Identification and Genetic Mapping of Highly Polymorphic Microsatellite Loci from an EST Database of the Septoria Tritici Blotch

Fungal Genetics and Biology 44 (2007) 398–414 www.elsevier.com/locate/yfgbi

Identiﬁcation and genetic mapping of highly polymorphic microsatellite loci from an EST database of the septoria tritici blotch pathogen Mycosphaerella graminicola q

Stephen B. Goodwin a,*, Theo A.J. van der Lee b, Jessica R. Cavaletto a, Bas te Lintel Hekkert b, Charles F. Crane a, Gert H.J. Kema b

a USDA-ARS, Crop Production and Pest Control Research Unit, Department of Botany and Plant Pathology, 915 West State Street, Purdue University, West Lafayette, IN 47907-2054, USA b Plant Research International B.V., P.O. Box 16, 6700 AA Wageningen, The Netherlands

Received 27 June 2006; accepted 20 September 2006 Available online 30 October 2006

Abstract

A database of 30,137 EST sequences from Mycosphaerella graminicola, the septoria tritici blotch fungus of wheat, was scanned with a custom software pipeline for di- and trinucleotide units repeated tandemly six or more times. The bioinformatics analysis identified 109 putative SSR loci, and for 99 of them, flanking primers were developed successfully and tested for amplification and polymorphism by PCR on five field isolates of diverse origin, including the parents of the standard M. graminicola mapping population. Seventy-seven of the 99 primer pairs generated an easily scored banding pattern and 51 were polymorphic, with up to four alleles per locus, among the isolates tested. Among these 51 loci, 23 were polymorphic between the parents of the mapping population. Twenty-one of these as well as two previously published microsatellite loci were positioned on the existing genetic linkage map of M. graminicola on 13 of the 24 linkage groups. Most (66%) of the primer pairs also amplified bands in the closely related barley pathogen Septoria passerinii, but only six were polymorphic among four isolates tested. A subset of the primer pairs also revealed polymorphisms when tested with DNA from the related banana black leaf streak (Black Sigatoka) pathogen, M. fijiensis. The EST database provided an excellent source of new, highly polymorphic microsatellite markers that can be multiplexed for high-throughput genetic analyses of M. graminicola and related species. Published by Elsevier Inc.

Keywords: Genetic linkage map; Mycosphaerella ﬁjiensis; Mycosphaerella graminicola; Septoria passerinii; Septoria tritici blotch; SSR; Population genetics; Plant pathogen

1. Introduction impact over the last 160 years (Bearchell et al., 2005). Prob- lems caused by this disease were emphasized recently by the Mycosphaerella graminicola (anamorph Septoria tritici) rapid development and spread of resistance to a new class causes septoria tritici blotch, which is the most important of fungicides, the strobilurins (Sierotzki et al., 2005). Due disease of wheat in Western Europe and other grain- to its genetic tractability and high economic significance, producing areas worldwide with a significant economic M. graminicola is developing rapidly as a model for fungi in the order Dothideales (Goodwin et al., 2004). This influenced the US Department of Energy—Joint Genome q Names are necessary to report factually on available data. However, Institute to initiate a genomic sequencing project for the USDA neither guarantees nor warrants the standard of the product, this organism (http://www.jgi.doe.gov/sequencing/why/ and the use of the name implies no approval of the product to the CSP2005/mycosphaerella.html). exclusion of others that also may be suitable. * Corresponding author. Fax: +1 765 494 0363. The sexual cycle of M. graminicola plays a crucial role in E-mail address: [email protected] (S.B. Goodwin). its epidemiology, and genetic variation among field isolates

1087-1845/$ - see front matter Published by Elsevier Inc. doi:10.1016/j.fgb.2006.09.004 S.B. Goodwin et al. / Fungal Genetics and Biology 44 (2007) 398–414 399 is large (Zhan et al., 2003). A range of molecular markers, et al., 2005; Lim et al., 2004; Sainudiin et al., 2004). Within primarily restriction and amplified fragment length poly- EST sequences, microsatellite loci have been identified pri- morphisms (RFLP and AFLP) and random amplified marily in the 50 leader but also in coding regions and occa- polymorphic DNA (RAPD), has aided genetic analyses sionally in introns of unprocessed or improperly spliced of this pathogen. Extensive population genetics analyses messenger RNAs (Kantety et al., 2002; La Rota et al., of M. graminicola have been conducted with RFLP mark- 2005; Serapion et al., 2004). ers (Linde et al., 2002), and AFLP and RAPD markers To address the great need for the identification and were used to construct a genetic linkage map (Kema genetic mapping of new microsatellites in M. graminicola, et al., 2002). However, each of these marker systems has we analyzed a database of 30,137 EST sequences (Kema technical or operational limitations that are overcome by et al., 2003) with a custom bioinformatics pipeline to iden- microsatellite markers (Selkoe and Toonen, 2006). tify potential microsatellites and design flanking primers. Microsatellites, also called simple-sequence repeats The primers were tested for amplification and polymor- (SSR), short tandem repeats (STR), or variable number phism on a panel of five field isolates from the Netherlands, tandem repeats (VNTR), consist of a specific sequence of Algeria and the USA. Microsatellites that showed poly- nucleotides, typically 1–6, repeated tandemly within the morphism between the parents of the M. graminicola map- genome. Like all genetic loci, SSRs are subject to point ping population were integrated into the existing genetic mutations, but slipped-strand mispairing at meiosis or dur- linkage map (Kema et al., 2002). The primers also were ing DNA replication also may occur and can change the successfully used on a limited number of isolates from number of repeat units (Lai and Sun, 2003; Levinson and the related barley pathogen Septoria passerinii and the Gutman, 1987). This process can generate a large number banana black leaf streak fungus M. fijiensis to test whether of alleles at a single microsatellite locus, each differing by they provided polymorphic markers for other members of one or more copies of the repeat unit. For example, in bar- the genus Mycosphaerella. ley up to 34 alleles have been observed in a step-ladder fashion at dinucleotide microsatellite loci (Saghai Maroof 2. Materials and methods et al., 1994). The flanking regions of microsatellite loci usually are identical, so primers can be developed easily for a 2.1. Fungal isolates and culture methods simple PCR amplification to screen for polymorphism on agarose or acrylamide gels, depending on the difference in In total, 27 field isolates of three species were used to test size between the alleles. Microsatellite loci are ideal for for amplification and polymorphism of microsatellites genetics and population biology analyses because they have (Table 1). Seven isolates of Mycosphaerella fijiensis were codominant alleles and are amplified by specific primers, assayed from DNA kindly provided by Dr. Alice Churchill which makes them robust, easily scored, and readily shared (Boyce Thompson Institute of Plant Research, Ithaca, NY, among research groups. In addition, they tend to be more USA). Cultures of the remaining isolates of M. fijiensis, M. polymorphic than other amplifiable markers (Selkoe and graminicola and its close relative S. passerinii were grown Toonen, 2006). on appropriate liquid and solid media as described previ- Microsatellites have been analyzed extensively in ani- ously (Goodwin et al., 2001). Mycelia were collected from mals (Dharma Prasad et al., 2005; Harr et al., 2002) and liquid cultures by filtration, lyophilized and stored at plants (La Rota et al., 2005), and more recently have been 80 C prior to DNA extraction. Long-term storage of used in fungi, oomycetes and mycobionts (Breuillin et al., cultures was on lyophilized filter paper strips at 80 C 2006; Dettman and Taylor, 2004; Ivors et al., 2006; Kaye as described previously (Goodwin et al., 2001). et al., 2003; Walser et al., 2005). Previously, the usual Genetic mapping was performed with the parents and method to develop microsatellites involved hybridization- progeny of the standard mapping population derived from based identification of genomic clones containing possible a cross between the two Dutch field isolates IPO323 and nucleotide repeats, sequencing of the clones and designing IPO94269 (Kema et al., 2002). Fungal culturing and primers that flank the repeat region. This strategy can be DNA extraction for the parents and 71 progeny were as effective, but is costly in resources and time. Its use in the described above. genus Mycosphaerella resulted in the identification of only nine microsatellites in M. graminicola (Owen et al., 1998), 2.2. Identification of microsatellites in an EST database 11 in M. fijiensis (Neu et al., 1999) and 26 in M. musicola (Molina et al., 2001), none of which was mapped. There- A database containing 30,137 EST sequences of M. gra- fore, a great need exists for the identification and genetic minicola isolate IPO323 assembled from ten libraries mapping of additional microsatellite loci in these species. (Kema et al., 2003) was screened for di- and trinucleotide Presently, high-throughput identification of microsatellite combinations repeated tandemly six or more times with a sequences in databases of expressed sequence tag (EST) custom bioinformatics pipeline written in Perl and C. The sequences and completed genomes provides a faster and cutoff value of six repeats was chosen to increase the prob- easier method for identifying microsatellite loci (Breuillin ability of polymorphism among the microsatellites identi- et al., 2006; Feau et al., 2006; Hosid et al., 2005; Karaoglu fied. Unigene sequences containing microsatellites were 400 S.B. Goodwin et al. / Fungal Genetics and Biology 44 (2007) 398–414

Table 1 Isolates of three species of Mycosphaerella used to test for amplification and polymorphism of microsatellites identified in an EST database of M. graminicola Species Isolate Mating type Year of isolation Location of isolation Mycosphaerella fijiensis 8837 —a —— CIRADb 282c — 1990 Tonga, Tongatapu CIRAD 294c — 1988 Papua New Guinea, Madang town CIRAD 301c — 1989 Nigeria, Onne CIRAD 435c — 1988 Papua New Guinea, Morobe CIRAD 436c — 1988 Papua New Guinea, Laloki CIRAD 722 — 1996 Mayotte, Vunapalading CIRAD 743c — 1988 Papua New Guinea, East New Britain CIRAD 275 — 1991 Cameroon, Obala rCRB2 — — — Mycosphaerella graminicola IPO323 mat1-1 1981 The Netherlands IPO94269 mat1-2 1994 The Netherlands IPO95052 mat1-2 1995 Algeria T8 mat1-1 1995 North Dakota, USA T18 mat1-2 1995 North Dakota, USA T27 mat1-2 1995 North Dakota, USA T41 mat1-1 1995 Ohio, USA T44 mat1-1 1995 Ohio, USA T47 mat1-1 1995 Indiana, USA T56 mat1-1 1995 North Dakota, USA T58 mat1-1 1995 North Dakota, USA Septoria passeriniid P63 mat1-1 1995 North Dakota, USA P64 mat1-1 1995 North Dakota, USA P67 mat1-2 1995 North Dakota, USA P75 mat1-1 1995 North Dakota, USA P76 mat1-2 1995 North Dakota, USA P78 mat1-2 1995 Minnesota, USA a Not known or could not be determined. b Isolate number from the collection of the Centre de Coope´ration Internationale en Recherche Agronomique pour le De´veloppement. c Originally collected by Dr. B.A. Fullerton, Horticulture and Food Research Institute, New Zealand. CIRAD282 = original isolate number 743, CIRAD294 = 490, CIRAD301 = 722, CIRAD435 = 302.1, CIRAD436 = 323, and CIRAD743 = 298. d A Mycosphaerella teleomorph has been discovered for this species recently but has not yet been named (Ware et al., 2006).

flagged and primers were designed within the flanking MgCl2, 0.2 lM of each dNTP, 0.32 lM of each primer, regions to amplify each microsatellite from isolate 1 U of HotStarTaq DNA polymerase, and 6–24 ng of IPO323 in four size ranges: 75–125; 150–200; 225–275; template DNA. Reactions were performed in a volume and 300–350 base pairs (bp). Primers were designed with of 25 lL in a Perkin-Elmer 9600 thermal cycler (Foster Primer3 (Whitehead Institute for Biomedical Research, City, CA) or an MJ Research PTC-100 thermal cycler Cambridge, MA, USA) with the following settings: (Watertown, MA) at 95 C for 10 min, 97 C for 1 min, GC_CLAMP = 1; OPT_SIZE = 20; MIN_SIZE = 18; and 95 C for 7 min, followed by 45 cycles of 94 C for MAX_SIZE = 22; MIN_TM = 58; and MAX_TM = 62. 1 min, 50, 55, or 60 C for 1 min, 72 C for 2 min, and Sequences containing microsatellites were analyzed by a final extension of 72 C for 10 min before cooling to blastn and blastx (Altschul et al., 1990) to identify similar- 4 C. PCR products were separated by electrophoresis in ities to previously characterized sequences in GenBank and 3% agarose gels containing 0.5 lg of ethidium bromide thereby deduce possible gene function. Reading frames per milliliter. Products that did not give visible polymor- were predicted as the longest unbroken translation from phisms on agarose gels also were separated on 9% (29:1 each ATG, and were verified by BLAST results when acylamide:bis) non-denaturing polyacrylamide gels and possible. detected by silver staining as described by Adhikari et al. (2003). 2.3. Testing for amplification and degree of polymorphism To test for polymorphism, the two Dutch parents of the mapping population (Kema et al., 2002) plus two of the DNA was extracted from lyophilized mycelia as isolates from the USA (Table 1) were tested with one of described previously (Goodwin et al., 2001). Polymerase the primer pairs for each locus. In addition, an isolate from chain reaction (PCR) consisted of 1 · Q-solution (Qiagen Algeria was tested with about half of the primer pairs. Inc., Valencia, CA), 1 · HotStarTaq PCR buffer, 2 mM Additional primers and different annealing temperatures S.B. Goodwin et al. / Fungal Genetics and Biology 44 (2007) 398–414 401 were tried if no amplification was obtained with the origi- 2.5. Estimation of microsatellite frequencies in other fungi nal pair and cycling conditions. To test for applicability to other species, each primer To compare the frequency of microsatellites in the pair was tested on from 2–4 isolates of the closely related M. graminicola EST database to those of other fungi, (Goodwin and Zismann, 2001; Ware et al., 2006) barley unigene EST data sets for 16 fungi (including an inde- pathogen S. passerinii, and 12 primer pairs were tested on pendent set of ESTs for M. graminicola) and two oomy- DNA from ten isolates of the more distantly related cetes were downloaded from the COGEME (Soanes (Goodwin et al., 2001) banana pathogen M. fijiensis et al., 2002) database on 11 August, 2006 and subjected (Table 1). to the same data-analysis pipeline. The initial analysis Suitability of the microsatellite primers for multiplexing of the M. graminicola data set was completed before was tested in two ways. First, the primers for three micro- clustering of the EST sequences. To allow direct compar- satellite loci with the same annealing temperature but ison with the additional data sets, a second analysis different size ranges were combined into a single PCR. was performed on the M. graminicola ESTs after they Alternatively, separate PCRs were performed and equal were clustered into 10,882 unigene sequences. In addition amounts of each product were combined after amplifica- to calculating the percentage of EST sequences contain- tion. Subsequent analyses of the multiplex reactions were ing a di- or trinucleotide microsatellite, separate Perl on agarose gels as described above. scripts also estimated the average size of EST sequences To confirm amplification of the correct locus and in each database, their percent GC content, and the whether polymorphisms occurred within the microsatellite, number of microsatellites per megabase of DNA the two alleles produced by the parents of the mapping analyzed. population were cloned and sequenced for four microsatellite loci. Cloning of bands and sequencing on an ALFex- press automated DNA sequencer (Amersham Pharmacia 3. Results Biotech, Piscataway, NJ, USA) were as described previously (Goodwin et al., 2001). The raw sequences were analyzed 3.1. Identification of microsatellites within EST sequences and processed with MacDNasis (Hitachi Software, San Francisco, CA, USA). Among the 30,137 EST sequences analyzed, 38 di- and In addition to the newly identified microsatellites, nine 71 trinucleotide microsatellites with repeat numbers of six previously published microsatellite loci (Owen et al., or more were identified. Most microsatellites occurred in 1998) also were tested for polymorphism on the isolates the region 50 to the translation initiation codon, but some of M. graminicola and S. passerinii. Those showing poly- also occurred within coding regions. One microsatellite morphism between the parents of the mapping population (tcc-0010) was found within an intron of an actin gene. also were tested on the progeny and added to the mapping The number of repeat units ranged from 6 to 31, but the data set. majority (80%) of the microsatellites had six or seven repeat units (Table 2). The database also probably contains 2.4. Genetic analysis and mapping of microsatellite markers microsatellites with five or fewer repeats, but those were considered less likely to be polymorphic so were not Microsatellites that were polymorphic between the par- analyzed. ents of the M. graminicola mapping population (Kema Frequencies of the 14 unique classes of di- and trinu- et al., 2002) were tested for Mendelian segregation by v2 cleotide repeats (Jurka and Pethiyagoda, 1995; Katti analysis. Those showing the expected 1:1 segregation were et al., 2001) varied widely among the M. graminicola added to the existing genetic linkage map with JoinMap microsatellites (Fig. 1A). All 14 classes were found except version 3 (Van Ooijen and Voorrips, 2001) as described for trinucleotide repeat classes 5 (AAT/ATA/TAA/ATT/ previously (Kema et al., 2002). The analysis began with TTA/TAT), 8 (ATG/TGA/GAT/CAT/ATC/TCA), and 401 loci and 74 progeny, but 28 progeny for which 100 9 (AGT/GTA/TAG/ACT/CTA/TAC). The most fre- or more marker scores were missing and 27 markers which quent were dinucleotide repeat classes 2 (AG/GA/CT/ showed an aberrant segregation ratio (P value < 0.10), TC) and 3 (AC/CA/TG/GT) with 21 and 15 occurrences were removed. The grouping for mapping was performed each, respectively, and trinucleotide class 6 (AAG/AGA/ with LOD values between 3 and 6. Order of the markers GAA/CTT/TTC/TCT) with 19 occurrences. The remain- was calculated with the default settings of JoinMap 3.0 ing repeat classes were found from 1 to 13 times each except for the maximum allowed Chi-square jump, which (Fig. 1A). sometimes was reduced from 5 to 2 and the LOD value, BLAST searches identified meaningful annotations for which was 0.05 instead of 1 to make sure that all linkage only 20 of the microsatellite-containing EST sequences information was used in the calculation. Finally, we (Table 2). An additional 24 ESTs matched sequences compared the genetic linkage map with the previously without useful annotation (e.g., hypothetical protein or published map and carefully examined the differences, unnamed protein). No matches were found for the remain- particularly regarding the grouping of markers. ing 65 sequences (Table 2). 402 S.B. Goodwin et al. / Fungal Genetics and Biology 44 (2007) 398–414

Table 2 Summary information for 99 microsatellite-containing loci identiﬁed in a database of 30,137 EST sequences of Mycosphaerella graminicola Locus Forward primer Reverse primer Microsatellite summary Tc Annotation (e value) a b (C) Type Class Repeat no. aag-0003 AGGACAAACAGGTGGACGAG TCAAAGTCGTCCTCTGGAGC aag 6 6 55 Translation initiation factor (2e37) aag-0013 CGAACAGCCCTCTACGCTAC GATTCCACCGACTGTTCCAG aag 6 6 55 No match ac-0001 CACCACACCGTCGTTCAAG CGTAAGTTGGTGGAGATGGG ac 3 7 55 No match ac-0002 TGAACATCAACCTCACACGC AGAAGAGGACGACCCACGAG ac 3 7 55 Thioredoxin peroxidase (8e76) ac-0004 TTGCCTTGCAACTTACCTCC GTCCTATCGGACATGACGCC ac 3 6 55 No match ac-0005 AACCGCTATCGACAGCTCAC CCGGACAGCTCAGGAATCTG ac 3 6 55 Vesicle transport protein (6e11) ac-0006 ACATCGCCAGAATCACCTTC GGATGTGCTGGTTGAGTGTG ac 3 6 55 Carbohydrate kinase (5e31) ac-0007 TGCTCGCAAGACATAAAACG CTCTTAGCATTGGTCGGTGG ac 3 15 55 No match ac-0009 AGATCTCCGCAGTCATCACC TCACCAACATTCGCATTGTC ac 3 9 55 No match ac-0010 ATGACCAGAACACCGTCCAC AAGTCCCAGCCTGCATACG ac 3 7 55 No match aca-0002 GAACACCTGTACGTGGTGCC GAATCGTGCCGTTGTTCTG aca 7 6 55 No match ag-0003 ACTTGGGGAGGTGTTGTGAG ACGAATTGTTCATTCCAGCG ag 2 15 55 Hypothetical protein (4e36) ag-0004 AACATGCACGTGTTCGGTC CCCATTTCATTCTCCGTGTC ag 2 6 55 ATP citrate lyase (0.0) ag-0005 AAGGAGAAAGGCAGGACGAC GCATCAAATCTCGTCCCTTG ag 2 6 55 No match ag-0006 TAACCAACACCAGGGGAATG CATCAGTTGTCAGCGAATGG ag 2 7 55 No match ag-0009 GACTCCATTTACCTGTGGCG TGTGAAGGACACGCAAAGAG ag 2 7 55 No match ag-0010 GAGGGAAACAAGTGCGGAG GTCGGGTTGTATTGGTAGCG ag 2 6 55 No match ag-0011 TTGAGCAGGTTACGGAGAGG CCAGCTGGGAGATATTCGTG ag 2 11 60 No match ag-0012 GTGCGAAGACGAGTGGGG CTGTGCATTCCTTCGTGATG ag 2 6 55 No match agc-0009 CGTCTGGGGGTGAGATAATG CTGCCACTGCTCTCCCAG agc 11 6 55 Unknown protein (3e38) at-0001 CGTATTGCTTGGACTCTGGG GATGAAATTCTGCCGTGGAC at 1 6 55 No match caa-0002 TCTGCAGAGATCCCGTTACC ATCCATCACATGACGCACAC caa 7 11 55 No match caa-0003 TCCGTCATCAACAACACCAG TGGCCGTAGAACTGCTGAG caa 7 7 55 Transcription factor (4e21) caa-0004 CAGGACAACCAGGCCAATAC GCGGTATTGACCATCAGGAC caa 7 6 55 Hypothetical protein (3e28) caa-0005 AAGAATCCCACCACCCAAAC CACACGGCTCCTTTGACAC caa 7 8 55 No match cag-0010 CAACAGGCGCAGCAGTTAC GCGTCATGTGAAGGATGTTG cag 11 6 55 No match cca-0001 ACATCCCACCTACCCAATCC CAGGAATCCGAGGGTTATGG cca 13 8 60 Hypothetical protein (3e12) cca-0002 CACAAAGACCAGACCCCAAC GAGTAGTTTTGAGCGCTGGC caa 7 9 55 Hypothetical protein (9e20) cca-0003 TTGTTTGACCGTCGTTCTCTC CAAAGATAGCAGCCCAGGTG cca 13 7 55 No match cca-0004 CATCCGAGACGAAACCACTC GCAGCCTTCTTCTTCGTTTG cca 13 7 55 No match cca-0005 CTCCACAAACGCATTTCCTC TGCGGGTGTGTACGTAAATG cca 13 6 55 No match cca-0006 CTGAACCACACATCTGCCAC CTCACAGCACTCACAGCACC cca 13 7 55 No match ccg-0003 CATTTCGCCTGTCGCTTATC GTTGGGAGCATAACCTGTCG ccg 14 6 55 No match cg-0001 GGGTTGGTCATTACTCGGTG TGTAGTCCTGCAAGTTGCCC cg 4 6 55 Hypothetical protein (4e17) cga-0004 TCCCGAAAGATCACGTCTTG GAGTTGTGGTGGAGGGTTTG cga 12 6 55 Hypothetical protein (4e23) ct-0001 ACGAATCACCAACACGCTTC GATGCGAGTGAGAGGAGAGG ct 2 8 55 Hypothetical protein (5e9) ct-0003 ATTCCTCTCGATCTCGCCTC TTTCATTGCGACAGTCTCCTC ct 2 7 55 Hypothetical protein (2e20) ct-0004 CACCTCACTCCTCAATTCCG GAAAGGTTGGTGTCGTGTCC ct 2 6 55 ATP citrate lyase (0.0) ct-0005 TGACCACTGACCTCCACACC AGAAGTGGCTTGGTGACAGG ct 2 10 55 No match ct-0007 TGCAGGGCATTTAATTGAGG TCCATCCATTTAGGCTCGTC ct 2 6 55 No match ct-0008 CATGACATCTGCACTCTCGC AAGGATTGCAGACAAGAGCG ct 2 7 55 No match ct-0009 GTCGCTCCTGCACTGCTTTC TTGACCTTAGGGGAAAACCC ct 2 6 55 No match ct-0010 GCTCCCAAACTCCTCTCTCC GTTGGCGAGCATTGTGAAG ct 2 9 55 Hypothetical protein (4e65) ct-0011 CCCGCTTATCTCCCTCTCTC ACTGGGCATGGAAGAGCAG ct 2 10 55 No match ctc-0005 AGATGAACTCGTCGGGTGAC CTTCCGGAGAGGGATTGAAG ctc 10 6 55 Hypothetical protein (1e11) gaa-0001 TCGATCCCTCTTCCCTTACC CCGCCTGTTCTAGCTCTTTG gaa 6 9 55 No match S.B. Goodwin et al. / Fungal Genetics and Biology 44 (2007) 398–414 403

Table 2 (continued) Locus Forward primer Reverse primer Microsatellite summary Tc Annotation (e value) a b (C) Type Class Repeat no. gaa-0002 TCTGGCGTCCATTGCTCTAC GAGGGATTGAGGAAGGAAGG gaa 6 31 60 Hypothetical protein (8e14) gaa-0004 CTCGAAATCCTCCTCGAAATC TTTTCCGAGAGGGAAAGAGG gaa 6 7 55 No match gaa-0005 AAATCCTTCTCGAAATCCGC GACGTCTCTAGGGACATGCG gaa 6 6 55 No match gaa-0006 ACCTCCTCGAAAACCTCTCG TGCGCGTATAGGACAGAGTG gaa 6 7 55 No match gaa-0007 GTCTCCACACGTCCCATAGC AGTCCCTCTTCTGCTTCTTGC gaa 6 8 60 Cell pattern formation- associated protein (3e12) gaa-0008 CGATTCGAACGAATAGGTGG TCGCAGAGTTGTAGATCCCC gaa 6 8 55 No match gaa-0009 CTCGAAAACCTCTCGAAATCC GTTGTAGATTCCACCGCCTG gaa 6 7 55 No match gaa-0010 GGTACACCTCCCCTCGAAAC GCGATTTCGATTCGGATTTC gaa 6 7 55 No match gaa-0011 AAAACCTCTTGAAATCCGCC TCCTTTCGAAGGTAACGACG gaa 6 8 55 No match gaa-0013 CAAATTTAGGGATTCCGGATG ATGCTGCATAGTCCCGTCTC gaa 6 7 55 No match gaa-0014 ACCTCCTCGAAAACCTCTCG TGCGCGTATAGGACAGAGTG gaa 6 6 55 No match gaa-0015 CATTGCATGTTTCCTTGTCG TGGCTGAGACTGTGTTGGAG gaa 6 6 55 Hypothetical protein (5e14) gaa-0016 ACCTCCTCGAAAACCTCTCG TGCGCGTATAGGACAGAGTG gaa 6 6 55 No match gac-0001 CTCGTTTTGCACGAAGGAAG TGGATATTCTTGCTGGTGGC gac 12 7 55 No match gac-0002 AATCGACCCCTTCCTTCAAC GGGGGAGAGGCATAGTCTTG gac 12 6 55 No match gac-0003 ATCCCTAGATTACGCCCACC AGCGTGTACTGTCGGAGAGC gac 12 7 55 No match gca-0001 CCCAGGATCCCATTTTCAG AGAATCGTGTTGGGCAAATG gca 11 7 55 Hypothetical protein (2e21) gca-0002 GTGTGAAACGAAAAGCGGAG TACTGGGTATCGAGATCGGC gca 11 6 55 No match gca-0003 TCCTATCAACTCCCGAGACG CCGCACGTAGGAATTTTCAG gca 11 7 55 No match gca-0004 TAACGGTAACGGCAACAACC GTGTACCCTTGAATCGCAGC gca 11 6 55 Hypothetical protein (1e56) gca-0006 CAGCAACAGATTCAGGACCC GATGGTGGGATCCTGCTG gca 11 6 55 Hypothetical protein (2e20) gca-0007 TGGACTTCACGGGAATGAAC ATCGAGAAACTTGTGACGGC gca 11 6 55 Zinc finger protein (3e10) gca-0008 CGCAGGGAGAGCAGTTTCG GCAAGCGAGAAGATGCTACC gca 11 6 60 No match gca-0009 CGAGTTTCGCGAACTACTCC GTGCCTGATTGAGGTTGGAC gca 11 6 60 No match gca-0010 GTGGACTCCGAGGGTGGTAG TTCCCAACAGCATCCGTATC gca 11 6 55 Programmed cell death (2e10) gcc-0001 TGGCTACGGAAACTCCACC AGTCCTTGTGTGGCATAGCAG gcc 14 6 55 No match gcc-0002 CATCAACGAAGCCAACCAG ACCGTTCCTCGGTTGAGTC gcc 14 7 55 Zinc finger protein (3e6) gcc-0003 AAGTTTCGCTTGAACTCCTGC CATCCCACCGTCCACATC gcc 14 7 55 No match gga-0001 GTACGACACGGGCTATGGAG GGCGATGACGATGAAACC gga 10 6 55 No match gga-0002 GAGGAGGAGGAGACCGAGAC ACTCGTCGAAGTGGTGCTTG gga 10 6 60 Ubiquinol-cytochrome C reductase (8e15) ggc-0001 GATACCAAGGTGGCCAAGG CACGTTGGGAGTGTCGAAG ggc 14 8 55 RNA binding protein (4e12) ggc-0002 TCCCTTTCTCGATTTCAACG GTTGGCCGTATTGATCTTGG ggc 14 6 55 No match ggc-0003 GACTAATCTCCTCGCCCTCC CGCCCTTACTCCTCTTCTCC ggc 14 6 60 No match gt-0001 AAGACAGCGAGTTGGACAGC ATGCCAAAGGACTTCAAACG gt 3 6 55 No match gt-0002 AAAATGGTGGAAGAGGTCGG TCCCAACAACAAGGAAATGG gt 3 7 55 No match gt-0003 GCCATGCACGACATCTCC TCAAGGTGGTTCTCGCAGTC gt 3 9 55 Hypothetical protein (3e47) gt-0005 TCTTTCAACCAGAGATGCCC AAGATGATGGCCTTGACAGC gt 3 6 55 Acetyl xylan esterase (9e25) gt-0006 AGACCCAGTGCGTGAAGAAG TTTTCGCACGACAACAGAAG gt 3 7 55 Metallothionein (1e18) gtg-0001 AATGTTCTTGGTGAGCAATCG TCGTCTTCGTCTTCATTCCC gtg 13 6 55 No match tcc-0002 GAATCCACCTCTTCCTTGCC AGGAGGATATCAAGGCCCAG tcc 10 6 60 Hypothetical protein (1e62) tcc-0003 CTCCTCCTCCGGCTACATAAC GTCTTGATTGCATGAACGCC tcc 10 7 60 No match tcc-0004 CTCCTCCTCCGGCTACATAAC GCAGGCCTCATTCAAGTCAG tcc 10 6 60 No match tcc-0005 ACGAGCAACCACTCACCATC GGAGAGGGTGAAAGGAGAGG tcc 10 7 60 High-affinity nickel permease (2e18) tcc-0006 ATCTGGACACCATCCACCAG GTAGGTGGGAGGGTTCATGC tcc 10 6 60 Hypothetical protein (2e9) tcc-0007 TCCCCTCCTCTCCATAATCC ACGAAGGTTGAGGACGAGTG tcc 10 6 60 ATP-dependent RNA helicase (5e22) (continued on next page) 404 S.B. Goodwin et al. / Fungal Genetics and Biology 44 (2007) 398–414

Table 2 (continued) Locus Forward primer Reverse primer Microsatellite summary Tc Annotation (e value) a b (C) Type Class Repeat no. tcc-0008 AAAAGACATGACGCCCGAC ACGAGGAATAATCGCGGAAC tcc 10 7 55 Hypothetical protein (9e26) tcc-0009 TCAATTGCCAATAATTCGGG AGACGAGGCAGTTGGTTGAG tcc 10 8 55 No match tcc-0010 TGTCTTCCCATCCATTGTCG AGTGAGGATACCACGCTTGC tcc 10 6 55 Actin (2e70) tcg-0001 TGATGATGTCCATCACGGAG TGGTTGATGTGTTGGTGAGG tcg 12 6 55 Histone H3 (2e68) tgg-0001 TCCTCGGGATAGCTACGATG TGTTCATGTCCCACTGTTGC tgg 13 6 55 Potential helicase (7e13) ttc-0001 ATGTCGTGCTTGGCCTATTC CCACAGGTCATGCTACCTCC ttc 6 6 55 No match ttc-0002 AAAAAGTGCAGTGAGGTCGC GCGTTGGTTGTGTTTGAGTG ttc 6 6 55 Oxidoreductase (5e62) ttc-0003 GCGGGAGATGAATATGTTGG GGAGGTATGGGTGTTGCTTG ttc 6 7 55 Hypothetical protein (1e56)

a The 14 possible classes of di- and trinucleotide microsatellites are numbered as follows: class 1 = AT/ TA; class 2 = AG/GA/CT/TC; class 3 = AC/ CA/TG/GT; class 4 = GC/CG; class 5 = AAT/ATA/TAA/ATT/TTA/TAT; class 6 = AAG/AGA/GAA/CTT/TTC/TCT; class 7 = AAC/ACA/CAA/ GTT/TTG/TGT; class 8 = ATG/TGA/GAT/CAT/ATC/TCA; class 9 = AGT/GTA/TAG/ACT/CTA/TAC; class 10 = AGG/GGA/GAG/CCT/CTC/ TCC; class 11 = AGC/GCA/CAG/GCT/CTG/TGC; class 12 = ACG/CGA/GAC/CGT/GTC/TCG; class 13 = ACC/CCA/CAC/GGT/GTG/TGG; class 14 = GGC/GCG/CGG/GCC/CCG/CGC. b Number of times the microsatellite sequence was repeated in the original clone. c Annealing temperature used for analysis with this primer pair.

3.2. Amplification and degree of polymorphism with a maximum of three alleles (Table 3). Interestingly, three of the loci that were polymorphic among the isolates Primers were developed in one or more size ranges for 99 of S. passerinii were monomorphic among the isolates of of the 109 microsatellites (Table 2). For the remaining 10, M. graminicola tested (Table 3). the microsatellite occurred too near an end of the contig Eight of the 12 primer pairs tested on 10 isolates of M. for successful primer design. These 10 are included in fijiensis also gave good amplification, and several appeared the summary numbers in Section 3.1 but are not listed in to identify polymorphisms (Fig. 4). However, the sizes of Table 2. the bands were different from those from M. graminicola Among the 99 primer pairs tested on the M. graminicola (data not shown). field isolates, 77 gave clear, easily scorable banding pat- Nine previously published microsatellite loci (Owen terns (Table 3). The remaining 22 gave amplification, but et al., 1998) also were tested and all but one gave scorable the bands were indistinct, too numerous to be resolved, amplifications on the isolates of M. graminicola (Table 4). or not of the expected size. Alternative sets of primers were Five of the nine were polymorphic, two of which had three made for some of the loci that did not yield scorable bands alleles. One of the three alleles in each case was a null, i.e., in the initial tests, and these second primer sets often solved lacked a band (Table 4). Two loci were polymorphic the difficulty. A locus was not analyzed further if scorable between the parents of the mapping population. Seven of amplification patterns were not obtained with the second these previously published primer pairs also worked well set of primers. with DNA of S. passerinii, but the only polymorphism The level of polymorphism among the four or five iso- was a null allele at locus ST1B3. lates tested was very high, regardless of microsatellite class Multiplexing by combining multiple primers in the same (Fig. 1B); at least two alleles were detected at 51 loci (52% reaction mix or by analyzing the results of separate ampli- of the total loci tested and 66% of those with scorable fications in single gel lanes both gave excellent results on amplifications). Six loci had three alleles and five had four agarose gels and up to three loci with non-overlapping (Table 3, Fig. 2). Twenty-three microsatellite loci were allele sizes could be analyzed simultaneously (Fig. 5). High- polymorphic between the parents of the mapping popula- er levels of multiplexing should be possible but were not tion (IPO323 · IPO94269). When the scores were com- tested. bined into multilocus haplotypes, each isolate was Sequence analysis of the alleles possessed by the par- unique, except for some of those that were tested on 15 ents of the mapping population at four loci confirmed or fewer loci. that the size polymorphisms usually were caused by When tested on isolates of S. passerinii, most (66%) of differences in number of repeat units (Fig. 6). However, the primer pairs gave good amplification (Fig. 3), but the these size changes often were accompanied by base sizes of the amplified bands often differed from those substitutions at the boundaries of the microsatellite amplified in M. graminicola and the level of polymorphism region (Fig. 6) and occasionally by mutations in other was much lower. Only six of the 65 loci that gave scorable parts of the sequence, including insertions and deletions amplifications of S. passerinii DNA were polymorphic, (data not shown). S.B. Goodwin et al. / Fungal Genetics and Biology 44 (2007) 398–414 405

A 25 loci allowed two of the smaller linkage groups in the Kema et al. (2002) map to be joined with larger groups. Previous

20 linkage group 10 was joined with linkage group 5, and linkage group 20 was joined to previous linkage group 11. One of the microsatellites helped form a new group of three loci, 15 and two other small new linkage groups also were identiﬁed with the new version of the mapping software. One micro-

Number 10 satellite locus (ac-0007) did not show linkage above the thresholds set for grouping so could not be mapped. One 5 other SSR marker was not mapped because the two amplification products seemed to be derived from different loci, 0 i.e., they were not allelic, possibly because of a duplication 1 2 3 4 5 6 7 8 91011121314 or translocation. Microsatellite class 3.4. Microsatellite frequencies in other fungi B 100 90 The number of di- and trinucleotide microsatellites iden- 80 tified in the unigene EST data sets downloaded from the 70 COGEME database ranged from two for Leptosphaeria 60 maculans to 229 for Magnaporthe grisea (Table 5). These 50 two species also had the lowest (118) and highest (12,354) 40 numbers of EST sequences, respectively. The number of 30 microsatellites per megabase of DNA varied by more than

Percent polymorphic 20 ten fold, from 8.4 in the oomycete Phytophthora infestans to just over 86 for Neurospora crassa. The corresponding 10 values for the two M. graminicola data sets were in the mid- 0 1234567891011121314 dle of the range for fungi: 18.5 for the COGEME EST data Microsatellite class set and 20.3 for the data set analyzed here (Table 5). The percent of EST sequences containing a microsatellite varied Fig. 1. (A) Frequency distribution of the 14 unique classes of di- and more than 11 fold, from 0.49 in Emericella nidulans to 5.58 trinucleotide repeats (Jurka and Pethiyagoda, 1995; Katti et al., 2001) among 109 potential microsatellite loci identified in an EST database of in Cryphonectria parasitica. The numbers of microsatellites Mycosphaerella graminicola. Microsatellite classes are as follows: class per EST tracked those per megabase of DNA with the 1 = AT/ TA; class 2 = AG/GA/CT/TC; class 3 = AC/CA/TG/GT; class exception of Fusarium sporotrichioides, which had a lower 4 = GC/CG; class 5 = AAT/ATA/TAA/ATT/TTA/TAT; class number of microsatellites per EST sequence than would 6 = AAG/AGA/GAA/CTT/TTC/TCT; class 7 = AAC/ACA/CAA/ have been expected (Table 5). This species also had the GTT/TTG/TGT; class 8 = ATG/TGA/GAT/CAT/ATC/TCA; class 9 = AGT/GTA/TAG/ACT/CTA/TAC; class 10 = AGG/GGA/GAG/ lowest average insert size, which probably explains the dis- CCT/CTC/TCC; class 11 = AGC/GCA/CAG/GCT/CTG/TGC; class crepancy; the average size of EST sequences varied consid- 12 = ACG/CGA/GAC/CGT/GTC/TCG; class 13 = ACC/CCA/CAC/ erably (Table 5), and a low average insert size could bias GGT/GTG/TGG; class 14 = GGC/GCG/CGG/GCC/CCG/CGC. (B) the number of microsatellites per EST sequence downward. The percent of microsatellite loci in each class that were polymorphic For this reason, the number of microsatellites per meg- when tested on a sample of four or five isolates of M. graminicola. abase of DNA provides a more valid statistic for compar- ative purposes. No obvious associations were identified 3.3. Segregation analysis and genetic mapping between the number of microsatellites per megabase of DNA and the average size or GC content of EST sequences The microsatellite loci that were polymorphic between (Table 5). the parents of the mapping population had segregation ratios ranging from 28:43 to 35:36, in agreement with the 4. Discussion Mendelian expectation of 1:1 (maximum v2 = 3.169, 0.05 < P < 0.10). Most loci segregated for two alleles of dif- The EST database of Mycosphaerella graminicola pro- ferent size (Fig. 7), but three loci segregated for a null allele vided a rich source of new, highly polymorphic microsat- (where no band was present) and were scored plus/minus. ellite markers. This database was made from 10 libraries In total, 21 of the new microsatellite loci and two of those (7 in vitro,3in planta) covering a wide range of physio- identified previously (Owen et al., 1998) were integrated logical states and consists of 30,137 sequences assembled into the existing genetic linkage map and were positioned into 10,882 contigs (Kema et al., 2003). These contigs on 13 of the 24 linkage groups, with small clusters of micro- likely represent a high proportion of the M. graminicola satellites on linkage groups 2, 5 + 10, and 17 (Fig. 8). The transcriptome. However, only 0.36% of the EST sequenc- new mapping software and the addition of the microsatellite es contained a di- or trinucleotide microsatellite, which is 406 S.B. Goodwin et al. / Fungal Genetics and Biology 44 (2007) 398–414

Table 3 Polymorphism testing of 99 microsatellite-containing loci identiﬁed in a database of 30,137 EST sequences of Mycosphaerella graminicola Locus M. graminicola isolates Total no. of alleles Mapped? S. passerinii isolates Total no. of alleles in a b c d e in M. graminicola f g h i S. passerinii 323 94269 95052 NA1 NA2 SP1 SP2 SP3 SP4 aag-0003 187j 187 187 187 187 1 No 152 152 152 —k 1 aag-0013 *l ****— No888888—1 ac-0001 187 175 187 187 187 2 Yes 62 62 62 62 1 ac-0002 189 191 189 190 189 3 Yes * 223 223 223 1 ac-0004 * * * * * — No * * * — — ac-0005 196 196 — 195 195 2 No 176 176 176 — 1 ac-0006 232 182 — 182 232 2 Yes 102 102 102 — 1 ac-0007 121 120 108 118 118 4 No * * * * — ac-0009 232 232 — 265 265 2 No 445 453 445 453 2 ac-0010 205 205 207 205 205 2 No * 150 150 150 1 aca-0002 * * * * * — No * * * — — ag-0003 252 223 223 247 240 4 Yes * * * * — ag-0004 169 169 172 171 171 3 No * * * — — ag-0005 118 118 * 118 118 1 No 230 — 230 230 1 ag-0006 156 162 162 156 156 2 Yes * * * * — ag-0009 196 198 198 196 196 2 Yes * 104 104 104 1 ag-0010 163 163 163 163 163 1 No 240 — 164 198 3 ag-0011 175 176 175 175 175 2 Yes — — * — — ag-0012 220 220 220 220 220 1 No * * * * — agc-0009 * * * * * — No * * * * — at-0001 175 175 — 175 175 1 No * 128 128 128 1 caa-0002 334 333 * 334 334 2 Yes * * * * — caa-0003 168 168 — 168 168 1 No 172 172 173 — 2 caa-0004 197 197 — 197 197 1 No 197 197 197 197 1 caa-0005 273 273 — 284 284 2 No * * * * — cag-0010 197 197 — 196 197 2 No 227 227 227 227 1 cca-0001 * * — * * — No 253 * 253 253 1 cca-0002 276 276 — 274 274 2 No 274 274 272 274 2 cca-0003 151 151 151 162 151 2 No * * * * — cca-0004 354 349 * 176 177 4 No * 158 158 158 1 cca-0005 * * * * * — No * * * * — cca-0006 252 252 * 252 252 1 No * 350 350 350 1 ccg-0003 167 167 167 167 167 1 No 167 167 167 167 1 cg-0001 200 200 198 200 200 2 No 200 200 200 200 1 cga-0004 175 175 174 175 175 2 No * * * * — ct-0001 * * — * * — No * 133 133 133 1 ct-0003 189 189 — 189 189 1 No 224 224 224 224 1 ct-0004 281 281 278 280 280 3 No 206 206 206 206 1 ct-0005 118 120 119 118 118 3 Yes * * * * — ct-0007 187 187 187 189 189 2 No * * * * — ct-0008 152 152 — 152 152 1 No * * * * — ct-0009 224 224 * 224 224 1 No 117 117 117 117 1 ct-0010 145 145 — 145 145 1 No * * * * — ct-0011 * * — * * — No 135 135 135 * 1 ctc-0005 162 162 161 162 162 2 No 168 168 168 168 1 gaa-0001 210 228 — 228 228 2 Yes — * — 228 1 gaa-0002 * * — * * — No — — — * — gaa-0004 196 168 — 205 205 3 Yes 176 176 176 176 1 gaa-0005 * * * * * — No * * * * — gaa-0006 * * — * * — No 102 102 102 * 1 gaa-0007 255 255 — 255 253 2 No 268 * 254 256 3 gaa-0008 * * — * * — No * * * * — gaa-0009 * * — * * — No 232 232 232 232 1 gaa-0010 * * — * * — No * * * — — gaa-0011 * * — * * — No * * * * — gaa-0013 * * — * * — No 110 110 110 110 1 gaa-0014 * * * * * — No * * * * — gaa-0015 163 163 163 163 163 1 No 318 318 318 318 1 gaa-0016 * * * * * — No * * * * — gac-0001 176 176 — 174 176 2 No 114 114 114 114 1 gac-0002 196 196 194 196 196 2 No * * * * — gac-0003 179 179 — 179 179 1 No 68 68 68 68 1 S.B. Goodwin et al. / Fungal Genetics and Biology 44 (2007) 398–414 407

Table 3 (continued) Locus M. graminicola isolates Total no. of alleles Mapped? S. passerinii isolates Total no. of a b c d e in M. graminicola f g h i alleles in 323 94269 95052 NA1 NA2 SP1 SP2 SP3 SP4 S. passerinii gca-0001 184 184 — 184 184 1 No * * * * — gca-0002 246 246 243 246 246 2 No 120 120 120 120 1 gca-0003 248 248 — 248 239 2 No 97 * 97 97 1 gca-0004 177 174 174 174 174 2 Yes 251 251 251 251 1 gca-0006 300 300 * 300 300 1 No 145 145 145 145 1 gca-0007 166 161 166 166 161 2 Yes 147 147 147 — 1 gca-0008 155 153 155 153 153 2 Yes 155 155 155 155 1 gca-0009 252 252 250 252 252 2 No 252 252 252 252 1 gca-0010 179 182 179 179 179 2 Yes 132 132 132 * 1 gcc-0001 225 225 223 225 225 2 No 119 119 119 119 1 gcc-0002 243 243 — 243 243 1 No 154 * 154 154 1 gcc-0003 155 155 157 155 155 2 No 92 * 92 92 1 gga-0001 154 157 152 157 156 4 Yes 122 122 122 122 1 gga-0002 247 247 * 247 247 1 No 89 89 89 89 1 ggc-0001 227 220 227 227 227 2 Yes * * * * — ggc-0002 152 152 152 152 152 1 No 141 141 141 141 1 ggc-0003 * * * * * — No 279 279 279 279 1 gt-0001 183 183 * 183 175 2 No * 181 181 181 1 gt-0002 171 171 — 171 171 1 No 160 * 160 160 1 gt-0003 152 152 — 152 152 1 No * * * * — gt-0005 325 325 * 325 325 1 No * 262 262 262 1 gt-0006 * * — * * — No 112 * 112 112 1 gtg-0001 176 176 176 177 177 2 No * * * * — tcc-0002 230 230 230 230 230 1 No 308 308 308 308 1 tcc-0003 * * — * * — No * * * * — tcc-0004 * * * 178 177 2 No * * * * — tcc-0005 228 226 * 226 226 2 Yes * * * * — tcc-0006 168 170 170 170 170 2 Yes 204 204 204 204 1 tcc-0007 * * * * * — No 131 131 131 131 1 tcc-0008 152 150 152 152 152 2 Yes 150 * 150 150 1 tcc-0009 157 165 157 159 158 4 Yes 118 118 118 118 1 tcc-0010 171 171 168 168 171 2 No * 171 171 171 1 tcg-0001 116 116 116 116 116 1 No * 203 203 203 1 tgg-0001 253 253 253 254 256 3 No * 253 253 253 1 ttc-0001 162 162 162 169 162 2 No * * * * — ttc-0002 151 151 150 151 151 2 No * 200 200 200 1 ttc-0003 246 246 — 246 246 1 No 152 * 175 175 2

a Isolate IPO323 of M. graminicola was isolated originally from bread wheat in the Netherlands during 1981 and is the mat1-1 parent of the standard mapping population (Kema et al., 2002). b Isolate IPO94269 of M. graminicola was isolated originally from bread wheat in the Netherlands during 1994 and is the mat1-2 parent of the standard mapping population (Kema et al., 2002). c Isolate IPO95052 of M. graminicola was isolated originally from durum wheat in Algeria during 1995. d North America isolate 1 of M. graminicola was one of: T18, T44, or T56. Isolates were grouped to reduce the size and complexity of the table in columns labeled NA1, NA2, SP1, SP2, SP3, and SP4. The original data files without isolate groupings are available from the authors by request. e North America isolate 2 of M. graminicola was one of: T8, T27, T41, T47, or T58. f Septoria passerinii isolate 1 was either P63 or P64. g Septoria passerinii isolate 2 was either P63 or P75. h Septoria passerinii isolate 3 was either P75 or P76. i Septoria passerinii isolate 4 was either P67 or P78. j Estimated sizes of amplification products observed in base pairs. k Not tested or could not be determined. l Amplification pattern could not be scored because too many bands were produced, bands were not well resolved, or were not in the expected size range. low compared to other organisms. For example, similar analyzed the number of microsatellites in the M. gramini- analyses of large EST databases for several grasses iden- cola database was near the middle of those for the other tified di- or trinucleotide microsatellites in 1.3 to 4.4% of fungi analyzed. The reason for the more than 10-fold the sequences (data for di- and trinucleotide repeats were variation in the frequency of microsatellites among spe- recalculated from Table 1 of Kantety et al., 2002). The cies is not known. low number for M. graminicola probably is due to bias Overall, dinucleotide microsatellites were less common in the non-normalized database in favor of ESTs that in the M. graminicola EST database than were those lack microsatellites; when the unigene data set was composed of trinucleotide repeats. This has been noted 408 S.B. Goodwin et al. / Fungal Genetics and Biology 44 (2007) 398–414

1234 56 78 9

Fig. 4. Amplification of polymorphic bands with DNA from Mycosphae- rella fijiensis when tested with primers for microsatellite locus tcc-0008 of Fig. 2. Some microsatellite loci in Mycosphaerella graminicola had up to M. graminicola. Isolates of M. fijiensis in each lane are as follows: lane four alleles when analyzed by acrylamide gel electrophoresis. Locus tcc- 1 = CIRAD275; 2 = 8837; 3 = rCRB2; 4 = CIRAD282; 5 = CIRAD294; 0009 had four alleles with amplification products from approximately 157 6 = CIRAD722; 7 = CIRAD436; 8 = CIRAD722; and 9 = CIRAD743. to 165 base pairs when tested on two isolates from the Netherlands (IPO The locations of four polymorphic bands are indicated by arrows on the 323 and IPO94269) and two from North Dakota, USA (T56 and T58). left. M = 25-base size marker. The size of each marker band is indicated by an arrow on the left. The smallest, most intense band was scored for each isolate; the higher molecular weight amplification products with low other fungi in which this was the first- or second-most fre- intensity were considered artifacts and were not scored. quent class (Karaoglu et al., 2005; Lim et al., 2004). The pattern of trinucleotide microsatellite frequencies in the M. graminicola database also differed somewhat from P67 M P64 P75 P76 P77 those for other plants and fungi. For example, (AAG)n 750 bp was the most common trinucleotide repeat in the M. graminicola database and also in several other fungal genomes 500 bp (Karaoglu et al., 2005; Lim et al., 2004), yet did not occur as commonly among plant EST sequences (Kantety et al., 2002; Thiel et al., 2003). The three trinucleotide microsatel- Fig. 3. Many primers for microsatellite loci in Mycosphaerella graminicola lites that were not detected among the M. graminicola EST also amplify and reveal polymorphisms when tested with DNA from the sequences also were relatively rare in grasses (Kantety related barley pathogen Septoria passerinii. Two alleles of microsatellite et al., 2002) and many fungi (Lim et al., 2004), although locus ac-0009 were identified when tested with five isolates of S. passerinii they were found commonly within some fungal genomes and separated on a 2% agarose gel. Isolates of S. passerinii tested are such as Schizosaccharomyces pombe (Karaoglu et al., indicated above each lane. M = bands for molecular size markers. Sizes in base pairs for two marker bands are indicated by arrows on the left. 2005). The least common microsatellite in most fungal genomes, (CCG)n, was detected at a moderate frequency in M. graminicola but was the most frequent in Magnaporthe gri- previously in EST databases from other organisms (Kant- sea (Karaoglu et al., 2005), which confirms the observation ety et al., 2002; Thiel et al., 2003), and may be because of Lim et al. (2004) that the pattern of microsatellite distri- repeat numbers of trinucleotide microsatellites can change bution is unique in each fungal species. In contrast, (CCG)n without altering the reading frame of the messenger RNA. microsatellites were the most common in several plant spe- It also could be due to the higher number of possible trinu- cies, including barley (Thiel et al., 2003) and sugarcane cleotide combinations compared to those for dinucleotide (Cordeiro et al., 2001). repeats. The most commonly identified individual micro- Although the frequency of microsatellites in the satellite in the M. graminicola database was the dinucleo- Mycosphaerella graminicola EST database was relatively tide (AG)n. A high frequency of (AG)n microsatellites low, the rate of successful primer design and the level of also was reported for grasses (Kantety et al., 2002; Thiel polymorphism both were high. More than half of the loci et al., 2003) and most other fungal genomes (Lim et al., were polymorphic within each of the microsatellite classes 2004). The low frequency of (GC)n microsatellites in the that gave good amplification. This was lower than the M. graminicola EST database also was similar to what 73% reported for genomic and EST-derived microsatellites has been reported in plants (Kantety et al., 2002; Thiel in Magnaporthe grisea (Kaye et al., 2003) but still is quite et al., 2003) and fungi (Karaoglu et al., 2005; Lim et al., high. Two to four alleles were identified for loci that were 2004). However, the very low frequency of (AT)n microsat- polymorphic among only five isolates of Mycosphaerella ellites in the M. graminicola database differed from most graminicola tested. This was low compared to many other S.B. Goodwin et al. / Fungal Genetics and Biology 44 (2007) 398–414 409

Table 4 Summary information and polymorphism testing of nine previously published microsatellite loci for Mycosphaerella graminicola Locus Repeat summary Tc (C) M. graminicola isolates Total allelesg Mapped? S. passerinii isolates Total allelesh Type Classa Numberb 323d 94269e 95052f T56 T58 P64 P67 P75 P76 ST1A2 ggc/ggt 13/14 7/2 55 102i Null —j 98 98 3 No *k * 126 * 1 ST1A4 cgg 14 7 55 98 98 — 98 101 2 No * 98 * 98 1 ST1B3 ccg 14 8 50 203 200 * 203 203 2 Yes * 214 214 Null 2 ST1D7 ac 3 22 55 72 Null — 75 75 3 No * 75 75 75 1 ST1E3 cgg 14 5 60 61 63 63 63 61 2 Yes * * * * ST1E7 cgg 14 5 60 90 90 — 90 90 1 No * 90 90 90 1 ST1G7 tg 3 9 60 85 85 — 85 85 1 No * 85 85 85 1 ST2C10 agcgg — 4 50, 60 * * — * * — No * * * * — ST2E4 ggc 14 5 60 77 77 — 77 77 1 No * 273 273 273 1 a Class 3 = AC/CA/TG/GT; class 13 = ACC/CCA/CAC/GGT/GTG/TGG; class 14 = GGC/GCG/CGG/GCC/CCG/CGC. b Number of times the microsatellite sequence was repeated in the original clone (Owen et al., 1998). c Annealing temperature(s) used for analysis with this primer pair. d Isolate IPO323 of M. graminicola was isolated originally from bread wheat in the Netherlands during 1981 and is the mat1-1 parent of the standard mapping population (Kema et al., 2002). e Isolate IPO94269 of M. graminicola was isolated originally from bread wheat in the Netherlands during 1994 and is the mat1-2 parent of the standard mapping population (Kema et al., 2002). f Isolate IPO95052 of M. graminicola was isolated originally from durum wheat in Algeria during 1995. g Detected among the isolates of M. graminicola tested. h Detected among the isolates of S. passerinii tested. i Estimated sizes of ampliﬁcation products observed in base pairs. j Not tested or could not be determined. k Ampliﬁcation pattern could not be scored because too many bands were produced, bands were not well resolved, or were not in the expected size range.

Locus 1Locus 2 Locus 3 Multiplex will be discovered at the SSR loci of M. graminicola as larg- M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 er samples are analyzed, but they may not be as numerous as those reported at genomic loci in some other fungi. The high success rate and ease of development of primers for microsatellites within EST sequences is an advantage that compensates for their relatively lower frequency and fewer alleles compared to those in non-coding regions of genomes (Hancock, 1995). 125 bp Two other advantages of EST-derived SSR loci are that they usually transfer more readily to other species, and they Fig. 5. Multiplexing of microsatellite primers for simultaneous analysis of three polymorphic loci of Mycosphaerella graminicola. These loci were may be in regions of the genome that are more stable so are chosen because the primers had similar annealing temperatures but gave less likely to have null alleles compared to those identified products that differed in size with no overlap among the alleles. Lane M: in genomic DNA (Thiel et al., 2003). In plants and animals, 25-base-pair ladder (the marker at 125 bp is indicated by an arrow on the transferability of primers for SSR loci is higher among spe- left); lanes 1, 5, 9 and 13: DNA from isolate IPO323; lanes 2, 6, 10 and 14: cies that are closely related and decreases with phylogenetic isolate IPO94269; lanes 3, 7, 11 and 15: progeny isolate 89 from the cross between IPO323 and IPO94269; lanes 4, 8, 12 and 16: progeny isolate 73. distance (Glenn et al., 1996; Thiel et al., 2003). High rates Locus 1 is tcc-0009, Locus 2 is ag-0003 and Locus 3 is caa-0002. Primers of successful transfer of microsatellite primers among for all three loci were combined in a single reaction for the set labeled closely related species also have been noted in fungi (Buc- Multiplex. heli et al., 2000; Enjalbert et al., 2002; Walser et al., 2003). A high proportion of the primers for the M. graminicola EST-derived SSRs also gave amplification when tested fungi, in which maximum allele numbers at a locus ranged with DNA from the very closely related (Goodwin and Zis- from five in Puccinia striiformis (Enjalbert et al., 2002), to mann, 2001; Ware et al., 2006) species S. passerinii as well six (Kaye et al., 2003) or nine (Brondani et al., 2000)in as from the more distantly related (Crous et al., 2001; Magnaporthe grisea,11inBotrytis cinerea (Fournier Goodwin et al., 2001) M. fijiensis, which suggests that some et al., 2002), 14 in Penicillium marneffei (Lasker and Ran, of the primers also will work with other related species. 2004), and 24 in Venturia inaequalis (Gue´rin et al., 2004). However, it is impossible to predict which primers will However, those studies all tested many more isolates than work with which other species, so each must be tested the five that were tested for Mycosphaerella graminicola. empirically. Fewer null alleles at EST-derived microsatellite Furthermore, in other species the highest numbers of alleles loci is an advantage for applications in genetics and popu- almost always were at loci in non-coding genomic regions lation biology, because nulls could have several origins so rather than in EST sequences. Certainly, additional alleles can lead to artificial lumping of different alleles. 410 S.B. Goodwin et al. / Fungal Genetics and Biology 44 (2007) 398–414

Fig. 6. Sequence analysis of microsatellite loci in Mycosphaerella graminicola revealed that most polymorphisms resulted from diﬀerences in the number of repeat units, although point mutations and other insertion/deletion mutations also were found. Sequences of microsatellites in the parents of the M. graminicola mapping population (isolates IPO323 and IPO94269) at loci: (A) tcc-8; and (B) gca-10. A star indicates that both sequences are identical at that base; gaps are indicated by dashes. The ruler indicates the base number from the beginning of the available EST sequence corresponding to each locus.

MP11P2 2 34678910 5 gametic disequilibrium due to their close genetic linkage if such markers were chosen without knowledge of their physical proximity on the same chromosome. The mapped microsatellite loci cover 13 of the 24 linkage groups, five of which have two or more microsatellites 125 bp spanning a large proportion of the linkage block These Fig. 7. Segregation at microsatellite locus ac-0001 of Mycosphaerella loci would be good candidates to assist genetic mapping graminicola among the progeny of the cross between isolates IPO323 and in additional crosses by bulked segregant analysis or IPO94269 (Kema et al., 2002). Lanes: M = 25-base-pair ladder; other approaches. P1 = IPO323; P2 = IP94269; 1–10 are isolates 1, 16, 18, 22, 23, 24, 27, 29, 47, and 50, respectively, of the progeny from the cross between IPO323 All of the microsatellite loci tested except for one segre- and IPO94269. gated according to Mendelian expectation, including those segregating for null alleles. Mendelian segregation of microsatellite loci was demonstrated previously in the fungi Primers for microsatellite amplification have been Ascochyta rabei (Geistlinger et al., 1997a) and Magnapor- developed previously for a wide range of fungi (Brondani the grisea (Kaye et al., 2003). The cause of the null alleles et al., 2000; Eckert et al., 2005; Enjalbert et al., 2002; at the Mycosphaerella graminicola SSR loci is not known Enkerli et al., 2001; Fournier et al., 2002). However, M. for certain but they most likely result from mutations in graminicola is one of the first in which SSR loci have been the sequence complementary to the primers. The one placed on a genetic linkage map, and the results were sim- exception was locus ggc-0003, in which two bands segre- ilar to the mapping of microsatellite loci in Magnaporthe gated independently in a ratio of 1:1:1:1. The cause of this grisea, in which SSRs were distributed on many linkage odd segregation is not known, but most likely is due to a groups (Kaye et al., 2003). Adding 23 microsatellite loci duplication, possibly involving a translocation. Evidence to the linkage map for Mycosphaerella graminicola, along for possible translocations in M. graminicola was reported with new mapping software, allowed some linkage groups previously by Kema et al. (1996). The genomic sequence to be merged. For the merged linkage group 5 + 10, the for one of the parent isolates from the mapping population, new microsatellite data clearly improved the map as IPO323, was generated recently through the Community SSR loci gca-0004 and gca-0007 mapped within the gap Sequencing Program of the U.S. DOE—Joint Genome between the two previous linkage groups 5 and 10. The Institute. A BLAST search of the genomic sequence for new microsatellite data also allowed group 11 of Kema SSR locus ggc-0003 revealed that it occurred as a single et al. (2002) to be joined with linkage group 20, albeit copy on scaffold 20 (results not shown), so it was not dupli- with a low LOD value. Weak linkages between groups 1 cated in isolate IPO323. Therefore, if a duplication caused and 18, and 3 and 16, also were found, but were too weak the aberrant segregation ratio, it must have occurred in iso- to justify their merger so these groups have been retained late IPO94269. separately in the present map. The 24 linkage groups in Sequence analysis of microsatellite loci from both the revised map are slightly more than the 18 chromo- parents confirmed that different alleles usually resulted somes estimated by pulsed-field gel electrophoresis (Kema from variability in the numbers of the repeat units, et al., 2002; McDonald and Martinez, 1991), so a few but other mutations also were observed. These usually gaps remain to be identified. involved changes in the bases just outside of the repeat Another benefit of the mapping analysis is that it will unit. However, some alleles showed many changes provide guidance for selecting markers for future work in throughout the sequence, confirming that, as noted pre- genetics and population biology. For example, some SSR viously in other organisms (Geistlinger et al., 1997b; loci were clustered and would give erroneous measures of Glenn et al., 1996; Walser et al., 2003), slippage of S.B. Goodwin et al. / Fungal Genetics and Biology 44 (2007) 398–414 411

1 2 3 4 5+10 6 7 8

AM10-1306 0 AEGGMpCG,173 AEATMpAG,124 0 BI14-668 AEGCMpCA,174 AEGAMpAC,300 0 AEGAMpCA,449 AEGAMpAC,114 0 0 0 0 0 BEGTMpAT,84 2 AEGAMpCA,265 2 AEGAMpCC,102 6 BEGCMpCA,173 2 AQ12-1593 6 BEGAMpAG,483 12 BEGAMpCG,308 6 AEGGMpCG,139 7 BEGAMpAC,153 BEGAMpAC,290 7 AU8-2952 7 AEGAMpCG,176 18 AEGGMpAT,74 8 AL19-912 9 BEGTMpAT,295 8 11 BL14-1091 21 BM02-1012 AEGAMpAC,289 AR1-760 15 15 AEGAMpCA,87 12 15 BEGAMpCC,390 ag-0003 AEGAMpAC,167 26 ag-0006 BEGAMpAG,141 17 AEGCMpCA,99 BEGAMpAG,262 19 AR9-689 BEGAMpAG,508 18 20 15 BEGTMpAT,745 20 AEGAMpAG,174 AEGAMpCG,262 AEGGMpCG,170 24 BQ12-2209 29 AEGAMpAG,515 24 AEGAMpAG,534 AEATMpAG,71 AEATMpCG,573 ST1B3 28 25 BL12-1100 27 AEGGMpCG,599 AEGAMpCA,73 AM13-2421 BEATMpAG,312 29 27 28 AEGAMpCA,80 34 16 BEATMpCG,607 AEGAMpCA,182 BM13-2272 tcc-0008 32 BEATMpAG,138 31 AEATMpCG,600 AEATMpAG,106 18 AEGGMpAT,426 AEATMpAG,126 38 34 tcc-0005 32 AEGAMpAG,276 BEGAMpAG,256 20 AEGAMpCA,117 34 AEGAMpCA,506 BEGAMpAG,120 37 AW6-889 41 AEGTMpAT,330 38 AEGTMpAT,440 BEGAMpCA,62 AEGAMpAG,123 41 BK20-1677 40 BI13-2323 BEATMpAG,258 40 BW6-916 42 BEGTMpAT,450 23 AEGAMpCC,292 34 AL12-764 BEGGMpAT,577 AK20-1338 44 AEGAMpAC,221 45 AEGAMpCA,108 52 AEGAMpAG,511 AEGGMpAT,444 35 BEATMpCG,642 52 AK20-1951 28 BEGGMpCG,103 47 BEGTMpAT,468 54 BEGAMpAG,241 36 AEATMpAG,514 54 AEGAMpCC,149 50 BEGAMpAG,505 32 AR1-384 51 AEGAMpAG,457 38 AEGAMpAC,513 52 AEGCMpCA,198 61 AR8-2018 42 AM10-1166 BEATMpAG,133 56 caa-0002 44 BM12-570 BEGAMpCC,71 BQ13-2229 AEATMpAG,143 59 55 AEGGMpAT,256 BEGAMpAG,127 62 gca-0007 51 AU8-2239 64 BEGGMpCG,700 49 AEGAMpAG,314 AEGGMpCG,322 64 BEGGMpAT,209 56 BEGGMpCG,81 AEGAMpCC,266 AEGTMpAT,293 AEATMpAG,362 60 62 AEGGMpAT,394 62 AEGCMpCA,226 66 58 BEGAMpAC,556 71 gca-0004 61 BEGAMpAC,134 ac-0002 52 BEATMpAG,391 64 AEGAMpAG,137 AEGAMpAC,558 74 68 BEGGMpCG,430 68 BEGAMpAC,144 67 AEATMpCG,146 ggc-0001 BEGTMpAT,318 BEATMpAG,212 69 70 BEGAMpAC,208 tcc-0006 BEGTMpAT,128 71 AEGAMpCA,239 BL12-1469 77 71 BEGAMpAG,198 73 BEGAMpCC,125 73 AEGAMpAC,212 BEGCMpCA,254 71 AQ13-2006 73 AR8-701 79 BI12-1983 BEGAMpCA,326 AEGGMpCG,209 75 AEGAMpAC,213 81 79 BEGTMpAT,217 81 BEGTMpAT,89 AEGTMpAT,730 81 81 BM02-2221 77 86 AEGAMpCC,580 86 BJ10-2451 82 ST1E3 tcc-0009 AEGAMpCC,370 BEGAMpCG,162 89 BEGGMpAT,162 91 BEGAMpCA,93 86 BEATMpAG,278 BEGAMpAC,489 81 AJ15-1789 BT7-1702 84 97 BEGGMpAT,174 92 94 AEGTMpAT,548 BEGAMpAC,283 BEGGMpCG,147 BEGGMpCG,217 93 95 BM12-682 88 AEGAMpAG,85 BEGCMpCA,238 BEGAMpAG,189 99 94 97 BI14-1303 AEGCMpCA,70 AEATMpCG,197 95 99 BEGGMpAT,401 AEATMpAG,225 101 100 BEGAMpCC,474 AEGCMpCA,193 104 AEATMpCG,561 104 BEGAMpCA,292 103 AEGTMpAT,91 107 AEGTMpAT,557 113 BEGAMpAC,324 112 AEATMpCG,331 114 ag-0011 116 AEGAMpCC,142 117 AEGAMpCA,321 124 AEATMpAG,82 AEGAMpAC,356 AEGTMpAT,188 119 BEATMpCG,205 126 AEATMpCG,141 122 BEGTMpAT,377 BEATMpCG,214 AEGTMpAT,622 127 BT16-2239

141 AW19-1710

9 11+20 12 13 14 15 16 17

0 AEGGMpCG,271 0 gca-0008 0 BEGAMpCG,95 0 AEGAMpAC,147 0 AEATMpCG,106 0 AW 5-976 0 ag-0009 0 AEGAMpAC,176 3 BR3-776 2 BEGGMpCG,469 8 AT1-652 6 BEGTMpAT,637 5 BEGGMpAT,204 AI10-2066 6 AR1-1841 7 AEGAMpCG,356 11 AEGGMpAT,278 AEGTMpAT,366 9 BEGGMpCG,99 10 9 AEGTMpAT,372 AEGCMpCA,160 12 AEGAMpAC,263 BI10-1694 gga-0001 11 BEATMpCG,313 13 BEGGMpAT,112 14 AEGGMpAT,356 BEGAMpCC,68 AEGGMpCG,96 ac-0001 17 16 AJ15-2145 13 BEGAMpCG,213 17 AEGGMpCG,456 MAT 13 BEATMpAG,263 15 AEGAMpCA,474 15 BT1-642 BEGAMpCA,278 BEGAMpCA,342 ct-0005 21 17 22 AEGAMpAC,69 16 AEGGMpCG,188 AEGAMpCA,339 24 BQ16-3625 15 BEGTMpAT,651 BEGAMpCA,214 27 AEGAMpAG,337 gca-0010 20 BR8-2770 BEGAMpAG,208 19 18 29 AN14-2015 AEGCMpCA,421 25 AEGAMpCC,313 31 AEGAMpAG,199 BW9-1105 32 AI14-886 30 AN14-1292 34 AEGAMpCG,85 20 BEGAMpAC,343 24 AEGAMpAC,223 38 AEATMpAG,230 37 BEGCMpCA,82 AR9-3367 40 35 BT1-1901 37 BEGGMpCG,248 46 BEGAMpCA,243 49 AEATMpAG,208 46 AM14-848 51 AEGTMpAT,481 55 AEGCMpCA,320 57 AEGAMpCG,174 58 BEGCMpCA,120 64 BEGAMpCA,288 65 AEGAMpCC,302 64 BEATMpCG,465

74 BEGGMpAT,142 75 AQ12-654 77 AW18-1937 81 gaa-0001 84 BEATMpCG,82 87 BEGAMpAC,129 91 AEGTMpAT,345

107 AM13-1221

18 19 21 22 23 NEW-1 NEW-2 NEW-3

0 AEGGMpAT,195 0 AEGAMpCA,454 0 AM14-1728 AEATMpCA,145 0 BT16-988 0 AEGAMpAG,362 0 BEGAMpAG,194 0 AEGAMpAG,146 2 AEGAMpAG,672 0 Virulence 2 AEATMpCG,279 AEGAMpCA,122 4 AEGGMpCG,130 5 AJ10-1085 2 AEGAMpAG,300 8 AQ16-2694 12 BEGAMpCC,208 16 BEGAMpCG,143 BEGAMpCG,160 12 BEGAMpCC,426 20 AEATMpCG,60 AEGTMpAT,400 AEGAMpCA,150 AEGCMpCA,269 24 AEGGMpAT,596 24 AEGAMpCG,109 22 BEATMpCG,273 23 BEGAMpAC,74 AEATMpCG,311 AEGAMpCC,212 BEGAMpCG,206 27 AEATMpAG,328 28 BM13-1298 31 AEATMpCG,201 gaa-0004 30 AEGTMpAT,676 BEGAMpCA,254 BEGAMpAC,334 33 ac-0006 33 AEGAMpCC,253 36 AEGAMpCC,64 AEGGMpCG,192

Fig. 8. Integration of 23 microsatellite loci into the existing genetic linkage map of Mycosphaerella graminicola. Numbers above each linkage group correspond to those in the map published previously (Kema et al., 2002); inclusion of the microsatellite loci joined two of the smallest linkage groups from the previous map to larger groups. The 23 microsatellite loci mapped to 13 of the linkage groups and are indicated in bold. Those identiﬁed from the EST library are denoted by the type of repeat and locus number, while those published by Owen et al. (1998) are denoted by the preﬁx ST. 412 S.B. Goodwin et al. / Fungal Genetics and Biology 44 (2007) 398–414

Table 5 Frequency of di- and trinucleotide microsatellites in EST databases of two oomycetes and 16 species of fungi, including two independent databases from Mycosphaerella graminicola, sorted by the number of microsatellites per megabase of DNA analyzed Species No. of EST Mean length Total Percent Total no. of Microsatellites Microsatellites per sequences of ESTs nucleotides GC microsatellites per EST Mb DNA Phytophthora infestans 1414 590.3 834,710 55.5 7 0.50 8.39 Emericella nidulans 6559 514.3 3,373,161 51.9 32 0.49 9.49 Blumeria graminis 3253 483.8 1,573,802 43.2 17 0.52 10.80 Sclerotinia sclerotiorum 738 667.8 492,860 44.5 9 1.22 18.26 Gibberella zeae 4687 706.9 3,313,162 51.4 61 1.30 18.41 Mycosphaerella graminicola 2926 664.4 1,944,100 55.1 36 1.23 18.52 Fusarium sporotrichioides 3439 388.0 1,334,452 50.0 26 0.76 19.48 Mycosphaerella graminicolaa 10,882 560.3 6,097,008 55.3 124 1.14 20.34 Cladosporium fulvum 512 609.0 311,792 53.6 7 1.37 22.45 Leptosphaeria maculans 118 515.1 60,784 53.2 2 1.69 32.90 Phytophthora sojae 7306 630.1 4,603,572 60.0 154 2.11 33.45 Magnaporthe grisea 12,354 526.3 6,502,220 53.1 229 1.85 35.22 Ustilago maydis 4272 559.4 2,389,830 56.2 85 1.99 35.56 Botryotinia fuckeliana 2842 720.3 2,047,127 45.2 78 2.74 38.10 Verticillium dahliae 1455 639.5 930,481 58.3 37 2.54 39.76 Aspergillus niger 1577 410.4 647,253 51.3 35 2.22 54.07 Colletotrichum trifolii 549 686.7 376,991 56.7 22 4.01 58.36 Cryphonectria parasitica 2185 663.5 1,449,662 56.8 122 5.58 84.16 Neurospora crassa 5135 513.8 2,638,541 52.8 227 4.42 86.03 a This database was the non-redundant set from the current study; data for all other species, including the other EST database for M. graminicola, were downloaded from the COGEME web site.

DNA strands at meiosis or during DNA replication are (www.JGI.DOE.GOV/CSP/). Published as paper 2006- not the only mechanisms generating variation at these 18030, Purdue University Agricultural Research Programs. loci. One possible explanation for large differences between microsatellite alleles could be that they are in References areas of the genome that are not under selection, such as in pseudogenes. However, because these microsatel- Adhikari, T.B., Anderson, J.M., Goodwin, S.B., 2003. Identification and lites were identified within expressed sequences, the molecular mapping of a gene in wheat conferring resistance to Mycosphaerella graminicola. Phytopathology 93, 1158–1164. pseudogene explanation seems unlikely. More work is Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. required to fully understand variability at these micro- Basic local alignment search tool. J. Mol. Biol. 215, 403–410. satellite loci, but clearly the level of variation at some Bearchell, S.J., Fraaije, B.A., Shaw, M.W., Fitt, B.D.L., 2005. Wheat of the SSR loci can be extremely high. archive links long-term fungal pathogen population dynamics to air The ability to use several primers together in a multi- pollution. Proc. Natl. Acad. Sci. USA 102, 5438–5442. Breuillin, F., Dutech, C., Robin, C., 2006. Genetic diversity of the plex reaction should greatly facilitate the application of chestnut blight fungus Cryphonectria parasitica in four French these microsatellite loci for large-scale genetic analyses. populations assessed by microsatellite markers. Mycol. Res. 110, A maximum of three primer pairs was tested in the cur- 288–296. rent work, but a higher degree of multiplexing could be Brondani, C., Brondani, R.P.V., Garrido, L.d.R., Ferreira, M.E., 2000. possible. As shown for many species of plants, the Development of microsatellite markers for the genetic analysis of Magnaporthe grisea. Genet. Mol. Biol. 23, 753–762. microsatellite loci available for M. graminicola should Bucheli, E., Gautschi, B., Shykoff, J.A., 2000. Host-specific differentiation provide a rich resource of easily transferable markers in the anther smut fungus Microbotryum violaceum as revealed by for continued genetic analyses of this important plant microsatellites. J. Evol. Biol. 13, 188–198. pathogen. Cordeiro, G.M., Casu, R., McIntyre, C.L., Manners, J.M., Henry, R.J., 2001. Microsatellite markers from sugarcane (Saccharum spp.) ESTs cross transferable to erianthus and sorghum. Plant Sci. 160, 1115– Acknowledgments 1123. Crous, P.W., Kang, J.-C., Braun, U., 2001. A phylogenetic redefinition of anamorph genera in Mycosphaerella based on ITS rDNA sequence This work was supported by USDA CRIS project 3602- and morphology. Mycologia 93, 1081–1101. 22000-013-00D and an OECD fellowship to GHJK. We Dettman, J.R., Taylor, J.W., 2004. Mutation and evolution of microsat- thank Alice Churchill for providing DNA samples for ellite loci in Neurospora. Genetics 168, 1231–1248. isolates of M. fijiensis, and Jennifer Sanders for excellent Dharma Prasad, M., Muthulakshmi, M., Madhu, M., Archak, S., Mita, K., Nagaraju, J., 2005. Survey and analysis of microsatellites in the technical assistance. The Department of Energy’s Joint silkworm, Bombyx mori: frequency, distribution, mutations, marker Genome Institute provided the genomic sequence of M. potential and their conservation in heterologous species. Genetics 169, graminicola through the Community Sequencing Program 197–214. S.B. Goodwin et al. / Fungal Genetics and Biology 44 (2007) 398–414 413

Eckert, M., Gout, L., Rouxel, T., Blaise, F., Jedryczka, M., Fitt, B., Kaye, C., Milazzo, J., Rozenfeld, S., Lebrun, M.-H., Tharreau, D., 2003. Balesdent, M.-H., 2005. Identification and characterization of poly- The development of simple sequence repeat markers for Magnaporthe morphic minisatellites in the phytopathogenic ascomycete Leptosphae- grisea and their integration into an established genetic linkage map. ria maculans. Curr. Genet. 47, 37–48. Fungal Genet. Biol. 40, 207–214. Enjalbert, J., Duan, X., Giraud, T., Vautrin, D., de Vallavieille-Pope, C., Kema, G.H.J., Goodwin, S.B., Hamza, S., Verstappen, E.C.P., Solignac, M., 2002. Isolation of twelve microsatellite loci, using an Cavaletto, J.R., Van der Lee, T.A.J., Hagenaar-de Weerdt, M., enrichment protocol, in the phytopathogenic fungus Puccinia striifor- Bonants, P.J.M., Waalwijk, C., 2002. A combined AFLP and mis f. sp. tritici. Mol. Ecol. Notes 2, 563–565. RAPD genetic linkage map of Mycosphaerella graminicola, the Enkerli, J., Widmer, F., Gessler, C., Keller, S., 2001. Strain-specific septoria tritici leaf blotch pathogen of wheat. Genetics 161, 1497– microsatellite markers in the entomopathogenic fungus Beauveria 1505. brongniartii. Mycol. Res. 105, 1079–1087. Kema, G.H.J., Verstappen, E.C.P., Todorova, M., Waalwijk, C., 1996. Feau, N., Jacobi, V., Hamelin, R.C., Bernier, L., 2006. Screening of ESTs Successful crosses and molecular tetrad and progeny analyses demon- from Septoria musiva (teleomorph Mycosphaerella populorum) for strate heterothallism in Mycosphaerella graminicola. Curr. Genet. 30, detection of SSR and PCR-RFLP markers. Mol. Ecol. Notes 6, 356– 251–258. 358. Kema, G.H.J., Verstappen, E., van der Lee, T., Mendes, O., Sandbrink, Fournier, E., Giraud, T., Loiseau, A., Vautrin, D., Estoup, A., Solignac, H., Klein-Lankhorst, R., Zwiers, L., Csukai, M., Baker, K., M., Cornuet, J.M., Brygoo, Y., 2002. Characterization of nine Waalwijk, C., 2003. Gene hunting in Mycosphaerella graminicola. polymorphic microsatellite loci in the fungus Botrytis cinerea (Asco- In: Proc. 22nd Fungal Genet. Conf., Asilomar, California, USA, mycota). Mol. Ecol. Notes 2, 253–255. p. 252. Geistlinger, J., Maqbool, S., Kaiser, W.J., Kahl, G., 1997a. Detection of Lai, Y., Sun, F., 2003. The relationship between microsatellite slippage microsatellite fingerprint markers and their Mendelian inheritance in mutation rate and the number of repeat units. Mol. Biol. Evol. 20, Ascochyta rabei. Mycol. Res. 101, 1113–1121. 2123–2131. Geistlinger, J., Weising, K., Kaiser, W.J., Kahl, G., 1997b. Allelic La Rota, M., Kantety, R.V., Yu, J.-K., Sorrells, M.E., 2005. variation at a hypervariable compound microsatellite locus in the Nonrandom distribution and frequencies of genomic and EST- ascomycete Ascochyta rabei. Mol. Gen. Genet. 256, 298–305. derived microsatellite markers in rice, wheat, and barley. BMC Glenn, T.C., Stephan, W., Dessauer, H.C., Braun, M.J., 1996. Allelic Genomics 6, 23. diversity in alligator microsatellite loci is negatively correlated with GC Lasker, B.A., Ran, Y., 2004. Analysis of polymorphic microsatellite content of flanking sequences and evolutionary conservation of PCR markers for typing Penicillium marneffei isolates. J. Clin. Microbiol. amplifiability. Mol. Biol. Evol. 13, 1151–1154. 42, 1483–1490. Goodwin, S.B., Dunkle, L.D., Zismann, V.L., 2001. Phylogenetic analysis Levinson, G., Gutman, G.A., 1987. Slipped-strand mispairing: a major of Cercospora and Mycosphaerella based on the internal transcribed mechanism for DNA sequence evolution. Mol. Biol. Evol. 4, 203– spacer region of ribosomal DNA. Phytopathology 91, 648–658. 221. Goodwin, S.B., Waalwijk, C., Kema, G.H.J., 2004. Genetics and genomics Lim, S., Notley-McRobb, L., Lim, M., Carter, D.A., 2004. A comparison of Mycosphaerella graminicola: a model for the Dothideales. In: of the nature and abundance of microsatellites in 14 fungal genomes. Applied Mycology & Biotechnology. In: Arora, D.K., Khachatouri- Fungal Genet. Biol. 41, 1025–1036. ans, G.G. (Eds.), Fungal Genomics, vol. 4. Elsevier Science B.V., Linde, C.C., Zhan, J., McDonald, B.A., 2002. Population structure of Amsterdam, pp. 315–330. Mycosphaerella graminicola: from lesions to continents. Phytopathol- Goodwin, S.B., Zismann, V.L., 2001. Phylogenetic analyses of the ITS ogy 92, 946–955. region of ribosomal DNA reveal that Septoria passerinii from barley is McDonald, B.A., Martinez, J.P., 1991. Chromosome length polymor- closely related to the wheat pathogen Mycosphaerella graminicola. phisms in a Septoria tritici population. Curr. Genet. 19, 265–271. Mycologia 93, 934–946. Molina, C., Kaemmer, D., Aponte, S., Weising, K., Kahl, G., 2001. Gue´rin, F., Franck, P., Loiseau, A., Devaux, M., Le Cam, B., 2004. Microsatellite markers for the fungal banana pathogen Mycosphaerella Isolation of 21 new polymorphic microsatellite loci in the phytopath- musicola. Mol. Ecol. Notes 1, 137. ogenic fungus Venturia inaequalis. Mol. Ecol. Notes 4, 268–270. Neu, C., Kaemmer, D., Kahl, G., Fischer, D., Weising, K., 1999. Hancock, J.M., 1995. The contribution of slippage-like processes to Polymorphic microsatellite markers for the banana pathogen Mycosp- genome evolution. J. Mol. Evol. 41, 1038–1047. haerella fijiensis. Mol. Ecol. 8, 523–525. Harr, B., Kauer, M., Schlo¨tterer, C., 2002. Hitchhiking mapping: A Owen, P.G., Pei, M., Karp, A., Royle, D.J., Edwards, K.J., 1998. Isolation population-based fine mapping strategy for adaptive mutations in and characterization of microsatellite loci in the wheat pathogen Drosophila melanogaster. Proc. Natl. Acad. Sci. USA 99, 12949–12954. Mycosphaerella graminicola. Mol. Ecol. 7, 1611–1612. Hosid, E., Grishkan, I., Frenkel, Z., Wasser, S.P., Nevo, E., Korol, A., Sainudiin, R., Durrett, R.T., Aquadro, C.F., Nielsen, R., 2004. Micro- 2005. Microsatellite markers for assessing DNA polymorphism of satellite mutation models: insights from a comparison of humans and Emericella nidulans in nature. Mol. Ecol. Notes 5, 647–649. chimpanzees. Genetics 168, 383–395. Ivors, K., Garbelotto, M., De Vries, I., Ruyter-Spira, C., Te Lintel Saghai Maroof, M.A., Biyashev, R.M., Yang, G.P., Zhang, Q., Allard, Hekkert, B., Rosenzweig, N., Bonants, P., 2006. Microsatellite R.W., 1994. Extraordinarily polymorphic microsatellite DNA in markers identify three lineages of Phytophthora ramorum in US barley: species diversity, chromosomal locations, and population nurseries, yet single lineages in US forest and European nursery dynamics. Proc. Natl. Acad. Sci. USA 91, 5466–5470. populations. Mol. Ecol. 15, 1493–1505. Selkoe, K.A., Toonen, R.J., 2006. Microsatellites for ecologists: a practical Jurka, J., Pethiyagoda, C., 1995. Simple repetitive DNA sequences from guide to using and evaluating microsatellite markers. Ecol. Lett. 9, primates: compilation and analysis. J. Mol. Evol. 40, 120–126. 615–629. Kantety, R.V., La Rota, M., Matthews, D.E., Sorrells, M.E., 2002. Serapion, J., Kucuktas, H., Feng, J., Liu, Z., 2004. Bioinformatic mining Data mining for simple sequence repeats in expressed sequence tags of type I microsatellites from expressed sequence tags of channel from barley, maize, rice, sorghum and wheat. Plant Mol. Biol. 48, catfish (Ictalurus punctatus). Mar. Biotechnol. 6, 364–377. 501–510. Sierotzki, H., Pavic, L., Hugelshofer, U., Stanger, C., Cleere, S., Karaoglu, H., Lee, C.M.Y., Meyer, W., 2005. Survey of simple sequence Windass, J., Gisi, U., 2005. Dynamics of Mycosphaerella gramini- repeats in completed fungal genomes. Mol. Biol. Evol. 22, 639–649. cola populations in response to selection by different fungicides. In: Katti, M.V., Ranjekar, P.K., Gupta, V.S., 2001. Differential distribution Dehne, H.-W., Gisi, U., Kuch, K.H., Russell, P.E., Lyr, H. (Eds.), of simple sequence repeats in Eukaryotic genome sequences. Mol. Biol. Modern Fungicides and Antifungal Compounds V. BCPC, Alton, Evol. 18, 1161–1167. UK, pp. 89–101. 414 S.B. Goodwin et al. / Fungal Genetics and Biology 44 (2007) 398–414

Soanes, D.M., Skinner, W., Keon, J., Hargreaves, J., Talbot, N.J., 2002. Walser, J.-C., Sperisen, C., Soliva, M., Scheidegger, C., 2003. Fungus- Genomics of phytopathogenic fungi and the development of bioinfor- specific microsatellite primers of lichens: application for the assessment matic resources. Mol. Plant–Microbe Interact. 15, 421–427. of genetic variation on different spatial scales in Lobaria pulmonaria. Thiel, W., Michalek, W., Varshney, R.K., Graner, A., 2003. Exploiting Fungal Genet. Biol. 40, 72–82. EST databases for the development and characterization of gene- Ware, S.B., Verstappen, E.C.P., Breeden, J., Cavaletto, J.R., Goodwin, derived SSR markers in barley (Hordeum vulgare L.). Theor. Appl. S.B., Waalwijk, C., Crous, P.W., Kema, G.H.J., 2006. Discovery of a Genet. 106, 411–422. functional Mycosphaerella teleomorph in the presumed asexual barley Van Ooijen, J.W., Voorrips, R.E., 2001. JoinMap version 3.0: software pathogen Septoria passerinii. Fungal Genet. Biol., accepted for for the calculation of genetic linkage maps. Plant Research Interna- publication. tional, Wageningen. Zhan, J., Pettway, R.E., McDonald, B.A., 2003. The global genetic Walser, J.-C., Holderegger, R., Gugerli, F., Hoebee, S.E., Scheidegger, C., structure of the wheat pathogen Mycosphaerella graminicola is 2005. Microsatellites reveal regional population differentiation and characterized by high nuclear diversity, low mitochondrial diversity, isolation in Lobaria pulmonaria, an epiphytic lichen. Mol. Ecol. 14, regular recombination, and gene flow. Fungal Genet. Biol. 38, 286– 457–467. 297.