DOCSLIB.ORG

Retrotransposon- and Microsatellite Sequence-Associated Genomic Changes in Early Generations of a Newly Synthesized Allotetraploid Cucumis 3 Hytivus Chen & Kirkbride

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Retrotransposon- and Microsatellite Sequence-Associated Genomic Changes in Early Generations of a Newly Synthesized Allotetraploid Cucumis 3 Hytivus Chen & Kirkbride Plant Mol Biol DOI 10.1007/s11103-011-9804-y Retrotransposon- and microsatellite sequence-associated genomic changes in early generations of a newly synthesized allotetraploid Cucumis 3 hytivus Chen & Kirkbride Biao Jiang • Qunfeng Lou • Zhiming Wu • Wanping Zhang • Dong Wang • Kere George Mbira • Yiqun Weng • Jinfeng Chen Received: 27 May 2011 / Accepted: 27 June 2011 Ó Springer Science+Business Media B.V. 2011 Abstract Allopolyploidization is considered an essential generations of a newly synthesized allotetraploid Cucum- evolutionary process in plants that could trigger genomic is 9 hytivus Chen & Kirkbride (2n = 4x = 38) which was shock in allopolyploid genome through activation of tran- derived from crossing between cultivated cucumber scription of retrotransposons, which may be important in C. sativus L. (2n = 2x = 14) and its wild relative C. hystrix plant evolution. Two retrotransposon-based markers, inter- Chakr. (2n = 2x = 24). Extensive genomic changes were retrotransposon amplified polymorphism and retro- observed, most of which involved the loss of parental DNA transposon-microsatellite amplified polymorphism and a fragments and gain of novel fragments in the allotetraploid. microsatellite-based marker, inter simple sequence repeat Among the 28 fragments examined, 24 were lost while four were employed to investigate genomic changes in early were novel, suggesting that DNA sequence elimination is a relatively frequent event during polyploidization in Cucumis. Interestingly, of the 24 lost fragments, 18 were of C. hystrix origin, four were C. sativus-specific, and the Electronic supplementary material The online version of this remaining two were shared by both species, implying that article (doi:10.1007/s11103-011-9804-y) contains supplementary material, which is available to authorized users. fragment loss may be correlated with haploid DNA content (genome size) of diploid parents. Most changes were B. Jiang Á Q. Lou Á Z. Wu Á D. Wang Á K. G. Mbira Á observed in the first generation after polyploidization (S ) & 1 J. Chen ( ) and stably inherited in the subsequent three generations State Key Laboratory of Crop Genetics and Germplasm Enhancement, Key Laboratory of Southern Vegetable Crop (S2–S4), indicating that genomic changes might be a rapid Genetic Improvement, College of Horticulture, Nanjing driving force for the stabilization of allotetraploids. Agricultural University, Nanjing 210095, China Sequence analysis of 11 of the 28 altered DNA fragments e-mail: [email protected] showed that genomic changes in the allotetraploid occurred B. Jiang in both coding and non-coding regions, which might sug- Vegetable Research Institute, Guangdong Academy gest that retrotransposons inserted into genome randomly of Agriculture Science, Guangzhou 510640, China and had a genome-wide effect on the allotetraploid evo- lution. Fluorescence in situ hybridization (FISH) analysis Z. Wu Institute of Economic Crop Research, Hebei Academy revealed a unique distribution of retrotransposon and/or of Agricultural and Forestry Sciences, Shijiazhuang 050051, microsatellite flanking sequences in mitotic and meiotic China chromosomes, where the preferential FISH signals occur- red in the centromeric and telomeric regions, implying that W. Zhang College of Agriculture, Guizhou University, these regions were the possible hotspots for genomic Guiyang 550025, China changes. & Y. Weng ( ) Keywords Polyploidization Á Evolution Á USDA-ARS, Vegetable Crops Research Unit, Horticulture Department, University of Wisconsin, Madison, WI 53705, USA Retrotransposon Á Cucumis Á IRAP Á REMAP Á e-mail: [email protected] Fluorescence in situ hybridization (FISH) 123 Plant Mol Biol Introduction may provide valuable information in understanding poly- ploid evolution and speciation. For example, in Triticale, Allopolyploidization is an evolutionary process whereby Bento et al. (2008) used Fluorescence in situ hybridization two or more different genomes are joined into the same (FISH) technique to reveal the chromosomal distribution nucleus by inter-specific or inter-generic hybridization of retrotransposon-microsatellite amplified polymorphism followed by chromosome doubling (Feldman and Levy (REMAP) products (retrotransposon- and/or microsatellite- 2005). Allopolyploidization has played an important role in flanking sequences), and their result showed the preferen- plant evolution (Leitch and Bennett 1997; Wendel 2000). tial distribution of REMAP products in condensed subtel- Genome size measurements and comparative molecular omeric domains, which implied the putative role of analyses from previous studies have revealed that the retrotransposons and/or microsatellite in the establishment polyploid genome is not a simple addition of diploid gen- of terminal heterochromatin. Therefore, the objectives of omes from which they are derived (Dolezel et al. 1998; the present study were to investigate the effect of retro- Leitch and Bennett 2004; Messing et al. 2004). Generally, transposons on genomic changes in early generations after the formation of allopolyploid is accompanied by rapid synthesis of C. hytivus and to localize physically these genetic and epigenetic changes, which contribute to sta- changes in cucumber chromosomes. Two retrotransposon- bilization of the newly formed species (Song et al. 1995; based markers, inter-retrotransposon amplified polymor- Feldman et al. 1997; Comai 2000; Ozkan et al. 2001; phism (IRAP), REMAP and the inter simple sequence Madlung et al. 2002; Kashkush et al. 2002; Adams et al. repeat (ISSR) marker were utilized to study genomic 2003; Feldman and Levy 2005). changes of retrotransposon- and/or microsatellite-asso- McClintock (1984) proposed that newly formed allop- ciated sequences in the first four generations of C. hytivus olyploids underwent a huge ‘genomic shock’, which could allotetraploid. Changed fragments were also identified and trigger the activation of retrotransposons. Many studies in sequenced, which were then employed in FISH to locate different species were in support of this hypothesis retrotransposon- and/or microsatellite-flanking sequences (Liu and Wendel 2000; Kashkush et al. 2002, 2003; Liu in mitotic and meiotic chromosomes. et al. 2004; Madlung et al. 2005; Shan et al. 2005; Jose- fsson et al. 2006; Petit et al. 2010; Kraitshtein et al. 2010). However, these studies focusing on different allopolyploid Materials and methods species only provide evidence for the transcription of ret- rotransposons activated by allopolyploidization. Little is Plant materials known about the impact of retrotransposons on allopoly- ploid evolution (Madlung et al. 2005; Beaulieu et al. 2009; Plant materials used in this study included two highly Kraitshtein et al. 2010). inbred diploid parental lines, the cultivated cucumber cul- Since accurate genetic information of parental lines and tivar C. sativus cv. Beijingjietou (2n = 2x = 14, genome derived allopolyploid can be obtained conveniently, newly CC) and a wild relative C. hystrix (2n = 2x = 24, genome synthesized allopolyploid serves as a unique model system HH), and S1–S4 generations of a synthetic allotetraploid, for tracing the mobility of retrotransposons during allo- C. hytivus (2n = 4x = 38, HHCC). The allotetraploid was polyploidization. Cucumis 9 hytivus Chen & Kirkbride obtained from interspecific hybridization, embryo rescue (2n = 4x = 38) is a newly synthesized allotetraploid and chromosome doubling (Chen and Kirkbride 2000) with derived from interspecific hybridization from C. sativus subsequent self-pollination to constitute the first four L. (2n = 2x = 14) and C. hystrix Char. (2n = 2x = 24) inbreeding generations (S1–S4). and subsequent tissue culture-induced chromosome dou- bling (Chen et al. 1997; Chen and Kirkbride 2000). Our DNA extraction previous studies revealed that allopolyploidization in Cucumis induced extensive genome changes and cytolog- Genomic DNA was extracted from young leaves of seed- ical diploidization as well as epigenetic changes such as lings using the cetyltrimethylammonium bromide method alterations of cytosine methylation, activation of retro- described by Murray and Thompson (1980). DNA quality transposons, gene silencing and gene activation in early was evaluated by electrophoresis in 1% agarose gel. DNA generations of this newly synthesized allotetraploid (Chen stocks were diluted to 50 ng/ll for subsequent uses. et al. 2007; Chen and Chen 2008; Zhuang and Chen 2009; Jiang et al. 2011). IRAP procedure Previous studies focused mainly on genetic changes following polyploid formation; little is known about the The IRAP analysis followed Kalendar et al. (1999). Four distribution of these changes in the chromosomes, which primers were designed based on the long terminal repeat 123 Plant Mol Biol Table 1 Primers used for PCR analysis to study the effect of retro- Electrophoresis and data analysis transposons on genomic changes during allopolyploid evolution in Cucumis PCR products were resolved in 2% agarose gels (BIO- Primer GenBank Primer sequence (50–30) WEST, Spain) in 19 TAE buffer for 2–3 h at 95 volts, accession # stained with ethidium bromide, and then photographed IRAP with an electrophoresis image analysis system (Peiqing, LTR1 GQ326556 TCGCTGAAGTGAATGGTGGTC China). Only bands with sizes between 100 and 2,000 bp LTR2 GQ326556 CGATAATACAACCCTCCGAAG were scored because of high resolution obtained in this LTR3 AM1174993 ATTCTTCTATCCTTGCCCGTGG region. Quantitative differences between bands and minor non-reproducible bands were not
Load more

Recommended publications
  • Young, L.J., & Hammock E.A.D. (2007)
    Update TRENDS in Genetics Vol.23 No.5 Research Focus On switches and knobs, microsatellites and monogamy Larry J. Young1 and Elizabeth A.D. Hammock2 1 Department of Psychiatry and Behavioral Sciences, Center for Behavioral Neuroscience, 954 Gatewood Road, Yerkes National Primate Research Center, Emory University School of Medicine, Atlanta, GA 30322, USA 2 Vanderbilt Kennedy Center and Department of Pharmacology, 465 21st Avenue South, MRBIII, Room 8114, Vanderbilt University, Nashville, TN 37232, USA Comparative studies in voles have suggested that a formation. In male prairie voles, infusion of vasopressin polymorphic microsatellite upstream of the Avpr1a locus facilitates the formation of partner preferences in the contributes to the evolution of monogamy. A recent study absence of mating [7]. The distribution of V1aR in the challenged this hypothesis by reporting that there is no brain differs markedly between the socially monogamous relationship between microsatellite structure and mon- and socially nonmonogamous vole species [8]. Site-specific ogamy in 21 vole species. Although the study demon- pharmacological manipulations and viral-vector-mediated strates that the microsatellite is not a universal genetic gene-transfer experiments in prairie, montane and mea- switch that determines mating strategy, the findings do dow voles suggest that the species differences in Avpr1a not preclude a substantial role for Avpr1a in regulating expression in the brain underlie the species differences in social behaviors associated with monogamy. social bonding among these three closely related species of vole [3,6,9,10]. Single genes and social behavior Microsatellites and monogamy The idea that a single gene can markedly influence Analysis of the Avpr1a loci in the four vole species complex social behaviors has recently received consider- mentioned so far (prairie, montane, meadow and pine voles) able attention [1,2].
    [Show full text]
  • Evaluation of the Effects of Sequence Length and Microsatellite Instability
    Int. J. Biol. Sci. 2019, Vol. 15 2641 Ivyspring International Publisher International Journal of Biological Sciences 2019; 15(12): 2641-2653. doi: 10.7150/ijbs.37152 Research Paper Evaluation of the effects of sequence length and microsatellite instability on single-guide RNA activity and specificity Changzhi Zhao1*, Yunlong Wang2*, Xiongwei Nie1, Xiaosong Han1, Hailong Liu1, Guanglei Li1, Gaojuan Yang1, Jinxue Ruan1, Yunlong Ma1, Xinyun Li1, 3, Huijun Cheng1, Shuhong Zhao1, 3, Yaping Fang2, Shengsong Xie1, 3 1. Key Laboratory of Agricultural Animal Genetics, Breeding and Reproduction of Ministry of Education & Key Lab of Swine Genetics and Breeding of Ministry of Agriculture and Rural Affairs, Huazhong Agricultural University, Wuhan 430070, P. R. China; 2. Agricultural Bioinformatics Key Laboratory of Hubei Province, Hubei Engineering Technology Research Center of Agricultural Big Data, College of Informatics, Huazhong Agricultural University, Wuhan 430070, P. R. China; 3. The Cooperative Innovation Center for Sustainable Pig Production, Huazhong Agricultural University, Wuhan 430070, P. R. China. *The authors wish it to be known that, in their opinion, the first two authors should be regarded as joint First Authors. Corresponding authors: Shengsong Xie, Tel: 086-027-87387480; Fax: 086-027-87280408; Email: [email protected]; Yaping Fang, Tel: 86-28-87285078; Fax: 86-28-87284285; Email: [email protected]. © The author(s). This is an open access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/). See http://ivyspring.com/terms for full terms and conditions. Received: 2019.07.21; Accepted: 2019.09.02; Published: 2019.10.03 Abstract Clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology is effective for genome editing and now widely used in life science research.
    [Show full text]
  • Genome-Wide Mapping and Characterization of Microsatellites In
    www.nature.com/scientificreports OPEN Genome-wide mapping and characterization of microsatellites in the swamp eel genome Received: 14 February 2017 Zhigang Li, Feng Chen, Chunhua Huang, Weixin Zheng, Chunlai Yu, Hanhua Cheng & Accepted: 26 April 2017 Rongjia Zhou Published: xx xx xxxx We described genome-wide screening and characterization of microsatellites in the swamp eel genome. A total of 99,293 microsatellite loci were identified in the genome with an overall density of 179 microsatellites per megabase of genomic sequences. The dinucleotide microsatellites were the most abundant type representing 71% of the total microsatellite loci and the AC-rich motifs were the most recurrent in all repeat types. Microsatellite frequency decreased as numbers of repeat units increased, which was more obvious in long than short microsatellite motifs. Most of microsatellites were located in non-coding regions, whereas only approximately 1% of the microsatellites were detected in coding regions. Trinucleotide repeats were most abundant microsatellites in the coding regions, which represented amino acid repeats in proteins. There was a chromosome-biased distribution of microsatellites in non-coding regions, with the highest density of 203.95/Mb on chromosome 8 and the least on chromosome 7 (164.06/Mb). The most abundant dinucleotides (AC)n was mainly located on chromosome 8. Notably, genomic mapping showed that there was a chromosome-biased association of genomic distributions between microsatellites and transposon elements. Thus, the novel dataset of microsatellites in swamp eel provides a valuable resource for further studies on QTL-based selection breeding, genetic resource conservation and evolutionary genetics. Swamp eel (Monopterus albus) taxonomically belongs to teleosts, the family Synbranchidae of the order Synbranchiformes (Neoteleostei, Teleostei, and Vertebrata).
    [Show full text]
  • Variation in MHC Class II B Genes in Marbled Murrelets: Implications for Delineating Conservation Units C
    bs_bs_banner Animal Conservation. Print ISSN 1367-9430 Variation in MHC class II B genes in marbled murrelets: implications for delineating conservation units C. Vásquez-Carrillo1*, V. Friesen2, L. Hall3 & M. Z. Peery1 1 Department of Forest and Wildlife Ecology, University of Wisconsin-Madison, Madison, WI, USA 2 Department of Biology, Queen’s University, Kingston, Ontario Canada 3 Department of Environmental Science, Policy, and Management, University of California-Berkeley, Berkeley, CA, USA Keywords Abstract adaptive genetic variation; major histocompatibility complex; marbled Conserving genetic variation is critical for maintaining the evolutionary potential murrelet; conservation units; neutral genetic and viability of a species. Genetic studies seeking to delineate conservation units, variation; selection. however, typically focus on characterizing neutral genetic variation and may not identify populations harboring local adaptations. Here, variation at two major Correspondence histocompatibility complex (MHC) class II B genes was characterized in four Catalina Vásquez-Carrillo, Department of populations of marbled murrelets Brachyramphus marmoratus, a threatened Biology, University of Miami, 1301 Memorial species in which little neutral genetic population structure has been detected. High Drive, Coral Gables, FL, 33124, USA. diversity, as well as evidence of balancing selection, was detected in exon 2 of these Tel: 305-284-3013; Fax: 305 284 3039 genes. Genetic population structure based on MHC markers was uncorrelated to Email: [email protected] genetic structure estimated with neutral markers, suggesting that selection played a more important role in shaping population structure at these markers than Editor: Jeff Johnson genetic drift. A high proportion of alleles and inferred peptides were unique to a single population, with the Aleutian Islands and southeast Alaska having the Received 15 March 2013; accepted 1 highest richness of both.
    [Show full text]
  • Sequence-Based Estimation of Minisatellite and Microsatellite Repeat Variability
    Downloaded from genome.cshlp.org on October 3, 2021 - Published by Cold Spring Harbor Laboratory Press Resource Sequence-based estimation of minisatellite and microsatellite repeat variability Matthieu Legendre,1,4 Nathalie Pochet,1,2,4 Theodore Pak,1 and Kevin J. Verstrepen1,3,5 1FAS Center for Systems Biology, Harvard University, Cambridge, Massachusetts 02138, USA; 2Broad Institute of Harvard and Massachusetts Institute of Technology, Cambridge, Massachusetts 02139, USA; 3Centre of Microbial and Plant Genetics, Department of Molecular and Microbial Systems, Katholieke Universiteit Leuven, Faculty of Applied Bioscience and Engineering, B-3001 Leuven (Heverlee), Belgium Variable tandem repeats are frequently used for genetic mapping, genotyping, and forensics studies. Moreover, variation in some repeats underlies rapidly evolving traits or certain diseases. However, mutation rates vary greatly from repeat to repeat, and as a consequence, not all tandem repeats are suitable genetic markers or interesting unstable genetic modules. We developed a model, “SERV,” that predicts the variability of a broad range of tandem repeats in a wide range of organisms. The nonlinear model uses three basic characteristics of the repeat (number of repeated units, unit length, and purity) to produce a numeric “VARscore” that correlates with repeat variability. SERV was experimentally validated using a large set of different artificial repeats located in the Saccharomyces cerevisiae URA3 gene. Further in silico analysis shows that SERV outperforms existing models and accurately predicts repeat variability in bacteria and eukaryotes, including plants and humans. Using SERV, we demonstrate significant enrichment of variable repeats within human genes involved in transcriptional regulation, chromatin remodeling, morphogenesis, and neurogenesis. Moreover, SERV allows identification of known and candidate genes involved in repeat-based diseases.
    [Show full text]
  • FANCJ Suppresses Microsatellite Instability and Lymphomagenesis Independent of the Fanconi Anemia Pathway
    Downloaded from genesdev.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press FANCJ suppresses microsatellite instability and lymphomagenesis independent of the Fanconi anemia pathway Kenichiro Matsuzaki,1 Valerie Borel,1 Carrie A. Adelman,1 Detlev Schindler,2 and Simon J. Boulton1 1DNA Damage Response Laboratory, Clare Hall Laboratories, The Francis Crick Institute, South Mimms EN6 3LD, United Kingdom; 2Department of Human Genetics, Biozentrum, University of Wurzburg, 97074 Wurzburg, Germany Microsatellites are short tandem repeat sequences that are highly prone to expansion/contraction due to their propensity to form non-B-form DNA structures, which hinder DNA polymerases and provoke template slippage. Although error correction by mismatch repair plays a key role in preventing microsatellite instability (MSI), which is a hallmark of Lynch syndrome, activities must also exist that unwind secondary structures to facilitate replication fidelity. Here, we report that Fancj helicase-deficient mice, while phenotypically resembling Fanconi anemia (FA), are also hypersensitive to replication inhibitors and predisposed to lymphoma. Whereas metabolism of G4-DNA − − structures is largely unaffected in Fancj / mice, high levels of spontaneous MSI occur, which is exacerbated by − − replication inhibition. In contrast, MSI is not observed in Fancd2 / mice but is prevalent in human FA-J patients. Together, these data implicate FANCJ as a key factor required to counteract MSI, which is functionally distinct from its role in the FA pathway. [Keywords: DNA repair; FANCJ; Fanconi anemia; genome stability; microsatellite instability] Supplemental material is available for this article. Received September 30, 2015; revised version accepted November 13, 2015. Maintenance of genome integrity during DNA replication which are caused by mutations in DNA mismatch repair is of vital importance to ensure that daughter cells inherit (MMR) genes.
    [Show full text]
  • Microsatellite Instability in Childhood T Cell Acute Lymphoblastic Leukemia a Baccichet1,2, N Benachenhou1,2, F Couture1, J-M Leclerc1,3 and D Sinnett1,2,3
    Leukemia (1997) 11, 797–802 1997 Stockton Press All rights reserved 0887-6924/97 $12.00 Microsatellite instability in childhood T cell acute lymphoblastic leukemia A Baccichet1,2, N Benachenhou1,2, F Couture1, J-M Leclerc1,3 and D Sinnett1,2,3 1Division of Hematology-Oncology, Centre de Cance´rologie Charles Bruneau and 2Research Center, Sainte-Justine Hospital; 3Department of Pediatrics, University of Montreal, Canada Acute lymphoblastic leukemia (ALL) is the most frequent can- in which malignant cells express diverse phenotypes and cer encountered in children. Little is known about the molecu- respond variably to chemotherapy. Alteration of genes in a lar pathology of childhood T cell ALL. Oncogenesis is a multi- step process that involves alterations in proto-oncogenes and cell-type-specific manner could be associated with the dis- tumor suppressor genes. Recently, a mutator phenotype crepancies in the observed phenotypes. In this regard, the detectable by microsatellite instabilities was shown to be asso- gene p16 was found inactivated in the majority of T cell ciated with predisposition to cancer. This new mechanism for ALL,14 but not in pre-B cell type. Few other specific genetic human carcinogenesis is caused by defects in the DNA alterations have been found in a significant number of T cell replication/repair system. To study the involvement of some of ALL patients investigated. Such a heterogeneity could be these mutational events in the development of T cell ALL, we have initiated a systematic search for losses of heterozygosity partly explained by the observation that mismatch repair- (LOH) and microsatellite instabilities in children affected with deficient cell lines survive from exposure to alkylating agents this disease.
    [Show full text]
  • Basic Molecular Genetics for Epidemiologists F Calafell, N Malats
    398 GLOSSARY Basic molecular genetics for epidemiologists F Calafell, N Malats ............................................................................................................................. J Epidemiol Community Health 2003;57:398–400 This is the first of a series of three glossaries on CHROMOSOME molecular genetics. This article focuses on basic Linear or (in bacteria and organelles) circular DNA molecule that constitutes the basic physical molecular terms. block of heredity. Chromosomes in diploid organ- .......................................................................... isms such as humans come in pairs; each member of a pair is inherited from one of the parents. general increase in the number of epide- Humans carry 23 pairs of chromosomes (22 pairs miological research articles that apply basic of autosomes and two sex chromosomes); chromo- science methods in their studies, resulting somes are distinguished by their length (from 48 A to 257 million base pairs) and by their banding in what is known as both molecular and genetic epidemiology, is evident. Actually, genetics has pattern when stained with appropriate methods. come into the epidemiological scene with plenty Homologous chromosome of new sophisticated concepts and methodologi- cal issues. Each of the chromosomes in a pair with respect to This fact led the editors of the journal to offer the other. Homologous chromosomes carry the you a glossary of terms commonly used in papers same set of genes, and recombine with each other applying genetic methods to health problems to during meiosis. facilitate your “walking” around the journal Sex chromosome issues and enjoying the articles while learning. Sex determining chromosome. In humans, as in Obviously, the topics are so extensive and inno- all other mammals, embryos carrying XX sex vative that a single short glossary would not be chromosomes develop as females, whereas XY sufficient to provide you with the minimum embryos develop as males.
    [Show full text]
  • On the Genealogy of a Duplicated Microsatellite
    Genetics: Published Articles Ahead of Print, published on October 18, 2007 as 10.1534/genetics.106.063131 On the genealogy of a duplicated microsatellite Kangyu Zhang1 and Noah A. Rosenberg2 Manuscript for Genetics, April 11, 2007 Corresponding author Noah A. Rosenberg Department of Human Genetics, Bioinformatics Program, and the Life Sciences Institute University of Michigan, Ann Arbor, MI 48109-2218 USA E-mail: [email protected] Phone: 734-615-9556 Fax: 734-615-6553 Key words Allele size identity, gene duplication, genome duplication, homozygosity, stepwise mutation model Running head Genealogy of a duplicated microsatellite 1 Program in Molecular and Computational Biology and Department of Mathematics, University of Southern California, Los Angeles, CA 90089-1113 USA. 2 Department of Human Genetics, Bioinformatics Program, and the Life Sciences Institute, University of Michigan, Ann Arbor, MI 48109-2218 USA. Page 1 of 33 Abstract When a microsatellite locus is duplicated in a diploid organism, a single pair of PCR primers may amplify as many as four distinct alleles. We consider a coalescent model with symmetric stepwise mutation in order to study the evolution of a duplicated microsatellite. Conditional on the time of duplication and a mutation rate, both in models of completely unlinked loci and of completely linked loci, we compute the probabilities for a sampled diploid individual to amplify 1, 2, 3, or 4 distinct alleles with one pair of microsatellite PCR primers. These probabilities are then studied to examine the nature of their dependence on the duplication time and the mutation rate. The mutation rate is observed to have a stronger effect than the duplication time on the four probabilities, and the unlinked and linked cases are seen to behave similarly.
    [Show full text]
  • Advanced Glossary on Genetic Epidemiology N Malats, F Calafell
    562 J Epidemiol Community Health: first published as 10.1136/jech.57.8.564 on 25 July 2003. Downloaded from GLOSSARY Advanced glossary on genetic epidemiology N Malats, F Calafell ............................................................................................................................. J Epidemiol Community Health 2003;57:562–564 This is the last of a series of glossaries on terms used in individuals. The alleles analysed may be thought genetic epidemiology published by the journal. This to contribute to the disease or be in linkage disequi- librium with any such causative variation. It can glossary covers the most advanced genetic terms, most provide sufficient power to distinguish slight of which are related to new study designs and variations in disease risks being more sensitive laboratory techniques. It provides the reader with than linkage methods when the genes of interest contribute to disease susceptibility but are neither examples and references of real studies that applied necessary nor sufficient to cause disease. The each of the study designs defined in the glossary. This methodology it uses is the same as used by epide- should help the reader grasp the subtleties of each of miological studies (cohort and case-control de- sign). For instance, Perikac-Vance et al had these strategies and will allow the reader to research the mapped a gene conferring susceptibility to late literature according to their interest. onset Alzheimer’s disease at chromosome 8 .......................................................................... 19q13.2 ; as apoliprotein E is found bound to the amyloid plaques characteristic of Alzheimer’s dis- ease and is also found in that genome region, it he previous glossaries on basic molecular and became a candidate gene for Alzheimer’s disease.
    [Show full text]
  • Microsatellites: a New Class of Genetic Markers for Salmo Trutta L
    Heredity 71 (1993) 488—496 Received 19 February 1993 Genetical Society of Great Britain (CT) and (GT) microsatellites: a new class of genetic markers for Salmo trutta L. (brown trout) ARNAUD ESTOUP*, PABLO PRESA, FRANCINE KRIEG, DANIEL VAIMANt & RENE GUYOMARD Laboratoire de Génetique des Poissons and tLaboratoire de Génétique Bioch/mique, CRJ-/NRA, F 78350, Jouy-en- Josas, France Thirteen(GT )andfour (CT ),microsatelliteloci (n =10or more and n =20 or more, respectively) have been isolated from a partial genomic library of brown trout and sequenced. On average, a (GT )repeatsequence occurs approximately every 23 kb and a (CT )repeatsequence every 76 kb in brown trout genome. Primers for DNA amplifications using the polymerase chain reaction (PCR) were synthesized for three single locus microsatellites. Mendelian inheritance of the observed polymorphisms was confirmed in full-sib families. Four brown trout populations (10 unrelated individuals per population) were screened for polymorphism with these three microsatellite loci. The total number of alleles detected in the four populations is five at one locus, six at the other two microsatellite loci and is three, on average, per population. Heterozygosities range from 0.18 to 0.74. The largest differences in allelic frequencies occurred between the Mediterranean and the Atlantic populations: this result is congruent with previous allozymic data. The gene—centromere distances of the three microsatellite markers were determined on gynogenetic lines: post-reduction rates range from 0.17 to 0.60. For all the three microsatellite loci, the primers designed from brown trout sequences can be used in another closely related species of salmonid, the rainbow trout (Oncorhynchus mykiss).
    [Show full text]
  • Are Microsatellite Patterns Specific for Tumor Types?
    Hypothesis Are Microsatellite Patterns Specific for Tumor Types? A Pilot Investigation Tiffany Haiduk 1, Michael Brockmann 1, Christoph Schmitt 2, Ramona-Liza Tillmann 1, Monika Pieper 1, Jessica Lüsebrink 1, Oliver Schildgen 1,* and Verena Schildgen 1,* 1 Kliniken der Stadt Köln, Klinikum der Privaten Universität Witten, Ostmerheimer Str. 200, 51109 Köln (Cologne), Germany; tiff[email protected] (T.H.); [email protected] (M.B.); [email protected] (R.-L.T.); [email protected] (M.P.); [email protected] (J.L.) 2 GENOPATH GbR, Heilsbachstraße 15, 53123 Bonn, Germany; [email protected] * Correspondence: [email protected] (O.S.); [email protected] (V.S.) Received: 22 July 2020; Accepted: 1 September 2020; Published: 4 September 2020 Abstract: Microsatellite testing is an emerging field of molecular pathology, as microsatellite instability (MSI) appears to be a predictive biomarker for some cancers. Although multiple studies on microsatellites have been published, recent observations suggest that the microsatellites that define instability differ between tumor entities. This assumption is confirmed by the present study that compared different MSI assays validated for colorectal cancer. Whilst all assays deliver the same MSI/MSS status for colorectal cancers, they differ for tonsillar tumors, leading to the hypothesis that MSI patterns are tumor-type specific. Keywords: microsatellite instability; MSI; colorectal cancer; tonsillar tumors; MSI pattern 1. Introduction Microsatellites (MS) are repetitive sequences in the genome that are present throughout the genome. These repeat sequences are more commonly found in non-coding regions on many alleles, but can also be found in coding regions. The mismatch repair system (MMR) is responsible for the correct detection of microsatellites in DNA replication.
    [Show full text]