: 1078-1087

Pi M, Spurney RF, Tu Q, Hinson T, Quarles LD (2002) Calcium-sensing receptor activation of rho involves filamin and rho-guanine nucleotide exchange factor. Endocrinology 143: 3830- 3838

Pollak MR, Brown EM, Estep HL, McLaine PN, Kifor O, Park J, Hebert SC, Seidman CE, Seidman JG (1994) Autosomal dominant hypocalcaemia caused by a Ca(2+)-sensing receptor gene mutation. Nat Genet 8: 303-307

Procino G, Carmosino M, Tamma G, Gouraud S, Laera A, Riccardi D, Svelto M, Valenti G (2004) Extracellular calcium antagonizes forskolin-induced aquaporin 2 trafficking in collecting duct cells. Kidney Int 66: 2245-2255

Quarles LD, Hartle JE, 2nd, Siddhanti SR, Guo R, Hinson TK (1997) A distinct cation-sensing mechanism in MC3T3-E1 osteoblasts functionally related to the calcium receptor. J Bone Miner Res 12: 393-402

Quinn SJ, Bai M, Brown EM (2004) pH Sensing by the calcium-sensing receptor. J Biol Chem 279: 37241-37249

Quinn SJ, Ye CP, Diaz R, Kifor O, Bai M, Vassilev P, Brown E (1997) The Ca2+-sensing receptor: a target for polyamines. Am J Physiol 273: C1315-1323

Racke FK, Nemeth EF (1993) Protein kinase C modulates hormone secretion regulated by extracellular polycations in bovine parathyroid cells. J Physiol 468: 163-176

211

Racz GZ, Kittel A, Riccardi D, Case RM, Elliott AC, Varga G (2002) Extracellular calcium sensing receptor in human pancreatic cells. Gut 51: 705-711

Ray JM, Squires PE, Curtis SB, Meloche MR, Buchan AM (1997a) Expression of the calcium- sensing receptor on human antral gastrin cells in culture. J Clin Invest 99: 2328-2333

Ray K, Clapp P, Goldsmith PK, Spiegel AM (1998) Identification of the sites of N-linked glycosylation on the human calcium receptor and assessment of their role in cell surface expression and signal transduction. J Biol Chem 273: 34558-34567

Ray K, Fan GF, Goldsmith PK, Spiegel AM (1997b) The carboxyl terminus of the human calcium receptor. Requirements for cell-surface expression and signal transduction. J Biol Chem 272: 31355-31361

Ray K, Ghosh SP, Northup JK (2004) The role of cysteines and charged amino acids in extracellular loops of the human Ca(2+) receptor in cell surface expression and receptor activation processes. Endocrinology 145: 3892-3903

Ray K, Hauschild BC, Steinbach PJ, Goldsmith PK, Hauache O, Spiegel AM (1999) Identification of the cysteine residues in the amino-terminal extracellular domain of the human Ca(2+) receptor critical for dimerization. Implications for function of monomeric Ca(2+) receptor. J Biol Chem 274: 27642-27650

Remy C, Kirchhoff P, Hafner P, Busque SM, Mueller MK, Geibel JP, Wagner CA (2007) Stimulatory pathways of the Calcium-sensing receptor on acid secretion in freshly isolated human gastric glands. Cell Physiol Biochem 19: 33-42

Renkema KY, Velic A, Dijkman HB, Verkaart S, van der Kemp AW, Nowik M, Timmermans K, Doucet A, Wagner CA, Bindels RJ, Hoenderop JG (2009) The calcium-sensing receptor promotes urinary acidification to prevent nephrolithiasis. J Am Soc Nephrol 20: 1705-1713

Rey O, Young SH, Papazyan R, Shapiro MS, Rozengurt E (2006) Requirement of the TRPC1 cation channel in the generation of transient Ca2+ oscillations by the calcium-sensing receptor. J Biol Chem 281: 38730-38737

Rey O, Young SH, Yuan J, Slice L, Rozengurt E (2005) Amino acid-stimulated Ca2+ oscillations produced by the Ca2+-sensing receptor are mediated by a phospholipase C/inositol 1,4,5- trisphosphate-independent pathway that requires G12, Rho, filamin-A, and the actin cytoskeleton. J Biol Chem 280: 22875-22882

Reyes-Cruz G, Hu J, Goldsmith PK, Steinbach PJ, Spiegel AM (2001) Human Ca(2+) receptor extracellular domain. Analysis of function of lobe I loop deletion mutants. J Biol Chem 276: 32145-32151

212

Riccardi D, Brown E (2010) Physiology and pathophysiology of the calcium-sensing receptor in the kidney. Am J Physiol Renal Physiol 298: F485-499

Riccardi D, Finney BA, Wilkinson WJ, Kemp PJ (2009) Novel regulatory aspects of the extracellular Ca2+-sensing receptor, CaR. Pflugers Arch 458: 1007-1022

Riccardi D, Hall AE, Chattopadhyay N, Xu JZ, Brown EM, Hebert SC (1998) Localization of the extracellular Ca2+/polyvalent cation-sensing protein in rat kidney. Am J Physiol 274: F611- 622

Riccardi D, Lee WS, Lee K, Segre GV, Brown EM, Hebert SC (1996) Localization of the extracellular Ca(2+)-sensing receptor and PTH/PTHrP receptor in rat kidney. Am J Physiol 271: F951-956

Riccardi D, Park J, Lee WS, Gamba G, Brown EM, Hebert SC (1995) Cloning and functional expression of a rat kidney extracellular calcium/polyvalent cation-sensing receptor. Proc Natl Acad Sci U S A 92: 131-135

Rodriguez M, Nemeth E, Martin D (2005) The calcium-sensing receptor: a key factor in the pathogenesis of secondary hyperparathyroidism. Am J Physiol Renal Physiol 288: F253-264

Rodríguez Soriano J (2002) Renal tubular acidosis: the clinical entity. J Am Soc Nephrol 13: 2160-2170

Rogers KV, Dunn CK, Hebert SC, Brown EM (1997) Localization of calcium receptor mRNA in the adult rat central nervous system by in situ hybridization. Brain Res 744: 47-56

Romano C, Yang WL, O'Malley KL (1996) Metabotropic glutamate receptor 5 is a disulfide- linked dimer. J Biol Chem 271: 28612-28616

Roscioni SS, Prins AG, Elzinga CR, Menzen MH, Dekkers BG, Halayko AJ, Meurs H, Maarsingh H, Schmidt M (2011) Protein kinase A and the exchange protein directly activated by cAMP (Epac) modulate phenotype plasticity in human airway smooth muscle. Br J Pharmacol 164: 958-969

Rubin LA, Peltekova V, Janicic N, Liew CC, Hwang D, Evrovski J, Hendy GN, Cole DE (1997) Calcium sensing receptor gene: analysis of polymorphism frequency. Scand J Clin Lab Invest Suppl 227: 122-125

Rutten MJ, Bacon KD, Marlink KL, Stoney M, Meichsner CL, Lee FP, Hobson SA, Rodland KD, Sheppard BC, Trunkey DD, Deveney KE, Deveney CW (1999) Identification of a functional

213

Ca2+-sensing receptor in normal human gastric mucous epithelial cells. Am J Physiol 277: G662-670

San Gabriel A, Uneyama H, Maekawa T, Torii K (2009) The calcium-sensing receptor in taste tissue. Biochem Biophys Res Commun 378: 414-418

Sands JM, Naruse M, Baum M, Jo I, Hebert SC, Brown EM, Harris HW (1997) Apical extracellular calcium/polyvalent cation-sensing receptor regulates vasopressin-elicited water permeability in rat kidney inner medullary collecting duct. J Clin Invest 99: 1399-1405

Sekler I, Kobayashi S, Kopito RR (1996) A cluster of cytoplasmic histidine residues specifies pH dependence of the AE2 plasma membrane anion exchanger. Cell 86: 929-935

Sherwood LM, Mayer GP, Ramberg CF, Kronfeld DS, Aurbach GD, Potts JT (1968) Regulation of parathyroid hormone secretion: proportional control by calcium, lack of effect of phosphate. Endocrinology 83: 1043-1051

Sherwood LM, Potts JT, Care AD, Mayer GP, Aurbach GD (1966) Evaluation by radioimmunoassay of factors controlling the secretion of parathyroid hormone. Nature 209: 52-55

Shiohara M, Mori T, Mei B, Brown EM, Watanabe T, Yasuda T (2004) A novel gain-of- function mutation (F821L) in the transmembrane domain of calcium-sensing receptor is a cause of severe sporadic hypoparathyroidism. Eur J Pediatr 163: 94-98

Shoback D, Thatcher J, Leombruno R, Brown E (1983) Effects of extracellular Ca++ and Mg++ on cytosolic Ca++ and PTH release in dispersed bovine parathyroid cells. Endocrinology 113: 424-426

Shoback DM, McGhee JM (1988) Fluoride stimulates the accumulation of inositol phosphates, increases intracellular free calcium, and inhibits parathyroid hormone release in dispersed bovine parathyroid cells. Endocrinology 122: 2833-2839

Shoback DM, Membreno LA, McGhee JG (1988) High calcium and other divalent cations increase inositol trisphosphate in bovine parathyroid cells. Endocrinology 123: 382-389

Shoback DM, Thatcher J, Leombruno R, Brown EM (1984) Relationship between parathyroid hormone secretion and cytosolic calcium concentration in dispersed bovine parathyroid cells. Proc Natl Acad Sci U S A 81: 3113-3117

Silve C, Petrel C, Leroy C, Bruel H, Mallet E, Rognan D, Ruat M (2005) Delineating a Ca2+ binding pocket within the venus flytrap module of the human calcium-sensing receptor. J Biol Chem 280: 37917-37923

214

Stepanchick A, McKenna J, McGovern O, Huang Y, Breitwieser GE (2010) Calcium sensing receptor mutations implicated in pancreatitis and idiopathic epilepsy syndrome disrupt an arginine-rich retention motif. Cell Physiol Biochem 26: 363-374

Stewart AK, Kurschat CE, Burns D, Banger N, Vaughan-Jones RD, Alper SL (2007) Transmembrane domain histidines contribute to regulation of AE2-mediated anion exchange by pH. Am J Physiol Cell Physiol 292: C909-918

Tfelt-Hansen J, MacLeod RJ, Chattopadhyay N, Yano S, Quinn S, Ren X, Terwilliger EF, Schwarz P, Brown EM (2003) Calcium-sensing receptor stimulates PTHrP release by pathways dependent on PKC, p38 MAPK, JNK, and ERK1/2 in H-500 cells. Am J Physiol Endocrinol Metab 285: E329-337

Thakker RV (2004) Diseases associated with the extracellular calcium-sensing receptor. Cell Calcium 35: 275-282

Toffaletti J, Savory J, Gitelman HJ (1977) Use of gel filtration to examine the distribution of calcium among serum proteins. Clin Chem 23: 2306-2310

Toke J, Czirjak G, Patocs A, Enyedi B, Gergics P, Csakvary V, Enyedi P, Toth M (2007) Neonatal severe hyperparathyroidism associated with a novel de novo heterozygous R551K inactivating mutation and a heterozygous A986S polymorphism of the calcium-sensing receptor gene. Clin Endocrinol (Oxf) 67: 385-392

Topala CN, Schoeber JP, Searchfield LE, Riccardi D, Hoenderop JG, Bindels RJ (2009) Activation of the Ca2+-sensing receptor stimulates the activity of the epithelial Ca2+ channel TRPV5. Cell Calcium 45: 331-339

VanHouten J, Dann P, McGeoch G, Brown EM, Krapcho K, Neville M, Wysolmerski JJ (2004) The calcium-sensing receptor regulates mammary gland parathyroid hormone-related protein production and calcium transport. J Clin Invest 113: 598-608

Vargas-Poussou R, Huang C, Hulin P, Houillier P, Jeunemaitre X, Paillard M, Planelles G, Dechaux M, Miller RT, Antignac C (2002) Functional characterization of a calcium-sensing receptor mutation in severe autosomal dominant hypocalcemia with a Bartter-like syndrome. J Am Soc Nephrol 13: 2259-2266

Vassilev PM, Ho-Pao CL, Kanazirska MP, Ye C, Hong K, Seidman CE, Seidman JG, Brown EM (1997) Cao-sensing receptor (CaR)-mediated activation of K+ channels is blunted in CaR gene-deficient mouse neurons. Neuroreport 8: 1411-1416

Vezzoli G, Terranegra A, Arcidiacono T, Biasion R, Coviello D, Syren ML, Paloschi V, Giannini S, Mignogna G, Rubinacci A, Ferraretto A, Cusi D, Bianchi G, Soldati L (2007) R990G

215

polymorphism of calcium-sensing receptor does produce a gain-of-function and predispose to primary hypercalciuria. Kidney Int 71: 1155-1162

Wang S, McDonnell EH, Sedor FA, Toffaletti JG (2002) pH effects on measurements of ionized calcium and ionized magnesium in blood. Arch Pathol Lab Med 126: 947-950

Wang W, Lu M, Balazy M, Hebert SC (1997) Phospholipase A2 is involved in mediating the effect of extracellular Ca2+ on apical K+ channels in rat TAL. Am J Physiol 273: F421-429

Wang WH, Lu M, Hebert SC (1996) Cytochrome P-450 metabolites mediate extracellular Ca(2+)-induced inhibition of apical K+ channels in the TAL. Am J Physiol 271: C103-111

Ward DT (2004) Calcium receptor-mediated intracellular signalling. Cell Calcium 35: 217- 228

Ward DT, Brown EM, Harris HW (1998) Disulfide bonds in the extracellular calcium- polyvalent cation-sensing receptor correlate with dimer formation and its response to divalent cations in vitro. J Biol Chem 273: 14476-14483

Ward DT, Hammond TG, Harris HW (1999) Modulation of vasopressin-elicited water transport by trafficking of aquaporin2-containing vesicles. Annu Rev Physiol 61: 683-697

Ward DT, McLarnon SJ, Riccardi D (2002) Aminoglycosides increase intracellular calcium levels and ERK activity in proximal tubular OK cells expressing the extracellular calcium- sensing receptor. J Am Soc Nephrol 13: 1481-1489

Ward DT, Riccardi D (2002) Renal physiology of the extracellular calcium-sensing receptor. Pflugers Arch 445: 169-176

Ward DT, Riccardi D (2012) New concepts in calcium-sensing receptor pharmacology and signalling. Br J Pharmacol 165: 35-48

Washburn DL, Anderson JW, Ferguson AV (2000) A subthreshold persistent sodium current mediates bursting in rat subfornical organ neurones. J Physiol 529 Pt 2: 359-371

Washburn DL, Smith PM, Ferguson AV (1999) Control of neuronal excitability by an ion- sensing receptor (correction of anion-sensing). Eur J Neurosci 11: 1947-1954

Watanabe S, Fukumoto S, Chang H, Takeuchi Y, Hasegawa Y, Okazaki R, Chikatsu N, Fujita T (2002) Association between activating mutations of calcium-sensing receptor and Bartter's syndrome. Lancet 360: 692-694

216

Watanabe T, Bai M, Lane CR, Matsumoto S, Minamitani K, Minagawa M, Niimi H, Brown EM, Yasuda T (1998) Familial hypoparathyroidism: identification of a novel gain of function mutation in transmembrane domain 5 of the calcium-sensing receptor. J Clin Endocrinol Metab 83: 2497-2502

Weston AH, Absi M, Harno E, Geraghty AR, Ward DT, Ruat M, Dodd RH, Dauban P, Edwards G (2008) The expression and function of Ca(2+)-sensing receptors in rat mesenteric artery; comparative studies using a model of type II diabetes. Br J Pharmacol 154: 652-662

Weston AH, Absi M, Ward DT, Ohanian J, Dodd RH, Dauban P, Petrel C, Ruat M, Edwards G (2005) Evidence in favor of a calcium-sensing receptor in arterial endothelial cells: studies with calindol and Calhex 231. Circ Res 97: 391-398

Wettschureck N, Lee E, Libutti SK, Offermanns S, Robey PG, Spiegel AM (2007) Parathyroid- specific double knockout of Gq and G11 alpha-subunits leads to a phenotype resembling germline knockout of the extracellular Ca2+ -sensing receptor. Mol Endocrinol 21: 274-280

White E, McKenna J, Cavanaugh A, Breitwieser GE (2009) Pharmacochaperone-mediated rescue of calcium-sensing receptor loss-of-function mutants. Mol Endocrinol 23: 1115-1123

Wise A, Green A, Main MJ, Wilson R, Fraser N, Marshall FH (1999) Calcium sensing properties of the GABA(B) receptor. Neuropharmacology 38: 1647-1656

Yamaguchi T (2008) The calcium-sensing receptor in bone. J Bone Miner Metab 26: 301-311

Yamaguchi T, Chattopadhyay N, Kifor O, Sanders JL, Brown EM (2000) Activation of p42/44 and p38 mitogen-activated protein kinases by extracellular calcium-sensing receptor agonists induces mitogenic responses in the mouse osteoblastic MC3T3-E1 cell line. Biochem Biophys Res Commun 279: 363-368

Yano S, Brown EM, Chattopadhyay N (2004) Calcium-sensing receptor in the brain. Cell Calcium 35: 257-264

Ye C, Ho-Pao CL, Kanazirska M, Quinn S, Rogers K, Seidman CE, Seidman JG, Brown EM, Vassilev PM (1997) Amyloid-beta proteins activate Ca(2+)-permeable channels through calcium-sensing receptors. J Neurosci Res 47: 547-554

Ye C, Kanazirska M, Quinn S, Brown EM, Vassilev PM (1996a) Modulation by polycationic Ca(2+)-sensing receptor agonists of nonselective cation channels in rat hippocampal neurons. Biochem Biophys Res Commun 224: 271-280

217

Ye C, Rogers K, Bai M, Quinn SJ, Brown EM, Vassilev PM (1996b) Agonists of the Ca(2+)- sensing receptor (CaR) activate nonselective cation channels in HEK293 cells stably transfected with the human CaR. Biochem Biophys Res Commun 226: 572-579

Zajickova K, Vrbikova J, Canaff L, Pawelek PD, Goltzman D, Hendy GN (2007) Identification and functional characterization of a novel mutation in the calcium-sensing receptor gene in familial hypocalciuric hypercalcemia: modulation of clinical severity by vitamin D status. J Clin Endocrinol Metab 92: 2616-2623

Zhang Z, Jiang Y, Quinn SJ, Krapcho K, Nemeth EF, Bai M (2002a) L-phenylalanine and NPS R- 467 synergistically potentiate the function of the extracellular calcium-sensing receptor through distinct sites. J Biol Chem 277: 33736-33741

Zhang Z, Qiu W, Quinn SJ, Conigrave AD, Brown EM, Bai M (2002b) Three adjacent serines in the extracellular domains of the CaR are required for L-amino acid-mediated potentiation of receptor function. J Biol Chem 277: 33727-33735

Zhang Z, Sun S, Quinn SJ, Brown EM, Bai M (2001) The extracellular calcium-sensing receptor dimerizes through multiple types of intermolecular interactions. J Biol Chem 276: 5316-5322

Zong X, Stieber J, Ludwig A, Hofmann F, Biel M (2001) A single histidine residue determines the pH sensitivity of the pacemaker channel HCN2. J Biol Chem 276: 6313-6319

218