Identification of B-Catenin As a Target of the Intracellular Tyrosine Kinase PTK6

236 Research Article

Identification of b-catenin as a target of the intracellular tyrosine kinase PTK6

Helena L. Palka-Hamblin1,*, Jessica J. Gierut1,*, Wenjun Bie1, Patrick M. Brauer1, Yu Zheng1, John M. Asara3 and Angela L. Tyner1,2,‡ 1Department of Biochemistry and Molecular Genetics and 2Department of Medicine, University of Illinois at Chicago, Chicago, IL 60607, USA 3Division of Signal Transduction, Beth Israel Deaconess Medical Center and Department of Medicine, Harvard Medical School, Boston, MA 02115, USA *These authors contributed equally to this work ‡Author for correspondence ([email protected])

Accepted 26 October 2009 Journal of Cell Science 123, 236-245 Published by The Company of Biologists 2010 doi:10.1242/jcs.053264

Summary Disruption of the gene encoding protein tyrosine kinase 6 (PTK6) leads to increased growth, impaired enterocyte differentiation and higher levels of nuclear b-catenin in the mouse small intestine. Here, we demonstrate that PTK6 associates with nuclear and cytoplasmic b-catenin and inhibits b-catenin- and T-cell factor (TCF)-mediated transcription. PTK6 directly phosphorylates b-catenin on Tyr64, Tyr142, Tyr331 and/or Tyr333, with the predominant site being Tyr64. However, mutation of these sites does not abrogate the ability of PTK6 to inhibit b-catenin transcriptional activity. Outcomes of PTK6-mediated regulation appear to be dependent on its intracellular localization. In the SW620 colorectal adenocarcinoma cell line, nuclear-targeted PTK6 negatively regulates endogenous b-catenin/TCF transcriptional activity, whereas membrane-targeted PTK6 enhances b-catenin/TCF regulated transcription. Levels of TCF4 and the transcriptional co-repressor TLE/Groucho increase in SW620 cells expressing nuclear-targeted PTK6. Knockdown of PTK6 in SW620 cells leads to increased b-catenin/TCF transcriptional activity and increased expression of b-catenin/TCF target genes Myc and Survivin. Ptk6-null BAT-GAL mice, containing a b-catenin-activated LacZ reporter transgene, have increased levels of b-galactosidase expression in the gastrointestinal tract. The ability of PTK6 to negatively regulate b-catenin/TCF transcription by modulating levels of TCF4 and TLE/Groucho could contribute to its growth-inhibitory activities in vivo. Key words: PTK6, BRK, Sik, b-catenin, Tyrosine kinase, Intestine, Colon

Introduction of the gastrointestinal tract in both humans and mice (Llor et al., Protein tyrosine kinase 6 (PTK6) is an intracellular tyrosine kinase 1999; Vasioukhin et al., 1995). Overexpression of PTK6 in mouse

Journal of Cell Science that is distantly related to Src family tyrosine kinases. Members of keratinocytes results in increased expression of the differentiation the PTK6 family are defined by a highly conserved exon structure marker filaggrin during calcium-induced differentiation, suggesting that is distinct from other major intracellular tyrosine kinase a positive role in differentiation (Vasioukhin and Tyner, 1997). PTK6 families (Lee et al., 1998; Mitchell et al., 1997; Serfas and Tyner, was also shown to positively regulate expression of keratin 10 during 2003). Like Src family kinases, PTK6 is negatively regulated by differentiation of human cultured keratinocytes (Wang et al., 2005). phosphorylation of a C-terminal tyrosine residue (Derry et al., 2000; Increased proliferation and impaired enterocyte differentiation in Qiu and Miller, 2002). Unlike Src family kinases, PTK6 is not the PTK6-deficient mouse model provided further evidence that myristoylated or specifically targeted to the membrane. As a this kinase promotes epithelial cell differentiation in vivo consequence, PTK6 has been localized to different cellular (Haegebarth et al., 2006). compartments, including the nucleus, where it might have a distinct During development, Wnt signaling has an essential role in set of substrates and interacting proteins (Derry et al., 2003; Derry establishing the stem cell zone in the intestinal crypts (Korinek et al., 2000; Haegebarth et al., 2004). et al., 1998). In adult tissues, active Wnt signaling characterizes We identified PTK6 in the mouse small intestine in a screen for intestinal epithelial progenitor cells (van de Wetering et al., 2002). factors that regulate epithelial cell differentiation, and originally Activation of canonical Wnt signaling results in accumulation of named it Sik (Src-related intestinal kinase) (Siyanova et al., 1994). nuclear b-catenin, which, in complex with T-cell factor (TCF) PTK6 was also identified in breast cancer cells where it is often family members, controls proliferation versus differentiation in referred to as BRK (breast tumor kinase) (Mitchell et al., 1994) and intestinal epithelial cells (Batlle et al., 2002; Pinto et al., 2003). in cultured human melanocytes (PTK6) (Lee et al., 1993). PTK6 Expansion of the progenitor zone in PTK6-deficient mice is predominantly expressed in epithelial cells of the skin, suggested that Wnt signaling might be affected in the intestines gastrointestinal tract (Llor et al., 1999; Vasioukhin et al., 1995; Wang of these mice. Indeed, increased numbers of cells that were positive et al., 2005), prostate (Derry et al., 2003) and oral epithelia (Petro for nuclear b-catenin were observed in intestines of PTK6- et al., 2004). PTK6 is also reported to be expressed in lymphocytes deficient mice compared with their wild-type counterparts (Kasprzycka et al., 2006). (Haegebarth et al., 2006). We explored the ability of PTK6 to PTK6 expression is developmentally regulated and detected only regulate components of the Wnt-signaling pathway, and discovered late in gestation in the mouse, when epithelial linings mature a direct relationship between PTK6 and b-catenin. We demonstrate (Vasioukhin et al., 1995). In mature tissues, PTK6 is expressed in that PTK6 directly associates with b-catenin and that PTK6 differentiated nondividing cells, with the highest levels in linings expression leads to an inhibition of b-catenin regulated PTK6 regulates b-catenin 237

transcription in vivo and an increase in the levels of TCF4 and PTK6 downregulates b-catenin transcriptional activity the co-repressor TLE/Groucho. Wnt-dependent and -independent signaling can lead to the stabilization of the cytoplasmic pool of b-catenin (Lu and Hunter, Results 2004). This stabilization results in nuclear accumulation of b-catenin b-catenin is tyrosine phosphorylated in cells expressing and increased b-catenin/TCF-regulated transcription. To determine active PTK6 whether PTK6 influenced nuclear localization of b-catenin, HEK293 The increase in nuclear b-catenin observed in the intestines of PTK6- cells expressing PTK6, PTK6 YF or PTK6 KM and b-catenin were deficient mice (Haegebarth et al., 2006) led us to investigate whether fractionated into nuclear and cytoplasmic fractions. All forms of PTK6 is involved in the Wnt-signaling pathway. To determine if b- PTK6 were detected in the nuclear and cytoplasmic fractions (PTK6, catenin associates with or is a substrate of PTK6, HEK293 cells Fig. 2A) and a robust increase in tyrosine phosphorylation was only were co-transfected with wild-type PTK6, constitutively active PTK6 observed in fractions from cells expressing PTK6 or PTK6 YF (PY, (PTK6 YF) or kinase-dead PTK6 (PTK6 KM) and full-length human Fig. 2A). b-catenin also localized to both nuclear and cytoplasmic b-catenin. In cells expressing comparable levels of PTK6, we fractions, and the levels of b-catenin in these fractions were not observed an overall increase in protein tyrosine phosphorylation significantly changed in cells co-expressing PTK6 (b-catenin, Fig. detected by anti-phosphotyrosine (PY) antibodies in cells expressing 2A). active forms of PTK6 (Fig. 1A). To determine whether b-catenin Immunoprecipitation of b-catenin from both nuclear and was one of the proteins phosphorylated in these cells, tyrosine- cytoplasmic fractions revealed increased tyrosine phosphorylation phosphorylated proteins were immunoprecipitated from Triton-X- of b-catenin in cells expressing PTK6 or PTK6 YF (PY, Fig. 2B). 100-soluble cell lysates (PY, Fig. 1B). Tyrosine-phosphorylated b- Probing the b-catenin immunoprecipitates with the Myc epitope catenin was immunoprecipitated from cells expressing PTK6 or tag antibody, which detects both ectopic b-catenin and ectopic PTK6 YF and not from cells lacking PTK6 (vector) or from cells PTK6, showed that PTK6 associates with b-catenin in both nuclear expressing PTK6 KM (b-catenin, Fig. 1B). Wild-type PTK6, and and cytoplasmic fractions (Myc, Fig. 2B). All forms of PTK6 were to a lesser extent PTK6 YF, were also immunoprecipitated with the found in a complex with nuclear and cytoplasmic b-catenin (PTK6, anti-phosphotyrosine antibodies (PTK6, Fig. 1B). Fig. 2B). To provide further evidence that b-catenin is tyrosine The ability of PTK6 to complex with nuclear b-catenin led us phosphorylated in cells expressing active forms of PTK6, b-catenin to investigate whether PTK6 could regulate b-catenin transcriptional was immunoprecipitated from cell lysates using a b-catenin-specific activity. Using the Super8XTOPFlash reporter construct we antibody. Although relatively equal levels of b-catenin were examined transcriptional activity of b-catenin in HEK293 cells co- immunoprecipitated from cell lysates (b-catenin, Fig. 1C), only b- expressing PTK6, PTK6 YF or PTK6 KM and b-catenin. Although catenin immunoprecipitated from cells expressing PTK6 or PTK6 all forms of PTK6 significantly inhibited b-catenin transcriptional YF was tyrosine phosphorylated (PY blot, asterisk, Fig. 1C). activity (Fig. 2C), PTK6 YF consistently inhibited b-catenin Several other tyrosine-phosphorylated proteins, including PTK6, co- transcriptional activity to the greatest extent, suggesting that there immunoprecipitated with b-catenin (PTK6, Fig. 1C). Association is a kinase-dependent component of transcriptional inhibition. The of PTK6 with b-catenin was independent of its kinase activity, ability of the kinase-dead form of PTK6 to also inhibit b-catenin

Journal of Cell Science because all forms of PTK6 were found in a complex with b-catenin transcriptional activity suggests that a kinase-independent (PTK6, Fig. 1C). component of transcriptional inhibition also exists.

Fig. 1. Tyrosine phosphorylation of b-catenin in cells expressing PTK6. HEK293 cells were co-transfected with wild-type PTK6, PTK6 YF or PTK6 KM and b-catenin. (A)Immunoblot analysis of Triton X-100 (TX-100)- soluble lysates using anti-phosphotyrosine (PY), b-catenin and PTK6 antibodies. a-tubulin was detected as a loading control. TX-100-soluble lysates from A were used to immunoprecipitate tyrosine-phosphorylated proteins using anti-PY antibodies (B) or b-catenin using a b-catenin- specific antibody (C). Immunoblot analysis was performed using anti-PY, b-catenin and PTK6 antibodies (B,C). Asterisk denotes the position of tyrosine- phosphorylated b-catenin (C). Size markers indicating molecular mass are shown to left of blots (kDa). 238 Journal of Cell Science 123 (2)

Fig. 2. Downregulation of b-catenin transcriptional activity by PTK6. HEK293 cells were co-transfected with wild-type PTK6, PTK6 YF or PTK6 KM and b- catenin. (A)Immunoblot analysis of nuclear and cytoplasmic fractions using anti-PY, b-catenin and PTK6 antibodies. Immunoblotting for the nuclear marker Sp1 and the cytoplasmic marker a-tubulin served as controls. (B)b-catenin was immunoprecipitated from nuclear and cytoplasmic fractions using a b-catenin-specific antibody. Immunoblot analysis was performed using anti-PY antibodies and with the Myc epitope tag antibody to detect ectopically expressed b-catenin and PTK6. Asterisk denotes the position of tyrosine-phosphorylated b-catenin. Size markers indicating molecular mass are shown (kDa). (C)b-catenin/TCF reporter gene expression in HEK293 cells co-expressing PTK6 and b-catenin. HEK293 cells were transfected with the Super8XTOPFlash (TOPFlash) luciferase reporter construct containing eight TCF/Lef binding sites or the control Super8XFOPFlash (FOPFlash) construct containing eight mutated TCF/Lef binding sites, vector (–) PTK6 (WT), PTK6 YF (YF) or PTK6 KM (KM) DNA and b-catenin DNA. Luciferase activity was measured in cell lysates. The decrease in luciferase activity observed between vector and all forms of PTK6 as well as between wild-type PTK6 and PTK6 YF is statistically significant (means ± s.d.; *P<0.05, **P<0.005). Journal of Cell Science

PTK6 directly phosphorylates and associates with Analysis of phosphorylated b-catenin (Fig. 3A) using mass b-catenin in vitro spectrometry, identified tyrosine phosphorylation events at tyrosine In cells co-expressing active forms of PTK6 and b-catenin, there residues Y64, Y142 and Y331 or Y333 (Y331,333) (Fig. 3C). is an increase in tyrosine phosphorylation of b-catenin. To address Phosphorylation on Y489, Y654 or Y670, residues that are whether PTK6 directly phosphorylates b-catenin, an in vitro kinase phosphorylated by Abl (Y489), EGFR and Src (Y654) (reviewed assay was performed using active recombinant PTK6 and by Lilien and Balsamo, 2005) and c-Met (Y654, Y670) (Zeng et recombinant b-catenin. Activated PTK6 was detected in all samples al., 2006), was not detected. by phosphotyrosine-specific antibodies (PY, arrowheads, Fig. 3A,D). In the presence of ATP, PTK6 directly phosphorylated wild- Identification of b-catenin Y64 as the major site type b-catenin (WT) in vitro (PY, asterisk, Fig. 3A). phosphorylated by PTK6 Co-immunoprecipitation experiments showed that PTK6 and b- Using site-directed mutagenesis, we generated GST-b-catenin catenin can be found in a complex (Fig. 1C, Fig. 2B). To determine fusion proteins with single (Y64F, Y142F), double (Y64F/Y142F, whether this association is direct or indirect, recombinant b-catenin Y142F/Y331,333F) and triple (Y64F/Y142F/Y331,333F) point was incubated with GST-fusion proteins of full-length PTK6, mutations to validate the tyrosine phosphorylation sites identified PTK6 SH2, SH3 and SH2-SH3 domains. To explore the impact of by mass spectrometry. b-catenin point mutants with a mutation at tyrosine phosphorylation, b-catenin was incubated with active Y64 were no longer phosphorylated by PTK6 (Fig. 3D), suggesting recombinant PTK6 in the presence and absence of ATP. that Y64 is the key residue phosphorylated by PTK6 in vitro. Single Unphosphorylated b-catenin (–ATP) directly associated with full- (Y64F, Y142F, Y331F), double (Y64F/Y142F) and triple length (FL) PTK6 (Fig. 3B, PTK6 FL, –ATP). Phosphorylation of (Y64F/Y142F/Y331,333F) point mutations were also introduced b-catenin by PTK6 increased the interaction between b-catenin and into a b-catenin mammalian expression construct to assess PTK6 GST-fusion proteins containing the PTK6 SH2 domain, which phosphorylation of these mutants in HEK293 cells. Immunoblot binds phosphorylated tyrosine residues (Fig. 3B, PTK6 SH2, analysis of immunoprecipitated b-catenin revealed that b-catenin SH2/SH3 and FL, +ATP). These data suggest that PTK6 and b- point mutants with a mutation at Y64 were no longer phosphorylated catenin directly associate and that this interaction is increased after by PTK6 YF in these cells (PY, Fig. 4A). Taken together, these data phosphorylation of b-catenin by PTK6. suggest that b-catenin Y64 is the major site phosphorylated by PTK6 regulates b-catenin 239

Fig. 3. PTK6 directly associates with and phosphorylates several tyrosine residues in b-catenin in vitro. (A)Recombinant human PTK6 and wild-type b-catenin were incubated in kinase buffer with or without ATP. Immunoblot analysis of the in vitro kinase reaction was performed using anti-PY, b-catenin and PTK6 antibodies. (B)Recombinant human PTK6 and wild-type b-catenin were incubated in kinase buffer with or without ATP. Phosphorylated and unphosphorylated b-catenin was then incubated with PTK6 fusion proteins [full length (FL), SH2, SH3 and SH2-SH3 domains]. Immunoblot analysis of the GST pull-down was performed using b-catenin and GST tag antibodies. (C)Schematic representation of b-catenin that contains 12 armadillo repeats. Tyrosine residues 64 (Y64), Y142 and Y331 or Y333 were identified as sites phosphorylated by PTK6 using tandem mass spectrometry. (D)Recombinant human PTK6 and wild-type b-catenin or b-catenin YF point mutants were subjected to in vitro kinase assay and immunoblotting as described in A. b-catenin point mutants with a mutation at Y64 show no detectable tyrosine phosphorylation in vitro. Size markers indicating molecular mass are included in A, B and D Journal of Cell Science (kDa). Asterisks denote the position of tyrosine-phosphorylated b- catenin and arrowheads indicate the position of activated PTK6 (A and D).

PTK6, not only in vitro, but also in vivo, and that phosphorylation of transcriptional inhibition still exists and that PTK6 might have of Y64 might be necessary for PTK6 to phosphorylate secondary additional, as yet unidentified, substrates that participate in the sites in b-catenin. regulation of b-catenin/TCF transcription.

Direct phosphorylation of b-catenin by PTK6 is not PTK6 regulates endogenous b-catenin transcriptional required for inhibition of transcriptional activity activity in SW620 cells Phosphorylation of b-catenin on tyrosine residues is well recognized Although PTK6 localizes to different cellular compartments, it lacks to be important for regulating b-catenin activity and intracellular nuclear localization and myristoylation or palmitoylation signals. associations (reviewed by Lilien and Balsamo, 2005). PTK6 is the In HEK293 cells, ectopically expressed PTK6 localized to the first tyrosine kinase identified to phosphorylate Y64 of b-catenin. nucleus and cytoplasm and was able to inhibit ectopic b-catenin We therefore wanted to investigate the impact of phosphorylation transcriptional activity. To determine whether the subcellular of Y64 by PTK6 on b-catenin transcriptional activity. Using the localization of PTK6 influenced its ability to inhibit b-catenin/TCF- Super8XTOPFlash reporter construct we determined the mediated transcription, we assessed the transcriptional activity of transcriptional activity of the b-catenin Y64F point mutant in endogenous b-catenin in the colorectal adenocarcinoma cell line HEK293 cells. Similarly to wild-type b-catenin, all forms of PTK6 SW620 expressing nuclear-targeted (NLS) PTK6, PTK6 YF or inhibited the transcriptional activity of the b-catenin Y64F (Fig. PTK6 KM. SW620 cells expressed low levels of endogenous PTK6 4B). PTK6 also inhibited the transcriptional activity of the b-catenin (Fig. 5B, Vector lanes) whereas ectopic PTK6 was expressed at Y142F, Y64F/Y142F and Y64F/Y142F/Y331,333F point mutants high levels (Fig. 5B, D, PTK6). NLS.PTK6, and to a greater extent (Fig. 4C). In all cases, PTK6 YF inhibited b-catenin/TCF-mediated NLS.PTK6 YF, inhibited endogenous b-catenin transcriptional transcription to the greatest extent, suggesting that although the activity in this system (Fig. 5A). Similarly to what was observed direct phosphorylation of b-catenin is not required for the inhibition in HEK293 cells, expression of nuclear-targeted PTK6 did not alter of b-catenin transcriptional activity, a kinase-dependent component the levels or subcellular distribution of endogenous b-catenin in 240 Journal of Cell Science 123 (2)

resulted in an increase in the levels of TCF4 and TLE/Groucho, suggesting that the observed increase in these proteins does not depend on PTK6 kinase activity. Expression of nuclear-targeted and membrane-targeted PTK6 in SW620 cells had opposing effects on b-catenin/TCF-mediated transcription. To assess the physiological role of PTK6 in regulating b-catenin transcriptional activity, we knocked down endogenous PTK6 in SW620 cells using two different shRNAs (shRNA49, shRNA52) and established stable SW620 cells lines (Fig. 6B). When the transcriptional activity of b-catenin was assessed in these cell lines, an increase in endogenous b-catenin transcriptional activity was observed (Fig. 6A). Next, we determined whether the observed increase in transcriptional activity correlated with increased expression of b-catenin/TCF target genes Myc (He et al., 1998) and Survivin (Zhang et al., 2001). Although the levels of b-catenin were not increased in the PTK6-knockdown cell lines, there was a threefold increase in the expression of Myc and a twofold increase in the expression of Survivin (Fig. 6B).

Disruption of the mouse Ptk6 gene enhances expression of a b-catenin/TCF reporter gene in transgenic mice Fig. 4. Phosphorylation of b-catenin on tyrosine is not essential for PTK6- mediated repression of b-catenin/TCF-regulated transcription. To further explore the impact of PTK6 on b-catenin/TCF-regulated (A)HEK293 cells were transfected with PTK6 YF and Myc-tagged wild-type transcription in vivo, Ptk6-null mice were crossed with BAT-GAL (WT) b-catenin or b-catenin YF point mutants. b-catenin was transgenic mice. BAT-GAL mice contain the LacZ gene that encodes immunoprecipitated using a b-catenin antibody from TX-100-soluble cell b-galactosidase under the control of b-catenin/TCF response elements lysates. Immunoblot analysis of immunoprecipitated wild-type b-catenin or (Maretto et al., 2003). In the distal colons of Ptk6–/– BAT-GAL mice, b-catenin YF point mutants using anti-PY antibodies, the Myc epitope tag increased numbers of crypts expressed the LacZ gene (Fig. 7A). antibody to detect ectopically expressed b-catenin (b-catenin) and the PTK6 Positive crypts were readily detected in whole-mount-stained colons antibody. b-catenin point mutants with a mutation at Y64 show no detectable from Ptk6–/– mice, but not in wild-type mice (Fig. 7Aa,b). Comparison tyrosine phosphorylation in cells. Size markers indicating molecular mass are of cross sections of distal colons from Ptk6+/+ and Ptk6–/– BAT-GAL shown (kDa). Asterisk denotes the position of tyrosine phosphorylated mice, revealed that entire crypts were populated with LacZ-expressing b-catenin. (B)b-catenin/TCF reporter gene expression in HEK293 cells co- –/– expressing PTK6 and b-catenin Y64F. HEK293 cells were transfected with cells in Ptk6 BAT-GAL animals (Fig. 7Ad,f). This suggests that Super8XTOPFlash (TOPFlash) or Super8XFOPFlash (FOPFlash), vector (–) PTK6 has a role in suppressing b-catenin/TCF-regulated transcription PTK6 (WT), PTK6 YF (YF) or PTK6 KM (KM) DNA and b-catenin Y64F. in stem or progenitor cells in the colon.

Journal of Cell Science The decrease in luciferase activity observed between vector and all forms of In the small intestine, b-catenin/TCF-regulated transcription was PTK6, as well as between wild-type PTK6 and PTK6 YF is statistically extinguished in most cells in both Ptk6+/+ and Ptk6–/– BAT-GAL significant (*P<0.05, **P<0.005; mean ± s.d.). (C)b-catenin/TCF reporter mice. However single cells expressing the LacZ gene could be gene expression in HEK293 cells co-expressing PTK6 YF and b-catenin point detected in numerous crypts of Ptk6–/– BAT-GAL mice, but these mutants (error bars indicate s.d.). HEK293 cells were transfected with were rarely observed in the Ptk6+/+ BAT-GAL small intestine (Fig. Super8XTOPFlash, vector or PTK6 YF DNA and -catenin Y142F, b 7B). The b-galactosidase-positive cells in the BAT-GAL small Y64F/Y142F or Y64F/Y142F/Y331,333F DNA. PTK6 YF was able to inhibit intestine contained granules characteristic of Paneth cells, the transcriptional activity of all tested b-catenin mutants. differentiated epithelial granulocytes that are localized at the base of the crypts (Fig. 7Bc,d).

these cells (Fig. 5B). We next wanted to test the effects of tethering Discussion PTK6 to the membrane. Using SW620 cells, we determined the In normal adult epithelial linings, PTK6 is most highly expressed transcriptional activity of endogenous b-catenin in cells expressing in nondividing differentiated epithelial cells (Derry et al., 2003; membrane targeted (Palm) PTK6, PTK6 YF or PTK6 KM. Contrary Haegebarth et al., 2006; Llor et al., 1999; Petro et al., 2004; to what we observed with NLS.PTK6, Palm.PTK6, and to a greater Vasioukhin et al., 1995; Wang et al., 2005). Characterization of the extent Palm.PTK6 YF, increased endogenous b-catenin Ptk6-null mouse revealed that PTK6 has a role in promoting transcriptional activity in this system (Fig. 5C). Expression of differentiation of enterocytes in the small intestine. Increased membrane-targeted PTK6 also did not alter the levels or subcellular intestinal epithelial cell turnover, growth and impaired enterocyte distribution of endogenous b-catenin in these cells (Fig. 5D). differentiation correlated with increased levels of active Akt in Ptk6- Although the levels of nuclear b-catenin were not affected by null mice (Haegebarth et al., 2006). In addition to increased ectopic expression of PTK6, we wanted to examine the effects of activation of Akt, nuclear b-catenin was more readily detected in PTK6 expression on other components of the b-catenin/TCF4 the Ptk6-null mice, suggesting that PTK6 functions to negatively transcriptional complex. Expression of nuclear-targeted PTK6 in regulate b-catenin transcriptional activity. Here, we demonstrate that SW620 cells resulted, on average, in a twofold increase in nuclear expression of PTK6 leads to an inhibition of b-catenin/TCF- TCF4 levels (Fig. 5E). More importantly, we also observed a twofold regulated transcription. increase in the nuclear levels of the transcriptional co-repressor The importance of Wnt signaling and b-catenin-regulated TLE/Groucho (Fig. 5E). Expression of all forms of NLS.PTK6 transcription in intestinal epithelial cell renewal has been well PTK6 regulates b-catenin 241

Fig. 5. PTK6 regulates endogenous b-catenin transcriptional activity in SW620 cells. (A)b-catenin/TCF reporter gene expression in SW620 cells expressing nuclear-targeted PTK6. SW620 cells were transfected with Super8XTOPFlash (TOPFlash) or Super8XFOPFlash (FOPFlash), vector (–) NLS.PTK6 (WT), NLS.PTK6 YF (YF) or NLS.PTK6 KM (KM) DNA. Luciferase activity was measured in cell lysates. The decrease in luciferase activity observed between vector and PTK6 or PTK6 YF is statistically significant (*P<0.05; error bars indicate s.d.). (B) SW620 cells were transfected with nuclear-targeted PTK6, PTK6 YF or PTK6 KM. Immunoblot analysis was performed using b-catenin and PTK6 antibodies. (C)b-catenin/TCF reporter gene expression in SW620-expressing membrane- targeted PTK6. SW620 cells were transfected as in A with vector (–) Palm.PTK6 (WT), Palm.PTK6 YF (YF) or Palm.PTK6 KM (KM) DNA. Luciferase activity was measured in cell lysates. The increase in luciferase activity observed between vector and PTK6 or PTK6 YF is statistically significant (*P<0.005; error bars indicate s.d.). (D)SW620 cells were transfected with membrane-targeted PTK6, PTK6 YF or PTK6 KM. Immunoblot analysis was performed using b-catenin and PTK6 antibodies. Immunoblotting for Sp1 and E-cadherin served as controls. (E)Nuclear PTK6 expression upregulates TCF4 and TLE/Groucho protein levels. SW620 cells were transfected with nuclear-targeted PTK6, PTK6 YF or PTK6 KM. Nuclear fractions were resolved by SDS-PAGE. Immunoblot analysis was performed using anti-PY, b-catenin, TCF4, TLE/Groucho and PTK6 antibodies. Changes in protein expression levels were quantified using ImageJ and on average a two-fold increase was observed in TCF4 and TLE protein levels. Size markers indicating molecular mass are shown for B, D and E (kDa).

established (reviewed by Gregorieff and Clevers, 2005). has an essential role in establishing the intestinal stem cell zone

Journal of Cell Science Inhibition of b-catenin signaling might be a prerequisite for in the developing crypts (Korinek et al., 1998), high levels of differentiation and normal tissue homeostasis. Although TCF-4 TCF-4 are expressed in differentiated nondividing epithelial cells, where it might function to repress activation of genes positively regulated by b-catenin (Gregorieff et al., 2005). PTK6 expression is also high in differentiated nondividing epithelial cells of the gastrointestinal tract (Vasioukhin et al., 1995). In Ptk6-null animals, enterocyte differentiation was delayed (Haegebarth et al., 2006). A recently established Ptk6-null epithelial cell line derived from colonic mucosa displays characteristics of progenitor cells (Whitehead et al., 2008), whereas an almost twofold increase in PTK6 message was observed in intestinal stem cells that were induced to differentiate by the deletion of b-catenin (Fevr et al., 2007). We demonstrate that PTK6 associates with and phosphorylates signaling pools of b-catenin and can negatively regulate b- catenin/TCF transcriptional activity. Although direct phosphorylation of b-catenin is not essential for PTK6-mediated Fig. 6. Endogenous PTK6 negatively regulates b-catenin in SW620 cells. negative regulation of b-catenin/TCF transcription, the ability of (A)b-catenin/TCF reporter gene expression in PTK6-knockdown cells. Stable PTK6 to associate with nuclear b-catenin might still have a role in SW620 cell lines expressing two different PTK6 shRNAs (shRNA49, the inhibition of b-catenin transcriptional activity. The adenomatous shRNA52) were transfected with Super8XTOPFlash (TOPFlash) or polyposis coli (APC) tumor suppressor protein inhibits b-catenin Super8XFOPFlash (FOPFlash) and the luciferase activity was measured in cell transcriptional activity by sequestering it away from promoter targets lysates. The increase in luciferase activity observed between vector and shRNA49 or shRNA52 is statistically significant (*P<0.005; error bars in the nucleus (Sierra et al., 2006). Similarly, PTK6 might compete indicate s.d.) (B) Immunoblot analysis of PTK6-knockdown SW620 cells with for binding of other positive factors, leading to decreased b-catenin, PTK6, Myc and Survivin antibodies. Immunoblotting for b-actin transcription. Alternatively, PTK6 might prevent b-catenin from served as a loading control. Size markers indicating molecular mass are shown effectively competing away transcriptional co-repressors such as (kDa). TLE/Groucho from TCF/Lef proteins. 242 Journal of Cell Science 123 (2)

Fig. 7. Disruption of PTK6 gene expression leads to ectopic b-catenin/TCF transcriptional activity in the mouse intestine. (A)Enhanced reporter gene expression in distal colons of Ptk6–/– BAT-GAL mice. Colons from Ptk6+/+ (a,c,e) and Ptk6–/– (b,d,f) BAT-GAL animals were stained for b-galactosidase activity. Numerous positive crypt units could be detected in whole mount preparations at low magnification in Ptk6–/– BAT-GAL mice (b). Colons were sectioned and positive cells were found throughout crypt units in Ptk6 null colons (d,f). Colon sections were counterstained with Nuclear Fast Red. (B)Enhanced reporter gene expression in the small intestines of Ptk6–/– BAT-GAL mice. Small intestines from Ptk6+/+ (a) and Ptk6–/– (b-d) BAT-GAL animals were stained for b-galactosidase activity and sectioned. Single cells at the base of the crypts in PTK6-null intestines were positive for b-galactosidase activity (b, arrow). These cells contained granules characteristic of Paneth cells. (c)Magnification of boxed area in b. (d)Magnification of boxed area in c. Small intestine sections were counterstained with hematoxylin and eosin. Scale bars: 50mm.

Earlier, we proposed that intracellular localization of PTK6 might al., 1993), Fyn and Fer (Piedra et al., 2003), as well as the epidermal have a crucial role in determining the outcomes of PTK6-regulated growth factor receptor (EGFR) (Hoschuetzky et al., 1994) and the signaling (Derry et al., 2003; Haegebarth et al., 2004). Although it hepatocyte growth factor receptor Met (Monga et al., 2002). The lacks a myristoylation or palmitoylation signal, and a nuclear Bruton’s tyrosine kinase (BTK) has recently been identified as a localization signal, PTK6 has been shown to have both membrane- negative regulator of the Wnt-signaling pathway. BTK increases associated and nuclear substrates. Recently Kim and Lee showed the levels of the polymerase-associated factor transcriptional that targeting PTK6 to the plasma membrane enhanced oncogenic elongation complex member CDC73, which acts as a repressor of signaling, whereas targeting PTK6 to the nucleus inhibited its b-catenin/TCF transcription (James et al., 2009). Similarly to BTK,

Journal of Cell Science oncogenic functions in HEK293 cells (Kim and Lee, 2009). Here, we show that nuclear PTK6 enhances expression of TCF4 and we show that targeting PTK6 to the membrane or nucleus has TLE/Groucho, a well-characterized corepressor of Wnt/b-catenin- opposing effects on endogenous b-catenin/TCF-regulated regulated transcription. transcription in SW620 cells. Although nuclear-targeted PTK6 Using a solid-phase peptide library, Shin and colleagues (Shin negatively regulates endogenous b-catenin/TCF transcriptional et al., 2008) identified a consensus sequence for PTK6 activity, membrane-targeted PTK6 results in activation of b- phosphorylation. PTK6 preferentially phosphorylated peptides with catenin/TCF-regulated transcription. Interestingly, expression of acidic amino acids at the C-terminus of the sequence [xxY(D/E)x nuclear-targeted PTK6 leads to increased levels of TCF4 and or xxYx(D/E)]. Based on our in vitro phosphorylation data, we TLE/Groucho (Fig. 5E), which form a repressor complex that identified several residues in b-catenin that can be phosphorylated inhibits target gene expression. by PTK6 (Y64, Y142, and Y331 and/or Y333). Analysis of the The importance of proper b-catenin/TCF signaling is underscored sequence surrounding these tyrosine residues showed that three of by the variety of mechanisms that have evolved to regulate this the four residues are within the preferred phosphorylation sequence signaling pathway. PTK6 and the Kruppel-like factor 4 transcription of PTK6 [Y64 (xxYEx), Y142 (xxYxD) and Y333 (xxYEx)]. factor (KLF4) share similar patterns of expression in the normal A recent report identified Y64, along with Y86 in b-catenin, as intestine, with expression being localized to differentiated epithelial major phosphorylation sites in F9 cells that lack a-catenin, cells (Haegebarth et al., 2006; Zhang et al., 2006). KLF4 was found following treatment with phosphatase inhibitors (Tominaga et al., to interact with the transcriptional activation domain of b-catenin, 2008). Expression of a Y64 phosphomimetic (Y64E) resulted in leading to inhibition of b-catenin-regulated transcription (Zhang et decreased b-catenin transcriptional activity compared with wild- al., 2006). Here, we demonstrate that similarly to KLF4, PTK6 can type protein. The endogenous kinase responsible for associate with and inhibit b-catenin-regulated transcription. phosphorylating b-catenin at Y64, however, was not identified. Although phosphorylation of b-catenin on serine and threonine Here we demonstrate that PTK6 preferentially phosphorylates b- is well recognized as important for regulating intracellular signaling catenin at Y64, and phosphorylation at this site might allow for pools of b-catenin, its phosphorylation on tyrosine is also important phosphorylation at secondary sites. for modulation of its activities and intracellular associations In addition to Y64, Y142, Y331 and/or Y333 were identified as (reviewed by Daugherty and Gottardi, 2007; Lilien and Balsamo, sites phosphorylated by PTK6. Similarly to PTK6, Fyn, Fer (Piedra 2005). Tyrosine kinases that can phosphorylate b-catenin include et al., 2003) and Met (Brembeck et al., 2004) phosphorylate b- the intracellular kinases Abl (Rhee et al., 2002), Src (Behrens et catenin on Y142. Phosphorylation of b-catenin by Fyn and Fer, PTK6 regulates b-catenin 243

which are also localized within the adherens complex, negatively conditions, the cell type in which it is expressed, its expression level regulates b-catenin binding to a-catenin, leading to decreased and its intracellular localization (reviewed by Brauer and Tyner, adhesion (Piedra et al., 2003). Met-regulated phosphorylation of b- 2009). catenin Y142 was reported to lead to its increased association with Bcl9-2, promoting transport to the nucleus and enhancing Materials and Methods Expression constructs transcription (Brembeck et al., 2004). Phosphorylation of b-catenin Full-length wild-type PTK6, PTK6 YF and PTK6 KM constructs in the pRcCMV on Y331/Y333, Y654 and Y670 has been reported in the Caco-2 vector were described previously (Kamalati et al., 1996) and were a gift from Mark colon carcinoma cell line following treatment with acetaldehyde, Crompton (Royal Holloway University of London, Surrey, UK). PTK6 YF has a substitution of the regulatory tyrosine, Y447, to phenylalanine, resulting in a which induced disruption of the E-cadherin/b-catenin complex constitutively active mutant. PTK6 KM has a substitution of a critical lysine (K219) (Sheth et al., 2007). Although PTK6 can phosphorylate b-catenin in the ATP binding site to methionine resulting in a kinase dead mutant. Coding on several tyrosine residues (Y142, Y331/333) that have been linked sequences from the pRcCMV constructs were subcloned into the pcDNA3 vector to decreased adhesion and increased signaling, the lack of reliable containing a Myc epitope tag (Invitrogen). PTK6 constructs tagged with an SV40 nuclear localization signal (NLS) were generated in the pcDNA4/TO vector phosphospecific antibodies for these sites has impeded our ability (Invitrogen). Duplexed oligonucleotides encoding a Myc epitope tag (bold) and the to determine whether these phosphorylation events occur in a SV40 NLS (underlined) (5Ј-AGCTCATGGAACAAAAGCTGATTAGCGAA - physiological setting. GAGGACCTGCCTAAAAAGAAGCGTAAAGTGAACCGGTGCTAGCA-3Ј; 5Ј- AGCTTGCTAGCACCGGTTCACTTTACGCTTCTTTTTAGGCAGGTCCTCTT - The inverse correlation between PTK6 expression and nuclear CGCTAATCAGCTTTTGTTCCATG-3Ј) were introduced into the pcDNA4/TO b-catenin in the gastrointestinal tract makes PTK6 an attractive vector. The coding sequences for wild-type PTK6, PTK6 YF and PTK6 KM were candidate for a negative regulator of b-catenin. Here, we show that subcloned into the vector, and constructs were verified by sequencing. PTK6 PTK6 negatively regulates endogenous -catenin/TCF constructs tagged with the Lyn tyrosine kinase myristoylation/palmitoylation sequence b (Palm) were generated in the pcDNA4/TO vector. Duplexed oligonucleotides transcriptional activity in SW620 cells. Similarly to what we encoding a Myc epitope tag (bold) and the Lyn Palm sequence (underlined) (5Ј- previously observed in the PTK6 knockout animals (Haegebarth et AGCTCATGGGCTGCATCAAGAGCAAGAGGAAGGAACAAAAGCTGATTA - Ј Ј al., 2006), loss of PTK6 in SW620 cells resulted in increased b- GCGAAGAGGACCTGAACCGGTGCTAGCA-3 ; 5 -AGCTTGCTAGCA CCG - GTTCAGGTCCTCTTCGCTAATCAGCTTTTGTTCCTTCCTCTTGCTCTTG- catenin/TCF transcription and increased expression of the b-catenin ATGCAGCCCATG-3Ј) were introduced into the pcDNA4/TO vector. The coding target genes Myc and Survivin. sequences for wild-type PTK6, PTK6 YF and PTK6 KM were subcloned into the We found that PTK6 is a negative regulator of b-catenin vector, and constructs were verified by sequencing. GST-tagged mouse PTK6 fusion constructs (full-length, SH2, SH3 and SH2-SH3 domains), in the bacterial expression transcription in the small and large intestine in BAT-GAL reporter vector pGEX KG, were described previously (Vasioukhin and Tyner, 1997). Wild- mice. Although b-catenin/TCF-driven reporter gene expression is type Myc-tagged human b-catenin, in the mammalian expression vector pCAN, was evident during development and in intestinal adenomas, little provided by Paul Polakis (Genentech). Wild-type GST-tagged mouse b-catenin and activity can be detected in the mature intestinal epithelium (Maretto the GST-tagged b-catenin Y142F point mutant, in the bacterial expression vector pGEX KG, were provided by Jack Lilien (University of Iowa, Iowa City, IA). The et al., 2003). The absence of strongly positive b-galactosidase- Super8XTOPFlash (TOPFlash) luciferase reporter construct containing eight TCF/Lef expressing cells in wild-type BAT-GAL mice suggests that binding sites and the control Super8XFOPFlash (FOPFlash) construct containing eight activation of b-catenin/TCF transcription is transient or very weak mutated TCF/Lef binding sites (Veeman et al., 2003) were a gift from Randall Moon (University of Washington, Seattle, WA) and were used to assess b-catenin in adult crypts and the reporter enzyme activity cannot be easily transcriptional activity. The packaging plasmids HIVtrans and VSVG (Feng et al., detected at the level of sensitivity of the system. However, 2007) were provided by Bin He (University of Illinois at Chicago, Chicago, IL). The

Journal of Cell Science disruption of the Ptk6 gene in BAT-GAL transgenic animals pRL-TK construct was purchased from Promega.

resulted in increased expression of the b-galactosidase reporter in Cell culture and transfection epithelial cells of the mature colon and small intestine (Fig. 7). In Human embryonal kidney (HEK) 293 cells (ATCC CRL-1573) and the human the distal colon, entire crypts were populated by b-galactosidase- colorectal adenocarcinoma cell line SW620 (ATCC CRL-227) were cultured according positive cells, suggesting that PTK6 is important for modulating to ATCC recommendations. Transfections of HEK293 cells were performed using the Lipofectamine Transfection Reagent in combination with PLUS Reagent Wnt signaling in either stem or progenitor cells in this region of (Invitrogen) as per the manufacturer’s instructions. For immunoprecipitation and the intestine. By contrast, enhanced LacZ expression in the small fractionation experiments, HEK293 cells were transfected with DNA encoding PTK6 intestine was detected in single cells in the small intestine, the (pcDNA3.Myc.PTK6) and b-catenin (pCAN.Myc.b-catenin). Transfections of SW620 cells were performed using Lipofectamine 2000 Transfection Reagent (Invitrogen) majority of which had granules that are characteristics of Paneth as per the manufacturer’s instructions. For fractionation experiments, SW620 cells cells, a cell type whose differentiation is positively regulated by were transfected with NLS.PTK6 (pcDNA4/TO.Myc/NLS.PTK6) or Palm.PTK6 Wnt signaling and b-catenin/TCF activity (Andreu et al., 2005; (pcDNA4/TO.Myc/Pal.PTK6) DNA. To examine the effects of PTK6 on wild type van Es et al., 2005). and mutant b-catenin transcriptional activity, HEK293 cells were transfected with Super8XTOPFlash or Super8XFOPFlash DNA, b-catenin (pCAN.Myc.b-catenin) Although PTK6 inhibits b-catenin-regulated transcription in DNA, and PTK6 (pcDNA3.Myc.PTK6) DNA and pRL-TK DNA as an internal normal intestinal cells, its role in cancer might be different. PTK6 transfection control. To examine the effects of PTK6 on endogenous b-catenin is not expressed in the normal mammary gland, but it is frequently transcriptional activity, SW620 cells were transfected with Super8XTOPFlash or Super8XFOPFlash DNA and NLS.PTK6 or Pal.PTK6 DNA and pRL-TK DNA as induced in breast cancers and has been implicated in promoting an internal transfection control. oncogenic signaling (reviewed by Harvey and Crompton, 2004). In normal prostate epithelial cells, PTK6 is largely found in the Luciferase reporter assays HEK293 cells or SW620 cells were transfected as stated above and lysed 18-24 hours nucleus, but in prostate cancer cells it is relocalized to the cytoplasm after transfection and luciferase activity was measured using the Dual-Luciferase (Derry et al., 2003). Even in the normal small intestine, PTK6 has Reporter Assay System (Promega) and the Clarity Microplate Luminometer (Bio- been shown to have distinct functions under different conditions. Tek Instruments). Reporter expression was normalized to co-transfected Renilla Although PTK6 inhibits growth and promotes epithelial cell luciferase activity. differentiation during normal intestinal tissue homeostasis, it is PTK6 knockdown induced in proliferating progenitor cells of the small intestinal crypts The MISSION TRC shRNA Target Set directed against PTK6 was purchased from following irradiation-induced DNA damage, where it promotes Sigma. Lentivirus expressing TRCN0000021549 (shRNA 49), TRCN0000021552 (shRNA 52) and empty vector were produced in the HEK293FT packaging cell line apoptosis (Haegebarth et al., 2009). It is becoming clear that by co-transfection with compatible packaging plasmids HIVtrans and VSVG (Feng functions of PTK6 might differ depending on environmental et al., 2007). SW620 cells were infected with retrovirus (50% viral supernatant and 244 Journal of Cell Science 123 (2)

50% growth medium containing 5 mg/ml polybrene) and placed in selection medium b-catenin and PTK6 fusion protein preparation for in vitro kinase assays containing 2 mg/ml puromycin for 2 weeks. and GST pull-downs GST-tagged mouse b-catenin proteins (wild type and point mutant) as well as GST- Antibodies tagged mouse PTK6 proteins (full-length, SH2, SH3 and SH2/SH3 domains) were Human PTK6 [Brk (C-18)], phosphotyrosine [p-Tyr (PY20)], Sp1 (PEP 2), E-cadherin generated in bacteria. Cleared sonicated bacterial cell lysates were run over a (H-108), Myc (N-262) and Survivin (FL-142) antibodies were purchased from Santa glutathione-Sepharose 4B column (GE Healthcare) and proteins were eluted with Cruz Biotechnology. The anti-phosphotyrosine, clone 4G10 antibody was purchased reduced glutathione in 50 mM Tris-HCl, pH 8.0. Eluted proteins were dialyzed against from Upstate. A b-catenin monoclonal antibody (clone 14) was purchased from BD 4 litre storage buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA, 0.05% Transduction Laboratories. The TCF4 antibody (C9B9), the TLE1/2/3/4 antibody Triton X-100, 5 mM DTT, 25% glycerol). In vitro kinase assays were performed and an antibody directed against the Myc epitope tag (9B11) were purchased from using recombinant human PTK6 (Invitrogen) and the mouse GST.b-catenin wild- Cell Signaling Technology. A monoclonal antibody against GST (4C10) was type and point mutant proteins, as described above. For GST pull-down experiments purchased from Covance. a-tubulin and b-actin (AC-15) antibodies were purchased b-catenin was cleaved from the GST tag by incubation in thrombin (Sigma) and the from Sigma. Donkey anti-rabbit or sheep anti-mouse antibodies conjugated to eluted protein was dialyzed against cold PBS and then against storage buffer as above. horseradish peroxidase were used as secondary antibodies (Amersham Biosciences) The cleaved b-catenin was incubated with recombinant human PTK6 (Invitrogen) and detected by chemiluminescence with SuperSignal West Dura Extended Duration and an in vitro kinase assay was first performed in the presence or absence of ATP. Substrate from Pierce. Mouse PTK6 GST fusion proteins (1 mg full-length, SH2, SH3 and SH2/SH3 domains) were incubated with glutathione-Sepharose 4B beads for 30 minutes and then Protein lysates, immunoprecipitations and immunoblotting Protein fractionation from transfected HEK293 cells was done using the NE-PER incubated with 20 ng phosphorylated or unphosphorylated b-catenin overnight at 4°C. Nuclear and Cytoplasmic Extraction Reagents from Pierce according to the GST pull-downs were washed four times in wash buffer (1% Triton X-100, 20 mM manufacturer’s instructions. Protein fractionation from transfected SW620 cells was HEPES, pH 7.4, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 10 mM Na- ϫ done using the ProteoExtract Subcellular Proteome Extraction Kit from Calbiochem pyrophosphate). Samples were resuspended in 30 ml of 2 Laemmli sample buffer, according to manufacturer’s instructions. One-tenth volume of each fraction was boiled for 5 minutes and resolved by SDS-PAGE. subjected to SDS-PAGE and transferred onto Immobilon-P membranes (Millipore) Ptk6–/– BAT-GAL mice and b-galactosidase staining for immunoblotting. Alternatively, transfected HEK293 cells were lysed in 1% Triton –/– X-100 lysis buffer (1% Triton X-100, 20 mM HEPES, pH 7.4, 150 mM NaCl, 1 mM Female Ptk6 mice in the C57BL/6J genetic background (Haegebarth et al., 2006) were crossed with male BAT-GAL transgenic mice described previously (Maretto et EDTA, 1 mM EGTA, 10 mM sodium pyrophosphate, 100 mM NaF, 10 mM Na3VO4, 5 mM iodoacetic acid, 0.2 mM PMSF, protease inhibitor cocktail). All transfected al., 2003) and purchased from the Jackson Laboratory [B6.Cg-Tg(BAT-lacZ)3Picc/J] +/– cell were harvested 18-24 hours after transfection. Tyrosine-phosphorylated proteins to generate Ptk6 BAT-GAL animals. Heterozygous animals were crossed to generate +/+ –/– were immunoprecipitated using a cocktail of anti-phosphotyrosine antibodies (4G10 Ptk6 BAT-GAL and Ptk6 BAT-GAL mice. Adult animals were sacrificed and and PY20). Changes in proteins levels were quantified using the ImageJ program. small intestines and colons were isolated, washed in fixative (1% formaldehyde, 0.2% glutaraldehyde, 0.02% NP-40 in PBS), and incubated in a b-galactosidase solution . In vitro kinase assays [5 mM K3FE(CN)6, 5 mM K4Fe(CN)6 3H2O, 2 mM MgCl2, 0.02% NP-40, 0.1% Recombinant human PTK6 (Invitrogen) alone or in combination with recombinant sodium deoxycholate, 1 mg/ml 5-bromo-4-chloro-3-indolyl-b-D-galactoside] human b-catenin (Upstate), was incubated in kinase buffer (10 mM HEPES, pH 7.5, overnight. Tissues were fixed overnight in 4% paraformaldehyde and paraffin blocks 150 mM NaCl, 2.5 mM DTT, 0.01% Triton X-100, 10 mM MnCl2) with or without were prepared using standard methods. Tissue sections (5 mm) were prepared and 200 mM ATP for 10 minutes at 30°C. One-tenth of each reaction was subjected to counterstained with either Nuclear Fast Red or hematoxylin and eosin (Vector SDS-PAGE and transferred onto Immobilon-P membranes (Millipore) for Laboratories). immunoblotting. The remainder of each reaction was resolved on a Tris-Glycine pre- cast gel (Invitrogen). Proteins were visualized with Coomassie Brilliant Blue R-250 The authors would like to thank Mark R. Crompton, Paul Polakis, Staining Solution (BioRad). b-catenin was excised from the gel and the gel slice was washed in 50% acetonitrile in preparation for mass spectrometry. Jack Lilien, Randall T. Moon and Bin He for their generous gifts, and Katherine Weaver for reviewing the manuscript. This work was Identification of phosphorylation sites by mass spectrometry supported by National Institutes of Health Grants DK44525 and Phosphorylated GST-tagged human -catenin was subjected to in-gel digestion using Journal of Cell Science b DK068503 (A.L.T.). J.J.G. was supported by an AGA Foundation both trypsin and chymotrypsin separately followed by C18 reversed-phase Graduate Student Research Fellowship Award and is supported by an microcapillary LC/MS/MS using a LTQ 2D linear ion trap mass spectrometer (Thermo Scientific) in positive ion data-dependent acquisition mode. MS/MS spectra were NRSA/NIH Institutional T32 training grant, ‘Training Program in Signal searched against the reversed Swissprot protein database using Sequest (Proteomics Transduction and Cellular Endocrinology’, T32 DK07739 from the Browser, Thermo Scientific) with differential modifications for STY phosphorylation NIDDK. P.M.B. was supported by a DOD Predoctoral Traineeship (+79.97) and methionine oxidation (+15.99). Phosphorylation sites were identified Award, Army W81XWH-06-1-000. Deposited in PMC for release after if they initially passed the following Sequest scoring thresholds: 2+ ions, Xcorr≥2.0, 12 months. Sf≥0.4, P>0; 3+ ions, Xcorr≥2.75, Sf≥0.5, P>0 against the forward database. Peptides with gas phase charges of 1+ and 4+ were not accepted owing to difficulty of interpretation. Passing MS/MS spectra were then manually inspected to be sure that References all b- and y- fragment ions aligned with the assigned protein database sequence. Andreu, P., Colnot, S., Godard, C., Gad, S., Chafey, P., Niwa-Kawakita, M., Laurent- Determination of the exact sites of phosphorylation was aided using GraphMod Puig, P., Kahn, A., Robine, S., Perret, C. et al. (2005). Crypt-restricted proliferation software (Proteomics Browser, Thermo Scientific), resulting in a false-positive and commitment to the Paneth cell lineage following Apc loss in the mouse intestine. identification rate of less than 2%. Development 132, 1443-1451. Batlle, E., Henderson, J. T., Beghtel, H., van den Born, M. M., Sancho, E., Huls, G., Site-directed mutagenesis Meeldijk, J., Robertson, J., van de Wetering, M., Pawson, T. et al. (2002). Beta- Using the QuikChange XL Site-Directed Mutagenesis Kit (Stratagene) we introduced catenin and TCF mediate cell positioning in the intestinal epithelium by controlling the single, double, and triple point mutations (tyrosine to phenylalanine) into Myc-tagged expression of EphB/ephrinB. Cell 111, 251-263. Behrens, J., Vakaet, L., Friis, R., Winterhager, E., Van Roy, F., Mareel, M. M. and human b-catenin in the mammalian expression vector pCAN, and GST-tagged mouse Birchmeier, W. (1993). Loss of epithelial differentiation and gain of invasiveness -catenin in the bacterial expression vector pGEX KG according to manufacturer’s b correlates with tyrosine phosphorylation of the E-cadherin/beta-catenin complex in cells instructions. Mutagenic primers used for human b-catenin include: Y64F, forward, Ј Ј Ј transformed with a temperature-sensitive v-SRC gene. J. Cell Biol. 120, 757-766. 5 -TGGATACCTCCCAAGTCCTGTTTGAGTGGGAAC-3 and reverse, 5 -GTT- Brauer, P. M. and Tyner, A. L. (2009). RAKing in AKT: a tumor suppressor function for CCCACTCAAACAGGACTTGGGAGGTATCCA-3Ј; Y142F, forward, 5Ј-GTAA- Ј Ј the intracellular tyrosine kinase FRK. Cell Cycle 8, 2728-2732. ACTTGATTAAC TTTCAAGATGATGCAGAA-3 and reverse, 5 -GTTCTGCAT - Brembeck, F. H., Schwarz-Romond, T., Bakkers, J., Wilhelm, S., Hammerschmidt, Ј Ј CATCTTGAAAGTTAATCAAGTTTAC-3 ; Y331F/Y333F, forward, 5 -CCAAGC- M. and Birchmeier, W. (2004). Essential role of BCL9-2 in the switch between beta- Ј TTTAGTAAATATAATGAGGACCTTTACTTTCGAAAAACTACTGTGGAC-3 catenin’s adhesive and transcriptional functions. Genes Dev. 18, 2225-2230. Ј and reverse, 5 -GTCCACAGTAGTTTTTCGAAAGTAAAGGTCCTCATTATAT - Daugherty, R. L. and Gottardi, C. J. (2007). Phospho-regulation of Beta-catenin TTACTAAAGCTTGT-3Ј. Mutagenic primers used for mouse b-catenin include adhesion and signaling functions. Physiology (Bethesda) 22, 303-309. Y64F, forward, 5Ј-GACACCTCCCAAGTCCTTTTTGAATGGGAGCAAGG-3Ј Derry, J. J., Richard, S., Valderrama, C. H., Ye, X., Vasioukhin, V., Cochrane, A. W., and reverse, 5Ј-CCTTGCTCCCATTCAAAAAGGACTTGGGAGGTGTC-3Ј; Chen, T. and Tyner, A. L. (2000). Sik (BRK) phosphorylates Sam68 in the nucleus Y331F/Y333F forward, 5Ј-AGTAAACATAATGAGGACCTTCACTTTTGAGA - and negatively regulates its RNA binding ability. Mol. Cell Biol. 20, 6114-6126. AGCTTCTGTGGAC-3Ј and reverse, 5Ј-GTCCACAGAAGCTTCTCAAA AGT - Derry, J. J., Prins, G. S., Ray, V. and Tyner, A. L. (2003). Altered localization and activity GAAGGTCCTCATTATGTTTACT-3Ј. All constructs were sequenced to verify point of the intracellular tyrosine kinase BRK/Sik in prostate tumor cells. Oncogene 22, 4212- mutations. 4220. PTK6 regulates b-catenin 245

Feng, Z., Cerveny, M., Yan, Z. and He, B. (2007). The VP35 protein of Ebola virus Monga, S. P., Mars, W. M., Pediaditakis, P., Bell, A., Mule, K., Bowen, W. C., Wang, inhibits the antiviral effect mediated by double-stranded RNA-dependent protein kinase X., Zarnegar, R. and Michalopoulos, G. K. (2002). Hepatocyte growth factor induces PKR. J. Virol. 81, 182-192. Wnt-independent nuclear translocation of beta-catenin after Met-beta-catenin dissociation Fevr, T., Robine, S., Louvard, D. and Huelsken, J. (2007). Wnt/beta-catenin is essential in hepatocytes. Cancer Res. 62, 2064-2071. for intestinal homeostasis and maintenance of intestinal stem cells. Mol. Cell. Biol. 27, Petro, B. J., Tan, R. C., Tyner, A. L., Lingen, M. W. and Watanabe, K. (2004). 7551-7559. Differential expression of the non-receptor tyrosine kinase BRK in oral squamous cell Gregorieff, A. and Clevers, H. (2005). Wnt signaling in the intestinal epithelium: from carcinoma and normal oral epithelium. Oral Oncol. 40, 1040-1047. endoderm to cancer. Genes Dev. 19, 877-890. Piedra, J., Miravet, S., Castano, J., Palmer, H. G., Heisterkamp, N., Garcia de Herreros, Gregorieff, A., Pinto, D., Begthel, H., Destree, O., Kielman, M. and Clevers, H. (2005). A. and Dunach, M. (2003). p120 Catenin-associated Fer and Fyn tyrosine kinases Expression pattern of Wnt signaling components in the adult intestine. Gastroenterology regulate beta-catenin Tyr-142 phosphorylation and beta-catenin-alpha-catenin Interaction. 129, 626-638. Mol. Cell. Biol. 23, 2287-2297. Haegebarth, A., Heap, D., Bie, W., Derry, J. J., Richard, S. and Tyner, A. L. (2004). Pinto, D., Gregorieff, A., Begthel, H. and Clevers, H. (2003). Canonical Wnt signals are The nuclear tyrosine kinase BRK/Sik phosphorylates and inhibits the RNA-binding essential for homeostasis of the intestinal epithelium. Genes Dev. 17, 1709-1713. activities of the Sam68-like mammalian proteins SLM-1 and SLM-2. J. Biol. Chem. Qiu, H. and Miller, W. T. (2002). Regulation of the nonreceptor tyrosine kinase Brk by 279, 54398-54404. autophosphorylation and by autoinhibition. J. Biol. Chem. 277, 34634-34641. Haegebarth, A., Bie, W., Yang, R., Crawford, S. E., Vasioukhin, V., Fuchs, E. and Rhee, J., Mahfooz, N. S., Arregui, C., Lilien, J., Balsamo, J. and VanBerkum, M. F. Tyner, A. L. (2006). Protein tyrosine kinase 6 negatively regulates growth and promotes (2002). Activation of the repulsive receptor Roundabout inhibits N-cadherin-mediated enterocyte differentiation in the small intestine. Mol. Cell. Biol. 26, 4949-4957. cell adhesion. Nat. Cell Biol. 4, 798-805. Haegebarth, A., Perekatt, A. O., Bie, W., Gierut, J. J. and Tyner, A. L. (2009). Induction Serfas, M. S. and Tyner, A. L. (2003). Brk, Srm, Frk, and Src42A form a distinct family of protein tyrosine kinase 6 in mouse intestinal crypt epithelial cells promotes DNA of intracellular Src-like tyrosine kinases. Oncol Res. 13, 409-419. damage-induced apoptosis. Gastroenterology 137, 945-954. Sheth, P., Seth, A., Atkinson, K. J., Gheyi, T., Kale, G., Giorgianni, F., Desiderio, D. Harvey, A. J. and Crompton, M. R. (2004). The Brk protein tyrosine kinase as a therapeutic M., Li, C., Naren, A. and Rao, R. (2007). Acetaldehyde dissociates the PTP1B-E- target in cancer: opportunities and challenges. Anticancer Drugs 15, 107-111. cadherin-beta-catenin complex in Caco-2 cell monolayers by a phosphorylation- He, T. C., Sparks, A. B., Rago, C., Hermeking, H., Zawel, L., da, Costa, L. T., Morin, dependent mechanism. Biochem. J. 402, 291-300. P. J., Vogelstein, B. and Kinzler, K. W. (1998). Identification of c-MYC as a target of Shin, D. S., Kim, Y. G., Kim, E. M., Kim, M., Park, H. Y., Kim, J. H., Lee, B. S., Kim, the APC pathway. Science 281, 1509-1512. B. G. and Lee, Y. S. (2008). Solid-phase peptide library synthesis on HiCore resin for Hoschuetzky, H., Aberle, H. and Kemler, R. (1994). Beta-catenin mediates the interaction screening substrate specificity of Brk protein tyrosine kinase. J. Comb. Chem. 10, 20- of the cadherin-catenin complex with epidermal growth factor receptor. J. Cell Biol. 23. 127, 1375-1380. Sierra, J., Yoshida, T., Joazeiro, C. A. and Jones, K. A. (2006). The APC tumor suppressor James, R. G., Biechele, T. L., Conrad, W. H., Camp, N. D., Fass, D. M., Major, M. B., counteracts beta-catenin activation and H3K4 methylation at Wnt target genes. Genes Sommer, K., Yi, X., Roberts, B. S., Cleary, M. A. et al. (2009). Bruton’s tyrosine kinase Dev. 20, 586-600. revealed as a negative regulator of Wnt-beta-catenin signaling. Sci. Signal 2, ra25. Siyanova, E. Y., Serfas, M. S., Mazo, I. A. and Tyner, A. L. (1994). Tyrosine kinase Kamalati, T., Jolin, H. E., Mitchell, P. J., Barker, K. T., Jackson, L. E., Dean, C. J., gene expression in the mouse small intestine. Oncogene 9, 2053-2057. Page, M. J., Gusterson, B. A. and Crompton, M. R. (1996). Brk, a breast tumor- Tominaga, J., Fukunaga, Y., Abelardo, E. and Nagafuchi, A. (2008). Defining the derived non-receptor protein-tyrosine kinase, sensitizes mammary epithelial cells to function of beta-catenin tyrosine phosphorylation in cadherin-mediated cell-cell adhesion. epidermal growth factor. J. Biol. Chem. 271, 30956-30963. Genes Cells 13, 67-77. Kasprzycka, M., Majewski, M., Wang, Z. J., Ptasznik, A., Wysocka, M., Zhang, Q., van de Wetering, M., Sancho, E., Verweij, C., de Lau, W., Oving, I., Hurlstone, A., Marzec, M., Gimotty, P., Crompton, M. R. and Wasik, M. A. (2006). Expression van der Horn, K., Batlle, E., Coudreuse, D., Haramis, A. P. et al. (2002). The beta- and oncogenic role of Brk (PTK6/Sik) protein tyrosine kinase in lymphocytes. Am. J. catenin/TCF-4 complex imposes a crypt progenitor phenotype on colorectal cancer cells. Pathol. 168, 1631-1641. Cell 111, 241-250. Kim, H. I. and Lee, S. T. (2009). Oncogenic functions of PTK6 are enhanced by its targeting van Es, J. H., Jay, P., Gregorieff, A., van Gijn, M. E., Jonkheer, S., Hatzis, P., Thiele, to plasma membrane but abolished by its targeting to nucleus. J. Biochem. 146, 133- A., van den Born, M., Begthel, H., Brabletz, T. et al. (2005). Wnt signalling induces 139. maturation of Paneth cells in intestinal crypts. Nat. Cell Biol. 7, 381-386. Korinek, V., Barker, N., Moerer, P., van Donselaar, E., Huls, G., Peters, P. J. and Clevers, Vasioukhin, V., Serfas, M. S., Siyanova, E. Y., Polonskaia, M., Costigan, V. J., Liu, B., H. (1998). Depletion of epithelial stem-cell compartments in the small intestine of mice Thomason, A. and Tyner, A. L. (1995). A novel intracellular epithelial cell tyrosine lacking Tcf-4. Nat. Genet. 19, 379-383. kinase is expressed in the skin and gastrointestinal tract. Oncogene 10, 349-357. Lee, H., Kim, M., Lee, K. H., Kang, K. N. and Lee, S. T. (1998). Exon-intron structure Vasioukhin, V. and Tyner, A. L. (1997). A role for the epithelial-cell-specific tyrosine

Journal of Cell Science of the human PTK6 gene demonstrates that PTK6 constitutes a distinct family of non- kinase Sik during keratinocyte differentiation. Proc. Natl. Acad. Sci. USA 94, 14477- receptor tyrosine kinase. Mol. Cells 8, 401-407. 14482. Lee, S. T., Strunk, K. M. and Spritz, R. A. (1993). A survey of protein tyrosine kinase Veeman, M. T., Slusarski, D. C., Kaykas, A., Louie, S. H. and Moon, R. T. (2003). mRNAs expressed in normal human melanocytes. Oncogene 8, 3403-3410. Zebrafish prickle, a modulator of noncanonical Wnt/Fz signaling, regulates gastrulation Lilien, J. and Balsamo, J. (2005). The regulation of cadherin-mediated adhesion by tyrosine movements. Curr. Biol. 13, 680-685. phosphorylation/dephosphorylation of beta-catenin. Curr. Opin. Cell Biol. 17, 459-465. Wang, T. C., Jee, S. H., Tsai, T. F., Huang, Y. L., Tsai, W. L. and Chen, R. H. (2005). Llor, X., Serfas, M. S., Bie, W., Vasioukhin, V., Polonskaia, M., Derry, J., Abbott, C. Role of breast tumour kinase in the in vitro differentiation of HaCaT cells. Br. J. Dermatol. M. and Tyner, A. L. (1999). BRK/Sik expression in the gastrointestinal tract and in 153, 282-289. colon tumors. Clin. Cancer Res. 5, 1767-1777. Whitehead, R. H., Robinson, P. S., Williams, J. A., Bie, W., Tyner, A. L. and Franklin, Lu, Z. and Hunter, T. (2004). Wnt-independent beta-catenin transactivation in tumor J. L. (2008). Conditionally immortalized colonic epithelial cell line from a Ptk6 null development. Cell Cycle 3, 571-573. mouse that polarizes and differentiates in vitro. J. Gastroenterol. Hepatol. 23, 1119- Maretto, S., Cordenonsi, M., Dupont, S., Braghetta, P., Broccoli, V., Hassan, A. B., 1124. Volpin, D., Bressan, G. M. and Piccolo, S. (2003). Mapping Wnt/beta-catenin signaling Zeng, G., Apte, U., Micsenyi, A., Bell, A. and Monga, S. P. (2006). Tyrosine residues during mouse development and in colorectal tumors. Proc. Natl. Acad. Sci. USA 100, 654 and 670 in beta-catenin are crucial in regulation of Met-beta-catenin interactions. 3299-3304. Exp. Cell Res. 312, 3620-3630. Mitchell, P. J., Barker, K. T., Martindale, J. E., Kamalati, T., Lowe, P. N., Page, M. Zhang, T., Otevrel, T., Gao, Z., Gao, Z., Ehrlich, S. M., Fields, J. Z. and Boman, B. J., Gusterson, B. A. and Crompton, M. R. (1994). Cloning and characterisation of M. (2001). Evidence that APC regulates survivin expression: a possible mechanism cDNAs encoding a novel non-receptor tyrosine kinase, brk, expressed in human breast contributing to the stem cell origin of colon cancer. Cancer Res. 61, 8664-8667. tumours. Oncogene 9, 2383-2390. Zhang, W., Chen, X., Kato, Y., Evans, P. M., Yuan, S., Yang, J., Rychahou, P. G., Yang, Mitchell, P. J., Barker, K. T., Shipley, J. and Crompton, M. R. (1997). Characterisation V. W., He, X., Evers, B. M. et al. (2006). Novel cross talk of Kruppel-like factor 4 and and chromosome mapping of the human non receptor tyrosine kinase gene, brk. Oncogene beta-catenin regulates normal intestinal homeostasis and tumor repression. Mol. Cell. 15, 1497-1502. Biol. 26, 2055-2064.