Genetic Analyses of Signal Transduction Pathways

GENETIC ANALYSES OF SIGNAL TRANSDUCTION PATHWAYS

INVOLVED IN NEUROMUSCULAR EXCITABILITY AND NEURODEGENERATION IN

CAENORHABTIDIS ELEGANS

BWARENABA KAUTU

GUY A. CALDWELL, COMMITTEE CHAIR

KIM A. CALDWELL JANIS M. O’DONNELL STEVAN MARCUS KATRINA RAMONELL ANDREW WEST

A DISSERTATION

Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Biological Sciences in the Graduate School of The University of Alabama

TUSCALOOSA, ALABAMA

2012

ABSTRACT

Signal transduction pathways regulate many cellular and molecular aspects of the brain

including neurotransmission and cell survival. Defects in neuronal signaling can lead to a variety

of cognitive and affective disorders such as epilepsy and Parkinson’s disease. Here, I use a

genetically tractable organism, Caenorhabditis elegans (C. elegans), as a model system to study the impact of two canonical signaling pathways on neuronal activity and survival. Using molecular and genetic tools, pharmacological assays, and microscopy techniques, I showed that the canonical Rac GTPase pathway regulates neuronal synchrony in the GABAergic neurons of

C. elegans. In our experiments we observed that Rac GTPase mutants exhibited behavioral responses to a GABAA receptor antagonist, pentylenetetrazole. These mutants also exhibited

hypersensitivities to an acetylcholinesterase inhibitor, aldicarb, suggesting deficiencies in GABA

transmission. Knockdown of selected cytoskeletal genes in Rac hypomorph mutants revealed

synergistic interactions, particularly between the dynein motor complex and some members of

the canonical Rac-signaling pathway. Examination of the nerve cords of C. elegans revealed that

these genetic factors function to regulate vesicle transport in the GABAergic neurons of C.

elegans.

In my second project, I characterized the role of the heterotrimeric G protein Gαq in the

context of neuronal survival, using a C. elegans model of Parkinson’s disease. In this work, we

found that activation of Gαq (EGL-30) can significantly protect the dopaminergic neurons

against a human Parkinson’s gene, α-synuclein (α-syn). Interestingly, inactivation of

downstream effectors of Gαq exacerbated the loss of dopaminergic neurons in the presence of α- syn suggesting that these factors likey function in a common pathway with Gαq to provide protection for the dopaminergic neurons against α-syn-induced toxicity. These data suggest that activation of Gαq signaling pathway can offer protection to the dopaminergic neurons and could be a potential therapeutic target for neurodegenerative diseases like Parkinson’s disease. Taken together, my work showed that Rac GTPase signaling pathway controls neuromuscular excitability in C. elegans and Gαq signaling modulates protection of the dopaminergic neurons.

iii

DEDICATION

This dissertation is dedicated to two people. First and foremost, to my grandmother

Kaarite Titiba who not only raised me in the absence of my biological parents, but also made a significant impact on my personal life and goals. Second, I dedicate this writing to my aunt

(adoptive mother) Tekarawarawa Tematang who accepted me (an orphan looking for a home) to be a part of her family, and provided me with care and education.

LIST OF ABBREVIATIONS AND SYMBOLS

6OHDA 6-hydroxydopamine

α Alpha

Ach Acetylcholine

ADE Anterior deirid neuron

β Beta

bp Base pair

0C Degrees Celsius

Ca2+ Calcium ion cDNA Complementary DNA

CEP Cephalic neuron dsRNA double-stranded RNA

D2 Dopamine 2 receptor

DA Dopamine

DAG Diacylglyerol

DNA Deoxyribonucleic acid

ε Epsilon

EGL Egg-laying defective

GABA GAMA aminobutyric acid

GAP GTPase activating protein

GDP Guanosine-5'-diphosphate

GEF Guanine nucleotide exchange factor

GTP Guanosine-5'-triphosphate

GFP Green Fluorescent Protein

H4 Neuroglioma cell line kDa Kilodalton

MAPK Mitogen-activated protein kinase

MAPKK Mitogen-activated protein kinase kinase

MAPKKK Mitogen-activated protein kinase kinase kinase

MPP+ 1-Methyl-4-phenylpyridinium

MPTP 1-Methyl-4-phenyl-1, 2, 5, 6-tetrahydropyridine

μg Microgram

μM Micromolar mg Milligram ml Milliliter mM Millimolar mRNA messenger RNA miRNA microRNA n sample size number

NMDA N-methyl-D-aspartic acid

NMJ Neuromuscular junction p Probability of null hypothesis

PARK Parkinson’s disease gene

PD Parkinson’s disease

PDE Posterior deirid neuron

PTZ Pentylenetetrazole

RGS Regulator of G protein signaling

RNA Ribonucleic acid

RNAi RNA interference

RT-PCR Reverse transcription polymerase chain reaction

SD Standard deviation

SEM Standard error of the mean

Unc Uncoordinated movement

UPR Unfolded protein response

UPS Upiquitin proteasome system

VA Valproic acid

WT Wildtype

Proteins/genes

α-syn Alpha synuclein

CAT-1 C. elegans vesicular monoamine transporter

CAT-2 C. elegans Tyrosine Hydroxylase

CED-10 C. elegans Rac GTPase protein

DJ-1 Oncogene DJ

EGL-8 C. elegans Phospholipase enzyme beta

EGL-10 C. elegans RGS protein

EGL-30 C. elegans heterotrimeric Gαq protein

vii

ERK-MAPK Extracellular regulated MAP kinase

CDK-5 Cyclin dependent kinase 5

GOA-1 C. elegans heterotrimeric g protein Gαo

INA-1 C. elegans integrin alpha receptor protein

LIS-1 C. elegans lissencephaly protein

LRRK2 Leucine-rich repeat kinase

MIG-2 C. elegans Rac/Rho protein

PTEN Phosphatase and tensin homolog

PKC Protein Kinase C

RAB-3 Small Ras associated protein

SID-1 Double stranded RNA transporter memberane

SNARE Soluble NSF attachment protein receptor

SNB-1 Synaptobrevin 1

viii

ACKNOWLEDGMENTS

I want to first thank my academic advisors Guy Caldwell and Kim Caldwell for giving me the opportunity to learn scientific research in their wonderful lab at this institution. I am also thankful for their mentorship and continual support to me since the beginning of my graduate school. I also want to thank my colleagues and friends in the Caldwell Lab for the relationship we have shared together. In particular, I am indebted to Cody Locke who taught me a lot about how to become a better thinker and researcher. In addition, I am grateful for the assistance of former and current undergraduate students who have helped me with several projects. Kyle Lee and Kalen Berry were the first undergraduates whom I had the priviledge to work with. Matthew

Hicks, Chris Gilmartin, and Akeem Borom are the recent undergraduate students who have also contributed to our research work. I also want to take this opportunity to acknowledge our wonderful lab manager, Dr. Laura Berkowitz, who has not only kept the lab safe and organized all the time, but has also been actively involved in mentoring students including myself. I thank

The University of Alabama and the Department of Biological Sciences for the golden opportunity they have offered me here, i.e. to receive an education from such great institution. I thank all my graduate committee members, Dr.Stevan Marcus, Dr. Janis O’Donnell, Dr. Katrina

Ramonell, Dr. Kim Caldwell, and Dr. Guy Caldwell for guiding me throughout my entire graduate study.

CONTENTS

ABSTRACT ...... ii

DEDICATION ...... iv

LIST OF ABBREVIATIONS AND SYMBOLS ...... v

ACKNOWLEDGMENTS ...... ix

LIST OF TABLES ...... xiv

LIST OF FIGURES ...... xv

1. INTRODUCTION a. Use of C. elegans in the study of synaptic transmission ...... 3 b. Methods for studying synaptic transmission in C. elegans...... 4 c. Key synaptic transmission pathways in C. elegans ...... 8 d. Modulation of neuromuscular excitability in C. elegans ...... 11 e. The role of cytoskeletal proteins in neurotransmission...... 13 f. C. elegans as a model system for studying Epilepsy ...... 15 g. C. elegans as a model system for studying Parkinson’s disease...... 17 h. Using C. elegans to study genetic factors associated with PD ...... 17 i. C. elegans α-syn model for neurodegeneration ...... 20 j. Use of C. elegans to identify modifiers of α-syn toxicity ...... 22 k. The role of dopamine signaling pathways in the survival of dopaminergic neurons ...... 23

l. Current studies ...... 24 m. References ...... 27

2. USING A COMPLEMENTARY PHARMACOLOGICAL/ BEHAVIORAL APPROACH TO CHARACTERIZE C. ELEGANS SYNAPTIC TRANSMISSION a. Abstract ...... 36 b. Materials/Methods ...... 37 c. Results ...... 39 d. Discussion ...... 41 e. References ...... 43

3. PHARMACOGENETIC ANALYSIS REVEALS THE POSTDEVELOPMENTAL ROLE OF RAC GTPASES IN GABAERGIC NEUROTRANSMISSION a. Abstract ...... 45 b. Introduction ...... 46 c. Materials/Methods...... 48 d. Results ...... 51 e. Discussion ...... 87 f. References ...... 94 h. Supporting online files ...... 101

4. MODULATION OF NEUROPROTECTION BY A CANONICAL GALPHAQ SIGNALING PATHWAY IN A C. ELEGANS MODEL OF PARKINSON’S DISEASE a. Abstract ...... 104 b. Introduction ...... 104 c. Materials/Methods...... 107

d. Results ...... 109

e. Discussion ...... 124

f. References ...... 130

5. PROTECTION OF C. ELEGANS DOPAMINERGIC NEURONS BY VALPROIC ACID a. Abstract ...... 134 b. Introduction ...... 135 c. Materials/Methods...... 137 d. Results ...... 140 e. Discussion ...... 143 f. References ...... 145

6. CONCLUSION a. Characterizing the postdevelopmental role of Rac GTPases ...... 149 b. Redundant functions of ced-10 and mig-2 in GABA transmission ....150 c. The role of specific Rac regulators in GABA transmission ...... 151 d. Not all Rac regulators display defects in GABA transmission ...... 151

e. The role of Rac GTPases and regulators in GABA vesicle motility ...152

f. Postdevelopmental role of Rac in GABA transmission ...... 153

g. Link between Rac GTPases and the dynein motor complex ...... 153

h. Neuroanatomy of the GABAergic nervous system ...... 154

i. Contribution of Glu-gated Cl_ channels to PTZ-induced convulsion ..155

j. PTZ-induced convulsion is associated with Rac deficiency ...... 156

k. Modulation of neuroprotection by Gαq ...... 157

l. The role of downstream effectors of Gαq in neuroprotection ...... 157

xii

m. ERK-MAPK as a downstream effector of Gαq ...... 158

n. Established role of ERK-MAPK in neuroprotection ...... 160

o. Negative regulation of egl-30 by goa-1 ...... 160

p. Neuroprotective role of valproic acid ...... 161

q. Previous studies showing the neuroprotective function of VA ...... 163

r. The link between valproic acid and ERK-MAPK ...... 163 s. Summary of dissertation ...... 164 t. Current studies ...... 164 u. References ...... 166

xiii

LIST OF TABLES

1.1 C. elegans mutants with GABA related transmission defects ...... 6

1.2 Synaptic transmission genes in C. elegans ...... 9

1.3 PARK genes ...... 19

2.1 Strains characterized with PTZ and aldicarb ...... 40

3.1 Mutants with no PTZ-induced anterior convulsions ...... 56

3.2 Rac signaling mutants with PTZ-induced convulsions ...... 60

3.3 SNB-1: GFP axonal gaps ...... 75

4.8 Molecular targets of Valproic Acid ...... 162

xiv

LIST OF FIGURES

1.1 C. elegans neuromuscular activity ...... 12

1.2 C. elegans dopaminergic neurons ...... 21

3.1 PTZ convulsion assay with Rac mutants ...... 53

3.2 Still frame video images of Rac signaling mutants ...... 54

3.3 Still frame images of Rac mutants ...... 55

3.4 PTZ convulsion assays of Rac mutants ...... 64

3.5 Aldicarb paralysis assays ...... 68

3.6 Young adult animals SNB-1: GFP microscopy ...... 71

3.7 Rac adult mutants SNB-1: GFP microscopy ...... 73

3.8 RNAi treated animals SNB-1: GFP microscopy ...... 78

3.9 RNAi treated animals SNB-1: GFP Dorsal Nerve Cord ...... 79

3.10 RNAi treated animals SNB-1: GFP Ventral Nerve Cord ...... 81

3.11 PTZ and aldicarb assays genetic interaction study…………………83

3.12 PTZ and aldicarb assays genetic interaction study ...... 85

3.13 Model of Rac GTPase signaling in C. elegans GABA signaling ...... 91

4.1 Gαq protection of dopaminergic neurons ...... 111

4.2 egl-8 and pkc-1 mutants neurodegeneration ...... 113

4.3 α-syn; pkc-2 (neurodegeneration) ...... 114

4.4 Cell specific RNAi of egl-8, pkc-1, and egl-30 ...... 116

4.5 Cell specific RNAi of mek-2, and mpk-1 ...... 118

4.6 Cell specific RNAi of mpk-1 and pkc-1 ...... 119

4.7 goa-1; egl-30 double mutant neurodgeneration ...... 121

4.8 egl-10; α-syn neurodegeneration ...... 123

4.9 Cell specific RNAi of itr-1 ...... 127

5.1 α-Syn overexpression in C. elegans dopaminergic neurons ...... 138

5.2 Graph of valproic acid experiment without RNAi ...... 139

5.3 Graph of valproic experiment with RNAi of mek-2 and mpk-1 ...... 142

6.1 Gαq signaling pathway in mammalian dopaminergic neurons ...... 159

xvi

CHAPTER 1

INTRODUCTION

The human brain is a highly complex organ consisting of billions of neurons. At

the molecular level, neurons employ chemical/electrical signals to communicate with

other cells. Defects in neurotransmission can lead to a variety of cognitive/neurological

disorders. For many years, the uses of rodent models and patient studies have been the

dominant approaches in the study of neurological function and pathology. At the same

time, basic and clinical scientists are often puzzled by the enormous complexity of the

mammalian brain, which stands as a formidable barrier hindering their ability to

investigate certain aspects of the cellular and molecular events associated with cognitive

function. Consequently, many neurobiologists have turned to a reductionist approach

whereby a scientific hypothesis is experimentally tested using model organisms with

simpler brains.

The nematode, Caenorhabditis elegans (C. elegans), has become one of the most desirable model systems for studying neurological function. Despite its evolutionary distance from humans, the C. elegans nervous system recapitulates many of the characteristics of the mammalian brain, which include conserved neurotransmitters, neuropeptide molecules, receptors, ion channels, and synaptic structure. Unlike the human brain, the C. elegans hermaphrodite possesses exactly 302 neurons, whose anatomy and connectivity has been completely mapped from reconstructed electron micrographs and refined to a greater extent

by pharmacological assays and advanced imaging tools (White et al. 1986). Thus, C. elegans offers an excellent system to study the cellular and molecular aspects of neuronal function and integrity in greater detail.

In this dissertation I present genetic and molecular evidence revealing the role of specific cytoskeletal and neuronal signaling pathways in the control of neuromuscular excitability

(neurotransmission) and neurodegeneration using what some scientists have called the “best understood animal on the planet”. In the second chapter of this dissertation, I set out to establish a complementary behavioral assay as a tool to improve the study of C. elegans neurotransmission, using two complementary pharmacological neural stimulants. This method was designed to better resolve the relationship between GABAergic and cholinergic signaling in the C. elegans nervous system. In chapter 3, I elucidated the plausible post-developmental role of integrin-Rac GTPase signaling pathway in the control of neuromuscular excitability, more specifically in the context of synaptic vesicle motility. In chapter 4, using C. elegans as a model for Parkinson’s disease, I showed that dopaminergic neuronal integrity is mediated by an evolutionary conserved heterotrimeric G protein signaling pathway. In chapter 5, I demonstrated how C. elegans can be effectively used not only as a model system for identifying dopaminergic neuroprotective compounds, but for studying the neuroprotective mechanisms associated with such compounds. In this particular study, the neuroprotective effect of the mood-stabilizing and anti-epileptic compound, valproic acid (VA), was elucidated. Overall, this body of work not only demonstrates the power of C. elegans in unraveling novel pathways that govern the function of the nervous system but also shows the expediency of this animal in modeling neurodegenerative diseases as well as assists in the discovery of potential novel therapeutic targets for PD.

Use of C. elegans in the study of synaptic transmission

Communication between nerve cells in the brain is mediated by the controlled release of

neurotransmitters at the synapse. The molecular events and machineries that regulate synaptic

transmission are conserved in metazoans (Riddle et al. 1997). In vertebrates, the identification of synaptic transmission components have been achieved mostly by biochemical analyses, whereas genetic approaches were utilized to unravel the molecular features of neurotransmission using invertebrate model organisms like C. elegans and Drosophila (Rand and Nonet, 1997). The biochemical approach has provided insight into the biochemical mechanisms underlying synaptic transmission, whereas the genetic approach has often led to the discovery of novel genes and pathways that often complement the biochemical models of synaptic transmission. The C. elegans hermaphrodite has an invariant 959 cells of which exactly 302 are neurons. The anatomy and connectivity of the entire nervous system has been completely mapped using reconstruction images obtained from electron micrographs (White et al. 1986). The reconstructed atlas of the

C. elegans nervous system not only reveals important information about the structure of the synapses but shows the existence of approximately 5,000 chemical synapses, 2,000 neuromuscular junctions, and 700 gap junctions. These synapses harbor the majority of the same chemical transmitters that are synthesized in the mammalian brain. For instance, neurobiologists have reported that the neurons of C. elegans express the classical neurotransmitters GABA, acetylcholine, serotonin, dopamine, glutamate, etc. Additional studies have also demonstrated that many other conserved molecules like neuropeptides, amino acids, and cytoskeletal proteins also play a role in neurotransmission (reviewed by Rand and Nonet, 1997). All these features of

C. elegans make this nematode a great model system for studying the molecular mechanisms of

neurotransmission. Moreover, due to its genetic amenability (Brenner, 1974), C. elegans offers a tremendous advantage for the discovery of novel synaptic transmission genes and pathways.

Methods for studying synaptic transmission in C. elegans

A variety of methods have been used to study synaptic transmission in C. elegans. In this chapter, I discuss the three most commonly used tools for studying neurotransmission. The most common methods for studying neurotransmission in C. elegans involve the use of behavioral/pharmacological assays, optical imaging techniques, and electrophysiology. First, pharmacological assays provide an opportunity to isolate mutants that harbor defects in neurotransmission. In this procedure, animals are exposed to neural stimulants that interfere with neuronal activity. These pharmacological agents have known cognate targets in the nervous system of C. elegans and appear to have specificity to corresponding neurotransmitter systems.

Some of the commonly used neural stimulants include an acetylcholineesterase (AChE) inhibitor aldicarb, pentylenetetrazole (PTZ), which is a GABA receptor antagonist, and acetylcholine agonists and antagonists such as levamisole, and atropine, respectively. In the C. elegans field, aldicarb assays are the standard procedure for characterizing synaptic transmission mutants

(Locke and Kautu et al. 2009). This assay was developed to identify mutants that displayed altered levels of acetylcholine secretion at the neuromuscular junction (Mahoney et al.2006).

When wildtype (WT) animals are placed on aldicarb, they gradually accumulate acetylcholine at the neuromuscular junction (NMJ). Such accumulation of acetylcholine causes worms to become paralyzed. This phenotype serves as the basis for characterizing synaptic transmission mutants.

For instance, if the normal function of gene x in the cell is to positively regulate acetylcholine transmission, then inactivation of gene x in C. elegans will confer resistance to aldicarb-induced

paralysis. This is because elimination of gene x results in decreased acetylcholine signaling

leading to diminished neuromuscular over-stimulation. Conversely, if the function of gene y is to negatively regulate acetylcholine transmission then disruption of gene y in C. elegans will lead

to enhanced paralysis. Aldicarb assays have led to the identification of important general

synaptic transmission genes including snb-1(synabtobrevin 1), unc-13 (priming protein), and tom-1 (tomosyn homolog), just to name a few. Moreover, in combination with genetic technologies such as reverse and forward genetics, C. elegans scientists can perform a large

genome-wide screen to identify novel modifiers of synaptic transmission (Sieburth et al. 2005; reviewed by Rand, 2007; Vashlisan et al. 2008).

Our lab has also developed a PTZ convulsion assay for the study of GABA transmission

(Williams et al. 2004; Locke et al. 2006; Locke et al. 2008). PTZ blocks GABA reception at the

synapse, causing diminished GABA transmission within the post-synaptic cell. C. elegans WT animals do not exhibit any behavioral deficits when exposed to PTZ. However, worms which are defective in GABA, such as unc-25 and unc-47 mutants, exhibited epileptic-like convulsions.

This suggests that decreased levels of GABA allows PTZ to overcome an epileptic-like seizure threshold and that perturbation of pathways that affect GABA signaling lower the intrinsic convulsive threshold of C. elegans. Using this assay, a number of mutants that are deficient in

GABA signaling have been characterized (Table 1.1).

Table 1.1 Key C. elegans mutants with neurotransmission deficits. These mutants exhibited epileptic-like convulsions in the presence of a GABA receptor antagonist Pentylenetetrazole (PTZ).

Mutant name Molecular Putative function References descripition of in C. elegans the gene involved neurotransmission

unc-25 Glutamic acid GABA presynaptic Jin et al. 1999; decarboxylase transmission Williams et al. 2004 unc-46 GABA transporter GABA presynaptic Williams et al. protein transmission; 2004; Jorgensen, excitatory 2005 transmission unc-47 Vesicular GABA GABA presynaptic Williams et al. transporter transmission 2004

unc-49 GABAA receptor GABA Williams et al. postsynaptic 2004 transmission lis-1 Lissencephaly 1 Mediates GABA Williams et al. protein vesicle localization 2004

rab-3 Ras GTPase exocytosis, vesicle Nonet et al. 1997; (RAB3 protein) trafficking; general Locke and Kautu synaptic et al. 2009 transmission nud-1 NudC homolog GABA vesicular Locke and nulcear migration localization Williams et al. protein 2006 cdk-5 Cyclic-dependent GABA vesicular Locke and kinase 5 localization Williams et al. 2006

The uses of acetylcholine agonists and antagonists have also led to the characterization of mutants with presynaptic and postsynaptic signaling defects in acetylcholine transmission.

Acetylcholine receptors (AChRs) are broadly expressed in the nervous system and can be classified into two categories. The first group consists of Ach-gated ion channels, which are normally referred to as nicotinic AChRs. These receptors can be activated by acetylcholine agonists such as levamisole (Richmond and Jorgensen, 1999; Waggoner et al. 2000). The second group of acetylcholine receptors are known as G protein coupled receptors (GPCR). These receptors can be modulated by acetylcholine antagonists such as atropine (Robatzek et al. 2001).

Altogether, the use of acetylcholine agonists and antagonists along with aldicarb and PTZ assays can better facilitate the characterization of novel synaptic transmission genes.

The results of the pharmacological neuromuscular manipulation in C. elegans can be corroborated by imaging work. For instance, the use of serial electron micrographs can yield important information regarding the local distribution of synaptic vesicles, alterations in synaptic structures and density, etc (White, 1986; Nonet, 1999; Dittman and Kaplan, 2006). Moreover, in combination with molecular biology techniques and optical imaging, an investigator can create fusion protein constructs whereby synaptic vesicles are tagged with a green fluorescent marker

(GFP), or other variants to mark presynaptic terminals (Nonet et al. 1999). These protein fusions can be slightly modified and expressed under different promoters to suit the purpose of quantifying synaptic vesicle distribution and dynamics of disparate neuronal networks (Sieburth et al. 2005; Dittman and Kaplan, 2006; Sturt et al. 2012). For instance, when imaging synapses in the nerve cords of C. elegans, an investigator can identify the nature of synaptic dysfunction by measuring the amount of protein fluorescence at either the synaptic terminal or at plasma membrane (Dittman and Kaplan, 2006; Sieburth, 2005). These imaging techniques have led to

the identification and characterization of synaptic proteins that regulate key steps of neurotransmitter release, synaptic vesicle dynamics, and synaptic assembly. Nevertheless, imaging does not provide information with regard to the electrical nature of a synapse. To study the electrical activity of a neuron, sophisticated electrophysiology techniques will have to be used.

By standard definition, electrophysiology is the study of the electrical nature of a biological tissue or cell. This method is often more technically difficult to use in C. elegans due to the small size of the worm neurons. Moreover, the thick cuticle of the worm presents a huge barrier when trying to access the neurons (Schafer, 2006). Despite these drawbacks, electrical recording procedures such as patch clamp have been used to aid in the study of neurotransmission in C. elegans by specificially targeting the neuromuscular junction and other accessible neuronal cell types or circuits (Raizen and Avery, 1994; Goodman et al. 1998;

Richmond and Jorgensen, 1999; Goodman et al. 2012). However, because of technical difficulties associated with such technique, patch clamping is used less often than imaging and pharmacological assays. Nevertheless, as the worm field continues to move forward, it is anticipated that the use of electrophysiology and photoactivation techniques will become increasingly popular.

Key synaptic transmission pathways in C. elegans

A number of C. elegans synaptic transmission mutants have been identified through pharmacological, behavioral, imaging, and electrophysiological studies. Most of these genes were found to regulate the key steps of neurotransmitter release including exocytosis, ion channel signaling, endocytosis, docking, and trafficking (Table 1.2). Perhaps the best dissected

Table 1.2 Key synaptic transmission genes with described molecular functions. These synaptic transmission genes were identified from genetic studies in C. elegans. Source: adapted and modified from J.E.Richmond, 2007.

GENE MOLECULAR FUNCTION IN C. REFERENCES DESCRIPTION ELEGANS NEURONS eat-11 GBP-2, a β5 homolog Regulator of RGSs EGL- Robatzek et al., 2001; 10 and EAT-16 van der Linden et al., 2001 eat-16 RGS (regulator of G Negatively regulates Hajdu-Cronin et al., protein signaling) EGL-30 (Gαq) 1999 egl-8 Homolog of Generates DAG from Brundage et al., 1996; Phospholipase c beta PIP2- increases UNC-13 Lackner et al., 1999; (PLCβ) priming Miller et al., 1999 egl-10 RGS protein (homolog Negative regulator of G Koelle and Horvitz, 1996 of RGS7) protein GOA-1 (Gαo) egl-30 Heterotrimeric G protein Activates PLC, and Brundage et al., 1996; (Gαq) increases UNC-13 Lackner et al., 1999 priming dgk-1 Diacylglycerol kinase Converts DAG to Nurrish et al., 1999 phosphatidic acid, decreases exocytosis dyn-1 Homolog of dynamin Vesicle fission Clark et al., 1997 goa-1 Heterotrimeric G protein Negatively regulates Mendel et al., 1995; Gαo EGL-30 and priming of Ségalat et al., 1995; UNC-13 Nurrish et al., 1999 rab-3 Ras family of GTPase Possibly vesicle Nonet et al., 1997; localization Gracheva et al., 2008 ric-4 SNAP-25 (SNARE Vesicle fusion Nguyen et al., 1995; protein) Nonet 1999 snb-1 expressed on the surface Vesicle fusion Nonet et al., 1998 of synaptic vesicles (synaptobrevin) snt-1 Synaptotagmin Ca++ sensor in Nonet et al., 1993, exocytosis Jorgensen et al., 1995 unc-2 Subunit of voltage-gated Evoked release, calcium Schafer and Kenyon, calcium channel influx at terminals 1995, Nonet et al., 1998; Richmond et al., 1999 unc-10 Rim (unc-13 interacting Priming Koushika et al., 2001; protein) Nguyen et al., 1995 unc-13 Phorbol ester/DAG Priming, promoting open Maruyama and Brenner, binding syntaxin 1991; Richmond et al., 1999; 2001 unc-26 Synaptojanin, a Endocytic budding, Harris et al., 2000; phosphoinositide fission, clathrin Nguyen et al., 1995; phosphatase uncoating Schuske et al., 2003 unc-57 endophilin Target synaptojanin, Schuske et al., 2003 involved in endocytosis, vesicle fission/budding

and most understood synaptic transmission pathway in C. elegans is controlled by the heterotrimeric G proteins Gαq (EGL-30) and Gαo (GOA-1). EGL-30 and GOA-1 are evolutionary conserved heterotrimeric G proteins that display more than 80% similarity to the mammalian Gαq and Gαo proteins. These proteins couple to G protein coupled receptors

(GPCRs) and act as central regulators of neurotransmitter release at the C. elegans synapse

(McMullan and Nurrish, 2007). Egl-30 animals were initially found in a genetic screen involving mutants that showed defects in egg-laying (Trent et al. 1983). However, it was later reported that egl-30 animals also displayed resistance to aldicarb, suggesting that the normal function EGL-30 is to promote acetylcholine signaling at the NMJ (Brundage et al. 1996; Miller et al. 1996).

Follow up studies on EGL-30 revealed that this protein regulates the levels of the second messenger molecule diacylglycerol (DAG), through phospholipase C- β (PLC-β). Activation of this signaling cascade leads to elevated acetylcholine signaling at the synapse (Lackner et al.

1999; Miller et al. 1999). Additional upstream and downstream effectors of the EGL-30 pathway have been discovered. For instance, using the aldicarb assay and genetics, it was found that GOA-1 (Gαo) not only negatively regulates EGL-30 (Miller et al. 1999), but antagonizes increased levels of DAG through diacylglycerol kinase (DGK-1) (Nurrish et al. 1999).

Moreover, it was found that EGL-30 positively regulates acetylcholine signaling through UNC-

13 (syntaxin interacting partner) and Protein Kinase C 1 (PKC-1) (Mansilla and Nurrish, 2009).

Recent studies have further demonstrated the roles of EGL-30 and GOA-1 in dopamine and serotonergic signaling in C. elegans, suggesting the global involvement of this pathway in neurotransmission (Chase et al. 2005; Tanis et al. 2008). Taken together Gαq/Gαo (EGL-

30/GOA-1), signaling stands as the central mediator of synaptic transmission. More importantly,

C. elegans offers an excellent system to characterize and dissect neuronal signaling networks

with great relevance to the human nervous system and continues to advance our understanding of

the signaling pathways in the mammaliam brain.

Modulation of C. elegans neuromuscular excitability by GABA and acetylcholine

Synaptic transmission at the C. elegans NMJ is achieved primarily by the actions of the

GABAergic and cholinergic motor neurons. Of the 302 neurons, 26 of them are GABAergic

neurons (Schuske et al. 2004), while 1/3 of the entire nervous system is comprised of cholinergic

neurons (Duerr et al. 2008). In the C. elegans nervous system, GABA serves as the principal inhibitory neurotransmitter and acts mostly at the neuromuscular junctionNMJ (Schuske et al.

2004). However, in comparison to the vertebrate brain, there is evidence that GABA can also function as an excitatory transmitter in certain cell types, depending on the receptor involved

(Schuske et al. 2004). Moreover, GABAergic neurons only made up about ten percent (10%) of the neurons of C. elegans, whereas they are more abundant in the vertebrate brain (Schuske et al.

2004). Acetylcholine on the other hand serves as the major excitatory neurotransmitter in C. elegans. Like in the mammalian nervous system, acetylcholine also functions at the C. elegans

NMJ (Duerr et al. 2008). Synaptic activity along the body wall muscles and the NMJs is mediated primarily by the activity of the GABAergic and cholinergic neurons (Jorgensen, 2005).

During C. elegans active sinusoidal locomotion, the cholinergic neurons provide an excitatory input to stimulate muscle activity along the body wall. Such excitatory activity leads to the release of GABA from the inhibitory motor neurons onto the contralateral muscles (Schuske et al. 2004; Dittman et al. 2008). Therefore, the actions of GABA and acetylcholine at the NMJ and along the body wall muscles appear to be antagonistic (Figure 1.1).

Figure 1.1 Antagonistic actions of GABA and acetylcholine at the C. elegans neuromuscular junction (figure source: Schuske et al., 2004 TRENDS in Neurosciences). GABAergic and cholinergic motor neurons regulate C. elegans locomotion. GABA serves as the principal inhibitory neurotransmitter at the NMJ, whereas acetylcholine provides the excitatory input. Excitatory input from the cholinergic neurons leads to GABA release onto the contralateral muscles.

The role of cytoskeletal proteins in neurotransmission and neurological disease

Many proteins have been implicated in synaptic transmission including proteins that

regulate cytoskeletal function. The neuronal cytoskeleton is the backbone of a nerve cell and any

perturbations of neuronal cytoskeletal activity can have neurological consequences. It is

comprised of three independent complex units that include microtubules (MTs), neurofilaments

(NFs), and microfilaments (MFs) (Siegiel et al. 1999). Each complex unit has a unique composition, organization, and structure. For instance, the neuronal MTs are made of polymers of tubulin subunits (55kDa) in which the heterodimers (α and β subunits) align together to form protofilaments. MTs are also dynamic polar structures, which possess plus (+) fast growing ends and minus (-) slow growing ends. These polar ends of the MT determine the direction in which

cargo moves along the MT (Cooper, 2000). Microtubules play important roles in maintaining the

structure, integrity, and intrinsic transport activities of the neurons. For this matter, it is not

surprising that most microtubule-associated proteins (MAPs) are involved in a variety of

functions of the cell, ranging from neuronal development to neurotransmission. Indeed, a number

of MAP proteins have been implicated in neurotransmission, including the motor proteins

kinesin, dynein, and dynamin (Gho et al. 1992; Locke and Kautu et al. 2009; Xie et al. 2012).

Moreover, several neurological diseases have been linked to mutations or aberrant functions of

MAPs. For instance, mutations in the motor protein kinesin, KIF1B, and dynamin are associated

with Charcot-Marie-Tooth disease, and epilepsy, which can also be caused by mutations in other

MAPs (Zhao et al. 2001; Gardiner and Marc, 2010). Other neurological diseases that have been

associated with mutations in MAPs include schizophrenia, lissencephaly, motor neuron diseases,

and Alzheimer’s disease (Gleeson, 2000; Kamiya et al. 2005; Simpson et al. 2009; Iqbal et al.

2009; Chen et al. 2010).

The next important complex unit of the neuronal cytoskeleton comprises of intermediate

filaments or more specifically, neurofilaments (NFs), which are quite diverse in the nervous

system. NFs can be compared to rope-like fibers. Their diameters are estimated to be in the

range of eight to twelve nanometers (8-12nm). Neurofilaments in myelinated axons are made of three protein subunits called the NF triplet. These protein subunits are known as light NF (NF-

L), medium NF (NF-M), and heavy NF (NF-H), which all come in different molecular weights

(Siegiel et al. 2007). The main function of NFs is to provide mechanical support and strength to the cell. Various neurological diseases, especially neurodegenerative diseases, have been linked to aberrant function of NFs. For instance, Amyotropic Lateral Sclerosis (ALS) is a neurodegenerative disorder that involves the accumulation of phosphorylated neurofilament proteins within the nerve cell (Leigh et al. 1989). Alzheimer’s disease is another neurological

condition whereby both abnormal levels and phosphorylation of neurofilaments have been

observed (Sternberger et al. 1985; Mandelkov et al. 1992). Other neurological diseases linked to

NFs include Parkinson’s disease (PD), and Charcot-Marie-Tooth disease (reviewed by Liu et al.

2011). These studies suggest that NFs may play an important role in maintaining the normal

health of neurons.

The third important structure of the nerve cytoskeleton is the microfilament structure

(MF). Microfilaments are made of globular monomer proteins called actin. Actin monomers are

arranged like thin string structures that intertwined to form fibrils (Siegiel et al. 2007). These

structures are diversely present in the cell in large quantities and play a diverse role in the

nervous system including cell motility, support, and intracellular transport. A number of proteins

that regulate the function of MF have been implicated in neurotransmission and neurological

disorders. For instance, mutations in actin-binding proteins such as Filamin A, neurabin, and

double-cortin have been linked to epilepsy (Parrini et al. 2006; Lad et al. 2008). These results

suggest a central role of the cytoskeleton and associated signaling pathways in the maintenance

of neuronal synchrony and integrity of the nervous system. As such, ongoing investigation of the

cytoskeletal basis of neurotransmission will help to further advance our understanding of not

only the human brain, but neurological diseases in general.

C. elegans as a model system for studying the molecular basis of epilepsy

The use of C. elegans has expanded beyond the study of neurotransmission. Since the completion of the human genome sequence, it became clear that many human genes have homologs in the nematode. In fact, it was evident from in vivo synaptic transmission studies in C. elegans that many of the genes that affect C. elegans neuronal function may also have implications on a plethora of neurological conditions. Epilepsy is one of the complex neurological disorders reported by the World Health Organization (WHO) to have affected more than 50 million of the world population (Birbeck, 2012). This disorder is associated with arrhythmic firing of neurons in the nervous system. In particular, asynchronous neuronal firing arises from a disordered antagonistic combat between inhibitory and excitatory transmission in the nervous system (Bernard, 2005). Neurotransmitters that regulate brain activity, particularly

GABA, the major inhibitory transmitter in the brain, are often important in the maintenance of synchronous neurotransmission (Treiman, 2001). In fact, perturbation of GABA transmission can influence susceptibility to seizure syndromes (MacNamara et al. 2006). Although cellular/molecular mechanisms that may be accountable for the overall maintenance of neuronal synchrony are still poorly understood, some studies have indicated a number of genetic factors that affect the excitability of nerve cells. These include ion channel defects (Xu and Clancy,

2008), neuropeptide depletion (Erikson et al.1996) brain malformation (Liu et al. 2000; Patel et

al., 2004) interneuron loss (Cobos et al., 2005) and synaptic vesicle recycling defects (Di Paolo et al., 2002). In addition to these factors, there is mounting evidence that disruption of the cytoskeleton is critical for the development and pathogenesis of epilepsy. In fact, mutations in a

number of cytoskeletal proteins have been linked to epileptic conditions. The list includes alpha-

tubulin (TUBA1A), doublecourtin (DCX), lissencephaly 1 (LIS1), reelin, laforin, and malin

(Gardiner et al. 2010). These studies assert the importance of the cytoskeletal factors in the

control of neuronal synchrony.

The nematode C. elegans has been used as model system to study the molecular bases of

epileptic convulsions. In 2004, Williams and colleagues showed that worms carrying a mutation

in the protein LIS-1 exhibited seizure-like activity in the presence of a GABA receptor

antagonist pentylenetetrazole (PTZ) (Williams et al. 2004). These convulsions coincide with

synaptic vesicle mislocalizations, which were observed only in GABAergic motor neurons.

Examination of the GABAergic neurons showed that lis-1 mutants exhibited synaptic vesicle

mislocalization, yet no obvious axon guidance or neuronal migration defects were observed,

indicating that the defects associated with convulsions are attributed to intrinsic perturbation of

synaptic vesicle motility (Williams et al. 2004). Furthermore, knockdown of other cytoskeletal

proteins that interact with with LIS-1, such as CDK-5 and NUD-1 caused worms to convulse on

PTZ, and conferred defects in synaptic vesicle transport in the GABAergic motor neurons of C. elegans (Locke et al. 2006). Moreover, it was reported that C. elegans mutants defective in

GABA transmission also exhibited epileptic-like convulsions, suggesting that LIS-1 may play a role in GABA transmission. Taken together, the results of these studies demonstrated the power

of C. elegans to decipher the basic molecular mechanisms of neurotransmission, which may help

to explain the underlying causes of neurological conditions such as epilepsy.

C. elegans as a model system for studying Parkinson’s disease

Interestingly, C. elegans has also been one of the most studied organisms for the purpose of understanding the nature of neurodegenerative diseases such as Parkinson’s disease (PD).

Parkinson’s disease is a neurodegenerative disorder with currently unknown cure. One of the clinical signatures of PD involves the loss of dopaminergic neurons in the substantia nigra of PD patients. Risk factors for PD are believed to have genetic and environmental bases. As a result, current efforts in the study of PD are focused on identifying genetic susceptibility factors to PD, as well as potential environmental contributors to the disease.

Using C. elegans to study the genetic factors associated with PD

In 1997, a clinical study conducted in Parkinson’s patients led to the identification of the protein α-synuclein (α-syn) as a culprit for PD (Polymeropolous et al. 1997). Since then, additional PD-linked genes/proteins have been discovered. These proteins (including α-syn) were classified as PARK proteins that encode different proteins that affect a number of molecular pathways, including oxidative stress, signal transduction, synaptic function, protein degradation, and perhaps many more. Consequently, there has been tremendous interest in understanding the functional consequences of these proteins in relation to PD pathology. This led to the development of a number of animal models of PD to facilitate the functional analysis and evaluation of these PD-associated proteins.

C. elegans offers a great advantage to evaluate the functional consequences of PARK proteins on the dopaminergic neurons and other cell types in general (reviewed by Harrington et al. 2010). Unlike the human brain, C. elegans only has only eight dopaminergic neurons that are visible when tagged with fluorescent markers. Any perturbation that occurs to these neurons over the course of aging can be easily visualized and quantified with a microscope. Moreover, some of the PARK genes have clear homologs in C. elegans, some of which have been already studied

in the nematode (Table 1.3). The functional implications of these genes on the dopaminergic

cells can be elucidated using forward and reverse genetics tools and in combination with

transgenesis protocols. For instance, in 2005, Ved and colleagues showed that knockdown of the

C. elegans homolog of PARK7, which encodes the protein DJ-1, rendered animals susceptible to oxidative stress (Ved et al. 2005). In another study involving PARK8, a gene that encodes

LRRK2 protein, Saha and colleagues reported their findings that depletion of this gene in C. elegans caused animals to become sensitive to oxidative stress in a similar manner. Interestingly, additional studies demonstrated that overexpression of several LRRK2 mutant variants caused dopaminergic neurodegeneration in C. elegans (Yao et al. 2010). Overall, these findings showed

how C. elegans can be exploited to study the functional impacts of PARK proteins on cellular

pathways. This may help to improve our understanding as far as the molecular mechanism of the

disease is concerned.

Table 1.3 List of Parkinson’s disease related genes (PARK genes) and their homologs in C. elegans. Reviewed by and adapted from Harrington et al. 2010.

PD gene PD protein C. elegans ortholog PARK1 SNCA/α-syn n/a

PARK2 PRKN/parkin pdr-1

PARK5 UCHL-1 ubh-1

PARK6 PINK1 pink-1

PARK7 DJ-1 djr-1.1 djr-1.2 PARK8 LRRK2 lrk-1

PARK9 ATP13A2 catp-6 PARK11 GIGYF2 n/a PARK13 HTRA2 n/a

C. elegans α-syn model of neurodegeneration

Perhaps the most studied PARK gene is PARK1, which encodes the protein α-syn. α-syn

is the first known protein linked to PD (Polymeropoulos et al. 1997). The protein is made of 140

amino acids and is expressed in neurons, mostly in the presynaptic terminals (George, 2002).

Evidence shows that point mutations as well as multiplications of the α-syn locus cause PD.

Moreover, immunochemical data indicated that α-syn protein is robustly expressed in Lewy

Bodies (Spillantini et al. 1997), creating the notion that the accumulation of α-syn in brain cells may underlie the observed neurotoxicity. To test the functional impact of α-syn in the dopaminergic neurons, scientists created animal models of PD that overexpress different variants of α-syn. Some of these models replicate key symptoms of PD including neurodegeneration.

The first C. elegans model of PD was created by Lakso and colleagues in 2003. In this model, α- syn was overexpressed in the dopaminergic neurons under a dopaminergic specific promoter

(dat-1). By co-expressing GFP with α-syn in the dopaminergic neurons, the investigators noted that overexpression of α-syn resulted in the loss of dopaminergic neurons (Lakso et al. 2003).

This model was later replicated by our lab in 2005 and other C. elegans investigators in 2010

(Cao et al. 2005; Cao et al. 2010). The outcome of all these investigations arrived at the same conclusion; overexpression of α-syn significantly enhanced dopaminergic neuronal cell death

(Figure 1.2).

Figure 1.2 Overexpression of α-synuclein in C. elegans in dopaminergic neurons. The cell bodies and processes are highlighted using GFP driven from the DA transporter promoter (Pdat- 1::GFP). The 6 anterior DA neurons include 2 pairs of cephalic neurons (CEPs, arrows in bottom image) and 1 pair of anterior deirid neurons (ADEs, arrowheads bottom image). Most worms within a population expressing α-synuclein in the dopaminergic neurons are missing anterior dopaminergic neurons by day 7, as shown in the top image where only three neurons remain (1 CEP, arrow; 2 ADE neurons, arrowheads). The worm on the bottom, also expressing a- synuclein displays a full complement of anterior dopaminergic neurons because it has been protected by co-expression with VPS41, a protein previously shown to be neuroprotective (Harrington et al., 2012).

Use of C. elegans to identify modifiers of α-syn toxicity

Following the development of C. elegans PD models with α-syn overexpression, scientists have taken advantage of these models to find genetic modifiers of α-syn. Due to its genetic amenability, combined with the availability of forward and reverse genetic tools and the feasibility of making transgenic animals, C. elegans offers an excellent system for executing genetic screens in the search for α-syn modifiers. In 2005, Cao and colleagues reported that overexpression of torsinA, a protein that has chaperone activity, was found to protect the dopaminergic neurons against α-syn toxicity (Cao et al. 2005). This was the first known genetic modifier of α-syn in the dopaminergic neurons of C. elegans and it suggested that modifying the activity of chaperone molecules may offer a therapeutic avenue for the treatment of PD.

Moreover, in 2008, Hamamichi et al. conducted an RNA interference (RNAi) screen in C. elegans, whereby modifiers of α-syn in the body wall muscles and dopaminergic neurons were discovered (Hamamichi et al. 2008). In this study, Hamamichi and colleagues embarked on a hypothesis-based approach using bioinformatics to obtain a list of candidate genes for the screen.

The genes that were found in this approach were shown to be involved in a number of pathways including protein folding, trafficking, and degradation. The end result of the screen was 20 genes that displayed the most significant impact on α-syn aggregation in the body wall muscles of worms when knocked down by RNAi. Among the top hits from this screen included proteins that have known links to PD such as PINK1 and DJ1. Moreover, Hamamichi showed that

overexpression of some of the positive hits obtained from the RNAi screen conferred significant

protection of the C. elegans dopaminergic neurons against α-syn-induced toxicity. Using a

similar approach, other groups have also performed RNAi screens to discover modifiers of α-syn

in the body wall muscles and neurons of C. elegans (Kuwahara et al. 2008; Tjakko et al. 2008).

Taken together, the results of these studies have demonstrated the power of C. elegans in the

discovery of genetic factors modulating α-syn induced neurodegeneration and misfolding. These findings may help to accelerate the discovery of novel therapeutic targets for PD and synucleinopathies in general.

The of role dopamine signaling pathways in the survival of the dopaminergic neuron

A key feature of PD is loss of dopaminergic neurons. Despite the fact that other types of

neurons are also affected, it is evident that dopaminergic neurons appear to be more susceptible

to toxic insults (Park et al. 2007). This creates the speculation that perhaps intrinsic features of

the dopaminergic neurons contribute to cell death. A theory has been postulated that the

preferential loss of the nigral neurons in PD patients is coincident with the increased amount

neuromelanin present in these cells (Hirsch et al. 1992; Sulzer et al. 2007). Neuromelanin is a product of dopamine oxidation, which is believed to be a major contributor to oxidative stress.

This observation led to the hypothesis that perturbation of dopamine metabolism and homeostasis may affect the survival of the dopaminergic cells (Cao et al. 2010). In fact, there is

substantial amount of evidence showing that disruption of dopamine metabolism pathways can

affect the survival of dopaminergic cells. For instance, cellular neurodegeneration has been

observed when tyrosine hydroxylase (TH) is overexpressed in primary neuronal cultures of

Drosophila (Park et al. 2007). Moreover, mice deficient in a vesicular monoamine transporter

(VMAT2) exhibited nigrostriatal neurodegeneration (Caudle et al. 2007). Similarly, in C.

elegans, overexpression of CAT-2 (Tyrosine Hydroxylase) resulted in enhanced dopaminergic

neurodegeneration, while overexpression of CAT-1 (VMAT) resulted in neuroprotection (Cao et

al. 2005; Cao et al. 2010). These results supported the hypothesis that proper regulation of

normal dopamine signaling metabolism and signaling is important for the survival of

dopaminergic neurons. Therefore, the results of these studies imply the continuing need to look into the role of dopamine signaling pathways and metabolism in the survival of the dopaminergic neurons.

Current studies

New emerging technologies have been developed to facilitate the study of synaptic transmission in C. elegans. Most recently, C. elegans neurobiologists have used optogenetic tools to manipulate neurotransmitter release and in dissecting neuronal circuitry. The basis of optogenetics relies upon the coupling of genetically encoded proteins and light. One of the main objectives of using this technique is to illuminate the functional consequences of specific neuronal networks in the control of C. elegans locomotion and behavior. For instance, the functional impacts of the mechansensory neurons on C. elegans locomotion was studied by expressing the channel protein, channelrhodopsin-2 (ChR2), which is activated in the presence of blue light (Stirman et al. 2010). Using this assay, the reversal behaviors of C. elegans were quantified upon blue light illumination. The technique has also been applied to study the function of other neuronal cell types such as the command interneurons and the motor neurons. The combined uses of optogenetics with traditional methods such as imaging, pharmacological manipulation, and electrophysiology will undoubtedly accelerate novel discoveries in the field of synaptic transmission.

Regarding the study of neuronal signaling, identification of novel synaptic transmission pathways will remain as the ultimate objective in the study of neurotransmission. In particular, the role of non-coding RNAs, such as microRNAs, in synaptic function has recently become the center of investigation (Hsu et al. 2012, Scott et al. 2012) and C. elegans has continued to play

an important role in this area (Simon et al. 2008; Hu et al. 2012). For instance, the role of the miRNA, miR1, in presynaptic acetylcholine signaling was recently determined in C. elegans

(Simon et al. 2008). These studies highlight the potential impact of non-coding RNAs on major neuronal signaling networks at the synapse.

As far as current studies with the neuronal cytoskeleton, signaling pathways involved in axonal transport will continue to be the key targets in the development of therapeutic strategies for neurological conditions. Neurons are not capable of synthesizing proteins along the axons and so they have great dependency on vesicular transport mechanisms (McMurray et al. 2000).

Many neurological conditions are attributed to defects in neuronal shape, trafficking, or problems with the motor proteins that drive the movement of cargo along the microtubules or microfilaments (McMurray et al. 2000). Therefore, gaining additional insights into the role of cytoskeletal trafficking mechanisms in the nervous system, together with the discovery of novel pathways, are imperative not only in advancing our knowledge of the human brain, but for the development of novel therapeutic strategies for neurological diseases.

With respect to the study of PD, functional evaluation of PARK proteins will remain as one of the ultimate directions for advancing knowledge of PD etiology and neurodegeneration before new treatments for PD can be established. More importantly, elucidating the functional relationships between PARK proteins and major pathways of the cell is central in improving our knowledge and understanding of PD. Disparate key cellular pathways including autophagy, neurotransmission, mitochondrial signaling, oxidative stress, ER stress, vesicular trafficking, protein degradation, microRNA networks, posttranslational modifications, apoptosis, and aging have already become the major focus of investigation in the study of PD and neurodegenerative

diseases in general (reviewed by Harrington et al. 2010; Exner et al. 2012). As a result, current

studies are now also being directed to evaluate the link between these pathways and some PARK

proteins.

Moreover, additional steps have been adopted to look into the environmental

contributions to PD. Although it is clear that PD has a genetic basis, only 10% of PD cases have

genetic mutations involving PARK proteins, to date. That means that up to 90% of the causes of

PD may originate from the environment (or unidentified genetic mutations). Consequently,

current investigations are addressing the connection between potential environmental

neurotoxins and PD. A number of dopaminergic neurotoxins have been studied including

pesticides, MPTP (1-methyl-4-phenyl-1, 2, 3, 6-tetrahydropyridine), 6-Hydroxydopamine (6-

OHDA), certain species of bacteria, and 1-methyl-4-phenylpyridinium (MPP+), with the possibility of adding more to the list (reviewed by Harrington et al. 2010). Taken together, it is clear that there is tremendous need to continually decipher both the molecular and environmental aspects of PD.

REFERENCES

Avery, L., Bargmann, C.I., and Horvitz, H.R. (1993). The Caenorhabditis elegans unc-31 gene affects multiple nervous system-controlled functions. Genetics 134, 455–464.

Bernard, C. (2005). Dogma and dreams: experimental lessons for epilepsy mechanism chasers. CMLS, Cell. Mol. Life. Sci. 62, 1177-1181.

Birbeck, G.L. (2010). Epilepsy Care in Developing Countries: Part I of II. Epilepsy. Curr. 10, 75–79.

Brenner, S. (1974). The genetics of Caenorhabditis elegans. Genetics 77, 71–94.

Brundage, L., Avery, L., Katz, A., Kim, U.J., Mendel, J.E., Sternberg, P.W., Simon, M.I. (1996). Mutations in a C. elegans Gqalpha gene disrupt movement, egg laying, and viability. Neuron 16, 999–1009.

Cao, S., Gelwix, C.C., Caldwell, K.A., Caldwell, G.A. (2005). Torsin-mediated neuroprotection from cellular stresses to dopaminergic neurons of C. elegans. J. Neurosci. 25, 3801-3812.

Cao, P. X., Yuan, Y.Y., Pehek, E.A., Ma Huang, R.Y., et al. (2010). Alpha-Synuclein Disrupted Dopamine Homeostasis Leads to Dopaminergic Neuron Degeneration in Caenorhabditis elegans. PLoS ONE 5, e9312.

Cardoso, C., Leventer, R. J., Dowling J. J., Ward , H. L., Chung, J., et al. (2002). Molecular basis of classical lissencephaly: mutations in the LIS1 gene (PAFAH1B1) Hum. Mutat. 19, 4–15.

Caudle, W.M., Richardson, J.R., Wang, M.Z., Taylor, T.N., Guillot, T.S., McCormack, A.L., Colebrooke, R.E., di Monte D.A., Emson, P.C., Miller, G.W. (2007). Reduced vesicular storage of dopamine causes progressive nigrostriatal neurodegeneration. J. Neurosci. 27, 8138–8148.

Chen, Y., Hancock, M.L., Role, L.W., Talmage, D.A. (2010). Intramembranous valine linked to schizophrenia is required for neuregulin 1 regulation of the morphological development of cortical neurons. J. Neurosci. 30, 9199–9208.

Clark, S.G., Shurland, D.L., Meyerowitz, E.M., Bargmann, C.I., and van der Bliek, A.M. (1997). A dynamin GTPase mutation causes a rapid and reversible temperature-inducible locomotion defect in C. elegans. Proc. Natl. Acad. Sci. U. S. A. 94, 10438–10443.

Cooper G. M. The Cell: A Molecular Approach. 2nd edition. Sunderland (MA): Sinauer Associates; 2000. Microtubule Motors and Movements. Available from: http://www.ncbi.nlm.nih.gov/books/NBK9833/.

Di Paolo, G., Sankaranarayanan, S., Wenk, M.R., Daniell, L., Perucco, E., Caldarone, B.J., Flavell, R., Picciotto, M.R., Ryan, T.A., Cremona, O., De Camilli, P. (2002). Decreased synaptic vesicle recycling efficiency and cognitive deficits in amphiphysin 1 knockout mice. Neuron 33, 789–804.

Dittman, J.S., Kaplan, J.M. (2006). Factors regulating the abundance and localization of synaptobrevin in the plasma membrane. Proc. Natl. Acad. Sci. U S A 103, 11399–11404.

Dittman J.S., Kaplan J.M. (2008). Behavioral impact of neurotransmitter-activated G-protein- coupled receptors: muscarinic and GABAB receptors regulate Caenorhabditis elegans locomotion J. Neurosci. 28, 7104-7112.

Erikson, J.C., Klegg, K.E., Palmiter, R.D. (1996). Sensitivity to leptin and susceptibility to seizures of mice lacking neuropeptide Y. Nature 381, 415–421.

Exner, N., Lutz, A.K., Haass, C., Winklhofer, K.F. (2012). Mitochondrial dysfunction in Parkinson's disease: molecular mechanisms and pathophysiological consequences. EMBO J. 31, 3038-3062.

Gardiner J, Marc J. (2010). Disruption of normal cytoskeletal dynamics may play a key role in the pathogenesis of epilepsy. Neuroscientist 16, 28–39.

George, J.M. (2002). The synucleins. Genome Biol. 3, REVIEWS3002.1-3002.6.

Gho, M., McDonald, K., Ganetzky, B., Saxton, W. M. (1992). Effects of kinesin mutations on neuronal functions. Science 258, 313-316.

Gleeson, J.G. (2000). Classical lissencephaly and doublecortex (subcortical band heterotopias): LIS1 and doublecortin. Curr. Opin. Neurol. 13, 121–125.

Goodman, M.B., Hall, D.H., Avery, L., and Lockery, S.R. (1998). Active currents regulate sensitivity and dynamic range in C. elegans neurons. Neuron 20, 763–772.

Goodman, M.B., Lindsay, T.H., Lockery, S.R., Richmond, J.E. (2012). Electrophysiological methods for Caenorhabditis elegans neurobiology Methods. Cell. Biol. 107, 409-4036.

Harris, T.W., Hartwieg, E., Horvitz, H.R., and Jorgensen, E.M. (2000). Mutations in synaptojanin disrupt synaptic vesicle recycling. J. Cell Biol. 150, 589–600.

Hajdu-Cronin, Y.M., Chen, W.J., Patikoglou, G., Koelle, M.R., and Sternberg, P.W. (1999). Antagonism between G(o)α and G(q)α in Caenorhabditis elegans: the RGS protein EAT-16 is necessary for G(o)α signaling and regulates G(q)α activity. Genes Dev. 13, 1780–1793.

Hamamichi, S., Rivas, R.N., Knight, A.L., Cao, S., Caldwell, K.A., Caldwell, G. A. (2008). Hypothesis-based RNAi screening identifies neuroprotective genes in a Parkinson's disease model. Proc. Natl. Acad. Sci. U S A. 105, 728-733.

Harrington, A.J., Hamamichi, S., Caldwell, G.A., and Caldwell, K.A. (2010). C. elegans as a model organism to investigate molecular pathways involved with Parkinson's disease Dev. Dyn. 239, 1282–1295.

Harrington, A. J., Yacoubian, T.A., Slone, S. R., Caldwell, K.A., Caldwell, G.A. (2012). Functional Analysis of VPS41-Mediated Neuroprotection in Caenorhabditis elegans and Mammalian Models of Parkinson’s Disease. J. Neurosci. 32, 2142–2153.

Hirsch, E.C. (1992). Why are nigral catecholaminergic neurons more vulnerable than other cells in Parkinson's disease? Ann. Neurol. 32, S88–S93.

Hsu, R., Schofield, C.M., Dela Cruz C.G., Jones-Davis D.M., Blelloch, R., Ullian E.M. (2012) Loss of microRNAs in pyramidal neurons leads to specific changes in inhibitory synaptic transmission in the prefrontal cortex. Mol .Cell. Neurosci. 50, 283-292.

Hu, Z., Hom, S., Kudze, T., Tong, X.J., Choi, S., Aramuni. G., Zhang, W., Kaplan, J.M. (2012). Neurexin and neuroligin mediate retrograde synaptic inhibition in C. elegans. Science 6097, 980- 984.

Iqbal, K., Liu, F., Gong, C.X., Alonso, Adel C., Grundke-Iqbal, I. (2009). Mechanisms of tau- induced neurodegeneration. Acta Neuropathol. 118, 53–69.

Jorgensen, E.M., Hartwieg, E., Schuske, K., Nonet, M.L., Jin, Y., and Horvitz, H.R. (1995). Defective recycling of synaptic vesicles in synaptotagmin mutants of Caenorhabditis elegans. Nature 378, 196–199.

Jorgensen, E.M. GABA (2005). WormBook, ed. The C. elegans Research Community, WormBook, doi/10.1895/wormbook.1.14.1, http://www.wormbook.org.

Kamiya, A., Kubo, K., Tomoda, T., Takaki, M., Youn, R., Ozeki, Y., et al. (2005). A schizophrenia-associated mutation of=DISC1 perturbs cerebral cortex development. Nat. Cell Biol. 7, 1167–1178.

Koelle, M.R., and Horvitz, H.R. (1996). EGL-10 regulates G protein signaling in the C. elegans nervous system and shares a conserved domain with many mammalian proteins. Cell 84, 115– 125.

Koushika, S.P., Richmond, J.E., Hadwiger, G., Weimer, R.M., Jorgensen, E.M., and Nonet, M.L. (2001). A post-docking role for active zone protein Rim. Nature Neurosci. 4, 997–1005.

Kuwahara, T., Koyama, A., Gengyo-Ando K., Masuda, M., Kowa, H., Tsunoda, M., Mitani, S., Iwatsubo, T. (2006). Familial Parkinson mutant alpha-synuclein causes dopamine neuron dysfucntion in transgenic Caenorhabditis elegans. J. Biol. Chem. 281, 334–340.

Lackner, M.R., Nurrish, S.J., Kaplan, J.M. (1999). Facilitation of synaptic transmission by EGL- 30 Gqα and EGL-8 PLCβ: DAG binding to UNC-13 is required to stimulate acetylcholine release. Neuron 24, 335–346.

Lad, Y., Jiang, P., Ruskamo, S., Harburger, D.S., Ylanne, J., et al. (2008). Structural basis of the migfilin-filamin interaction and competition with integrin beta tails. J. Biol. Chem. 28, 35154– 35163.

Lakso, M., Vartiainen, S., Moilanen, A.M., Sirviö, J., Thomas, J. H., Nass, R., Blakely, R.D., Wong, G. (2003). Dopaminergic neuronal loss and motor deficits in Caenorhabditis elegans overexpressing human alpha-synuclein. J. Neurochem. 86, 165– 172.

Leigh, P.N., Dodson, A., Swash, M., Brion, J.P., Anderton B.H. (1989). Cytoskeletal abnormalities in motor neuron disease. An immunocytochemical study. Brain 112, 521–535.

Liu, Z., Steward, R., and Luo, L. (2000). Drosophila Lis1 is required for neuroblast proliferation, dendritic elaboration and axonal transport. Nat. Cell. Biol. 2, 776–783.

Liu, Q., Xie, F., Alvarado-Diaz, A., Smith, M.A., Moreira, P.I., Zhu, X., Perry, G. (2011). Neurofilamentopathy in Neurodegenerative Diseases. The Open Neurology Journal 5, 58-62.

Locke, C. J., Berry, K., Kautu, B., Lee, K., Caldwell, K., et al. (2008). Paradigms for pharmacological characterization of C. elegans synaptic transmission mutants. J. Vis. Exp. 18 837.

Locke, C.J., Kautu, B.B., Berry, K.P., Lee S.K., Caldwell, K.A., Caldwell, G.A. (2009). Pharmacogenetic analysis reveals a post-developmental role for Rac GTPases in Caenorhabditis elegans GABAergic neurotransmission. Genetics 183, 1357–1372.

Locke, C.J., Williams, S.N., Schwarz, E.M., Caldwell, G.A., Caldwell, K.A. (2006). Genetic interactions among cortical malformation genes that influence susceptibility to convulsions in C. elegans. Brain Res. 1120, 23–34.

Mahoney, T.R., Luo, S., Nonet M.L. (2006). Analysis of synaptic transmission in Caenorhabditis elegans using an aldicarb-sensitivity assay. Nat. Protoc. 1, 1772–1777.

Mandelkow, E.-M., Drewes, G., Biernat, J., Gustke, N., Van Lint, J.,Vandenheede, J. R. and Mandelkow, E. (1992). Glycogen synthase kinase-3 and the Alzheimer’s disease-like state of microtubule-associated protein tau. FEBS. Lett. 314, 315-321.

Maruyama, I.N., and Brenner, S. (1991). A phorbol ester/diacylglycerol-binding protein encoded by the unc-13 gene of Caenorhabditis elegans. Proc. Natl. Acad. Sci. U. S. A. 88, 5729–5733.

McMurray, C. T. (2000). Neurodegeneration: Diseases of the cytoskeleton? Cell. Death. Differ. 7, 861–865.

McNamara, J.O., Huang, Y.Z., and Leonard, A.S. (2006). Molecular signalling mechanisms underlying epileptogenesis. Science , re12.

Mendel, J.E., Korswagen, H.C., Liu, K.S., Hajdu-Cronin, Y.M., Simon, M.I., Plasterk, R.H., and Sternberg, P.W. (1995). Participation of the protein Go in multiple aspects of behavior in C. elegans. Science 267, 1652–1655.

Miller, K.G., Emerson, M.D., Rand, J.B. (1999). Goα and diacylglycerol kinase negatively regulate the Gqα pathway in C. elegans. Neuron 24, 323–333.

Nguyen, M., Alfonso, A., Johnson, C.D., and Rand, J.B. (1995). Caenorhabditis elegans mutants resistant to inhibitors of acetylcholinesterase. Genetics 140, 527–535.

Nonet, M.L., Grundahl, K., Meyer, B.J., and Rand, J.B. (1993). Synaptic function is impaired but not eliminated in C. elegans mutants lacking synaptotagmin. Cell 73, 1291–1305.

Nonet, M.L., Staunton, J.E., Kilgard, M.P., Fergestad, T., Hartwieg, E., Horvitz, H.R., Jorgensen, E.M., and Meyer, B.J. (1997). Caenorhabditis elegans rab-3 mutant synapses exhibit impaired function and are partially depleted of vesicles. J. Neurosci. 17, 8061–8073.

Nonet, M.L., Saifee, O., Zhao, H., Rand, J.B., and Wei, L. (1998). Synaptic transmission deficits in Caenorhabditis elegans synaptobrevin mutants. J. Neurosci. 18, 70–80.

Nonet, M.L. (1999). Visualization of synaptic specializations in live C. elegans with synaptic vesicle protein-GFP fusions. J. Neurosci. Methods 89, 33–40.

Nonet, M.L., Holgado, A.M., Brewer, F., Serpe, C.J., Norbeck, B.A., Holleran, J., Wei, L., Hartwieg, E., Jorgensen, E.M., and Alfonso, A. (1999). UNC-11, a Caenorhabditis elegans AP180 homologue, regulates the size and protein composition of synaptic vesicles. Mol. Biol. Cell 10, 2343–2360.

Nurrish, S., Segalat, L., and Kaplan, J.M. (1999). Serotonin inhibition of synaptic transmission: Galpha (0) decreases the abundance of UNC-13 at release sites. Neuron 24, 231–242.

Patel, L.S., Wenzel, H.J., Schwartzkroin, P.A. (2004). Physiological and morphological characterization of dentate granule cells in the p35 knock-out mouse hippocampus: evidence for an epileptic circuit. J. Neurosci. 24, 9005–9014.

Park, S.S., Schulz, E.M., Lee, D. (2007). Disruption of dopamine homeostasis underlies selective neurodegeneration mediated by alpha-synuclein. Eur. J. Neurosci. 26, 3104–3112.

Parrini, E., Ramazzotti A., Dobyns, W.B., Mei. D., Moro, F., Veggiotti, P., et al. (2006). Perventricular heterotopias: phenotypic heterogeneity and correlation with Filamin A mutations. Brain 129, 1892–906.

Polymeropoulos, M.H., Lavedan, C., Leroy, E., Ide, S.E., Dehejia, A., et al. (1997). Mutation in the alpha-synuclein gene identified in families with Parkinson's disease. Science 276, 2045– 2047.

Raizen, D.M., and Avery, L. (1994). Electrical activity and behavior in the pharynx of Caenorhabditis elegans. Neuron 12, 483–495.

Rand, J.B., Nonet, M.L. (1997). Synaptic transmission. in C. elegans II, eds Riddle DL, Blumenthal T, Meyer BJ, Priess JR (Cold Spring Harbor Laboratory,Cold Spring Harbor, NY), pp 611–644.

Rand, J.B. (2007). Acetylcholine. WormBook, ed. The C. elegans Research Community, WormBook, doi/10.1895/wormbook.1.131.1, http://www.wormbook.org.

Richmond, J.E., Davis, W.S., and Jorgensen, E.M. (1999). UNC-13 is required for synaptic vesicle fusion in C. elegans. Nature Neurosci. 2, 959–964.

Richmond, J.E., and Jorgensen, E.M. (1999). One GABA and two acetylcholine receptors function at the C. elegans neuromuscular junction. Nature Neurosci. 2, 1–7.

Richmond, J.E., Weimer, R.M., and Jorgensen, E.M. (2001). An open form of syntaxin bypasses the requirement for UNC-13 in vesicle priming. Nature 412, 338–341.

Richmond, J. Synaptic function (2007), WormBook, ed. The C. elegans Research Community, WormBook, doi/10.1895/wormbook.1.69.1, http://www.wormbook.org.

Riddle, D. L., Blumenthal, T., Meyer, B.J., et al. editors. C. elegans II. 2nd edition. Cold Spring Harbor (NY): Cold Spring Harbor Laboratory Press; 1997. Section IV.

Robatzek, M., Niacaris, T., Steger, K., Avery, L., and Thomas, J.H. (2001). eat-11 encodes GPB- 2, a Gβ(5) ortholog that interacts with G(o)α and G(q)α to regulate C. elegans behavior. Curr. Biol. 11, 288–293.

Saifee, O., Wei, L., and Nonet, M.L. (1998). The Caenorhabditis elegans unc-64 locus encodes a syntaxin that interacts genetically with synaptobrevin. Mol. Biol. Cell 9, 1235–1252.

Schafer, W.R., and Kenyon, C.J. (1995). A calcium-channel homologue required for adaptation to dopamine and serotonin in Caenorhabditis elegans. Nature 375, 73–78.

Schafer, W.R. (2006). Neurophysiological methods in C. elegans: an introduction WormBook, ed. The C. elegans Research Community, WormBook,doi/10.1895/wormbook.1.111.1, http://www.wormbook.org.

Schuske, K.R., Richmond, J.E., Matthies, D.S., Davis, W.S., Runz, S., Rube, D.A., van der Bliek, A.M., Jorgensen, E.M. (2003). Endophilin is required for synaptic vesicle endocytosis by localizing synaptojanin. Neuron 40, 749–762.

Schuske, K., Beg, A.A., Jorgensen, E.M. (2004). The GABA nervous system in C. elegans. Trends Neurosci. 27, 407–414.

Scott, H.L., Tamagnini, F., Narduzzo, K.E., Howarth, J. L., Lee, Y.B., Wong, L.F., Brown M.W., Warburton, E.C, Bashir, Z.I, Uney, J. B (2012). MicroRNA-132 regulates recognition memory and synaptic plasticity in the perirhinal cortex. Eur. J. Neurosci. 27, 2941-2948.

Ségalat, L., Elkes, D.A., and Kaplan, J.M. (1995). Modulation of serotonin-controlled behaviors by Go in Caenorhabditis elegans. Science 267, 1648–1651.

Siegel, G. J., Agranoff, B.W., Albers, R.W et al. editors. Basic Neurochemistry: Molecular, Cellular and Medical Aspects. 6th edition. Philadelphia: Lippincott-Raven; 1999. Molecular 32

Components of the Neuronal Cytoskeleton. Available from: http: www.ncbi.nlm.nih.gov/books/ NBK28122/.

Sieburth, D., Ch’ng, Q., Dybbs, M., Tavazoie, M., Kennedy, S., Wang, D., Dupuy, D., Rual, J.F., Hill, D.E., Vidal, M et al. (2005). Systematic analysis of genes required for synapse structure and function. Nature 436, 510–517.

Simon, D.J., Madison J.M., Conery, A.L., Thompson-Peer, K.L., Soskis, M., et al. (2008). The MicroRNA miR-1 Regulates a MEF-2-Dependent Retrograde Signal at Neuromuscular Junctions. Cell 133, 903–915.

Spillantini, M. G., Crowther, R. A., Jakes, R., Hasegawa, M., Goedert, M. (1998). alpha- Synuclein in filamentous inclusions of Lewy bodies from Parkinson’s disease and dementia with lewy bodies. Proc. Natl. Acad. Sci. U. S. A. 95, 6469–6473.

Sternberger, N.H., Sternberger, L.A., Ulrich, J. (1985). Aberrant neurofilament phosphorylation in Alzheimer disease Proc. Nati. Acad. Sci. U. S. A. 82, 4274-4276.

Stirman, J. N., Crane, M.M., Husson, S.J., Wabnig, S., Schultheis, C., et al. (2011). Real-time multimodal optical control of neurons and muscles in freely behaving Caenorhabditis elegans. Nat. Methods. 8, 153–158.

Sturt, B. L., Bamber, B. A. (2012). Automated Quantification of Synaptic Fluorescence in C. elegans. J. Vis. Exp. 66, e4090

Sulzer, D. (2007). Multiple hit hypotheses for dopamine neuron loss in Parkinson’s disease. Trends. Neurosci. 30, 244–250.

Treiman, D.M. (2001). GABAergic Mechanisms in Epilepsy. Epilepsia 42, 8–12.

van der Linden, A.M., Simmer, F., Cuppen, E., and Plasterk, R.H. (2001). The G-proteinβ- subunit GPB-2 in Caenorhabditis elegans regulates the G(o)α-G(q)α signaling network through interactions with the regulator of G-protein signaling proteins EGL-10 and EAT-16. Genetics 158, 221–235.

Vashlishan, A.B., Madison J.M., Dybbs, M., Bai, J., Sieburth, D., Ch'n, Q., Tavazoie, M., Kaplan, J. M. (2008) An RNAi screen identifies genes that regulate GABA synapses. Neuron.58, 346-61.

Ved, R., Saha, S., Westlund, B., Perier, C., Burnam, L., et al. (2005). Similar patterns of mitochondrial vulnerability and rescue induced by genetic modification of α-synuclein, parkin, and DJ-1 in Caenorhabditis elegans. J. Biol. Chem. 280, 42655–42668.

Waggoner, L.E., Dickinson, K. A., Pool, D.S., Tabuse, Y., Miwa, J., Schafer, W.R. (2000). Long-term nicotine adaptation in Caenorhabditis elegans involves PKC-dependent changes in nicotinic receptor abundance. J. Neurosci. 20, 8802– 8811.

Williams, S.N., Locke, C.J., Braden, A. L., Caldwell, K.A, Caldwell, G.A. (2004). Epileptic-like convulsions associated with LIS-1 in the cytoskeletal control of neurotransmitter signaling in Caenorhabditis elegans. Hum.Mol.Genet. 13, 2043–2059.

Xie, W., Adayev, T., Zhu, H., Wegiel, J., Wieraszko, A., Hwang, Y.W. (2012). Activity- dependent phosphorylation of dynamin 1 at serine 857. Biochemistry 51, 6786-96.

Xu, J., Clancy, C.E. (2008). Ionic Mechanisms of Endogenous Bursting in CA3 Hippocampal Pyramidal Neurons: A Model Study. PLoS ONE 3, e2056.

Zhao, C., Takita. J., Tanaka, Y et al. (2001). Charcot-Marie-Tooth disease type 2A caused by mutation in a microtubule motor KIF1Bβ. Cell 105, 587–597.

CHAPTER 2

USING A COMPLEMENTARY PHARMACOLOGICAL/BEHAVIORAL ASSAY TO CHARACTERIZE C. ELEGANS SYNAPTIC TRANSMISSION MUTANTS

This work was published in the Journal of Visualized Experiments August, 2008 under the following citation: Locke, C. J., K. Berry, B. Kautu, K. Lee, K. Caldwell, and G. Caldwell. 2008. Paradigms for pharmacological characterization of C. elegans synaptic transmission mutants. J. Vis. Exp., 18: 837. It is presented in this dissertation with slight modifications. Bwarenaba Kautu and Kyle Lee performed behavioral/pharmacological assays, and experiments to characterize the specified mutants in the study, helped developed the experimental protocols, and contributed ideas to the project. Kalen Berry took all the videos and images of worms during the experiment, involved in designing experiments, and contributed ideas to the project. Cody Locke conceived the ideas for the project, designed experiments/protocols, illustrated all the experiments shown in the videos, and wrote the manuscript together with Guy Caldwell and Kim Caldwell.

ABSTRACT

The nematode, Caenorhabditis elegans, has become an expedient model for studying neurotransmission. C. elegans is unique among animal models, as the anatomy and connectivity of its nervous system has been determined from electron micrographs and refined by pharmacological assays. In this work, we describe how two complementary neural stimulants, an acetylcholinesterase inhibitor, called aldicarb, and a gamma-aminobutyric acid (GABA) receptor antagonist, called pentylenetetrazole (PTZ), may be employed to specifically characterize signaling at C. elegans neuromuscular junctions (NMJs) and facilitate our understanding of antagonistic neural circuits.

Of 302 C. elegans neurons, nineteen GABAergic D-type motor neurons innervate body wall muscles (BWMs), while four GABAergic neurons, called RMEs, innervate head muscles.

Conversely, 39 motor neurons express the excitatory neurotransmitter, acetylcholine (ACh), and antagonize GABA transmission at BWMs to coordinate locomotion. The antagonistic nature of

GABAergic and cholinergic motor neurons at body wall NMJs was initially determined by laser ablation and later buttressed by aldicarb exposure. Acute aldicarb exposure results in a time- course or dose-responsive paralysis in wild-type worms. Yet, loss of excitatory ACh transmission confers resistance to aldicarb, as less ACh accumulates at worm NMJs, leading to less stimulation of BWMs. Resistance to aldicarb may be observed with ACh-specific or general synaptic function mutants. Consistent with antagonistic GABA and ACh transmission, loss of

GABA transmission, or a failure to negatively regulate ACh release, confers hypersensitivity to aldicarb. Although aldicarb exposure has led to the isolation of numerous worm homologs of neurotransmission genes, aldicarb exposure alone cannot efficiently determine prevailing roles

for genes and pathways in specific C. elegans motor neurons. For this purpose, we have

introduced a complementary experimental approach, which uses PTZ.

Neurotransmission mutants display clear phenotypes in response to PTZ, distinct from

aldicarb-induced paralysis. Wildtype worms, as well as mutants with specific inabilities to release or receive ACh, do not show apparent sensitivity to PTZ. However, GABA mutants, as well as general synaptic function mutants, display anterior convulsions in a time-course or dose-

responsive manner. Mutants that cannot negatively regulate general neurotransmitter release and,

thus, secrete excessive amounts of ACh onto BWMs, become paralyzed on PTZ. The PTZ-

induced phenotypes of discrete mutant classes indicate that a complementary approach with

aldicarb and PTZ exposure paradigms in C. elegans may accelerate our understanding of

neurotransmission. Moreover, videos demonstrating how we perform pharmacological assays

should establish consistent methods for C. elegans research.

MATERIALS/METHODS

Aldicarb exposure paradigm: On the first day, 30 young adult stage worms of each different genetic background were collected for the aldicarb assay. All the strains used in this experiment were obtained from the C. elegans Genetics Center (CGC), which is funded by the

NIH. All animals were previously cultured on E. coli (OP50) and were grown for 12-24 hours at a permissive temperature (20°C to 22°C). On the second day, a 100 mM stock solution of aldicarb was made using 70% ethanol (EtOH) and 30% ddH2O as solvents. A specified volume

of aldicarb was spread onto NGM plates lacking nystatin to achieve the desired aldicarb

concentrations. For our assay, we consistently used 0.5 mM aldicarb by plating 37.5 μL of 100

mM aldicarb onto 7.5 mL NGM plates. Aldicarb was then left to dry on the plates for roughly

30-60 minutes at room temperature. We then plated 25 μL of OP50 in the center of the plate

containing aldicarb as a way to keep the worms concentrated in a small spot without

overcrowding. We then performed the aldicarb assay after the food lawn had dried. All aldicarb

experiments were performed blindly due to the subjective nature of the assays. We performed at

least three replicates for each experiment. To score the animals, we counted the number of

paralyzed worms by prodding in a consistent manner with a platinum wire. We consistently prod animals twice on the head and twice on the tail every 30 minutes for a total of three hours. The paralysis rate or profile for each specific strain of animal was determined by plotting the percentage of worms paralyzed at each single time point.

PTZ exposure paradigm: On the first day, thirty young adult stage worms of each genotype were obtained for PTZ assays. All worms were cultured on fresh NGM plates (without nystatin), which contain E. coli (OP50) as a food source, and grown for 12-24 hours at permissive temperature (20°C to 22°C). All the strains used in this experiment were obtained from the C. elegans Genetics Center (CGC), which is funded by the NIH. On the second day, 0.5

g PTZ/mL ddH2O stock solution of PTZ was made using water as a solvent. A specified amount

of PTZ was then spread onto NGM minus nystatin plates to achieve the desired PTZ

concentrations. In this specific experiment, varying concentrations of PTZ were made for a dose-

response assay. All PTZ plates were dried roughly 60-120 minutes at room temperature. After

the plates had dried, 25 μL of OP50 was placed onto the center of each PTZ plate and dried for

another 30-60 minutes at room temperature. PTZ assays were performed as soon as the food

lawn dried. Like the aldicarb assay, PTZ experiments were performed "blindly". For our purpose,

we consistently analyzed thirty worms of a single genotype for each replicate. We also

performed at least three replicates for each experiment. To score animals on PTZ plates, we

counted the number of "epileptic-like" convulsing worms every 30 minutes for a total of one

hour. With this scoring method, we looked for animals that displayed anterior convulsions,

which we call "head-bobs", worms with full-body convulsions, worms that displayed full-body paralysis, which we call "tonic", and animals that exhibited both anterior convulsions with BWM paralysis, which we call "tonic-clonic". Most worms of a single genotype exhibited only one kind of convulsion. The level of convulsion for each strain of animal was determined by calculating the percentage of convulsing animals at 30 minutes and 60 minutes time points respectively.

RESULTS

Two neural stimulants, an acetylcholinesterase inhibitor, called aldicarb, and a GABA

receptor antagonist, called pentylenetetrazole (PTZ), can be used in a complementary manner to

characterize C. elegans synaptic transmission mutants (Table 2.1). Excess excitatory acetylcholine (ACh) accumulates at worm body wall neuromuscular junctions (NMJs) from deleterious mutations in negative regulators of ACh transmission (e.g. tom-1 and unc-43) or positive regulators of inhibitory GABA transmission (e.g., unc-25). Conversely, excitatory ACh levels at worm NMJs are diminished by deleterious mutations in positive regulators of general synaptic transmission (e.g., snb-1) or ACh-specific transmission genes (e.g. unc-4) (Table 2.1).

When compared to wild-type N2 worms, mutant worms with elevated excitatory ACh transmission at NMJs exhibit enhanced rates of aldicarb-induced paralysis, whereas mutant worms with lowered excitatory ACh transmission demonstrate reduced rates of aldicarb-induced paralysis. Although PTZ disrupts neuronal synchrony at C. elegans body wall muscles, not unlike aldicarb, PTZ also antagonizes inhibitory GABA at C. elegans head muscles. As a result, aldicarb sensitivity cannot accurately predict PTZ sensitivity. Mutant worms with specific

Table 2.1 List of strains and mutants that were characterized for synaptic transmission defects using both aldicarb and PTZ assay. Mutant Name Synaptic Role Behavior Behavioral Behavioral without Drug Response to Response to PTZ Aldicarb (compared to wild-type N2) tom-1(ok188) inhibits uncoordinated enhanced rate of indistinguishable synaptic paralysis from wild-type transmission unc- complex uncoordinated enhanced rate of full-body 43(n498n1186) paralysis convulsions unc-25(e156) promotes uncoordinated enhanced rate of anterior GABA paralysis convulsions, full- transmission body paralysis snb-1(md247) promotes uncoordinated reduced rate of anterior synaptic paralysis convulsions transmission unc-4(e120) promotes ACh uncoordinated reduced rate of indistinguishable transmission paralysis from wild-type

defects in negative or positive regulation of ACh transmission are indistinguishable from wild-

type N2 worms in the presence of PTZ, whereas mutant worms with defects in positive

regulation of general synaptic transmission or specific defects in inhibitory GABA transmission

exhibit robust PTZ-induced anterior convulsions. Moreover, unc-43 loss-of-function mutants display full-body convulsions in the presence of PTZ and likely have additional synaptic transmission abnormalities, which contribute to their unique drug responses.

DISCUSSION

Current protocols for aldicarb exposure with C. elegans do not allow experimenters to distinguish between mutants with specific deficits in ACh transmission and mutants with generalized deficits in synaptic transmission, as both classes of mutants exhibit resistance to aldicarb. Likewise, aldicarb cannot be used to determine if mutants have specific deficits in

GABA transmission or generalized failures to negatively regulate ACh transmission, as both classes of mutants exhibit hypersensitivity to aldicarb. Results from our PTZ exposure assays, when combined with results from aldicarb exposure assays, allows researchers to better characterize synaptic transmission mutants.

C. elegans synaptic transmission mutants may be classified in a straightforward manner by complementary aldicarb and PTZ exposure paradigms. Aldicarb resistant mutants with PTZ- induced anterior convulsions are likely deficient in general synaptic function. Conversely, aldicarb resistant mutants without PTZ-induced anterior convulsions are likely specifically deficient in ACh transmission. Mutants with aldicarb hypersensitivity, which do not exhibit PTZ- induced anterior convulsions, likely fail to negatively regulate ACh transmission. Finally, mutants with aldicarb hypersensitivity, which do exhibit PTZ-induced anterior convulsions, are likely GABA deficient.

The utility of aldicarb exposure is also weakened by its subjectivity, as different

experimenters often have varying definitions of paralysis. A single experimenter's technique can

also fluctuate. Also, aldicarb-exposed worms move differently in response to diverse forces of

prodding. The distinction between a paralyzed worm and a responsive worm can be as subtle as a

slight head or tail twitch. In addition to complementing aldicarb assays for better characterization

of C. elegans synaptic transmission mutants, PTZ may also be used to isolate synaptic transmission mutants, especially those mutants with hypersensitivity to aldicarb. Experimenters, who utilize PTZ exposure, may simply look for anterior convulsions, instead of subtle differences in aldicarb-induced paralysis.

ACKNOWLEDGMENTS

We wish to acknowledge the cooperative spirit of all Caldwell Lab members. A Basil O’Connor

Scholar Award from the March of Dimes and a CAREER Award from the National Science

Foundation to GAC, as well as an Undergraduate Research Science Program Grant from the

Howard Hughes Medical Institute to The University of Alabama, have funded neuronal

excitability and epilepsy research in the Caldwell Lab.

REFERENCES

Mahoney, T.R., Luo, S., Nonet, M.L. (2006). Analysis of synaptic transmission in Caenorhabditis elegans using an aldicarb-sensitivity assay. Nat. Protoc.1, 1772–1777.

Williams, S.N., Locke, C.J., Braden, A.L., Caldwell, K.A., Caldwell, G.A. (2004) Epileptic-like convulsions associated with LIS-1 in the cytoskeletal control of neurotransmitter signaling in Caenorhabditis elegans. Hum. Mol. Genet. 13, 2043–2059.

CHAPTER 3

PHARMACOGENETIC ANALYSIS REVEALS A POST-DEVELOPMENTAL ROLE FOR RAC GTPASES IN CAENORHABTIDIS ELEGANS GABAERGIC NEUROTRANSMISSION

This work was published in the journal GENETICS December, 2009 under the following citation: Locke, C.J., Kautu, B.B., Berry, K.P., Lee S.K., Caldwell, K.A., Caldwell, G.A. (2009). Pharmacogenetic analysis reveals a post-developmental role for Rac GTPases in Caenorhabditis elegans GABAergic neurotransmission. Genetics 183, 1357–1372. Bwarenaba Kautu is the co- first author who performed all pharmacological assays in Figures 3.1A, 3.1B, 3.4A-D, 3.5 A, B, 3.6C, 3.11, 3.12, and Table 3.1 A, performed microinjections, genetic crosses, and involved in designing, developing experiments, collecting and analyzing data. Cody Locke conceived the idea that Rac GTPases regulate GABA signaling, developed, designed and performed some experiments, and wrote the manuscript. Kalen Berry performed some experiments, collected data, took images of animals, and involved in designing experiments. Kyle Lee helped collected data, designed experiments and provided technical experitise and ideas. Guy Caldwell and Kim Caldwell co-wrote the manuscript and made images for the figures and graphs.

ABSTRACT

The nerve-cell cytoskeleton is essential for the regulation of intrinsic neuronal activity.

For example, neuronal migration defects are associated with microtubule regulators, such as

LIS1 and dynein, as well as with actin regulators, including Rac GTPases and integrins, and have

been thought to underlie epileptic seizures in patients with cortical malformations. However, it is

plausible that post-developmental functions of specific cytoskeletal regulators contribute to the

more transient nature of aberrant neuronal activity and could be masked by developmental

anomalies. Accordingly, our previous results have illuminated functional roles, distinct from

developmental contributions, for Caenorhabditis elegans orthologs of LIS1 and dynein in

GABAergic synaptic vesicle transport. Here, we report that C. elegans with function-altering

mutations in canonical Rac GTPase-signaling-pathway members demonstrated a robust behavioral response to a GABAA receptor antagonist, pentylenetetrazole. Rac mutants also

exhibited hypersensitivity to an acetylcholinesterase inhibitor, aldicarb, uncovering deficiencies

in inhibitory neurotransmission. RNA interference targeting Rac hypomorphs revealed

synergistic interactions between the dynein motor complex and some, but not all, members of

Rac-signaling pathways. These genetic interactions are consistent with putative Rac-dependent

regulation of actin and microtubule networks and suggest that some cytoskeletal regulators

cooperate to uniquely govern neuronal synchrony through dynein-mediated GABAergic vesicle

transport in C. elegans.

INTRODUCTION

Epilepsy affects 1–2% of the world population and is associated with imbalances between

excitatory and inhibitory neurotransmission in the brain (Locke et al. 2009). In particular, interneurons expressing gamma-aminobutyric acid (GABA), the principal inhibitory neurotransmitter in the human brain, are essential for normal neuronal synchronization and maintenance of a seizure threshold in humans (Cossette et al. 2002), rodents (Delorey et al.

1998), and zebrafish (Baraban et al. 2005). A failure of the brain to properly regulate neuronal synchrony can result from ion channel defects (Xu and Clancy 2008), neuropeptide depletion

(Brill et al. 2006), brain malformations (Patel et al. 2004), interneuron loss (Cobos et al. 2005), and/or synaptic vesicle recycling failure (Di Paolo et al. 2002), all of which may be caused by disrupting the nerve-cell cytoskeleton. Therefore, further exploration of putative links between cytoskeletal components and neurotransmission may accelerate development of novel therapeutics for epilepsy.

Epilepsy associated with cytoskeletal dysfunction often has a developmental basis (Di

Cunto et al. 2000; Wenzel et al. 2001; Keays et al. 2007). For example, mutations in LIS1, a dynein motor complex regulator, lead to classical lissencephaly, which is characterized by neuronal migration defects, a lack of convolutions in the brain, mental retardation, and epileptic seizures (Lo Nigro et al. 1997). Yet, observations that lissencephaly-associated seizures worsen after neuronal migration ceases, while LIS1 expression persists, imply that LIS1 also acts in the adult brain (Cardoso et al. 2002).

We previously reported that C. elegans with a predicted null mutation (t1550) in lis-1, the worm ortholog of human LIS1, exhibited synaptic vesicle misaccumulations, but not neuronal

migration or axon-pathfinding defects, in GABAergic motor neurons. We also observed anterior

“epileptic-like” convulsions, which were intense, frequent, and repetitive, with lis-1(t1550) homozygotes in the presence of pentylenetetrazole (PTZ; Williams et al. 2004), an epileptogenic

GABAA receptor antagonist (Huang et al. 2001; Fernandez et al. 2007). PTZ sensitivity was also

increased in heterozygous lis-1(t1550) mutants following RNA interference (RNAi) against

worm orthologs of associated cortical malformation genes, such as cdk-5 and nud-2, which are

known to interact with LIS1 and the dynein motor complex. Depletion of these gene products

was coincident with dynein-mediated synaptic vesicle transport defects, not with architectural

defects, in GABAergic motor neurons (Locke et al. 2006).

Plausible functional interactions among LIS-1, dynein, and Rac GTPases (Rehberg et al.

2005; Kholmanskikh et al. 2006) have not been explored in an intact adult nervous system. C.

elegans is ideal for characterizing these interactions due to the availability of weak and strong

Rac pathway mutants (Lundquist et al. 2001; Poinat et al. 2002; Lucanic et al. 2006), a

comprehensive RNAi library (Kamath et al. 2003), and GFP-based neuronal markers. Here, we

combine these tools with pharmacological modifiers of neuronal activity and establish an

experimental paradigm that reveals a novel regulatory pathway. This pathway is composed of

integrins at the plasma membrane that signal through Racs to dynein-associated proteins, which

function to coordinate synaptic vesicle transport in larval and adult GABAergic motor neurons.

MATERIALS/METHODS

Worm strains and maintenance: C. elegans were maintained via standard procedures

(Brenner 1974). The following strains were used: Bristol N2, avr-14(ad1302) avr-15(ad1051)

glc-1(pk54), cat-2(e1112), ced-2(n1994), ced-5(n1812), ced-10(n1993), ced-10(n3246), dgk-

1(nu62), dhc-1(js121)/hT2[bli-4(e937) let-?(q782) qIs48]; jsIs37, eat-4(ky5), egl-8(md1971), egl-10(md176), goa-1(sa734), ina-1(gm39), ina-1(gm144), lis-1(t1550) unc-32(e189)/qC1 dpy-

19(e1259) glp-1(q339); him-3(e1147), mig-2(gm103), mig-2(mu28), mig-15(rh80), mig-

15(rh148), mig-15(rh326), rab-3(y251), swan-1(ok267), tom-1(ok188), tph-1(mg280), unc-

5(e53), unc-17(e245), unc-25(e156), unc-26(e1196), unc-30(e191), unc-32(e189), unc-34(e315), unc-34(e566), unc-40(n324), unc-49(e407), unc-51(e396), unc-73(e936), unc-73(ev802), unc-

73(rh40), unc-115(ky275), Punc-115 mig-2(G16V), Punc-115 rac-2(G12V), juIs1 (Punc-25 SNB-

1 GFP), and oxIs12 (Punc-47 GFP).∷ ∷ ∷

∷ ∷ Behavioral and pharmacological assays: Convulsion assays were performed, as previously

described (Williams et al. 2004; Locke et al. 2008). Concentrations of PTZ (Sigma) employed

are indicated in the text. Aldicarb-induced paralysis assays also were performed, as described

(Nonet et al. 1998), by transferring young adult hermaphrodites to NGM plates with 0.5 mm

aldicarb (Supelco). Worms were observed in 30-min intervals for a period of 3 hr. For thrashing

assays, 1-day-old adult worms were washed clean of bacteria with M9, transferred to 7.5-ml

NGM plates with 2 ml M9, and allowed to recover for 2 min. Movies of worms thrashing were

captured in real-time with a Q Imaging Retiga Exi digital video camera at 25 frames/sec. Movies were saved onto an Intel Pentium computer using ImageJ (National Institutes of Health,

Bethesda, MD) and scored at a reduced frame rate for accuracy. A thrash was defined as a

change in direction at the worm mid-body.

RNA interference: Lactose-induced RNA interference (RNAi) by bacterial feeding was

performed as previously described (Locke et al. 2006), except that NGM with 0.25% lactose was

used. RNAi feeding against hermaphroditic parents (supporting Figure 3.8), in addition to first

generation offspring (Figure 3.8), was employed for fluorescence microscopy of young adult

ventral nerve cords. The L4440 dsRNA production vectors for all RNAi experiments, except for

α-synuclein (α-syn), a mock RNAi control, were obtained from a C. elegans RNAi library

(MRC, Cambridge, UK) (Kamath et al. 2003). Experiments with α-syn (RNAi) were performed

after Gateway recombination cloning of α-syn cDNA into a Gateway-converted L4440 plasmid.

Primers used for α-syn cDNA production were Primer 1: 5' ggg-gac-aag-ttt-gta-caa-aaa-agc-agg- cta-cat-gga-cgt-gtt-cat-gaa-ggg-c 3’ and Primer 2: 5' ggg-gaccac-ttt-gta-caa-gaa-agc-tgg-gtg-tta- ggc-ttc-agg-ttc-gta-gtc-ttg 3'.

Fluorescence microscopy: To observe possible alterations in GABAergic D-type motor neuron architecture, oxIs12 males were crossed with hermaphrodites from strains carrying ced-

10(n3246), ina-1(gm39), ina-1(gm144), mig-2(gm103), mig-15(rh148), unc-73(e936), or unc-

73(rh40). After homozygosing for oxIs12 and a mutation of interest, young adult hermaphrodites were examined for proper axon pathfinding along the full lengths of the ventral and dorsal nerve cords, whereas L1 larvae hermaphrodites were examined for proper axon pathfinding along the full length of the ventral nerve cord (Knobel et al. 2001). Both mig-2(gm103) and mig-15(rh148) mutants with oxIs12 were generated by meiotic recombination, as previously described (Poinat et al. 2002) and selected based upon uncoordination and hypersensitivity to aldicarb and/or PTZ.

To score synaptic vesicle distribution defects in GABAergic D-type motor neurons of mutant strains of interest, juIs1males were crossed with hermaphrodites from strains carrying ced-

10(n3246), ina-1(gm39), ina-1(gm144), mig-2(gm103), mig-15(rh148), unc-73(e936), or unc-

73(rh40). After homozygosing for juIs1 and a mutation of interest, except for ced-10(n3246), young adult hermaphrodites were assayed for SNB-1::GFP accumulation along the full lengths of the ventral and dorsal nerve cords, whereas L1 larvae hermaphrodites were assayed for SNB-

1::GFP accumulation along the full lengths of the ventral nerve cord. SNB-1::GFP misaccumulations associated with CED-10 were scored with ced-10(n3246) heterozygotes, due to a failure to isolate homozygotes with juIs1 and dominance from n3246 (Yang et al. 2006).

Architectural defects and synaptic vesicle distribution defects were also examined, as previously described, following lactose-induced RNAi feeding against oxIs12 and hermaphrodites, respectively. The average ventral nerve cord gap sizes for young adult and L1 worms were obtained by capturing images with a Photometrics Cool Snap CCD camera driven by

MetaMorph software (Universal Imaging). Ten images from ten worms of each strain were captured for analysis. Gaps in SNB-1::GFP expression were then measured with MetaMorph.

For all fluorescence microscope assays, young adult hermaphrodites were mounted in 3 mM levamisole on 2% agarose pads and observed with a Nikon Eclipse E600 epifluorescence microscope with DIC optics and Endow GFP HYQ and UV-2E/C DAPI filter cubes (Chroma,

Inc.). All analyses were made at 400X-600X magnification for young adult worms and 1000X magnification for L1 larvae.

Rescue of ina-1: An ina-1 cDNA (F54G8.3) was made by RT-PCR from total N2 RNA samples.

Primers used for ina-1 cDNA isolation were Primer 1: 5' gg-gac-tac-aag-gac-gac-gat-gac-aag- atg-cgt-gaa-tgt-ata-att-agc 3’ and Primer 2: 5' gg-cta-aag-tcc-cgt-atc-agc-cc 3'. A Gateway entry vector was generated by using Gateway recombination cloning (Invitrogen) to insert the ina-1 cDNA into pDONR221 via BP reaction. The sequence verified ina-1 cDNA was shuttled into a

Gateway destination vector, pDEST-UNC-47, via an LR reaction. The pDEST-UNC-47

destination vector was generated by cloning an unc-47 promoter (Williams et al.2004) into

pDEST-UNC-54 (Hamamichi et al. 2008) after removing the unc-54 promoter at the HindIII and

KpnI sites. Two independent transgenic (Tg) Punc-47::ina-1 lines were generated by

microinjecting pDEST-UNC-47-ina-1 and an intestinal GFP marker, Pges-1::gfp, into wild type

(N2) young adult hermaphrodites at a concentration of 100 ng/μL. Genetic crosses were done by

first crossing N2 males to Punc-47::ina-1 hermaphrodites, verified by intestinal GFP expression.

Tg male offspring were then crossed with hermaphrodites of target mutant strains. GFP-positive

progeny from these crosses were tested for homozygosity of the target gene by uncoordination,

PTZ-induced convulsions, and thrashing, consistent with homozygosity of non-Tg mutants.

Statistical analysis: Statistical analyses of all data sets, except for those obtained from thrashing

assays, were performed using Fisher's exact test (http://www.langsrud.com/fisher.htm). Results

given are two-tail P-values, which were found by comparing two appropriate data sets for

specified comparisons. Statistical analyses of data sets from thrashing assays were performed

using Student's t-test. Data are shown as mean ± SD and were deemed significant, if P < 0.05,

for both statistical tests.

RESULTS

PTZ induces anterior convulsions in Rac GTPase-signaling-pathway mutants

We previously demonstrated that worms lacking LIS-1 exhibit PTZ-induced anterior

convulsions. We also found these behavioral responses to be associated with loss of GABA

because systemic GABA mutants (i.e., unc-25 and unc-47) demonstrated similar responses to

PTZ (Williams et al. 2004). Moreover, we previously used PTZ to reveal genetic interactions among lis-1 and other microtubule-dependent cortical malformation genes (Locke et al. 2006).

Intriguingly, LIS-1 orthologs have also been shown to interact with Rac1 in Dictyostelium and

mammals to shape the actin cytoskeleton (Kholmanskikh et al. 2003; Rehberg et al. 2005).

These findings suggest an evolutionarily conserved role for LIS-1 and actin regulators, whose

impact on intrinsic neuronal activity is undefined. To determine if C. elegans Racs modulate

neuronal synchrony, we exposed loss- and gain-of-function Rac mutants to PTZ. The products of

worm ced-10, mig-2, and rac-2 genes act redundantly in multiple developmental processes,

including axon pathfinding in GABAergic D-type motor neurons (Lundquist et al. 2001). The

Rac gain-of-function (gf) mutant allele, ced-10(n3246), confers axon-pathfinding defects similar to those resulting from multiple Rac loss-of-function (lf) mutations and is predicted to interfere with a common guanine nucleotide exchange factor (GEF) of redundant Racs (Shakir et al.

2006). A second Rac gf mutant allele, mig-2(gm103), has been shown to perturb axon pathfinding (Zipkin et al. 1997), vulval cell migration (Kishore and Sundaram, 2002), and male tail development (Dalpé et al. 2004) in a manner consistent with cross-inhibition of redundant

Rac pathways (Zipkin et al. 1997; Lundquist et al. 2001). We found that, like a strong systemic

GABA mutant (Figure 3.4A; Figure 3.2; File S2), both ced-10(n3246) (Figure 3.3; File S3) and mig-2(gm103) (Figure 3.2; File S4) mutants had anterior PTZ-induced convulsions (Figure

3.1A). The frequency and intensity of convulsions positively correlated with PTZ concentration, similar to lis-1(t1550) and systemic GABA mutant responses to PTZ (Williams et al. 2004).

Neither of the Rac lf muta nts, ced-10(n1993) and mig-2(mu28), had altered PTZ sensitivity, compared to C. elegans N2, wild-type, worms (Figure 3.1A). A putative rac-2 lf allele, ok326,

Figure 3.1 Rac GTPase and canonical Rac regulator mutant anterior convulsions are commensurate with increasing concentrations of PTZ. (A and B) The response level (the percentage of young adult worms convulsing per total sample size; n = 30 for each of three independent experiments) of various C. elegans strains is depicted for each PTZ concentration, ranging from 0 to 10 mg/ml. N2 wild-type worms (black squares) did not exhibit anterior convulsions at any tested concentration of PTZ. Conversely, representative GABA (black diamonds) and general synaptic transmission (black circles) mutants did exhibit PTZ-induced anterior convulsions. (A) Rac gain-of-function (blue and green circles), but not loss-of-function mutants (collectively shown by gray circles), demonstrated PTZ-induced anterior convulsions. (B) Rac regulator mutants also displayed PTZ-induced anterior convulsions. Although both unc- 73 Rac GEF mutants were hypersensitive to PTZ, the weakest mutant tested, e936 (brown circles), was more sensitive to PTZ than a stronger unc-73 Rac GEF mutant, rh40 (purple circles). The strongest mig-15 mutant tested, rh326 (blue circles), was more sensitive to PTZ than a weaker mig-15 mutant, rh148 (blue circles), but was not significantly different from a mig-15 mutant, rh80 (gray circles), of intermediate strength. Hypomorphic alpha integrin (ina-1) mutants, gm39 (green circles) and gm144 (gray squares), were hypersensitive to PTZ. Of these two mutants, gm39, thought to be the weakest, exhibited the greatest sensitivity, as 97.8 ± 3.8% convulsed on 10 mg/ml PTZ, whereas 25.6 ± 3.8% of gm144 worms convulsed at the same concentration. Each data point represents mean ± SD.

Figure 3.2 Still frame images demonstrating C. elegans mutant strains with anterior convulsions in response to PTZ. The still images are representative frames from movies (25 frames per second), which are available in Supplementary Material. The black lines represent stationary reference points for visualization of anterior movements in relation to time (indicated in s). Anterior is to the left in all images, where lines are placed perpendicular to the original position of each worm’s nose. The convulsions of a GABA mutant, unc-25(e156), mimic those of a Rac gain-of-function mutant, mig-2(gm103), and the Rac regulator mutants, ina-1(gm144), mig- 15(rh148), and unc-73(e936). A G protein signaling mutant, egl-10(md176), which is deficient in general neurotransmitter release, also exhibits anterior convulsions on PTZ. Bar = 100 mm.

Figure 3.3 Still-frame images demonstrating C. elegans mutant strains with anterior convulsions in response to 10 mg/ml PTZ. The still images are representative frames from movies (25 frames/sec). The black lines represent stationary reference points for visualization of anterior movements in relation to time (“s” indicates seconds). Anterior is to the left in all images where lines are placed perpendicularly to the original position of each worm's nose. The convulsions of a general synaptic transmission mutant, rab-3(y251), mimic those of a Rac gain-of-function mutant, ced-10(n3246), and the Rac regulator mutants, mig-15(rh80) and ina-1(gm39). Bar, 100 μm.

Table 3.1 C. elegans mutants of interest exhibiting no PTZ-induced anterior convulsions

Gene Allele Protein identity C. elegans neuronal Reference name name function(s) Rac GTPase signaling rac-2 ok326 One of three triply Axon pathfinding; cell Lundquist et al. (2001) redundant Rac migration; cell corpse GTPases engulfment unc-73 ev802 Rho/Rac guanine Axon pathfinding; cell Struckhoff and Lundquist nucleotide exchange migration; neurotransmitter (2003); Williams et al. factor release (2007) ced-2 n1994 Src homology 2- and 3- Axon pathfinding; cell Wu et al. (2002); containing adaptor migration; cell corpse Kinchen et al. (2005) engulfment ced-5 n1812 Signaling protein, Axon pathfinding; cell Wu et al. (2002); DOCK180, ortholog migration; cell corpse Kinchen et al. (2005); engulfment Lundquist et al. (2001) unc- ky275 Actin-binding protein, Axon pathfinding Struckhoff and Lundquist 115 limatin, ortholog (2003) swan-1 ok267 WD40 repeat- Negative regulation of Racs Yang et al. (2006) containing AN11-like protein Netrin signaling unc-34 e315 Enabled/VASP Axon pathfinding; cell Gitai et al. (2003); ortholog migration Lucanic et al. (2006); Shakir et al. (2006) unc-34 e566 Enabled/VASP Axon pathfinding; cell Gitai et al. (2003); ortholog migration Lucanic et al. (2006); Shakir et al. (2006) unc-40 n324 Netrin receptor, DCC, Axon pathfinding; cell Gitai et al. (2003); ortholog migration Lucanic et al. (2006) unc-5 e53 Netrin receptor Axon pathfinding; cell Gitai et al. (2003); migration Lucanic et al. (2006)

GABA transmission at body-wall muscles unc-30 e191 Homeodomain D-type motor neuron Jin et al. (1994) transcription factor differentiation Non-GABA transmission unc-17 e245 Vesicular acetylcholine Acetylcholine transmission Miller et al. (1996) transporter cat-2 e1112 Tyrosine hydroxylase Dopamine transmission Sulston et al. (1975) eat-4 ky5 Vesicular glutamate Glutamate transmission Rankin and Wicks (2000) transporter tph-1 mg280 Tryptophan Serotonin transmission Keane and Avery (2003) hydroxylase General synaptic transmission tom-1 ok188 Tomosyn ortholog Negative regulation of McEwen et al. 2006 neurotransmitter release

DCC, deleted in colorectal cancer.

did not alter PTZ sensitivity (Table 3.1). These data suggest that CED-10, MIG-2, and perhaps

RAC-2 play redundant roles in controlling C. elegans inhibitory GABA transmission.

Rac GTPases are known to function in a variety of neurobiological processes, including

neurite branching and extension, axon pathfinding, and synapse formation. Furthermore, Rac

GTPases are regulated by a number of other proteins, which are not simply limited to GEFs and

GTPase-activating proteins (GAPs) (de Curtis, 2008). To determine which, if any, known C. elegans Rac regulators modulate neuronal synchrony, we exposed an array of Rac regulator mutants to PTZ. A Rac GTPase-signaling pathway, which is governed by interactions between

C. elegans orthologs of integrins and Nck-interacting kinase (NIK), mediates GABAergic D-type

motor neuron axon pathfinding (Poinat et al. 2002). Consistent with a role for these Rac regulators in GABAergic neurotransmission, multiple ina-1 (α-integrin) and mig-15 (NIK) hypomorphs demonstrated anterior epileptic-like convulsions in response to PTZ (Figure 3.1B;

Figure 3.3; Figure 3.2; File S5; File S6). The percentages of mig-15 mutants with anterior convulsions (Figure 3.1B) were roughly coincident with the strengths of mutant alleles, where rh326 > rh80 > rh148 (Shakir et al. 2006). Yet, the frequencies of rh326 and rh80 mutant convulsions were not significantly different from each other (Figure 3.1B). Surprisingly, ina-

1(gm39) mutants had higher percentages of PTZ-induced convulsions at all concentrations than ina-1(gm144) mutants, which are predicted from cell migration defects to be weaker (Baum and

Garriga 1997) (Figure 3.1B). Perhaps gm39 disrupts the binding of a different number and/or class of ligands than gm144 disrupts (Baum and Garriga 1997). Future studies with candidate

INA-1 ligands should assess this hypothesis.

We also observed PTZ-induced convulsions with a pair of unc-73 mutants, which are deficient in UNC-73 GEF-dependent activation of the triply redundant Racs (Struckhoff and

Lundquist 2003). The weaker unc-73(e936) mutants, which carry a splice donor mutation that disrupts all Rac GEF-containing isoforms of UNC-73, had higher percentages of PTZ-induced convulsions than stronger unc-73(rh40) mutants, which lack UNC-73 guanosine-5′-diphosphate to guanosine-5′-triphosphate exchange activity (Steven et al. 1998) (Figure 3.1B; Figure 3.2; File

S7). This result could be due to disruption of GEF2 Rho GEF activity by e936 (Steven et al.

1998). GEF2 Rho GEF activity may contribute to PTZ sensitivity, as it has been previously linked to normal synaptic transmission in C. elegans (Steven et al. 2005; Williams et al. 2007).

Yet, GEF2 Rho GEF-deficient unc-73(ev802) mutants (Steven et al. 2005) did not exhibit altered

PTZ sensitivities (Table 3.1), indicating that loss of GEF2 Rho GEF activity alone is not sufficient to allow for PTZ-induced convulsions.

We also did not observe altered PTZ sensitivities in ced-2(n1994) or ced-5(n1812) lf mutants (Table 3.1), which disrupt Rac-dependent cell corpse engulfment (Kinchen et al. 2005), cell migration, and axon pathfinding (Wu et al. 2002), suggesting that a different Rac-dependent mechanism underlies PTZ-induced convulsions. Likewise, we were unable to detect PTZ- induced convulsions with unc-40(n324) netrin receptor null mutants (Table 3.1), which are deficient in Rac-dependent GABAergic D-type motor neuron axon pathfinding (Lucanic et al.

2006) and non-GABAergic neuron axon pathfinding (Gitai et al. 2003). We also did not observe

PTZ-induced convulsions with multiple lf mutants of unc-34, which has been shown to function in parallel to Rac mutants, downstream of UNC-40, in C. elegans axon pathfinding (Gitai et al.

2003; Lucanic et al. 2006; Shakir et al. 2006) or a second netrin receptor null mutant, unc-5(e53)

(Lucanic et al. 2006; Table 3.1). Mutants lacking SWAN-1, which negatively regulates Rac mutants in neuronal and non-neuronal cells (Yang et al. 2006), or UNC-115, which positively

regulates RAC-2, but not CED-10 or MIG-2, in GABAergic D-type motor neuron axon

pathfinding (Struckhoff and Lundquist 2003), also did not have PTZ-induced convulsions (Table

3.1). These data suggest that UNC-73 activation of redundant Rac mutants, not Rho, lowers PTZ

sensitivity in a manner that depends on integrins, not netrins. We have found that Rac-signaling mutants phenocopy lis-1(t1550) and systemic GABA mutants by exhibiting anterior convulsions on PTZ (Table 3.2).

Table 3.2 C. elegans Rac-signaling-pathway mutants with PTZ-induced anterior convulsions

Gene Mutant Protein identity Human BLAST E- name allele(s) homolog valuea ced-10 n3246 One of three triply RAC1 7.0e-87 redundant Rac GTPases mig-2 gm103 One of three triply RAC1 1.7e-69 redundant Rac GTPases ina-1 gm144, gm39 α-Integrin subunit ITGA6 8.2e-84 mig-15 rh148, rh326, Nck-interacting kinase MAP4K4 1.2e-284 rh80 unc-73 e936, rh40 Rho/Rac guanine nucleotide TRIO 9.1e-237 exchange factor

Yet, generalized synaptic transmission defects lower a threshold for PTZ-induced convulsions,

as another general synaptic transmission mutant, rab-3(y251), convulses on PTZ (Figure 1, A and B; Figure 3.3; File S8). Thus, we cannot resolve if this Rac pathway plays a GABA-specific role in worm neurons by PTZ.

The C. elegans inhibitory GABAergic nervous system is composed of 19 D-type motor neurons that innervate body-wall muscles and four nerve ring RME (ring motor) neurons that innervate head muscles (McIntire et al. 1993). Deficits in a single class of inhibitory GABAergic neurons could be sufficient for PTZ-induced convulsions. To address this possibility, we examined unc-30(e191) null mutants, which express wild-type levels of GABA in RME neurons

but fail to express GABA in D-type motor neurons (Jin et al. 1994). We did not observe

convulsions in these mutants with any PTZ concentration tested (Table 3.1), implying that RMEs

may be chiefly responsible for this behavioral phenotype. Yet, these data do not rule out a

contributory role for D-type motor neurons in convulsions.

GABA may not be the only source of inhibitory transmission at head muscles because

unc-49(e407)-predicted null GABAA receptor mutants respond to PTZ in a dose-dependent manner (Williams et al. 2004). The C. elegans genome contains sequences for many other

GABAA receptor homologs, including glutamate-gated chloride (GluCl) channels, which could

function redundantly with unc-49 (Schuske et al. 2004). In support of this argument, predicted

null unc-49 mutants have been shown to respond to a GABA agonist, muscimol, albeit less

strongly than wild-type worms (McIntire et al. 1993). Likewise, predicted null unc-49 GABA

mutants also do not display RME neuron-mediated “loopy” foraging defects, unlike other

GABA-deficient worms, further suggesting redundancy among GABAA receptor homologs

(McIntire et al. 1993). To elucidate roles of other neurotransmitters in PTZ-induced convulsions,

we assayed mutants systemically lacking acetylcholine [unc-17(e245)] (Miller et al. 1996), dopamine [cat-2(e1112)] (Sulston et al. 1975), glutamate [eat-4(ky5)] (Rankin and Wicks 2000), or serotonin [tph-1(mg280)] (Keane and Avery 2003) on PTZ. None of these mutants had PTZ- induced convulsions (Table 3.1). Yet, 28.9% of triple GluCl channel mutants [avr-14(ad1302); avr-15(ad1051) glc-1(pk54)], which lack inhibitory glutamate transmission at the nerve ring

(Dent et al. 2000), displayed anterior convulsions in the presence of 10 mg/ml PTZ (File S9), whereas 100.0% of these mutants had anterior convulsions in the presence of 20 mg/ml PTZ. We did not observe convulsions in N2 worms at these concentrations of PTZ. These results may explain the failure of strong GABA mutants, such as unc-25(e156), to spontaneously convulse

(Williams et al. 2004). Indeed, C. elegans GluCl channels may also be perturbed by PTZ.

Picrotoxin (PTX), a second epileptogenic GABAA receptor antagonist, has been shown to block

invertebrate GluCl's (Etter et al. 1999). Since PTX and PTZ interact with overlapping domains

of GABAA receptors (Huang et al. 2001), they may similarly block worm GluCl's. Yet, because

the triple GluCl mutant convulsions are substantially less frequent and intense than convulsions

of Rac-signaling mutants or systemic GABA mutants, it is likely that Rac-signaling mutants are

GABA deficient. We hypothesize that loss of UNC-49 significantly lowers an intrinsic threshold, which PTZ overcomes by antagonizing other partially redundant GABAA receptor homologs on

RME-innervated muscles. Future experiments, including electrophysiology, will be needed to better describe the roles of GABAA receptor homologs in C. elegans neuron.

LIS-1, Dynein, and Rac-signaling-pathway mutants are hypersensitive to aldicarb

To determine if a Rac GTPase-signaling pathway, such as LIS-1 and the dynein motor

complex, participates in synaptic transmission at C. elegans NMJs, we exposed Rac and Rac

regulator mutants to aldicarb. Consistent with functionally redundant roles for Racs in synaptic

transmission, both ced-10(n1993) and mig-2(mu28) lf mutants demonstrated wild-type

sensitivities to aldicarb (Figure 3.4B). Conversely, transgenic worms, expressing constitutively

active mig-2(G16V) or rac-2(G12V) under the control of the neuron-specific unc-115 promoter

(Punc-115) (Lucanic et al. 2006), were hypersensitive to aldicarb (Figure 3.4B). Similarly, the Rac

gf mutants ced-10(n3246) and mig-2(gm103) were hypersensitive to aldicarb (Figure 3.4B),

suggesting cross-inhibition of redundant Racs.

Hypomorphic ina-1 and mig-15 mutants, as well as Rac-deficient unc-73 mutants, were

also hypersensitive to aldicarb (Figure 3.4C). INA-1 is known to function upstream of Racs

during axon pathfinding of GABAergic motor neurons (Poinat et al. 2002) and may also function

upstream of Racs post-developmentally in synaptic transmission on the basis of our

pharmacological results. To test if INA-1 contributes to aldicarb sensitivity through integrin and

Rac-signaling pathways in GABAergic motor neurons, we used a GABA-specific unc-47

promoter (Punc-47) to drive the expression of ina-1 in various genotypic backgrounds.

Overexpression of ina-1 in GABAergic neurons significantly decreased the aldicarb sensitivity

of wild-type worms (Figure 3.4C). Overexpression of ina-1 also partially rescued the aldicarb

hypersensitivity of ina-1(gm144), mig-15(rh148), and unc-73(e936) hypomorphs (Figure 3.4D).

Figure 3.4 Dynein motor complex and canonical Rac-signaling pathway mutants have increased neuromuscular excitability, as revealed by hypersensitivity to aldicarb. (A–C) The response level (the percentage of young adult worms paralyzed per total sample size; n = 30 for each of three independent experiments) of various C. elegans strains is depicted for each 30-min time point over a 3-hr exposure to 0.5 mm aldicarb. Paralysis of N2 wild-type worms (black squares) was commensurate with the time of aldicarb exposure. A representative GABA mutant (unc-25, black diamonds) was hypersensitive to aldicarb, whereas a general synaptic vesicle transport mutant (rab-3, black circles) was resistant to aldicarb when compared to wild type. (A) A hypomorphic dhc-1 mutant, js121 (orange circles), demonstrated hypersensitivity to aldicarb. Likewise, a predicted lis-1 null mutant (blue circles) exhibited robust aldicarb hypersensitivity, despite also carrying a mutation (unc-32) that confers resistance to aldicarb in isolation (green circles). (B) Rac loss-of-function mutants (collectively shown by gray circles) exhibited wild-type aldicarb sensitivities. However, Rac gain-of-function mutants (blue and green circles) and transgenic worms, which express either constitutively active mig-2(G16V) (purple circles) or rac-2(G12V) (brown circles) under the control of the neuron-specific unc-115 promoter (Punc-115), were hypersensitive to aldicarb. (C) Rac regulator mutants also displayed hypersensitivity to aldicarb. A higher percentage of mutants with a weak Rac GEF allele, unc-73(e936) (brown circles), was paralyzed at 1 hr of aldicarb exposure, compared with mutants in a stronger Rac GEF allele, unc- 73(rh40) (purple circles) at the same time. Conversely, significantly fewer mutants with the weakest mig-15 allele, rh148 (dark blue circles), were paralyzed after 1 hr of aldicarb exposure, compared to the percentage of mutants with the strongest mig-15 allele, rh326 (dark blue circles), or to the percentage of mutants with a mig-15 allele of intermediate strength, rh80 (gray circles). Likewise, there was a differential paralysis observed between ina-1(gm39) (green circles) and ina-1(gm144) (gray squares) mutants after 1 hr of aldicarb exposure. Notably, very few N2 wild-type worms were paralyzed after 1 hr of aldicarb exposure. All dynein motor

complex, Rac gain-of-function, and regulator mutants were hypersensitive at 60 and 90 min. Two independently generated transgenic lines, which overexpress an ina-1 cDNA transgene under the control of the GABAergic neuron-specific unc-47 promoter (Punc-47), were resistant to aldicarb (light blue circles). Each data point represents mean ± SD. Trends in sensitivity are shown in pale yellow. (D) The response level (the percentage of young adult worms paralyzed per total sample size; n = 30 for each of three independent experiments) of various C. elegans Rac-signaling mutants with (+) or without (−) an ina-1 cDNA transgene (Tg) under the control of Punc-47 is depicted for 90 min of aldicarb exposure. Averaged results from two independently generated Punc-47 ina-1 transgenic lines are shown. GABAergic neuron overexpression of ina-1 did not significantly affect aldicarb sensitivity of wild-type (WT) worms at this time point. Similarly, Punc-47∷ina-1 failed to alter aldicarb sensitivity of either the Rac gain-of-function mutants n3246 or gm103 or the strongest Rac-deficient GEF mutant, unc-73(rh40). Yet, GABAergic neuron∷ overexpression of ina-1 significantly reduced aldicarb hypersensitivity of weaker ina-1(gm144), mig-15(rh148), and unc-73(e936) mutants. Each data point represents mean ± S.

Conversely, ina-1 overexpression did not rescue the aldicarb hypersensitivity of the

dominant Rac gf mutant or the strongest available Rac-deficient GEF mutant, unc-73(rh40)

(Figure 3.4D), which is consistent with INA-1 functioning upstream of Racs in GABAergic motor neurons. Overexpression of ina-1 in GABAergic neurons of the Rac gf mutants n3246 and gm103 may trend toward significance (Figure 3.4D) due to integrin-dependent modulation of parallel Rac pathways. These results suggest that a Rac-signaling pathway, dependent upon Trio, integrin, and NIK, could mediate sensitivity to aldicarb via the same GABA-based mechanism by which it mediates sensitivity to PTZ.

Considering that rab-3(y251) mutants (Figure 3.1, A and B; Figure 3.4, A–C; Nonet et al.

1997) and other PTZ-responsive general synaptic transmission mutants (Nguyen et al. 1995;

Williams et al. 2004) are resistant to aldicarb, whereas systemic GABA mutants are PTZ

responsive (Figure 3.1, A and B; Williams et al. 2004) and hypersensitive to aldicarb (Figure 3.4,

A–C; Jiang et al. 2005; Vashlishan et al. 2008), these results are consistent with GABA-specific

roles for our Rac-signaling pathway. As corroboration, heterotrimeric G-protein-signaling

mutants, which are hypersensitive to aldicarb (Robatzek and Thomas 2000; Figure 3.5A) from

excess secretion of ACh at NMJs, did not convulse on PTZ (Figure 3.5B). In fact, lf mutations in

two antagonists of DGK-1 and GOA-1 activity, EGL-8 and EGL-10 (Robatzek and Thomas

2000), increased susceptibility to PTZ-induced anterior convulsions (Figure 3.2; Figure 3.5B;

File S10), implying that GOA-1 inhibits RME activity.

To increase confidence in the interpretation of our pharmacological assays, we also

placed young adult hermaphrodites in liquid and analyzed a high-frequency, drug-independent

locomotory behavior known as “thrashing.” Mutants lacking egl-10 or other synaptic

transmission genes have previously been shown to exhibit reduced thrashing rates (Miller et al.

1996). Despite hypersensitivity to aldicarb, goa-1(lf) mutants did not demonstrate thrashing rates

significantly different from wild-type worms. Furthermore, goa-1(lf) mutants thrashed at

significantly higher rates than the general synaptic transmission mutant [rab-3(y251)], a systemic

GABA mutant [unc-25(e156)], Rac gf mutants, and Rac regulator mutants (Figure 3.5C).

Surprisingly, thrashing assays have revealed another plausible explanation for the failure of unc-

25(e156) mutants to spontaneously convulse. Although unc-25(e156) mutants had significantly lower thrashing rates (127.2 ± 17.5 thrashes/min) than wild-type worms (188.2 ± 14.8 thrashes/min), these systemic GABA mutants thrashed at significantly higher rates than unc-

49(e407) mutants (96.5 ± 14.6 thrashes/min; Figure 3.5C), which have been shown to lack detectable inhibitory GABA transmission at body-wall muscles (Richmond and Jorgensen 1999).

Perhaps unc-25(e156) mutants have sufficient GABA production, which is undetectable by immunocytochemistry, in RMEs to prevent them from spontaneously convulsing. A different mutant with excess ACh secretion and associated hypersensitivity to aldicarb, tom-1(ok188)

(McEwen et al. 2006), also failed to convulse in response to PTZ (Table 3.1) and thrashed at wild-type rates (185.3 ± 28.8 thrashes/min; n = 30 worms). These data imply that the dynein motor complex and Rac-signaling pathway control neuronal synchrony at C. elegans NMJs by promoting GABA transmission, not by negative regulation of ACh.

Figure 3.5 Results from pharmacological and behavioral assays are inconsistent with a role for Rac GTPases and Rac regulators in heterotrimeric G protein signaling. (A-B) The response level (percent young adult worms paralyzed per total sample size; n=30 for each of three independent experiments) of various C. elegans strains is depicted for each 30-min. time point in three hours of exposure to 0.5 mM aldicarb (A) and each PTZ concentration, ranging from 0 to 10 mg/ml (B). Results from control strains (shown collectively in black) are repeated from Figure 1 (B) and Figure 3 (A) for convenience. (A) Paralysis of a predicted null goa-1 mutant, sa734 (dark gray circles), which fails to inhibit excitatory cholinergic transmission at C. elegans neuromuscular

junctions, was greatest. Similar aldicarb sensitivity was also observed for dgk-1(nu62) lf mutants (green circles), which are also characterized by excess levels of excitatory acetylcholine (ACh) transmission, as well as a strong GABA mutant, unc-25(e156) (black diamonds). Conversely, lf mutants for genes, which antagonize signaling through goa-1 and dgk-1, exhibited resistance to aldicarb (blue and light gray circles); these mutants demonstrated similar aldicarb sensitivities as rab-3(y251) mutants (black circles), which are deficient in general synaptic transmission. Trends in aldicarb sensitivity are shown with pale yellow shading. (B)Despite similar sensitivities to aldicarb as a representative GABA mutant, goa-1(sa734) and dgk-1(nu62) mutants (collectively shown by light gray circles) did not exhibit PTZ-induced anterior convulsions, like unc-25(e156) (black diamonds) and rab-3(y251)(black circles). However, egl-8(md1971) (blue circles) and egl-10(md176) (dark gray circles) did exhibit PTZ-induced anterior convulsions. Each data point represents mean ± mean of standard deviations. Each data point represents mean ± standard deviation. (C)The number of thrashes per minute for one-day old adult worms (n=30) are shown. A mutant with excess Ach transmission, goa-1(sa734), thrashes at a wild type (WT) rate. Yet, Rac signaling pathway mutants, including ced-10(n3246), mig-2(gm103), ina-1(gm144), and mig-15(rh148) mutants, like a representative general synaptic transmission, rab-3(y251), and GABA,unc-25(e156), mutants, thrash at significantly slower rates than N2 WT worms. Each data point represents mean ± standard deviation. *p < 0.05; Student’s t-test.

GABAergic synaptic vesicles misaccumulate in Rac-signaling mutants

Despite evidence that disruption of RMEs is most responsible for PTZ-induced

convulsions, GABAergic synaptic vesicle misaccumulations in D-type motor neurons correlate well with PTZ sensitivity and are reliably scored (Williams et al. 2004; Locke et al. 2006). Our

previous work demonstrates that misaccumulations of synaptic vesicles in GABAergic D-type motor neurons are associated with depletion of LIS-1 and dynein motor complex activity

(Williams et al. 2004; Locke et al. 2006). Although Rac GTPase-signaling-pathway mutants mimic lis-1 and dynein motor complex mutants in the presence of PTZ or aldicarb, we cannot assume that their sensitivities to these neural stimulants arise from a common mechanism. A Rac pathway functions in inhibitory GABAergic motor neuron development (Lundquist et al. 2001;

Poinat et al. 2002; Lucanic et al. 2006). Thus, Rac pathway mutants may have increased susceptibilities to aldicarb and/or PTZ as a result of architectural defects in the GABAergic nervous system.

To determine if a Rac pathway contributes to post-developmental GABAergic synaptic vesicle transport, we assayed for axonal gaps with SNB-1 GFP or soluble GFP expressed in

GABAergic D-type motor neurons (Figure 3.6; Figure 3.7).∷ To correlate axonal gaps with PTZ or aldicarb sensitivity, we first examined ventral nerve cords (VNCs; Figure 3.6A) and dorsal nerve cords (DNCs; Figure 3.7) of young adult hermaphrodites (Williams et al. 2004; Locke et al. 2006). However, axons from the two sets of GABAergic D-type motor neurons, known as

VD and DD neurons, overlap extensively in the VNCs and DNCs of young adults. To buttress our analysis, we assayed VNCs of L1 larvae hermaphrodites for axonal GFP gaps whose VNCs contain only DD axons (Sakamoto et al. 2005; Figure 3.6C). Consistent with a role for triply redundant Racs and an integrin–NIK complex in mediating GABAergic D-type commissural

Figure 3.6 Rac GTPase and canonical Rac regulator mutants exhibit synaptic vesicle misaccumulations, but not architectural breaks, in GABAergic D-type motor neurons of ventral nerve cords. (A) The percentage of axonal GFP gaps (the percentage of young adult worms with gaps per total sample size; n = 30 for each of three independent experiments) in GABAergic D- type motor neurons of ventral nerve cords (VNCs) in various C. elegans strains. Soluble GFP expression showed no architectural breaks in the VNC axons of wild-type (WT) or Rac- signaling-pathway mutant young adult oxIs12 (Punc-47 GFP) worms (dark gray bars). Yet, Rac- signaling mutants, except for hypomorphic mig-15(rh148) mutants, had misaccumulated synaptic vesicles, as revealed by gaps in GABAergic ∷neuron-specific expression of a synaptobrevin-1 (SNB-1) and GFP translational fusion protein (light gray bars). Results from oxIs12-bearing Rac-signaling mutants were standardized against wild-type oxIs12 worms. Likewise, results from juIs1-bearing Rac-signaling mutants were standardized against wild-type juIs1 (Punc-25 SNB-1 GFP) worms. Each data point represents mean ± SD. *P < 0.05; Fisher's exact test. The ced-10(n3246) mutants with juIs1 are heterozygous for the dominant n3246 allele, whereas∷ ced-10(n3246)∷ mutants with oxIs12 are homozygous for the dominant n3246 allele. (B) A representative wild-type juIs1 young adult hermaphrodite exhibited no axonal SNB- 1 GFP gaps, unlike an unc-73(e936) homozygote, which was deficient in Rac activation. (C)

∷ 71

Soluble GFP expression revealed no significant architectural breaks in the VNC axons of wild- type, Rac gf, or Rac regulator mutant L1 larval oxIs12 (Punc-47 GFP) worms. GABAergic neuron-specific expression of a SNB-1 and GFP translational fusion protein in L1 larval GABAergic D-type motor neurons showed significant percentages∷ of synaptic vesicle misaccumulations, as demonstrated by SNB-1 GFP gaps, in Rac gf, ina-1(gm144), ina-1(gm39), unc-73(e936), and unc-73(rh40) mutants. No axonal GFP gaps were observed in the VNCs of mig-15(rh148) mutant L1 larvae. Results from∷ oxIs12-bearing Rac signaling mutants were standardized against wild-type oxIs12 worms at the same developmental stage. Likewise, results from juIs1-bearing Rac signaling mutants were standardized against wild-type juIs1 (Punc- 25 SNB-1 GFP) worms at the same developmental stage. Each data point represents mean ± SD. *P < 0.05; Fisher's exact test. Asterisks for Punc-25 SNB-1 GFP data indicate significant differences∷ ∷ in percentages of axonal GFP gaps, compared to the wild-type juIs1 background and Punc-47 GFP data for the same mutant, suggesting ∷that synaptic∷ vesicle transport defects (SNB- 1 GFP gaps) occur independently of architectural defects (soluble GFP gaps). Bar, 5 μm. ∷ ∷

Figure 3.7 Rac GTPase and canonical Rac regulator mutants exhibit synaptic vesicle misaccumulations and some architectural breaks in GABAergic DD motor neurons. The percentage of axonal GFP gaps (percent worms with gaps per total sample size; n=30 for each of three independent experiments) in GABAergic D-type motor neurons of dorsal nerve cords (DNCs) of young adult hermaphrodites in various C. elegans strains is depicted. Soluble GFP expression showed no significant architectural breaks in the DNC axons of wild type (WT), ced- 10(n3246), or ina-1(gm39) young adult oxIs12 (Punc-47::GFP) worms (light gray bars). However, mig-2(gm103), ina-1(gm144), mig-15(rh148), unc-73(e936), and unc-73(rh40) mutants had significant percentages of soluble GFP gaps in young adult GABAergic Dtype motor neurons of the DNC, indicating architectural abnormalities. GABAergic neuron-specific expression of a synaptobrevin-1 (SNB-1) and GFP translational fusion protein in young adult GABAergic D-type motor neurons revealed significant percentages of synaptic vesicle misaccumulations, as demonstrated by axonal SNB-1::GFP gaps, in all Rac signaling mutants tested (dark gray bars). Architectural defects in the DNCs of mig-15(rh148) and unc-73(rh40) mutants could not be separated from synaptic vesicle transport defects. Each data point represents mean ± mean of standard deviations. *p < 0.05; Fisher’s Exact Test. Asterisks for Punc-25::SNB-1::GFP data indicate significant differences in percentages of axonal GFP gaps, compared to the WT juIs1 background and Punc-47::GFP data for the same mutant, suggesting that synaptic vesicle transport defects (SNB-1::GFP gaps) occur independently of architectural defects (soluble GFP gaps). Red outlines around bars, which represent Punc-47::GFP, indicate that percentages of axonal GFP gaps are significantly different from the WT oxIs12 background. Red outlines around bars, which represent Punc-25::SNB-1::GFP, indicate that percentages of axonal GFP gaps are significantly different from the WT juIs1 background, but are not significantly different from an oxIs12-bearing Rac signaling pathway mutant, which carries the same allele. The ced-10(n3246) mutants with juIs1 are heterozygous for the dominant n3246 allele, while ced-10(n3246) mutants with oxIs12 are homozygous for the dominant n3246 allele.

navigation (Poinat et al. 2002), we observed significant soluble GFP gaps in DNCs of mig-

2(gm103) young adult Rac gf mutants, in ina-1(gm144) and mig-15(rh148) young adult hypomorphs, and in Rac GEF-deficient (Steven et al. 1998), unc-73(e936) and unc-73(rh40) mutant young adults (Figure 3.7). Conversely, young adult mutants for either ced-10(n3246) or ina-1(gm39) did not exhibit significant soluble GFP gaps in their DNCs (Figure 3.7). Moreover, none of these Rac-signaling mutants had significant soluble GFP gaps in their VNCs, either as

L1 larvae or as young adults (Figure 3.6).

All Rac-signaling mutants that we examined had significantly higher percentages of abnormally distributed synaptic vesicles, as revealed by SNB-1 GFP axonal gaps, than axon outgrowth defects, as revealed by soluble GFP (Punc-47 GFP) gaps,∷ in their VNCs at the young

adult stage (Figure 3.6A) and at the L1 larval stage (Figure∷ 3.6C). Figure 3.6B is a representative image showing SNB-1 GFP axonal gaps in the unc-73(e936) mutant background. We never observed SNB-1 GFP ∷mislocalization in the DNCs of Rac-signaling mutant L1 larvae (data not shown), suggesting∷ that this Rac-signaling pathway does not participate in synaptic vesicle cargo recognition during DD neuron remodeling (Sakamoto et al. 2005). The only Rac pathway mutants that did not exhibit significantly more SNB-1 GFP axonal gaps than soluble GFP gaps in young adult DNCs were the mig-15 mutant, rh148 (∷Shakir et al. 2006), and the strongest Rac

GEF mutant, rh40 (Steven et al. 1998) (Figure 3.7). Rac-signaling mutants had similar interpunctal SNB-1 GFP axonal gap widths and gap numbers at both L1 larval and young adult stages (Table 3.3). Thus,∷ SNB-1 GFP axonal gap frequencies, not interpunctal widths or numbers, correlate with Rac-signaling∷ mutant sensitivities to PTZ and aldicarb.

Table 3.3 C. elegans SNB-1::GFP Axonal Gap Quantifications

Because significantly reduced SNB-1 GFP gaps in the majority of the Rac pathway mutants tested could not be explained by axon∷ outgrowth defects, these data suggest that synaptic vesicle misaccumulations in GABAergic motor neurons could be sufficient for enhanced sensitivities of Rac pathway mutants to aldicarb and PTZ. In support of this hypothesis, ina-1(gm39) mutants, unlike ina-1(gm144) mutants, had insignificant architectural defects in GABAergic DD motor neurons of young adults (Figure 3.7). Yet, ina-1(gm39) mutants were more sensitive to aldicarb (Figure 3.4C) and PTZ (Figure 3.1B) than ina-1(gm144) mutants. Defects in non-GABAergic neurons of the stronger mutant might explain its weaker sensitivities to aldicarb and PTZ. However, paralysis from severe defects in synaptic transmission or axon pathfinding does not prevent PTZ-induced convulsions, since 100.0% of unc-26(e1196) and 82.2% of unc-51(e396) immotile mutants exhibited anterior convulsions with

2.5 mg/ml PTZ. As noted above, gm39 may also affect binding of a different number and/or class of ligands than gm144. Regardless, similar synaptic vesicle misaccumulations suggest that

LIS-1 and dynein converge with Racs to control GABA transmission at adult C. elegans NMJs.

RNAi confirms role for Rac-signaling pathway in GABAergic vesicle transport

SNB-1 GFP misaccumulations implicate Rac signaling in GABAergic vesicle transport.

Yet, these data∷ are difficult to interpret in light of subtle axon-pathfinding defects in GABAergic

D-type motor neurons. To be confident that GABAergic vesicle transport defects from Rac signaling attenuation are not secondary to axon-pathfinding defects, we used RNAi to produce weaker phenotypes than those of extant mutants.

We have previously shown that lactose-induced RNAi feeding against LIS-1 pathway members is sufficient to cause SNB-1 GFP misaccumulations in D-type motor neurons (Locke et al. 2006). Accordingly, lactose-induced∷ RNAi feeding uncovered GABAergic vesicle

transport abnormalities, which phenocopied lis-1(t1550) and Rac-signaling-pathway mutants, with combinatorial RNAi (Tischler et al. 2006) against both ced-10 and rac-2 (Figure 3.8; Figure

3.9) in first generation (F1) progeny of RNAi-treated worms. As with the mutant alleles, SNB-

1 GFP misaccumulated with mig-15(RNAi) in DNCs and with ina-1(RNAi), lis-1(RNAi), or unc∷ -73(RNAi) in both VNCs and DNCs (Figure 3.8; Figure 3.9) of F1 progeny. RNAi feeding

also revealed SNB-1 GFP misaccumulations with combinatorial RNAi against the functionally

redundant C. elegans∷ PAK orthologs, pak-1 and max-2 (Figure 3.8; Figure 3.9), that encode the

immediate downstream effectors of activated Racs implicated in GABAergic D-type

commissural axon navigation (Lucanic et al. 2006). These results may suggest that PAK-

mediated signals between actin and microtubule networks are particularly important for

GABAergic vesicle transport, as dynein motor complex subunits, such as dynein light chain (Lu et al. 2005) and dynamitin (Menzel et al. 2007), have also been shown to physically interact with

PAK orthologs in humans and Drosophila, respectively.

Figure 3.8 Lactose-induced RNAi feeding against canonical Rac-signaling pathway members results in synaptic vesicle misaccumulations, but not architectural breaks, in GABAergic D-type motor neurons of ventral nerve cords. The percentage of axonal GFP gaps (the percentage of young adult worms with gaps per total sample size; n = 30 for each of three to five independent experiments) in GABAergic D-type motor neurons of ventral nerve cords (VNCs) of various RNAi treatments. Soluble GFP expression showed no architectural breaks in the VNC axons of young adult oxIs12 (Punc-47 GFP) worms with mock (α-synuclein) RNAi or RNAi against Rac- signaling-pathway members (dark gray bars). Yet, RNAi against Rac-signaling-pathway members, except for mig-15∷, resulted in misaccumulated synaptic vesicles, as revealed by gaps in GABAergic neuron-specific expression of a synaptobrevin-1 (SNB-1) and GFP translational fusion protein (light gray bars). Combinatorial RNAi was used against two of three triply redundant Racs, ced-10 and rac-2. Results from mock RNAi against oxIs12 worms were used to standardize other results with oxIs12 worms. Likewise, results from mock RNAi against juIs1 (Punc-25 SNB-1 GFP) worms were used to standardize other results with juIs1 worms. Each data point represents mean ± SD. *P < 0.05; Fisher's exact test. ∷ ∷

Figure 3.9 Lactose-induced RNAi feeding against canonical Rac signaling pathway members results in synaptic vesicle misaccumulations, but not architectural breaks, in GABAergic D-type motor neurons of dorsal nerve cords. The percentage of axonal GFP gaps (percent young adult worms with gaps per total sample size; n=30 for each of three to five independent experiments) in GABAergic D-type motor neurons of dorsal nerve cords (DNCs) of various RNAi treatments is depicted. Soluble GFP expression showed no architectural breaks in the DNC axons of young adult oxIs12 (Punc-47:: GFP) worms with mock (α-synuclein) RNAi or RNAi against Rac signaling pathway members (light gray bars). Yet, RNAi against most Rac signaling pathway members resulted in misaccumulated synaptic vesicles, as revealed by gaps in GABAergic neuron-specific expression of a synaptobrevin-1 (SNB-1) and GFP translational fusion protein (dark gray bars). Despite not significantly disrupting SNB-1::GFP localization in ventral nerve cords (VNCs) of young adults, mig-15(RNAi) yielded SNB-1::GFP misaccumulations in young adult DNCs. Conversely, pes-7(RNAi) did not significantly disrupt SNB-1::GFP localization in DNCs, despite affecting VNCs. Combinatorial RNAi was used against two of three triply redundant Racs, ced-10 and rac-2. Results from mock RNAi against oxIs12 worms were used to standardize other results with oxIs12 worms. Likewise, results from mock RNAi against juIs1 (Punc-25::SNB-1::GFP) worms were used to standardize other results with juIs1 worms. Each data point represents mean ± mean of standard deviations. *p < 0.05; Fisher’s Exact Test.

Additionally, our results suggest novel roles for bicd-1, the worm ortholog of bicaudal-D,

a dynein- and NIK-interacting protein (Houalla et al. 2005), and pes-7, the worm ortholog of

IQGAP1, a rodent Lis1 and Rac1 interactor (Kholmanskikh et al. 2006), in GABAergic vesicle

transport (Figure 3.8; Figure 3.9). RNAi against these genes did not result in soluble GFP axonal

gaps (Figure 3.8; Figure 3.9). In contrast, most of the same RNAi treatments against parent

animals, instead of their F1 progeny, resulted in SNB-1 GFP misaccumulations, but not soluble

GFP axonal gaps (Figure 3.10), such as those observed ∷with young adult Rac-signaling mutants

(Table 3.3). The only treatment that did not uncover a trend toward GABAergic vesicle transport defects was combinatorial RNAi against pak-1 and max-2 in parents (Figure 3.10). This result may be explained by dilution of phenotypic strength, where RNAi phenotypes are weakened by multiple gene targeting (Tischler et al. 2006).

Figure 3.10 Lactose-induced RNAi feeding in parental generations, instead of first generation progeny, further suggests a post-developmental role for a Rac signaling pathway in dynein- mediated GABAergic synaptic vesicle transport. The percentage of axonal GFP gaps (percent young adult worms with gaps per total sample size; n=30 for each of three independent experiments) in GABAergic D-type motor neurons of ventral nerve cords (VNCs) of various RNAi treatments is depicted. Soluble GFP expression showed no architectural breaks in the VNC axons of young adult oxIs12 (Punc-47::GFP) worms with mock (α-synuclein) RNAi or RNAi against Rac signaling pathway members (light gray bars). Yet, RNAi against Rac signaling pathway members, except for combinatorial RNAi against two PAK orthologs, pak-1 and max-2, resulted in misaccumulated synaptic vesicles, as revealed by gaps in GABAergic neuron-specific expression of a synaptobrevin-1 (SNB-1) and GFP translational fusion protein (dark gray bars). Despite not significantly disrupting SNB-1::GFP localization in VNCs of young adults mig-15(RNAi) yielded SNB-1::GFP misaccumulations in VNCs of L1 larvae. Combinatorial RNAi was also used against two of three triply redundant Racs, ced-10 and rac-2. Results from mock RNAi against oxIs12 worms were used to standardize other results with oxIs12 worms. Likewise, results from mock RNAi against juIs1 (Punc-25::SNB-1::GFP) worms were used to standardize other results with juIs1 worms. Each data point represents mean ± mean of standard deviations. *p < 0.05; Fisher’s Exact Test.

RNAi reveals synergistic interactions between dynein and Rac-signaling pathways

To determine if members of a canonical Rac-signaling pathway function together to

modulate neuronal synchrony in C. elegans, we performed aldicarb-induced paralysis assays and

PTZ-induced convulsion assays with RNAi-treated animals. Consistent with parallel functions of

triply redundant Racs in GABAergic motor neurons (Lundquist et al. 2001), RNAi against ced-

10 in mig-2(gm103) gf mutants was not sufficient to alter sensitivity to aldicarb (Figure 3.11A).

Likewise, RNAi against rac-2 in either ced-10(n3246) or mig-2(gm103) gf mutant backgrounds was not sufficient to alter aldicarb sensitivity (Figure 3.11A). However, combinatorial RNAi against ced-10 and rac-2 synergized with a mig-2(gm103) mutation to significantly enhance aldicarb sensitivity and was also sufficient to increase aldicarb sensitivity of N2 wild-type worms

(Figure 3.11A).

RNAi against bicd-1, ina-1, lis-1, mig-15, pes-7, or unc-73, as well as combinatorial

RNAi against the functionally redundant pak-1 and max-2 genes, was sufficient to enhance the aldicarb sensitivity of wild-type worms (Figure 3.11A). RNAi against these putative Rac- signaling-pathway members, except for pes-7 with ced-10(n3246), resulted in synergistic enhancement of sensitivity to aldicarb in both Rac gf mutant backgrounds (Figure 3.11A).

Despite not being sufficient to induce anterior convulsions in the presence of PTZ, as predicted by our earlier studies (Locke et al. 2006), these same RNAi treatments also synergized with Rac gf mutations to increase sensitivity to PTZ-induced anterior convulsions (Figure 3.11B).

Furthermore, most of these RNAi treatments synergized with hypomorphic ina-1(gm144) and mig-15(rh148) mutations, albeit weakly with the latter, to increase sensitivity to aldicarb

Figure 3.11 RNAi feeding and pharmacological assays with Rac GTPase mutant backgrounds reveal synergistic genetic interactions with the dynein motor complex and canonical Rac regulators. (A and B) The response level (the percentage of young adult worms paralyzed per total sample size; n = 30 for each of three to five independent experiments) of various RNAi treatments after 60 min of exposure to aldicarb (A) or PTZ (B). (A) Like mock (α-synuclein) RNAi, RNAi against triply redundant Rac, ced-10, or rac-2 was not sufficient to enhance aldicarb sensitivity of N2 wild-type worms (dark gray bars). Conversely, combinatorial RNAi against ced-10 (medium gray bars) and rac-2 (light gray bars) was sufficient to enhance aldicarb sensitivity of wild-type worms. Similar enhancements of N2 sensitivity to aldicarb were observed with RNAi against the canonical Rac regulators, ina-1, mig-15, pes-7, or unc-73. Combinatorial RNAi against the functionally redundant PAK orthologs, pak-1 and max-2, or RNAi against the dynein motor complex members, bicd-1 and lis-1, was also sufficient to increase N2 sensitivity to aldicarb. RNAi against most of these Rac-signaling-pathway or dynein motor complex members also enhanced aldicarb sensitivities of either or both Rac gain-of- function mutants, ced-10(n3246) and mig-2(gm103). RNAi against either ced-10 or rac-2 was

not sufficient to enhance the aldicarb sensitivity of either Rac gain-of-function mutant, while pes-7(RNAi) enhanced aldicarb sensitivity of mig-2(gm103), but not of ced-10(n3246). (B) The same synergistic genetic interactions, which were uncovered with aldicarb exposure, were confirmed with PTZ exposure. Yet, RNAi against wild-type worms was not sufficient to yield convulsions. Each data point represents mean ± SD. *P < 0.05; Fisher's exact test. Asterisks indicate enhancement, compared to mock RNAi against a given genotypic background. Red outlines around bars indicate synergism, in which RNAi against a mutant background results in greater drug sensitivity than the sum of the same RNAi treatment against a wild-type background and mock RNAi against the same mutant.

Figure 3.12 RNAi feeding and pharmacological assays with hypomorphic Rac regulator mutant backgrounds reveal synergistic genetic interactions with the dynein motor complex and canonical Rac regulators. (A and B) The response level (the percentage of young adult worms paralyzed per total sample size; n = 30 for each of three to five independent experiments) of various RNAi treatments after 60 min of exposure to aldicarb (A) or PTZ (B). All RNAi treatments against N2 wild-type worms are repeated from 3.11 for convenience (dark gray bars). As denoted by “X”, lethality resulted from ina-1(RNAi) against ina-1(gm144) mutants, precluding analysis. (A) RNAi against most of the Rac-signaling-pathway or dynein motor complex members enhanced aldicarb sensitivities of either or both Rac regulator mutants, ina- 1(gm144) (medium gray bars) and mig-15(rh148) (light gray bars). Unlike combinatorial RNAi against both genes, RNAi against the redundant Racs ced-10 or rac-2 was not sufficient to enhance the aldicarb sensitivity of either Rac regulator mutant. RNAi against pes-7 enhanced aldicarb sensitivity of mig-15(rh148), but not of ina-1(gm144), whereas unc-73(RNAi) enhanced aldicarb sensitivity of ina-1(gm144), but not of mig-15(rh148). (B) The same synergistic genetic interactions that were uncovered with aldicarb were confirmed with PTZ. Unlike the results from aldicarb exposure, RNAi against either ced-10 or rac-2 was sufficient to enhance PTZ-induced

anterior convulsions of ina-1(gm144) mutants, but not of mig-15(rh148). PTZ exposure also did not reveal synergistic genetic interactions between mig-15 and lis-1, pes-7, or the PAK orthologs pak-1 and max-2. Yet, unc-73(RNAi) enhanced mig-15(rh148) convulsions, revealing interactions that were not apparent from aldicarb exposure. Each data point represents mean ± SD. *P < 0.05; Fisher's exact test. Asterisks indicate enhancement, compared to mock RNAi against a given genotypic background. Red outlines around bars indicate synergism, in which RNAi against a mutant background results in greater drug sensitivity than the sum of the same RNAi treatment against a wild-type background and mock RNAi against the same mutant.

(Figure 3.12A) and PTZ (Figure 3.12B). Specifically, neither RNAi against lis-1, pes-7, and unc-

73 nor combinatorial RNAi against pak-1 and max-2 was sufficient to significantly enhance

sensitivity to PTZ with mig-15(rh148) (Figure 3.12B). Likewise, pes-7(RNAi) was not sufficient

to significantly enhance sensitivity to aldicarb (Figure 3.12A) or PTZ with ina-1(gm144) (Figure

3.12B). These inconsistencies could result from our use of weaker hypomorphic mutants (Poinat et al. 2002) or subthreshold levels of neural stimulants. Ultimately, however, these results suggest that the canonical Rac GTPase regulators, INA-1, MIG-15, UNC-73, PAK-1, and MAX-

2, modulate neuronal synchrony through interactions with triply redundant Racs, integrators of microtubule-actin-signaling networks, such as LIS-1, PES-7, and BICD-1.

DISCUSSION

We previously reported that disturbance of LIS-1 and the dynein motor complex results in enhanced sensitivities to a GABAA receptor antagonist, PTZ, and synaptic vesicle

misaccumulations, which were specific to GABAergic motor neurons (Williams et al. 2004;

Locke et al. 2006). In this work, we show that both lis-1 and dhc-1 mutants are also hypersensitive to an acetylcholinesterase inhibitor, aldicarb, which overstimulates body-wall muscles (Nguyen et al. 1995; Miller et al. 1996) in a similar manner to PTZ. These results further suggest that lis-1 and dhc-1 cooperate with GABA to modulate neuronal synchrony. Yet, these data do not suggest a mechanism by which LIS-1 and dynein may function specifically in

C. elegans GABA transmission, given their pleiotropy and likely roles in general synaptic function. Here, we present evidence that this mechanism is Rac dependent and active in diverse sets of GABAergic neurons.

GABAergic D-type motor neurons are known to complete their development in the second of four C. elegans larval stages (Knobel et al. 1999). Moreover, previous studies have

demonstrated that a tripartite Rac GTPase-signaling cascade mediates commissural axon

navigation of these neurons (Lundquist et al. 2001; Poinat et al. 2002; Lucanic et al. 2006).

Interestingly, expression of C. elegans Racs persists in the adult GABAergic nervous system

(Lundquist et al. 2001). Rac regulators, including ina-1 (Baum and Garriga, 1997), mig-15

(Poinat et al. 2002), and unc-73 (Steven et al. 1998; Hunt-Newbury et al. 2007), as well as lis-1

(Dawe et al. 2001; Hunt-Newbury et al. 2007) and dhc-1 (Hunt-Newbury et al. 2007), have also been detected in GABAergic neurons of adult C. elegans hermaphrodites. These findings suggest that a Rac-signaling pathway could govern not only GABAergic neuron development but also

GABA transmission, post-developmentally. Consistent with this hypothesis, we show for the first time that a Rac-signaling pathway modulates synaptic transmission at adult C. elegans

NMJs. Furthermore, we present evidence that Racs have post-developmental functions, which appear distinct from previously described neuromuscular roles for RHO-1 (McMullan et al.

2006; Williams et al. 2007). More specifically, this Rac cascade is required for dynein-mediated synaptic vesicle transport in GABAergic neurons.

Rho family GTPases, including Racs, may be differentially regulated in space and time to confer cellular identity (de Curtis, 2008). Indeed, disparate Rac-signaling pathways have been implicated in several C. elegans developmental processes (Lundquist et al. 2001). Here, we reveal a specific role for an integrin-mediated tripartite Rac cascade in GABAergic motor neurons by combining microscopic, pharmacological, and behavioral approaches. Furthermore,

we have shown that Rac regulators, which were previously implicated in GABAergic D-type

motor neuron commissural axon navigation (Poinat et al. 2002), genetically interact with Racs

and the dynein motor complex to mediate GABAergic vesicle transport. We have also identified

roles for C. elegans orthologs of bicaudal-D and IQGAP1 in this dynein–Rac-signaling pathway.

It has been speculated that these genes integrate signals between microtubule and actin networks

via NIK and Lis1, respectively (Houalla et al. 2005; Kholmanskikh et al. 2006). Although our

results support these propositions, a series of bicd-1 and pes-7 hypomorphic and null mutant alleles will be required to fully understand the neuronal functions of these genes.

On the basis of the above results, we present a model in which disruption of this dynein–

Rac-signaling pathway results in a loss of the axonal transport of synaptic vesicles in

GABAergic motor neurons (Figure 3.13). As suggested in Figure 3.13, it is plausible that this dynein–Rac-signaling pathway coordinates microtubule plus end-binding of GABAergic

synaptic vesicles, thereby allowing them to undergo retrograde transport. Evidence for the

interdependency of dynein and kinesin in anterograde transport also exists and likely explains the

GABAergic vesicle misaccumulations and associated behavioral phenotypes, which we observed

(Williams et al. 2004; Locke et al. 2006). These GABAergic vesicle misaccumulations could

also be caused by disruptions in other cellular processes, such as the localization of SNB-1 GFP

to synaptic vesicle membranes, selective degeneration or retraction of axons, or regulated ∷

degradation or endocytosis of SNB-1 GFP (Koushika et al. 2004). We hypothesize that SNB-

1 GFP misaccumulates in these dynein∷ –Rac-signaling mutants due to axonal transport defects.

However,∷ these alternative hypotheses could be considered in the future, perhaps best with live

imaging.

The identification and characterization of interactions between Racs and the dynein

motor complex was accomplished by separating the architectural from the functional defects in

GABAergic neurons and knocking down putative interactors in sensitized genotypic

backgrounds. To this end, we employed lactose-induced RNAi feeding, which dependably

inhibits gene expression in GABAergic motor neurons (Locke et al. 2006). We found that RNAi

against members of a Rac cascade was not sufficient to cause architectural defects in the

GABAergic nervous system, even though these genes are important for GABAergic D-type

motor neuron development (Lundquist et al. 2001; Poinat et al. 2002; Lucanic et al. 2006).

Conversely, RNAi against these targets was sufficient to cause SNB-1 GFP misaccumulations, revealing a link with synaptic vesicle transport. RNAi feeding in hypomorphic∷ genotypic backgrounds was sufficient to uncover genetic interactions without the need to cross mutants with slow-growing hypersensitive RNAi strains. This approach may be used to accelerate the mapping of other signaling cascades and to identify roles for other developmental genes in adult neurons.

Figure 3.13 Model depicting a potential role for a Rac GTPase-signaling pathway in dynein- mediated synaptic vesicle transport in en passant C. elegans GABAergic motor axons. Triply redundant Racs (CED-10, MIG-2, and RAC-2) and their activator, UNC-73 (Trio), may transmit extracellular signals from a Nck-interacting kinase (MIG-15), α-integrin (INA-1), and β-integrin (PAT-3) complex to a PAK-mediated interface between actin and microtubule networks. Redundant worm PAK orthologs (PAK-1 and MAX-2) may promote dynein motility through physical interactions with dynein motor complex subunits and/or actin. BICD-1 may regulate vesicle transport via physical interactions with dynein. LIS-1 may also regulate dynein motor activity through direct physical interactions with dynein motor complex subunits and/or Racs. These interactions may be involved in coordinating the binding of GABAergic synaptic vesicles at microtubule plus ends and subsequent retrograde transport. Disrupting these interactions could also lead to anterograde transport defects, due to the putative interdependency of dynein and kinesin, and to diminished levels of inhibitory GABA secretion. Blue arrows indicate that physical and genetic interactions have been shown. Orange arrows indicate that only a genetic interaction has been observed. Microtubules are shown in green, while F-actin is shown in brown. GABA is colored purple.

Previous studies with C. elegans and other model systems have postulated interactions

between the dynein motor complex and Rac GTPases. For example, an integrin-dependent signaling cascade has been shown to mediate trafficking of lipid rafts through Rac1, Arf6, and microtubules (Balasubramanian et al. 2007). Likewise, inhibition of Dictyostelium orthologs of

LIS-1 and dynein intermediate chain has been associated with actin depolymerization, possibly through disruption of Rac1 (Rehberg et al. 2005). Consistent with these results, a C. elegans

study has shown that lis-1 and dhc-1 mutants are defective in germline cell corpse engulfment

(Buttner et al. 2007). Although the molecular basis of these engulfment defects was not

investigated, the data suggested that corpse engulfment is dynein dependent and likely required

lis-1 and dhc-1 for cargo transport and/or changes in cytoskeletal dynamics (Buttner et al. 2007).

These hypotheses are particularly relevant to our own findings, as one of three C. elegans Racs,

CED-10, is essential for corpse engulfment (Kinchen et al. 2005). It is possible that dynein and

LIS-1 cooperate with CED-10 and other Rac regulators to mediate engulfment. However, it is

unlikely that the CED-10-dependent mechanism, which is necessary for engulfment, is the same

one responsible for neuronal synchronization and dynein-mediated GABAergic vesicle transport.

Indeed, null mutants of ced-2 and ced-5, both of which are important regulators of CED-10 in

engulfment (Ellis et al. 1991), exhibited wild-type sensitivities to the GABAA receptor

antagonist PTZ (Table 3.1). Thus, a unique and perhaps uncharacterized set of Rac regulators

could govern Rac and dynein activity in adult GABAergic neurons.

Perturbations of inhibitory GABA transmission can promote epileptic activity in a wide

range of model systems, including rodents (Delorey et al. 1998), zebrafish (Baraban et al. 2005),

Drosophila (Pavlidis et al. 1994; Guan et al. 2005), and C. elegans (Williams et al. 2004). These

studies underscore the utility of both mammalian and non-mammalian models to reveal cellular

effectors of neuronal activity (Locke et al. 2009). Accordingly, several reports from a variety of

animal models further implicate members of a Rac-signaling pathway in seizures and epilepsy.

Orthologs of dhc-1, lis-1, the functionally redundant Racs and Paks, ina-1, mig-15, unc-73, bicd-

1, and pes-7 are all expressed in GABA-enriched regions of the adult mouse brain (Lein et al.

2007). In addition, limbic seizures have been shown to result in increased expression levels of

integrin β 1 (Pinkstaff et al. 1998) and NIK (Arion et al. 2006), while integrins have been shown to modulate long-term potentiation in a mature hippocampus (Chan et al. 2006; Huang et al.

2006). Seizure-like activity in Drosophila has also been shown to induce α-integrin and trio

expression and to downregulate a Rac-GAP (Guan et al. 2005). Together with our own findings,

these data strongly suggest the plausibility of an evolutionarily conserved network of

cytoskeletal regulators that cooperate in the maintenance of a GABA-dependent seizure

threshold.

ACKNOWLEDGEMENTS

We thank all members of the Caldwell Laboratory, especially Laura Berkowitz, Lindsay

Faircloth, Stacey Fox, and David Agee for their collegiality and teamwork. Particular thanks also

go to Hwai-Jong Cheng, Gian Garriga, Yishi Jin, Erik Jorgensen, and Erik Lundquist for

donating C. elegans strains. All C. elegans mutants came from the Caenorhabditis Genetics

Center, which is funded by the National Institutes of Health National Center for Research

Resources. An Undergraduate Science Education Program grant from the Howard Hughes

Medical Institute supported the undergraduate researchers (K.P.B. and S.K.L.) involved in this

study. Additional support came from a National Science Foundation CAREER Award to G.A.C.

REFERENCES

Arion, D., Sabatini, M., Unger, T., Pastor, J., Alonso-Nanclares L., et al. (2006). Correlation of transcriptome profile with electrical activity in temporal lobe epilepsy. Neurobiol. Dis. 22, 374– 387.

Balasubramanian, N., Scott, D.W., Castel, J.D., Casanova, J.E. and Schwartz, M.A. (2007). Arf6 and microtubules in adhesion-dependent trafficking of lipid rafts. Nat. Cell Biol. 9, 1381–1391.

Baraban, S.C., Taylor, M.R., Castro P.A., and Baier, H. (2005). Pentylenetetrazole induced changes in zebrafish behavior, neural activity and c-fos expression. Neuroscience 131, 759–768.

Baum, P.D., and Garriga, G. (1997). Neuronal migrations and axon fasciculation are disrupted in ina-1 integrin mutants. Neuron 19, 51–62.

Brenner, S. (1974). The genetics of Caenorhabditis elegans. Genetics 77, 95–104.

Brill, J., Lee, M., Zhao, S., Fernald, R.D., and Huguenard, J.R. (2006). Chronic valproic acid treatment triggers increased neuropeptide y expression and signaling in rat nucleus reticularis thalami. J. Neurosci. 26, 6813–6822.

Buttner, E.A., Gil-Krzewska, A.J., Rajpurohit, A.K., Hunter, C.P. (2007). Progression from mitotic catastrophe to germ cell death in Caenorhabditis elegans lis-1 mutants requires the spindle checkpoint. Dev. Biol. 305, 397–410.

Cardoso, C., Leventer, R.J., Dowling, J.J., Ward, H.L., Chung, J., et al. (2002). Clinical and molecular basis of classical lissencephaly: mutations in the LIS1 gene (PAFAH1B1). Hum. Mutat. 19, 4–15.

Chan, C. S., Weeber, E.J., Zong L., Fuchs, E., Sweatt, J. D., et al. (2006). Beta 1-integrins are required for hippocampal AMPA receptor-dependent synaptic transmission, synaptic plasticity, and working memory. J. Neurosci. 26, 223–232.

Cobos, I., M. E. Calcagnotto, A. J. Vilaythong, M. T. Thwin, J. L. Noebels et al. (2005). Mice lacking Dlx1 show subtype-specific loss of interneurons, reduced inhibition and epilepsy. Nature Neurosci. 8, 1059–1068.

Cossette, P., Liu, L., Brisebois, K., Dong, H., Lortie, A., et al. (2002). Mutation of GABRA1 in an autosomal dominant form of juvenile myoclonic epilepsy. Nat. Genet. 31, 184–189.

Dalpé, G., Zhang, L.W., Zheng, H., Culotti. J. G. (2004). Conversion of cell movement responses to semaphorin-1 and plexin-1 from attraction to repulsion by lowered levels of specific RAC GTPases in C. elegans. Development 131, 2073–2088.

Dawe, A. L., Harris, P. M., Morris, N.R., and Caldwell, G. A. (2001). Evolutionarily conserved nuclear migration genes required for early embryonic development in Caenorhabditis elegans. Dev. Genes Evol. 211, 434–441. de Curtis, I. (2008) Functions of Rac GTPases during neuronal development. Dev. Neurosci. 30, 47–58.

DeLorey, T. M., Handforth, A., Anagnostaras, S.G., Homanics, G.E., Minassian, B.A., et al. (1998). Mice lacking the beta3 subunit of the GABAA receptor have the epilepsy phenotype and many of the behavioral characteristics of Angelman syndrome. J. Neurosci. 18, 8505–8514.

Dent, J.A., Smith, M.M., Vassilatis, D.K., and Avery, L. (2000). The genetics of ivermectin resistance in Caenorhabditis elegans. Proc. Natl. Acad. Sci. U. S. A 97, 2674–2679.

Di Cunto, F., Imarisio, S., Hirsch, E., Broccoli, V., Bulfone, A., et al. (2000). Defective neurogenesis in citron kinase knockout mice by altered cytokinesis and massive apoptosis. Neuron 28, 115–127.

Di Paolo, G., Sankaranarayanan, S., Wenk, M. R., Daniell, L., Perucco, E., et al. (2002). Decreased synaptic vesicle recycling efficiency and cognitive deficits in amphiphysin 1 knockout mice. Neuron 33, 789–804.

Ellis, R. E., Jacobson, D.M., and Horvitz, H.R. (1991). Genes required for the engulfment of cell corpses during programmed cell death in Caenorhabditis elegans. Genetics 129, 79–94.

Etter, A., Cully, D.F., Liu, K.K., Reiss, B., Vassilatis, D.K., et al. (1999). Picrotoxin blockade of invertebrate glutamate-gated chloride channels: subunit dependence and evidence for binding within the pore. J. Neurochem. 72, 318–326.

Fernandez, F., Morishita, W., Zuniga, E., Nguyen, J., Blank, M., et al. (2007). Pharmacotherapy for cognitive impairment in a mouse model of Down syndrome. Nature Neurosci. 10, 411–413.

Gitai, Z., Yu, T.W., Lundquist, E.A., Tessier-Lavigne, M., and Bargmann, C. I. (2003). The netrin receptor UNC-40/DCC stimulates axon attraction and outgrowth through enabled and, in parallel, Rac and UNC-115/AbLim. Neuron 37, 53–65.

Guan, Z., Saraswati, S., Adolfsen, B., and Littleton, J.T. (2005). Genome-wide transcriptional changes associated with enhanced activity in the Drosophila nervous system. Neuron 48, 91– 107.

Houalla, T., Hien Vuong, D., Ruan, W., Suter, B., and Rao, Y. (2005). The Ste20-like kinase misshapen functions together with Bicaudal-D and dynein in driving nuclear migration in the developing Drosophila eye. Mech. Dev. 122, 97–108.

Huang, R. Q., Bell-Horner, C.L., Dibas, M.I., Covey, D.F., Drewe, J.A., et al. (2001). Pentylenetetrazole-induced inhibition of recombinant gamma-aminobutyric acid type A (GABA (A)) receptors: mechanism and site of action. J. Pharmacol. Exp. Ther. 298, 986–995.

Huang, Z., Shimazu, K., Woo, N.H., Zang, K., Muller, U., et al. (2006). Distinct roles of the beta 1-class integrins at the developing and the mature hippocampal excitatory synapse. J. Neurosci. 26, 11208–11219.

Hunt-Newbury, R., Viveiros, R., Johnsen, R., Mah, A., Anastas, D. et al. (2007). High- throughput in vivo analysis of gene expression in Caenorhabditis elegans. PLoS Biol. 5, e237.

Jiang, G., Zhuang, L., Miyauchi, S., Miyake, K., Fei, Y.J. et al. (2005). A Na+/Cl− -coupled GABA transporter, GAT-1, from Caenorhabditis elegans: structural and functional features, specific expression in GABA-ergic neurons, and involvement in muscle function. J. Biol. Chem. 280, 2065–2077.

Jin, Y., Hoskins, R., and Horvitz, H.R. (1994). Control of type-D GABAergic neuron differentiation by C. elegans UNC-30 homeodomain protein. Nature 372, 780–783.

Kamath, R. S., Fraser, A.G., Dong, Y., Poulin, G., Durbin, R., et al. (2003). Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. Nature 421, 231–237.

Keane, J., and Avery, L. (2003). Mechanosensory inputs influence Caenorhabditis elegans pharyngeal activity via ivermectin sensitivity genes. Genetics 164, 153–162.

Keays, D. A., Tian, G., Poirier, K., Huang, G.J., Siebold, C., et al. (2007). Mutations in alpha- tubulin cause abnormal neuronal migration in mice and lissencephaly in humans. Cell 128, 45– 57.

Kholmanskikh, S. S., Dobrin, J.S., Wynshaw-Boris, A., Letourneau, P.C., and Ross, M.E (2003). Disregulated RhoGTPases and actin cytoskeleton contribute to the migration defect in Lis1- deficient neurons. J. Neurosci. 23, 8673–8681.

Kholmanskikh, S. S., Koeller, H.B., Wynshaw-Boris, A., Gomez, T., Letourneau, P.C., et al. (2006). Calcium-dependent interaction of Lis1 with IQGAP1 and Cdc42 promotes neuronal motility. Nature Neurosci. 9, 50–57.

Kinchen, J. M., Cabello, J., Klingele, D., Wong, K., Feichtinger, R., et al.(2005). Two pathways converge at CED-10 to mediate actin rearrangement and corpse removal in C. elegans. Nature 434, 93–99.

Kishore, R. S., and Sundaram, M.V. (2002). ced-10 Rac and mig-2 function redundantly and act with unc-73 trio to control the orientation of vulval cell divisions and migrations in Caenorhabditis elegans. Dev. Biol. 241, 339–348.

Knobel, K. M., Jorgensen, E.M., and Bastiani, M.J. (1999). Growth cones stall and collapse during axon outgrowth in Caenorhabditis elegans. Development 126, 4489–4498.

Koushika, S. P., Schaefer, A.M., Vincent, R., Willis, J, H., Bowerman, B., et al. (2004). Mutations in Caenorhabditis elegans cytoplasmic dynein components reveal specificity of neuronal retrograde cargo. J. Neurosci. 24, 3907–3916.

Lein, E. S., Hawrylycz, M.J., Ao, N., Ayres, M., Bensinger, A., et al.(2007). Genome-wide atlas of gene expression in the adult mouse brain. Nature 445, 168–176.

Locke, C. J., Williams, S.N., Schwarz, E.M., Caldwell, G.A., and Caldwell, K.A. (2006). Genetic interactions among cortical malformation genes that influence susceptibility to convulsions in C. elegans. Brain Res. 1120, 23–34.

Locke, C. J., Berry, K., Kautu, B., Lee, K., Caldwell, K., et al. (2008). Paradigms for pharmacological characterization of C. elegans synaptic transmission mutants. J. Vis. Exp. 18, 837.

Locke, C. J., Caldwell, K.A., and Caldwell, G.A. (2009). The nematode, C. elegans, as an emerging model of seizures and epilepsy, pp. 1–25 in Animal Models of Epilepsy: Methods and Innovations, edited by S. C. Baraban. Humana Press, Totowa, NJ.

Lo Nigro, C., Chong, C.S., Smith, A.C., Dobyns, W.B., Carrozzo, R., et al. (1997). Point mutations and an intragenic deletion in LIS1, the lissencephaly causative gene in isolated lissencephaly sequence and Miller-Dieker syndrome. Hum. Mol. Genet. 6, 157–164.

Lu, J., Sun,Q., Chen, X., Wang, H., Hu, Y et al. (2005). Identification of dynein light chain 2 as an interaction partner of p21-activated kinase 1. Biochem. Biophys. Res. Commun. 331, 153– 158.

Lucanic, M., Kiley, M., Ashcroft, N., L'Etoile, N., and Cheng, H.J. (2006). The Caenorhabditis elegans P21-activated kinases are differentially required for UNC-6/netrin-mediated commissural motor axon guidance. Development 133, 4549–4559.

Lundquist, E. A., Reddien, P.W., Hartwieg, E., Horvitz, H.R., and Bargmann, C.I. (2001) Three C. elegans Rac proteins and several alternative Rac regulators control axon guidance, cell migration, and apoptotic cell phagocytosis. Development 128, 4475–4488.

McEwen, J. M., Madison, J.M., Dybbs, M., and Kaplan, J.M. (2006). Antagonistic regulation of synaptic vesicle priming by Tomosyn and UNC-13. Neuron 51, 303–315.

McIntire, S. L., Jorgensen, E., and Horvitz, H.R. (1993). Genes required for GABA function in Caenorhabditis elegans. Nature 364, 334–337.

McMullan, R., Hiley, E., Morrison, P., and Nurrish, S.J. (2006). Rho is a presynaptic activator of neurotransmitter release at pre-existing synapses in C. elegans. Genes. Dev. 20, 65–76.

Menzel, N., Chari, A., Fischer, U., Linder, M., and Raabe, T. (2007). A 5′- fluorosulfonylbenzoyladenosine-based method to identify physiological substrates of a Drosophila p21-activated kinase. Anal. Biochem. 368, 178–184.

Miller, K. G., Alfonso, A., Nguyen, M., Crowell, J.A., Johnson, C.D., et al. (1996). A genetic selection for Caenorhabditis elegans synaptic transmission mutants. Proc. Natl. Acad. Sci. U. S. A. 93, 12593–12598.

Nguyen, M., Alfonso, A., Johnson, C.D., and Rand, J.B. (1995) Caenorhabditis elegans mutants resistant to inhibitors of acetylcholinesterase. Genetics 140, 527–535.

Nonet, M. L., Staunton, J.E., Kilgard, M.P., Fergestad, T., Hartwieg, E., et al. (1997). Caenorhabditis elegans rab-3 mutant synapses exhibit impaired function and are partially depleted of vesicles. J. Neurosci. 17, 8061–8073.

Nonet, M. L., Saifee, O., Zhao, H., Rand, J.B., and Wei, L. (1998). Synaptic transmission deficits in Caenorhabditis elegans synaptobrevin mutants. J. Neurosci. 18, 70–80.

Patel, L. S., Wenzel, H.J., and Schwartzkroin, P.A. (2004). Physiological and morphological characterization of dentate granule cells in the p35 knock-out mouse hippocampus: evidence for an epileptic circuit. J. Neurosci. 24, 9005–9014.

Pavlidis, P., Ramaswami, M., and Tanouye, M.A. (1994). The Drosophila easily shocked gene: a mutation in a phospholipids synthetic pathway causes seizure, neuronal failure, and paralysis. Cell 79, 23–33.

Pinkstaff, J. K., Lynch, G., and Gall, C.M. (1998). Localization and seizure-regulation of integrin beta 1 mRNA in adult rat brain. Brain Res. Mol. Brain Res. 55, 265–276.

Poinat, P., De Arcangelis, A., Sookhareea, S., Zhu, X., Hedgecock, E.M., et al. (2002). A conserved interaction between beta1 integrin/PAT-3 and Nck-interacting kinase/MIG-15 that mediates commissural axon navigation in C. elegans. Curr. Biol. 12, 622–631.

Rankin, C. H., and Wicks. S.R. (2000). Mutations of the Caenorhabditis elegans brain-specific inorganic phosphate transporter eat-4 affect habituation of the tap-withdrawal response without affecting the response itself. J. Neurosci. 20, 4337–4344.

Rehberg, M., Kleylein-Sohn, J., Faix, J., Ho, T.H., Schulz, I., et al. (2005). Dictyostelium LIS1 is a centrosomal protein required for microtubule/cell cortex interactions, nucleus/centrosome linkage, and actin dynamics. Mol. Biol. Cell. 16, 2759–2771.

Richmond, J. E., and Jorgensen, E.M. (1999). One GABA and two acetylcholine receptors function at the C. elegans neuromuscular junction. Nature Neurosci. 2, 791–797.

Robatzek, M., and Thomas. J.H. (2000). Calcium/calmodulin-dependent protein kinase II regulates Caenorhabditis elegans locomotion in concert with a G(o)/G(q) signaling network. Genetics 156, 1069–1082.

Sakamoto, R., Byrd, D.T., Brown, H.M., Hisamoto, N., Matsumoto, K., et al. (2005). The Caenorhabditis elegans UNC-14 RUN domain protein binds to the kinesin-1 and UNC-16 complex and regulates synaptic vesicle localization. Mol. Biol. Cell. 16, 483–496.

Schuske, K., A., Beg, A., and Jorgensen, E.M. (2004). The GABA nervous system in C. elegans. Trends Neurosci. 27, 407–414.

Shakir, M. A., J. S. Gill and E. A. Lundquist. (2006). Interactions of UNC-34 Enabled with Rac GTPases and the NIK kinase MIG-15 in Caenorhabditis elegans axon pathfinding and neuronal migration. Genetics 172¸893–913.

Steven, R., Kubiseski, T.J., Zheng, H., Kulkami, S., Mancillas, J., et al. (1998). UNC-73 activates the Rac GTPase and is required for cell and growth cone migrations in C. elegans. Cell 92, 785–795.

Steven, R., Zhang, L., Culotti, J., and Pawson, T. (2005). The UNC-73/Trio RhoGEF-2 domain is required in separate isoforms for the regulation of pharynx pumping and normal neurotransmission in C. elegans. Genes Dev. 19, 2016–2029.

Struckhoff, E. C., and Lundquist, E.A. (2003). The actin-binding protein UNC-115 is an effector of Rac signaling during axon pathfinding in C. elegans. Development 130, 693–704.

Sulston, J., Dew, M., and S. Brenner. (1975). Dopaminergic neurons in the nematode Caenorhabditis elegans. J. Comp. Neurol. 163, 215–226.

Tischler, J., Lehner, B., Chen, N., and Fraser, A.G. (2006). Combinatorial RNA interference in Caenorhabditis elegans reveals that redundancy between gene duplicates can be maintained for more than 80 million years of evolution. Genome Biol. 7, R69.

Vashlishan, A. B., Madison, J.M., Dybbs, M., Bai, J., Sieburth, D., et al. (2008) An RNAi screen identifies genes that regulate GABA synapses. Neuron 58: 346–361.

Wenzel, H. J., Robbins, C.A., Tsai, L.H., and Schwartzkroin, P.A. (2001). Abnormal morphological and functional organization of the hippocampus in a p35 mutant model of cortical dysplasia associated with spontaneous seizures. J. Neurosci. 21, 983–998.

Williams, S. L., Lutz, S., Charlie, N.K., Vettel, C., Ailion, M., et al. (2007) Trio's Rho-specific GEF domain is the missing Galpha q effector in C. elegans. Genes Dev. 21, 2731–2746.

Williams, S. N., Locke, C.J., Braden, A.L., Caldwell, K.A., Caldwell, G.A. (2004). Epileptic-like convulsions associated with LIS-1 in the cytoskeletal control of neurotransmitter signaling in Caenorhabditis elegans. Hum. Mol. Genet. 13, 2043–2059. Wu, Y. C., Cheng, T.W., Lee, M.C., and Weng, N.Y. (2002). Distinct rac activation pathways control Caenorhabditis elegans cell migration and axon outgrowth. Dev. Biol. 250, 145–155.

Xu, J., and Clancy, C.E. (2008). Ionic mechanisms of endogenous bursting in CA3 hippocampal pyramidal neurons: a model study. PLoS ONE 3, e2056.

Yang, Y., Lu, J., Rovnak, J., Quackenbush, S.L., and Lundquist, E.A. (2006). SWAN-1, a Caenorhabditis elegans WD repeat protein of the AN11 family, is a negative regulator of Rac GTPase function. Genetics 174, 1917–1932.

Zipkin, I. D., Kindt, R.M., and Kenyon, C.J. (1997). Role of a new Rho family member in cell migration and axon guidance in C. elegans. Cell 90, 883–894.

SUPPORTING REFERENCES

Hamamichi, S., Rivas, R.N., Knight, A.L., Cao, S., Caldwell, K.A., and Caldwell, G.A. (2008). Hypothesis-based RNAi screening identifies neuroprotective genes in a Parkinson’s disease model. Proc. Natl. Acad. Sci. U. S. A 105, 728-733.

Kamath, R. S., Fraser, A.G., Dong, Y., Poulin, G., Durbin, R., et al. (2003). Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. Nature 421, 231-237.

Knobel, K. M., Davis, W.S., Jorgensen, E.M., and Bastiani. M.J. (2001). UNC-119 suppresses axon branching in C. elegans. Development 128, 4079-4092.

Locke, C. J., Williams, S.N., Schwarz, E.M., Caldwell, G.A., and Caldwell, K.A. (2006). Genetic interactions among corticalmalformation genes that influence susceptibility to convulsions in C. elegans. Brain Res. 1120, 23-34.

Poinat, P., De Arcangelis, A., Sookhareea, S., Zhu, X., Hedgecock, E.M., et al. (2002). A conserved interaction between beta1integrin/PAT-3 and Nck-interacting kinase/MIG-15 that mediates commissural axon navigation in C. elegans. Curr. Biol. 12, 622-631.

100

SUPPORTING VIDEO FILES http://www.genetics.org/cgi/content/full/genetics.109.106880/DC1.

File S2: Representative GABA mutant with anterior convulsions in response to 10 mg/ml

PTZ. The strong mutant, unc-25(e156), is deficient in GABA synthesis and displays PTZ-

induced anterior convulsions. This movie is representative of the behavioral responses to PTZ

from all GABA mutant strains upon exposure to PTZ.

File S3: Rac GTPase, ced-10, mutant with anterior convulsions in response to 10 mg/ml

PTZ. The Rac gain-of-function mutant,ced-10(n3246), exhibits PTZ-induced anterior

convulsions. This behavioral response is reminiscent of GABA mutant convulsions.

File S4: Rac GTPase, mig-2, mutant with anterior convulsions in response to 10 mg/ml

PTZ. The Rac gain-of-function mutant,mig-2(gm103), exhibits PTZ-induced anterior convulsions. This behavioral response is reminiscent of GABA mutant convulsions.

File S5: Rac GTPase regulator mutant, ina-1, with anterior convulsions in response to 10 mg/ml PTZ. The Rac regulator mutant, ina-1(gm39), is deficient in integrin activation and displays PTZ-induced anterior convulsions. This behavioral response mimics those of Rac gain- of-function and GABA mutants in the presence of PTZ.

File S6: Rac GTPase regulator mutant, mig-15, with anterior convulsions in response to

10 mg/ml PTZ. The Rac regulator mutant, mig-15(rh80), is deficient in integrin-mediated kinase activity and displays PTZ-induced anterior convulsions. This behavioral response mimics those of Rac gain-of-function and GABA mutants in the presence of PTZ.

101

File S7: Rac GTPase regulator mutant, unc-73, with anterior convulsions in response to

10 mg/ml PTZ. The Rac regulator mutant, unc-73(e936), fails to activate redundant Racs and

demonstrates PTZ-induced anterior convulsions. This behavioral response is reminiscent of Rac

gain-of-function and GABA mutant convulsions.

File S8: Representative general synaptic transmission mutant with anterior convulsions in

response to 10 mg/ml PTZ. The mutant, rab-3(y251), is deficient in synaptic vesicle targeting and, as a result, general synaptic transmission. This mutant exhibits PTZ-induced anterior convulsions that are reminiscent of Rac gain-of-function and GABA mutant convulsions. This movie is representative of the behavioral responses to PTZ from other general synaptic transmission mutant strains upon exposure to PTZ.

File S9: Triple glutamate-gated chloride channel mutant with anterior convulsions in response to 10 mg/ml PTZ. A triple glutamate-gated chloride channel mutant [avr-14(ad1302); avr-15(ad1051) glc-1(pk54)] is deficient in inhibitory glutamate transmission at the nerve ring and demonstrates PTZ-induced anterior convulsions. This behavioral response is reminiscent of

Rac gain-of-function and GABA mutant convulsions, but is less frequent and intense.

File S10: Heterotrimeric G protein signaling mutant, egl-10, with anterior convulsions in response to 10 mg/ml PTZ

102

CHAPTER 4

MODULATION OF DOPAMINERGIC NEUROPROTECTION BY THE CANONICAL GALPHAQ SIGNALING PATHWAY IN A C. ELEGANS MODEL OF PARKINSON’S DISEASE

This work is currently in preparation for publication. Bwarenaba Kautu conceived the ideas for the project, designed and performed all experiments, analyzed all the data, and wrote the manuscript. Matthew Hicks provided technical support, performed some experiments and contributed ideas to the project. Guy Caldwell and Kim Caldwell co-wrote the manuscript, took images of worms, and made the graphs and figures.

103

ABSTRACT

Signal transduction pathways are important for conferring cellular identity such as cell

survival. Gαq signaling is a well-studied pathway of the nervous system. However, whether this

pathway plays a role in modulation of dopaminergic neuron survival remains to be determined.

Here, we provide genetic evidence that the C. elegans canonical heterotrimeric Gαq (EGL-30)

signaling pathway modulates the protection of dopaminergic neurons against a human

Parkinson’s protein, α-synuclein (α-Syn). Our genetic analyses also indicate that Gαq EGL-30

downstream signal transducers EGL-8 PLC-β and PKC-1(PKC-ε) exacerbated α-Syn-induced

neurodegeneration when knocked down by RNAi in the dopaminergic neurons. Furthermore,

congruent with the well-established linear interaction of Gαq signaling and ERK-MAPK in mammalian dopaminergic neurons, we found that the knocking down the C. elegans ortholog of

ERK-MAPK, MPK-1, enhanced neurodegeneration in the overexpression of α-Syn. Consistent with previously known roles of Gαq in the C. elegans nervous system, we revealed through genetic analysis that the ability of Gαq to protect dopaminergic neurons is negatively regulated by another heterotrimeric G protein Gαo (GOA-1). Knocking down the C. elegans IP3 receptor

homolog (itr-1) in the dopaminergic neurons did not significantly alter the integrity of

dopaminergic neurons in the presence of α-Syn, suggesting that ITR-1 may either act redundantly with other proteins, downstream of Gαq to affect neurodegeneration, or does not play a role in this neuroprotective pathway. These data suggest that activation of Gαq signaling pathway confers protection of the dopaminergic neurons against α-Syn insult.

INTRODUCTION

Degeneration of dopaminergic neurons is a cellular hallmark of Parkinson’s disease (PD).

Clinical studies have revealed a number of human proteins that may be influential in the

104

degeneration of dopaminergic neurons in PD patients. For instance, one of the first proteins

linked to PD is alpha-Synuclein (α-Syn), a principal component of Lewy bodies found in the

neurons of PD patients (Spillantini et al. 1998). Genetic studies showed that multiplication, as well as point mutations of the α-Syn (SCNA) gene cause PD (Polymeropoulos et al. 1997;

Singleton et al. 2003). Moreover, studies using animal models of PD demonstrated that overexpression of α-Syn can cause degeneration of dopaminergic neurons (Lasko et al. 2003;

Bayersdorfer et al. 2010).

In connection with the aforementioned findings, genetic screens conducted in model organisms have led to the identifications of a number of genetic factors that modify the toxicity of α-Syn in dopaminergic neurons (Hamamichi et al. 2008). The results of these findings are paramount because they suggest the possible existence of dopamine pathways or signaling mechanisms in the cell that may be involved in modulating the survival of dopaminergic neurons against α-Syn insult. Accordingly, since α-Syn is also a synaptic protein (George, 2002), it has been suggested that mutation, or overexpression, of the α-Syn gene may interfere with basic dopamine synaptic transmission mechanisms, leading to anatomical deterioration of the dopaminergic neurons (Mosharov et al. 2006; Cao et al. 2010; Kurz et al. 2010; Nemani et al.

2010; Schulz-Schaeffer, 2010). In light of this knowledge, we put forth a hypothesis that certain proteins involved in dopamine signaling pathways may modulate the survival of dopaminergic neurons against α-Syn toxicity.

In vertebrate and invertebrate organisms one aspect of dopamine signaling is mediated by heterotrimeric G proteins. Heterotrimeric G proteins are GTPases that couple to G protein coupled receptors (GPCRs), and are both expressed, and functional, in the dopaminergic neurons. For instance, early work on dopamine signaling in the mammalian brain asserts that

105

Gαs protein activates cyclic-AMP (cAMP), Gαi inactivates cAMP, while Gαq activates a

phospholipase enzyme PLC-β which leads to the production of diacylglyerol (DAG) and inositol

1, 4, 5-trisphosphate (IP3), all of which act in the cell respectively to generate cellular responses by affecting downstream proteins, and ultimately transcription (Missale et al. 1998; Yan et al.

1999). Similarly, in C. elegans, heterotrimeric G proteins also appear to be important for dopamine signaling and behavior. In particular, only two heterotrimeric G proteins have so far been implicated in dopamine signaling in C. elegans. For instance, Gαq and Gαo have been implicated in regulating C. elegans dopamine-mediated locomotion, and tap habituation behaviors (Chase et al. 2004; Kindt et al. 2007). These G proteins are ubiquitously expressed throughout the nervous system of C. elegans, and are thought to be involved in many vital functions of the nervous system (Miller et al. 1999). In fact, large bodies of work from C. elegans neurobiologists have led to the identification and, thus, construction of the canonical pathway associated with Gαq and Gαo signaling in the nervous system of C. elegans. Hence, we are taking advantage of this already well-established body of knowledge to investigate the impact of Gαq signaling and Gαo with respect to degeneration of the dopaminergic neurons of C. elegans.

Unraveling the genetic/molecular basis of dopaminergic cell neurodegeneration using C. elegans is perhaps a more amenable problem. C. elegans is a genetically tractable organism whose entire nervous system is completely mapped, and has been further refined by advanced microscopy, behavioral, and pharmacological methods. Of the entire 302 neurons of the hermaphrodite animal, exactly eight of them are dopaminergic neurons (Sulston et al. 1975).

These neurons can be easily highlighted with fluorescent markers such as the Green Fluorescent

Protein (GFP), exhibiting great visibility under a fluorescent microscope. Moreover, any

106

architectural alteration associated with the dopaminergic neurons that occur over the course of

aging can be continually monitored and quantified easily using well-established microscopy

techniques and protocols. In addition, the C. elegans genome is completely sequenced, and

contains homologs of many human disease genes, further affirming the role of this nematode as

an effective biomedical research organism.

Our PD model overexpresses human α-Syn in all eight dopaminergic neurons of C.

elegans, which results in the age-and dose-dependent degeneration of these cells (Cao et al.

2005; Hamamichi et al. 2008). Our findings showed that the C. elegans canonical Gαq signaling modulates protection of dopaminerginc neurons and that the action of this pathway is negatively regulated by Gαo. Moreover, consistent with previously established interactions of Gαq signaling and ERK-MAPK, we revealed that the C. elegans ortholog of ERK-MAPK, MPK-1, also acts in the C. elegans dopaminergic neurons to promote neuroprotection. In our mechanistic study using H4 neuroglioma cells, we demonstrated that Gαq expression can significantly suppress α-Syn inclusions. Thus, our work suggests that modulation of heterotrimeric Gαq signaling may potentially offer a therapeutic avenue for the treatment of PD and, perhaps other neurodegenerative diseases. Moreover, since approximately 40 percent of FDA-approved drugs in the market target G protein-coupled receptor signaling, we believe that our work will help to accelerate the discovery of FDA-approved compounds that can be tested immediately for the treatment of PD.

MATERIALS/METHODS

Worm strains and maintenance: The following strains were used in this study: elg-

8(md197,) egl-30(n686), egl-30(n715), egl-30(ep271), goa-1(sa734), egl-10(md176), pkc-

1(ok563), pkc-2(ok328), pkc-3(ok544)/mIn1[dpy-10(e128)mIs14], UA44 baIn11 [Pdat-1::α-syn,

107

Pdat-1::GFP], UA195 [sid-1(pk3321); baIn33 (Pdat-1::sid-1, Pmyo-2::mCherry)], UA196 [sid-

1(pk3321); baIn11; baIn33]. All mutant strains were obtained from Caenorhabditis Genetics

Center. All strains were kept and maintained at 20oC, and according to standard procedures

(Brenner, 1974).

Genetic crosses and mutant studies: egl-8, egl-30, goa-1, egl-10, pkc-1, pkc-2, pkc-3 mutants were individually crossed into the UA44 strain and allele transmission for most of these mutants was selected using well-characterized phenotypes associated with the mutations (i.e, uncoordination, hyperactivity, vulva protrusions, hypersensitivity /resistance to exogenous dopamine and aldicarb), as well as the presence of GFP in the dopaminergic neurons. However, pkc-1 and pkc-2 mutants do not have obvious phenotypes. Therefore, these mutations were confirmed by PCR analysis. The following primers were used for confirming pkc-1 (ok563) mutants: Primer 1 TCCTTGATGTACTCCCGACT and Primer 2

CCCAATAGGCGACGACAAC. The following primers were used to confirm pkc-2 (ok328) mutants: Primer 1 GCATTTGTTCGTCGTCGTGGTGC and Primer 2

CAGACCGACGGCAATTTCAG. Each mutant was crossed to homozygosity with UA44.

Analysis of dopaminergic neurodegeneration: To visualize dopaminergic neurons, worms were mounted on a 2% agarose pad and were immobilized with 3mM levamisole. The neurons were examined using a Nikon Eclipse E800 epifluorescence microscope equipped with GFP filter. A worm was scored as normal when all six anterior dopaminergic neurons and processes were intact. A worm was scored as degenerating when at least one of six anterior cell bodies and/or processes were lost.

Cell-specific RNA interference: RNA interference (RNAi) by bacterial feeding was performed in the UA196 strain background according to the method described by Locke and

108

Kautu et al. 2009. The cell-specific RNAi strain (UA196) was generated from a cross between

UA195 [sid-1(pk3321); baIn33 (Pdat-1::sid-1, Pmyo-2::mCherry)] and UA44 [baIn11(Pdat-1::

α-syn, Pdat-1::GFP)] animals. UA195 animals carry an overexpression of the double-stranded

RNA transporter SID-1, driven under Pdat-1 promoter. This construct was injected into a sid-1 null mutant animal, thus rendering the dopaminergic neurons sensitive to RNAi only (Harrington et al. 2012). UA44 animals express α-syn in the dopaminergic neurons. All RNAi clones for egl-

8, egl-30, pkc-1, pkc-3, mek-2, and mpk-1 were obtained from a comprehensive C. elegans RNAi

library (MRC Cambridge UK) (Kamath et al. 2003). These RNAi clones were used to knock

down the corresponding genes in UA196 animals. The RNAi empty vector (L4440) was used as

a negative control for all RNAi experiments.

Statistical analysis: Fisher’s Exact Test was used to analyze all experimental data sets for

neurodegeneration assay (http://www.langsrud.com/fisher.htm). Results of two-tail p-values

were generated by comparing two different data sets (i.e control animals vs RNAi-treated or

mutant animals). All data are shown with ± mean of standard deviations and were significant, if

p < 0.05.

RESULTS

Activation of Gαq (EGL-30) protects the C. elegans dopaminergic neurons

egl-30 encodes the C. elegans ortholog of vertebrate Gαq or Gq11 (Brundage et al.

1996). Gαq is widely expressed in the nervous system of vertebrate and invertebrate animals.

Dissociation of Gαq from GPCR leads to the activation of a phospholipase enzyme PLC-β,

which hydrolyzes Phosphatidylinositol (4, 5)-bisphosphate (PIP2) to generate diacylglyerol

(DAG) and inositol 1, 4, 5-trisphosphate (IP3) (Brundage et al. 1996; Missale et al. 1998; Yan et

al. 1998; Miller et al. 1999). Gαq plays diverse roles in the nervous system, including regulation

109

of dopamine signaling (Yan et al. 1999; Chase et al. 2004; Kindt et al. 2007). Therefore, we

wanted to test if Gαq plays a role in the degeneration or protection of dopaminergic neurons. To

test this hypothesis we crossed reduction-of-function mutants of egl-30(n686) (Hawasli et al.

2004) with animals overexpressing α-Syn in dopaminergic neurons. The α-Syn worms exhibit dopaminergic neurodegeneration; this degenerating is age-dependent and worms were analyzed during this time course at both 4 and 7 days of age when the amount of degeneration becomes significantly enhanced. Specifically, at 4 days, only 37.7% of worms display WT neurons, while at 7 days, only 15.5% of worms exhibit WT neurons neurons. The egl-30(n686) allele

significantly enhanced neurodegeneration at day-4 (Fig.4.1A;D) in the presence of α-Syn,

whereby only 10% of the population of animals from α-Syn; egl-30 (n686) animals have normal

DA neurons compared to 37% with α-Syn animals alone (Fig. 4.1A;C). At day-7, there was no

significant difference between α-Syn animals and α-Syn; egl-30(n686) mutants (Fig. 4.1A). This

could possibly due to the fact that most α-Syn animals already display severe neurodegeneration at day-7 and therefore it may not be possible to see a big difference at this stage. However, our data from day-4 adult animals suggests that endogenous levels of EGL-30 offered significant protection of the dopaminergic neurons against α-Syn. To further support this hypothesis, we also analyzed a gain-of-function egl-30 (ep271) allele (Fig. 4.1A; E), which causes a constitutively active EGL-30 (Fitzgerald et al. 2006). Our data showed that the dopaminergic

neurons in α-Syn; egl-30 (ep271) animals were significantly protected vs. α-Syn alone animals

(76.6% vs. 37.7%) at day-4, and 34.4% vs 15.5% at day-7. (Fig. 4.1A). These results confirm that activation of EGL-30 protects the dopaminergic neurons from α-Syn insult.

110

Figure 4.1 Activation of Gαq (EGL-30) protects the C. elegans dopaminergic neurons against α- Syn. Reduction of function egl-30 (n686) and gain-of-function egl-30 (ep271) animals were crossed individually with α-Syn animals. egl-30 (n686); α-Syn reduction of function animals showed enhanced neurodgeneration (4D) in comparison the the control animals (4A).

111

Loss of egl-8 and pkc-1 enhanced degeneration of C. elegans dopaminergic neurons in the presence of α-Syn

In the C. elegans nervous system the downstream factors of egl-30 are egl-8 and pkc

(Miller et al. 1999; Lackner et al. 1999; Kindt et al. 2007). egl-8 encodes the C. elegans ortholog

of PLC-β (Trent et al. 1983; Lackner et al. 1999; Miller et al. 1999), while pkc encodes Protein

Kinase C isoforms (Tabuse, 2002). Gαq functions upstream of PLC- β and PKC in mammalian

dopaminergic neuron signal transduction (Yan et al. 1999). With respect to dopamine signaling

in C. elegans, it has been shown that egl-30 function upstream of egl-8 and a specific Protein

Kinase C isoform, pkc-1(C. elegans ortholog of mammalian PKC-ε) in the regulation of dopamine-mediated tap habituation behavior (Kindt et al. 2007). Based on this knowledge, we hypothesize that egl-8 and pkc-1 may also function downstream of egl-30 to positively regulate neuroprotection. To test this hypothesis, we analyzed the dopaminergic neurons of egl-8(md197) and pkc-1(ok563), loss-of-function mutants in the presence of α-Syn overexpression. Our results showed that α-Syn; egl-8(md197) and α-Syn; pkc-1(ok563), mutant animals displayed enhanced dopaminergic neurodegeneration in comparison to α-Syn animals alone. For example, at day-4, only 3.3% of α-Syn; egl-8 (md197) animals displayed non-degenerating dopaminergic neurons and 1.1% at day-7 compared to 37.7% and 15.5 % in α-Syn animals respectively. For α-Syn; pkc-1(ok563) animals, only 5.5% of these animals have WT DA neurons at day-4, and 2.2% at day-7. These data suggest that EGL-8 and PKC-1 act in a common pathway with EGL-30 to protect the dopaminergic neurons (Fig. 4.2). Interestingly, we also analyzed another pkc allele, pkc-2 which encodes a protein orthologous to the conventional mammalian PKC-α (Kindt et al.

2007), and found that pkc-2(ok328) deletion mutants also significantly enhanced neurodegeneration of dopaminergic neurons (Fig. 4.3). The results of these findings imply that

Gαq signaling acts in the dopaminergic neurons to confer neuroprotection.

112

Figure 4.2 Inactivations of egl-8 and pkc-1 enhanced degeneration of dopaminergic neurons in the presence of α-Syn. Animals of pkc-1 and egl-8 mutants (crossed with α-Syn) showed enhanced degeneration at both day-4 and day-7. The percentage of degeneration in these animals was compared to α-Syn animals.

113

Figure 4.3 Inactivation of pkc-2 exacerbated degeneration of dopaminergic neurons in the overexpressed α-Syn animals. The levels of degeneration were compared at both day-4 and day- 7 respectively.

114

EGL-30 EGL-8 and PKC-1 act in the C. elegans dopaminergic neurons to provide protection

The results of our analyses with egl-30, egl-8, and pkc-1 mutants imply that the products of these genes may exist or act in the cell to provide some protection for the dopaminergic neurons. The next logical route of investigation is to examine the site of actions for these genes.

To address this question we performed cell-specific RNAi to deplete these genes in the dopaminergic neurons. In our RNAi experiments, we used the strain UA196, which expresses

SID-1 genomic DNA in the dopaminergic neurons of sid-1 mutants, thus directing RNAi in the dopaminergic neurons only (Harrington et al. 2012). This particular strain also carries α-Syn overexpressed in the dopaminergic neurons under a dopamine-specific (Pdat-1) promoter. Our results showed that cell-specific depletions of egl-30, egl-8, and pkc-1 in the dopaminergic neurons all enhanced neurodegeneration (Fig 4.4). Specifically, RNAi of egl-30, egl-8, and pkc-1 in the α-Syn background resulted in 23.3%, 22.2%, and 5.5% of the animals with normal dopaminergic neurons. In comparison, α-Syn alone in this RNAi strain (which was knocked down with a control L4440 vector) had 55.5% of nomal dopaminergic neurons. In this particular experiment, we chose to portray our data for day-4 adult animals because the difference in severity of neurodegeneration between control animals and RNAi animals is resolved better at this age of animals with RNAi. These results are consistent with the mutant phenotypes.

Interestingly, we additionally observed that the pkc-1 RNAi animals displayed a greater degree of neurodegeneration (94.5%) than egl-30 and egl-8 RNAi animals (76.7% and 77.8%) suggesting that pkc-1 may act on multiple downstream signaling factors to mediate neuroprotection in the C. elegans dopaminergic neurons (p is less than 0.05 for both

115

Figure 4.4 Cell-specific depletions of egl-30, pkc-1 and egl-8 in the dopaminergic neurons. Knockdown of Gαq signaling cascade exacerbated the effect of α-Syn on the dopaminergic neurons which is evident by increased neurodegeneration in UA196 animals when these genes are knocked down individually.

116

comparisons). This result is not surprising since PKCs are known to phosphorylate a

plethora of proteins.

C. elegans ERK-MAPK ortholog acts in the dopaminergic neurons to modulate neuroprotection

In the mammalian dopaminergic neurons, Gαq, PLC-β, and PKC act in a linear pathway to activate ERK-MAPK in the relay of signal transduction events (Yan et al. 1998). Similarly, in the C. elegans nervous system, PKC-1 functions with the ortholog of ERK-MAPK, MPK-1, to mediate mechanosensory response (Hyde et al. 2011). We, therefore, hypothesize that ERK-

MAPK or MPK-1 may also act in a common pathway with Gαq signaling to modulate

neuroprotection in the dopaminergic neurons. To test this hypothesis, we used cell-specific RNAi to deplete mpk-1 (ERK-MAPK) and mek-2 (encodes an upstream regulator of mpk-1, MEK-2 or

MAP2K), in the dopaminergic neurons of C. elegans. Our results showed that cell-specific knockdown of mpk-1 and mek-2 in the dopaminergic neurons significantly enhanced neurodegeneration (Fig. 4.5). In contrast to α-Syn alone, we found that knockdown of mpk-1 and mek-2 in α-Syn resulted in populations of worms with 23.3% and 18.8% of normal dopaminergic neurons. These data were consistent with the phenotypes of egl-30, egl-8, and pkc-1 RNAi- depleted animals. This result asserts that mpk-1 and mek-2 act in a common pathway with Gαq signaling in the dopaminergic neurons of C. elegans to provide neuroprotection against α-Syn. In fact, we found that combinatorial RNAi knockdown of pkc-1 and mpk-1 produced a non-additive phenotype (Fig 4.6) suggesting that the product of these two genes likely function in a linear pathway to modulate neuroprotection.

117

Figure 4.5 Knockdown of ERK-MAPK signaling in the dopaminergic neurons. ERK-MAPK knockdown exacerbated the level of neurodegeneration in UA196 animals

118

Figure 4.6 Combinatorial knockdowns of pkc-1 and mpk-1 in the dopaminergic neurons. Knockdown of both genes did not synergistically increase neurodgeneration but seemed to reverse it back to mpk-1 degeneration levels.

119

Gαo negatively regulates Gαq with respect to degeneration of dopaminergic neurons of C. elegans

In the C. elegans nervous system, it is well established from studies of neurotransmission

that Gαq is negatively regulated by another heterotrimeric G protein, Gαo (Miller et al. 1999). In

contrast, an analysis of dopamine transmission in C. elegans suggested that Gαq and Gαo

antagonize each other to regulate locomotion (Chase et al. 2005). Therefore, to determine the

relationship between Gαq and Gαo in the context of α-Syn-mediated dopaminergic cell neurodegeneration, we analyzed the dopaminergic neurons of goa-1(sa734) null mutant animals first, and then subsequently analyzed egl-30;goa-1 doubly mutant animals. In our analysis, we found that goa-1 animals were significantly neuroprotected (Figure 4.7 A; C). Worms expressing α-Syn alone at day- 4 display 37.7% normal dopaminergic neurons while α-Syn; goa-

1 animals exhibited 65.5% normal DA neurons, and a similar trend was seen with day-7 adult animals (Figure 4.7 A). This protection is the opposite of what we saw with egl-30 reduction- of-function mutants and suggests that egl-30 and goa-1 either act antagonistically, or one acts to negatively regulate the other. If egl-30 and goa-1 were to antagonize each other, the prediction would be that α-Syn; egl-30; goa-1 reduction/loss-of-function doubly mutants would exhibit a similar level of neuroprotection as α-Syn animals alone (approximately 37.7% at day-4, and

15.5% at day-7). However, the results of our double mutant analysis showed that α-Syn; egl-

30;goa-1 animals exhibited enhanced neurodegeneration whereby only 10% of worms were normal (Fig. 4.7 B). This result is consistent with what we previously observed with α-Syn; egl-

30 animals (i.e enhanced neurodegeneration), suggesting that the egl-30 masked the phenotype of goa-1 allele (Figure 4.7B). We interpret that in this genetic pathway, the presence or activation of GOA-1 represses the downstream neuroprotective factor EGL-30. Interestingly, we also found that inactivation of a putative negative regulator of GOA-1, EGL-10 (RGS protein) by

120

Figure 4.7 goa-1 null mutant animals showed significant protection of dopaminergic neurons in the overexpression of α-Syn (4.7A), at both day-4, and day-7. A doubly mutant animal created by crossing goa-1 with egl-30 mutants, on the other hand showed enhanced neurodegeneration of DA neurons (4.7B)

121

a loss-of-function mutation (Miller et al 1999; Koelle and Horvitz, 1996) also resulted in enhanced neurodegeneration of DA neurons in α-Syn animals (10% of α-Syn;egl-10 day-4 adult animals have normal DA neurons, and 2.2% in day-7 animals) (Fig. 4.8). EGL-10 is the C. elegans ortholog of the mammalian protein RGS7, a regulator of G protein that functions upstream of both GOA-1 and EGL-30 in the C. elegans nervous system (Miller et al 1999;

Koelle and Horvitz, 1996). This result suggests that perhaps activation of GOA-1 negatively impacts the downstream neuroprotective factor EGL-30, thus exacerbating neurodegeneration.

However, we also think that there may be other additional downstream targets of GOA-1, as previous studies have shown that GOA-1 negatively regulates the levels of DAG independent of

EGL-30 (reviewed by Hiley et al. 2006).

122

Figure 4.8 Inactivation of a negative regulator of GOA-1. Loss-of-function of egl-10 (RGS protein that negatively regulates GOA-1) exacerbated dopaminergic neurodegeneration in the presence of α-Syn.

123

DISCUSSION

In this study, we provide evidence that the canonical Gαq signaling pathway modulates

protection of dopaminergic neurons of C. elegans in the presence of α-Syn. Our findings showed that EGL-30 Gαq downstream signal transducers EGL-8 and PKC-1 are involved in protection of dopaminergic neurons. Consistent with previously confirmed interactions of Gαq and Gαo in the

C. elegans nervous system, we revealed in our double mutant analysis that goa-1 negatively regulates egl-30, with respect to neurodegeneration. Moreover, we showed that a downstream factor of Gαq signaling in the dopaminergic neurons, ERK-MAPK, also plays a role in the protection of C. elegans dopaminergic neurons

The heterotrimeric G proteins Gαo and Gαq act in a diverse manner to control a variety of cellular functions of the nervous system. This is consistent with the fact that these G proteins are abundantly expressed in nervous tissues. Interestingly, in C. elegans the homologs of human

Gαo and Gαq display more than 80% similarities at a protein level to their human counterparts, suggesting that their functions are highly conserved across species (Lochrie et al. 1991;

Brundage et al. 1996). However, literature shows that there is not much known about the role of these G proteins in neurodegeneration or neuroprotection. Despite that, a number of studies performed in cell culture, as well as animal models of neurodegenerative diseases, have provided some clues that point to the possible involvement of Gαq signaling in protection of the nervous system against insults. For instance, numerous studies indicated that some downstream components of Gαq signaling are essential for protection of the nervous system against cell death or neurodegeneration. For instance, studies using immortalized hippocampal cell lines showed that PKC and ERK act in a linear pathway, to protect nerve cells from oxidative-induced cell death (Maher et al. 2001). Moreover, in one recent study using a mouse model of Alzheimer’s

124

disease, it was demonstrated that activation of PKC-ε can prevent synaptic loss, Aβ accumulation and cognitive deficits (Hongpaisan et al. 2011). The results of these studies revealed that downstream components of Gαq perhaps play an important role in the protection of the nervous system in general. Similarly, using an in vivo model of PD, we showed that these same downstream effectors are involved in protection of the dopaminergic neurons against α-Syn

insult.

Our findings suggest that there may be a functional link between Gαq signaling and α-

Syn or PD. This hypothesis is supported by two important findings from mammalian neuronal

studies. Firstly, Gαq functions downstream of D2 receptor to modulate signal transduction via

PLC-β, DAG, PKC, and ERK-MAPK (Yan et al. 1999). This shows that Gαq signaling may

indeed play an important role in regulating various aspects of dopamine signaling and

homeostasis. Perhaps Gαq signaling pathway may functionally interact with α-Syn. In fact, there is evidence from mammalian studies that α-Syn binds PKC-ε (C. elegans PKC-1), PKC-α (C. elegans PKC-2), and ERK-MAPK (Ostrerova et al. 1999). In this study, it was shown that the binding of α-Syn to PKC caused PKC inhibition. In 2001, Iwata and colleagues also showed that

α-Syn inhibits ERK-MAPK causing enhanced cell death (Iwata et al. 2001). These findings in mammalian cells are consistent with our in vivo results and may explain why inactivations of pkc and mpk-1enhanced the degeneration of dopaminergic neurons in α-Syn animals. Future studies will investigate the functional or biochemical link between α-Syn and Gαq.

The enhanced neurodegeneration phenotype seen with inactivation or depletions of egl-

30, egl-8, and pkc-1 in the dopaminergic neurons implies that these genes act in a common

pathway to promote neuroprotection against α-Syn toxicity. We think, however, that there are

other downstream factors affected by Gαq signaling module because the level of enhanced

125

neurodegeneration conferred by inactivation of pkc-1 is significantly greater than that of egl-30,

egl-8, and mpk-1 mutants or RNAi phenotypes. This hypothesis is in agreement with multiple

lines of evidence from the literature, which demonstrates that PKC can phosphorylate a plethora

of proteins.

Another downstream effector of Gαq-PLCβ is IP3. In the mammalian dopaminergic

neurons, upon activation of Gαq by a D2 dopamine receptor, two second messengers are

generated, DAG and IP3. DAG activates Protein Kinase C, which in turn activates ERK-MAPK through phosphorylation of MEK-2, while IP3 triggers calcium release (Yan et al. 1999). Our

results showed that cell-specific depletion of IP3 receptor homolog, ITR-1 in the dopaminergic

neurons did not significantly affect the survival of dopaminergic neurons in the presence of α-

Syn (Fig. 4.9). This suggests that ITR-1 may either act redundantly with other molecules to

affect neurodegeneration, or it is possible that it may not be involved in this neuroprotective pathway. However, it is also possible that our techniques in this study may not be sensitive enough for assaying the function of ITR-1 in the dopaminergic neurons.

In our findings, we also showed that ERK-MAPK (MPK-1) acts in the dopaminergic neurons to confer neuroprotection. The fact that cell-specific depletions of mek-2 and mpk-1 in the dopaminergic neurons conferred enhanced neurodegeneration suggests that ERK-MAPK acts in a common pathway with Gαq signaling to positively regulate neuroprotection. We chose to investigate the role of ERK-MAPK in C. elegans, in conjunction with Gαq signaling because it is well established through biochemical studies that activation of ERK-MAPK in the dopaminergic neurons is dependent upon Gαq signaling (Yan et al. 1999). Early studies in the mammalian brain using brain slices from rats and mice revealed that upon activation of Gαq MEK-2 becomes phosphorylated by Protein Kinase C, which in turn phosphorylates ERK-MAPK to modulate

126

Figure 4.9 Cell-specific knockdown of itr-1 (IP3 receptor homolog) did not significantly alter the levels of neurodegeneration in UA196 animals. Neurodegeneration analyses were performed in both day-4 and day-7 adult animals.

127

gene transcription (Yan et al. 1999). Interestingly, this interaction between Gαq signaling

module and ERK-MAPK appears to be very well conserved in C. elegans because recent studies

have shown that PKC-1 in fact interacts with ERK-MAPK in the C. elegans nervous system to mediate mechanosensory response (Hyde et al. 2011). In another study using C. elegans, it was also revealed that Gαq activates MPK-1 through PKC during C. elegans starvation, further asserting the conserved relationship between Gαq and ERK-MAPK (You et al. 2006).

Accordingly, our data also indicates that combinatorial dopaminergic cell-specific RNAi against mpk-1 and pkc-1 neither produce an additive nor synergistic effect on neurodegeneration, implying that the products of these genes may act in a linear pathway to mediate neuroprotection

(Fig 4.6).

Why do the dopaminergic cells require a negative regulation input on Gαq using another heterotrimeric G protein? A number of studies have shown that Gαq activity can be modulated by a number of ligands, including neurotransmitters, hormones, and neuropeptides via GPCRs

(Miller et al. 1999). If the activity of Gαq can be controlled by such factors, why is there a need for the dopaminergic neurons to add a negative regulation input on Gαq? One possible explanation for this is that it gives the dopaminergic neurons a control mechanism, perhaps within its own reach, to produce the proper amount of protection without causing unintended consequences to the cell. More study is needed to address whether the control mechanism is cell autonomous, or cell non-autonomous in nature.

Therefore, on the basis of these results, we propose a model whereby Gαq signaling acts with ERK-MAPK to protect dopaminergic neurons against α-Syn toxicity. Our model also proposes that the ability of Gαq to protect the dopaminergic neurons is negatively controlled by

Gαo. In this study, we were unable to identify GPCRs functioning upstream of Gαq or Gαo in

128

the context of neurodegeneration. Future studies will focus on identifying GPCR candidates for this pathway, as well as identifying other interactors.

ACKNOWLEDGEMENT

We would like to acknowledge members of the Caldwell Laboratory, especially Laura

Berkowitz, Chris Gilliman, and Akeem Borom for their collegiality and teamwork. All C. elegans mutants came from the Caenorhabditis Genetics Center, which is funded by the National

Institutes of Health National Center for Research Resources. Additional support came from QRx

Pharma and NIH grant awarded to GAC.

129

REFERENCES

Brenner, S. (1974). The genetics of Caenorhabditis elegans. Genetics, 77, 95-104.

Cao, S, Gelwix, C.C., Caldwell, K.A., and Caldwell, G.A. (2005). Torsin-Mediated Protection from Cellular Stress in theDopaminergic Neurons of Caenorhabditis elegans J. Neurosci. 25, 3801–3812.

Cao, P X., Yuan, Y.Y., Pehek, E.A., Ma Huang, R.Y., et al. (2010). Alpha-Synuclein Disrupted Dopamine Homeostasis Leads to Dopaminergic Neuron Degeneration in Caenorhabditis elegans. PLoS ONE 5, e9312.

Chase, D L., Pepper, J.S., Koelle, M.R. (2004).Mechanism of extrasynaptic dopamine signaling in Caenorhabditis elegans. Nature Neurosci. 7, 1096–1103.

Fitzgerald, K., Tertyshnikova, S., Moore, L., Bjerke, L., Burley, B., Cao, J., Caroll, P., et al. (2006). Chemical genetics reveals an RGS/G-protein role in the action of a compound. PLoS Genet. 2, e57.

George J.M. (2002).The synucleins. Genome Biol3: REVIEWS3002.

Hamamichi, S., Rivas, R.N., Knight, A.L., Cao, S., Caldwell, K.A., Caldwell, G.A. (2008). Hypothesis-based RNAi screening identifies neuroprotective genes in a Parkinson's disease model. Proc. Nat. Acad. Sci. U. S. A 105, 728-733.

Harrington A, J., Yacoubian, T.A., Slone, S. R., Caldwell, K.A., Caldwell, G.A. (2012). Functional Analysis of VPS41-Mediated Neuroprotection in Caenorhabditis elegans and Mammalian Models of Parkinson’s Disease. J. Neurosci. 32, 2142–2153.

Hiley, E., McMullan, R., Nurrish, S. J. (2006). The Galpha12-RGS RhoGEF-RhoA signalling pathway regulates neurotransmitter release in C. elegans. EMBO J. 25, 5884–5895.

Hongpaisan, J., Sun, M-K., Alkon, D.L. (2011). PKC ε Activation Prevents Synaptic Loss, Aβ Elevation, and Cognitive Deficits in Alzheimer's Disease Transgenic Mice. J. Neurosci. 31, 630-643.

Iwata, A., Maruyama, M., Kanazawa, I., Nukina, N. (2001). alpha-Synuclein affects the MAPK pathway and accelerates cell death. J. Biol. Chem. 276, 45320–45329.

130

Kindt, K.S., Quast, K. B., Giles, A. C., De, S., Hendrey, D., et al. (2007). Dopamine mediates context-dependent modulation of sensory plasticity in C. elegans. Neuron 55, 662–676.

Lochrie, M. A., Mendel, J. E., Sternberg, P. W., Simon, M. I. (1991). Homologous and unique G protein alpha subunits in the nematode Caenorhabditis elegans. Cell Regul. 2, 135–154. Kurz, A., Kay, L.D., Lastres-Becker, I., Tozzi, A., M. Tantucci., et al. (2010). A53T-Alpha- Synuclein Overexpression Impairs Dopamine Signaling and Striatal Synaptic Plasticity in Old Mice. PLoS ONE 7, e11464.

Kamath, R. S., Fraser, A.G., Dong, Y., Poulin, G., Durbin, R., et al. (2003). Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. Nature 421, 231–237.

Koelle, M.R., and Horvitz, H, R. (1996). EGL-10 Regulates G Protein Signaling in the C. elegans Nervous System and Sharesa Conserved Domain with Many Mammalian Proteins. Cell 84: 115–125.

Lakso, M., Vartiainen, S., Moilanen, A.M., Sirviö, J., Thomas, J. H., Nass, R., Blakely, R.D., et al. (2003). Dopaminergic neuronal loss and motor deficits in Caenorhabditis elegans overexpressing human alpha-synuclein. J.Neurochem. 86, 165-172.

Lackner, M.R., Nurrish, S.J., Kaplan. J.M. (1999). Facilitation of synaptic transmission by EGL- 30 Gqα and EGL-8 PLCβ: DAG binding to UNC-13 is required to stimulate acetylcholinerelease. Neuron 24, 335–346.

Maher, P. (2001). How Protein Kinase C Activation Protects Nerve Cells from Oxidative Stress-Induced Cell Death. J. Neurosci. 21, 2929–2938.

McLean, P. J, Kawamata, H., Hyman, B.T. (2001). Alpha-Synuclein-enhanced green fluorescent protein fusion proteins form proteasome sensitive inclusions in primary neurons. Neuroscience 104, 901–912.

Miller, K.G., Emerson, M.D., Rand, J.B. (1999). Goα and diacylglycerol kinase negatively regulate the Gqα pathway in C. elegans. Neuron 24, 323–333.

Mosharov, E.V., Staal, R.G., Bove, J., Prou, D., et al. (2006). α-Synuclein Overexpression Increases Cytosolic Catecholamine Concentration. J. Neurosci. 26, 9304-9311.

Nemani, V.M., Lu, W., Berge, V., Nakamura, K., Onoa, B., Lee, M. K., Chaudhry, F. A. et al. (2010). Increased expression of alpha-synuclein reduces neurotransmitter release by inhibiting synaptic vesicle reclustering after endocytosis. Neuron 65, 66–79.

Ostrerova, N., Petrucelli, L., Farrer, M., Mehta, N., Choi, P., et al. (1999). alpha-Synuclein shares physical and functional homology with 14-3-3 proteins. J. Neurosci. 19, 5782–5791.

131

Polymeropoulos M.H., Lavedan, C., Leroy, E., Ide S.E., Dehejia, A., et al. (1997). Mutation in the alpha-synuclein gene identified in families with Parkinson's disease. Science 276, 2045– 2047.

Missale, V.M., Nash, S.R., Robison, S.W., Jaber, M., Caron, G. (1998). Dopamine Receptors: From Receptor to Function. Physiol Rev. 78, 189-225.

Schulz-Schaeffer, W. J. (2010). The synaptic pathology of alpha-synuclein aggregation in dementia with Lewy bodies, Parkinson’s disease and Parkinson’s disease dementia. Acta Neuropathologica 120, 131–143.

Singleton, A. B., Farrer, M., Johnson, J., Singleton, A., Hague, S. et al. (2003). alpha-Synuclein locus triplication causes Parkinson's disease. Science 302, 841.

Spillantini, M.G., Crowther, R. A., Jakes, R., Hasegawa, M. Goedert, M. (1998). alpha- Synuclein in filamentous inclusions of Lewy bodies from Parkinson’s disease and dementia with lewy bodies. Proc. Natl. Acad. Sci. U. S. A. 95, 6469–6473.

Sulston, J., Drew, M., Brenner, S. (1975). Dopaminergic neurons in the nematode Caenorhabditis elegans. J. Comp. Neur. 163, 215–226.

Tabuse, Y. (2002). Protein Kinase C Isotypes in C. elegans. J. Biochem. 132, 519-522.

Trent, C., Tsuing, N., Horvitz, H.R. (1983). Egg-laying defective mutants of the nematode Caenorhabditis elegans. Genetics 104, 619–647.

Yan, Z., Feng, J., Fienburg, A.A., Greengard, P. (1999). D2 dopamine receptors induce mitogen- activated protein kinase and cAMP response element-binding protein phosphorylation in neurons. Proc. Natl. Acad. Sci. U. S. A. 96, 11607–11612.

You, Y., Kim, J., Cobb, M., Avery, L. (2006). Starvation activates MAP kinase through the muscarinic acetylcholine pathway in Caenorhabditis elegans pharynx. Cell 3(4), 237-4.

132

CHAPTER 5

PROTECTION OF DOPAMINERGIC NEURONS BY VALPROIC ACID

This work is currently in preparation for publication. Bwarenaba Kautu conceived the ideas for the project, designed and performed all experiments, analyzed all the data, and wrote the manuscript. Alejandro Carasquilla and Matthew Hicks provided technical support, performed some experiments and contributed ideas to the project. Guy Caldwell and Kim Caldwell co- wrote the manuscript, took images of worms, and made the graphs and figures.

133

ABSTRACT

Parkinson’s disease (PD) is a currently incurable neurodegenerative disorder that affects

the aging population. The loss of dopaminergic neurons in the substantia nigra is one of the

pathological features of PD. The precise causes of PD remain unresolved but evidence supports

both environmental and genetic contributions. Current efforts for the treatment of PD are

directed toward the discovery of compounds that show promise in impeding age-dependent

neurodegeneration in PD patients. Alpha-synuclein (α-Syn) is a human protein that is mutated in

specific populations of patients with familial PD. Overexpression of α-Syn in animal models of

PD replicates key symptoms of PD, including neurodegeneration. Here, we use the nematode C. elegans as a model system, whereby α-Syn toxicity causes dopaminergic neurodegeneration, to test the capacity of valproic acid (VA) to protect neurons. The results of our study showed that treatment of nematodes with moderate concentrations of VA significantly protects dopaminergic neurons against α-Syn toxicity. Consistent with previously established knowledge related to the mechanistic action of VA in the cell, we showed through genetic analysis that the neuroprotection conferred by VA is inhibited by cell-specific depletion of the C. elegans ortholog of the MAP extracellular signal-regulated kinase (ERK), MPK-1, in the dopaminergic neurons. These findings suggest that VA may, in part, protect C. elegans dopaminergic neurons through ERK-MAPK.

134

The degeneration of dopaminergic neurons in Parkinson’s disease (PD) patients

represents one of the pathological features of PD. Risk factors for PD include both

environmental and genetic factors (Dauer et al. 2003). The gene encoding the protein alpha-

synuclein (α-Syn) is a well-studied genetic risk factor. α-Syn is a major constituent of the Lewy bodies found in PD patients, and is considered to play a key role in the pathogenesis of PD. For instance, it was found that point mutations as well as multiplication of the α-Syn locus cause familial forms of PD (Polymeropoulos et al. 1997; Singleton et al. 2003). Similarly, overexpression of α-Syn in mice and other model organisms mimic symptomatic features of PD, including accumulation of misfolded protein, cellular toxicity, and neurodegeneration (Waxman et al. 2009). Current efforts for the treatment of PD are aimed at identifying compounds that exhibit potency in ameliorating age-dependent neurodegeneration.

Valproic Acid (VA) is an FDA approved compound that is normally prescribed for the treatment of epilepsy and bipolar disorders. Studies have shown that VA affects GABA transmission, voltage gated Na+ channels, T-type calcium channels, and histone deacetylases

(HDACs) (Christian et al. 2012). However, several studies revealed that VA can also activate

ERK-MAPK both in vivo and in vitro. This action of VA, through ERK-MAPK, could have both neuroprotective and positive growth effects on neurons (Hunsberger et al. 2009; Christian et al. 2012). For example, it has been reported that application of VA resulted not only in neuroprotection but regeneration of injured retinal ganglion cells. This neuroprotective

/regenerative effect was accompanied by prolonged activation of phosphorylated ERK 1/2

(Biermann et al. 2010) suggesting that ERK-MAPK mediates both the neuroprotective and neuroregenerative effect of VA. In two other independent studies, VA was also shown to promote neurite growth through ERK (Yuan et al. 2001) and positively affect cortical neuron

135

growth and hippocampal neurogenesis in adult mice, also through the ERK pathway. As such, it

was postulated that VA plays a role in promoting neurotrophic factors that positively regulate

neuronal growth and maintenance to counteract neuronal cell death (Hao et al. 2004).

The neuroprotective effect of VA has also been documented in select models of PD. In

one study, it was observed that chronic dietary administration of VA reduced dopaminergic cell

death in neurodegenerative rats that were treated with rotenone (Monti et al. 2010). In another

model developed by the same group, VA was shown to confer neuroprotection in the

degenerating brain cells of rats that were previously injected with the toxin 6-hydroxydopamine

(6-OHDA) (Monti et al. 2012). In a mouse model of PD, VA protected the nigrostriatal

dopamine system against the toxin 1-methyl-4-phenyl-1, 2, 3, 6-tetrahydropyridine (MPTP)

(Kidd et al. 2011). These findings support the hypothesis that VA may have a neuroprotective effect on the dopaminergic neurons. Although such studies using acute neurotoxins have been insightful, it remains to be known whether or not VA can protect dopaminergic neurons impacted by the overproduction of α-Syn. Moreover, it has not been demonstrated if VA can exert its protective effect on the dopaminergic neurons through ERK-MAPK pathway.

Our laboratory had previously reported that overexpression of α-Syn in the dopaminergic

neurons of C. elegans causes age-dependent neurodegeneration (Cao et al. 2005). Despite its vast anatomical difference from humans, the C. elegans nervous system possesses important cellular and molecular features of mammalian neurons, which include conserved neurotransmitter systems (dopamine, GABA, acetylcholine, serotonin, etc.), receptors, axon guidance molecules, ion channels, and synaptic features. Moreover, the C. elegans genome contains homologs of many human genes including those that have been implicated in PD and other neurodegenerative diseases. Using this model system, we set out to test the hypothesis that VA may protect

136

dopaminergic neurons of C. elegans against α-Syn toxicity via an ERK-MAPK-dependent mechanism.

We investigated this hypothesis using a combination of pharmacology and cell-specific

RNA interference technology (RNAi). For the cell-specific RNAi experiments, the C. elegans ortholog of ERK-MAPK, MPK-1, and an upstream regulator MEK-2, were depleted in the dopaminergic neurons in the presence of overexpressed α-Syn. The cell-specific RNAi strain used in this study was created by introducing a sid-1 loss-of-function mutation in conjunction with SID-1 genomic DNA UA195 [sid-1(pk3321); baIn33 (Pdat-1::sid-1, Pmyo-2::mCherry)] into animals expressing α-Syn in the dopaminergic neurons UA44 [baIn11(Pdat-1:: α-syn, Pdat-

1::GFP)]. The resulting strain, UA196 [sid-1(pk3321); baIn11; baIn33], renders only the dopaminergic neurons susceptible to the effect of RNAi (Harrington et al. 2012). Using this strain, we monitored the loss of the dopaminergic neurons of C. elegans in adult animals. In this experimental paradigm, animals were treated with or without VA at various drug concentrations.

All animals were cultured according to standard worm maintenance procedures (Brenner, 1974).

A molten nematode growth medium (NGM) was used to dissolve VA inside conical flasks at 55-

60 oC. Three independent mixtures were made containing 1mM, 2mM, and 3mM final

concentrations. These mixtures were then poured into 60 mm Petri dishes and incubated at room

temperature overnight. On the next day plates were seeded with bacteria (strain OP50) and

incubated at 37 o C. Gravid adults were then transferred onto the plates to lay embryos and

removed after 24 hours. The offspring were analyzed at day 7 post embryonic development

because significant neurodegeneration is reproducibly observed in populations at this time

[Harrington et al. 2012]. At day 7, 88% of α-syn animals displayed neurodegeneration in the dopaminergic neurons (12% of neuroprotection) (Figures 5.1, 5.2).

137

Figure 5.1 Dopaminergic neurons (DA) of C. elegans in day-7 adult animals. (A) The six anterior DA neurons remain intact in the absence of α-synuclein (α-Syn). (B) Anterior neurons undergoing neurodegeneration when α-Syn is overexpressed. Arrowheads indicate the cell bodies, and arrows depict the processes.

138

Figure 5.2 Treatment of α-Syn animals with Valproic Acid (VA) is neuroprotective. Dopaminergic neuroprotection of α-Syn-expressing animals was commensurate with VA concentration, wherein 1mM was not protective, while 2mM and 3mM both displayed significant neuroprotection when compared to animals treated with vehicle alone. It should be noted the 3mM VA exposure was also significantly more protective that 2mM VA.

139

To score dopaminergic neurons, animals were placed in a 3mM solution of levamisole

and mounted with a coverslip on a two percent (2%) agarose pad. Animals were examined with a

Nikon Eclipse E800 epifluorescence microscope at 400x magnification. The six anterior

dopaminergic neurons of C. elegans were scored in our experiments. An animal with normal, or

wildtype, neurons is defined as having all intact dopaminergic neurons (i.e. cell bodies and

processes). An animal with degenerating neurons is defined as having at least one missing

neuron within that individual (i.e. missing cell body or dendrite). Statistical analyses were

performed by comparing two sets of data/experiments involving control and treated animals

(RNAi or VA treatments), using the Fisher Exact Test (http://www.langsrud.com/fisher.htm).

The mean values for all data sets were shown with standard deviations, where a p-value of less than 0.05 is considered significant. In total, 90 animals were examined, per experimental condition.

Our results showed that VA is significantly neuroprotective against α-Syn at 2mM and

3mM concentrations in day-7 adult animals. In untreated animals, only 12% of animals expressing α-Syn exhibit normal dopaminergic neurons (Figure 5.2). When animals were

treated with 2mM of VA, the percentage of the population displaying the normal complement of

dopamine neurons rose significantly to approximately 50%. There was an even greater increase

when animals were treated with 3mM VA, as 72% of these animals displayed normal

dopaminergic neurons (Figure 5.2). No significant protection was observed at 1mM (Figure

5.2). We could not analyze animals treated with 4mM VA (or higher) because these higher

concentrations of VA slowed the growth of animals. For example, at day-7 were unable to

obtain 30 animals for analysis at 4mM VA concentration. Moreover, the size of the animals

treated with 4mM VA was significantly smaller than the non-treated animals. However, our

140

results suggest that VA can protect the dopaminergic neurons against α-Syn toxicity at 2mM and

3mM concentrations.

We proceeded to ask whether VA protected the C. elegans dopaminergic neurons via

ERK-MAPK. To answer this question, we used cell-specific RNAi to deplete ERK-MAPK in the dopaminergic neurons. In C. elegans, the ortholog of ERK is encoded by the gene mpk-1

(Lackner et al. 1994; Wu et al. 1994, Lee et al. 2007). The direct upstream regulator of MPK-1 is MEK-2, which is a MAP2 kinase (Church et al. 1995; Wu et al.1995; Okuyama et al. 2010).

RNAi bacterial clones for mek-2 and mpk-1 were obtained from a comprehensive C. elegans

RNAi library (MRC Cambridge) (Kamath et al. 2003). RNAi experiments were performed by growing RNAi bacteria (HT115) on agar plates containing 0.25% beta-lactose [Locke et al.

2009]. Gravid adult animals, UA196 α-Syn RNAi strain (described above), were transferred onto the RNAi plates and allowed to lay embryos for 24 hours. The offspring from these parental animals were left on the plates to eat HT115 bacteria containing the specified RNAi clones and were analyzed for neurodegeneration at day 7. The results of our RNAi experiments showed that depletion of mek-2 negates the protective effect of VA on the dopaminergic neurons of adult animals at concentrations tested 2mM, and 3mM levels of treatments (Figure 5.3). In contrast, dopaminergic-selective RNAi against mpk-1 abolished neuroprotection only at the 3mM concentration (Figure 5.3). The difference in responses could possibly occur because of differential levels of mpk-1 and mek-2 transcripts when worms are treated with different concentrations of VA. These data imply that VA requires the presence of endogenous levels of

MEK-2 and MPK-1 in order to protect the dopaminergic neurons from α-Syn toxicity. We therefore concluded that VA attenuates dopaminergic neurodegeneration via ERK-MAPK.

141

Figure 5.3 VA neuroprotection of α-Syn-overexpression in DA neurons is dependent on the ERK-MAPK signaling pathway. Cell-specific RNAi depletion of mek-2, and mpk-1 in α-Syn- overexpressing DA neurons enhanced degeneration. This knockdown also negated the neuroprotective effect of VA on these DA neurons.

142

What is the relevance of these findings to the mammalian brain, particularly the

dopaminergic neurons and PD? First, it is well established that VA affects ERK-MAPK

signaling in various biological contexts. Our data showed that VA significantly protected the

dopaminergic neurons from the toxicity caused by α-Syn overexpression. Moreover, we showed that independent RNAi knockdowns of mek-2 and mpk-1 abolished the neuroprotective effect of

VA on the dopaminergic neurons. This finding implicates ERK-MAPK as the plausible pathway mediating the neuroprotective effect of VA in the C. elegans dopaminergic neurons. Despite its pleiotropic roles in cells and tissues, ERK-MAPK is also an affirmed downstream component of

D2 dopamine receptor signaling in the mammalian brain (Yan et al. 1999). Such a role asserts that ERK-MAPK additionally plays a vital function in the regulation of various aspects of dopamine signaling and homeostasis. Coincidently, there is strong evidence that ERK-MAPK physically associates with α-Syn (Ostrerova et al. 2005; Iwata et al. 2001) suggesting its potential role in PD. Moreover, transient overexpression of α-Syn in neuro2A cells suppressed the function of ERK-MAPK, resulting in decreased cell viability (Iwata et al. 2001). Such in vitro findings corroborate our findings in vivo, all of which affirm the notion that downregulation of ERK-MAPK mediates α-Syn induced cellular toxicity and neurodegeneration. In addition, studies using other cellular models of PD have also offered supporting evidence regarding the role of ERK-MAPK in cell viability. For instance, in one study, it was reported that activation of

ERK-MAPK is necessary for protection of dopaminergic cells against rotenone toxicity (Hsuan et al. 2006). In another study, it was revealed that rapid activation of ERK-MAPK promoted the survival of dopaminergic neurons in the presence of 6-OHDA (Lin et al. 2008). These findings corroborate the potential neuroprotective role of ERK-MAPK in the cell, and suggest that administration of VA may serve to enhance the neuroprotective function of this pathway. It is

143

also important to note that cytoplasmic accumulation of phosphorylated ERK-MAPK has been detected in the substantia nigra of PD and Dementia Lewy Body (DLB) patients (Ferrer et al.

2001; Zhu et al. 2002) suggesting the potential link of this pathway to PD and other common

Lewy Body diseases. Our finding that VA can ameliorate dopaminergic neurodegeneration via

ERK-MAPK not only confirms VA as a neuroprotective compound, but also implicates ERK-

MAPK signaling as the plausible molecular target of VA in the protection of the dopaminergic neurons.

ACKNOWLEDGMENTS

Funding for this study comes from QRX Pharma, Ltd.

144

REFERENCES

Biermann, J., Grieshaber, P., Goebel, U., Martin, G., Thanos, S., Giovanni, S.D., Lagre`ze, W.A. (2010). Valproic Acid–Mediated Neuroprotection and Regeneration in Injured Retinal Ganglion Cells. Invest Ophthalmol Vis Sci. 51, 526-534.

Brenner. S. (1974). The genetics of Caenorhabditis elegans. Genetics 77, 95-104.

Cao, S., Gelwix, C.C., Caldwell, K.A., Caldwell, G.A. (2005). Torsin-Mediated Protection from Cellular Stress in theDopaminergic Neurons of Caenorhabditis elegans. J. Neurosci 25, 3801– 3812.

Christian, J., Ximenes, M., Crisóstomo, E., Verde1, L., Graça, M., et al. (2012). Valproic Acid, a Drug with Multiple Molecular Targets Related to Its Potential Neuroprotective Action. Neuroscience and Medicine 3, 107-123.

Church, D.L., Guan, K.L., Lambie, E.J. (1995). Three genes of the MAP kinase cascade, mek-2, mpk-1/sur-1 and let-60 ras, are required for meiotic cell cycle progression in Caenorhabditis elegans. Development 121, 2525–2535.

Dauer, W., Przedborski, S. (2003). Parkinson’s disease: Mechanisms and Models. Neuron 39, 889–909.

Ferrer, I., Blanco, R., Carmona, M., Puig, B., Barrachina, M., et al. (2001). Active phosphorylation-dependent mitogen-activated protein kinase (MAPK/ERK), stress-activated protein kinase/c-Jun N-terminal kinase (SAPK/JNK), and p38 kinase expression in Parkinson's disease and Dementia with Lewy bodies. J Neural Transm. 108, (2001) 1383–1396.

Hao, Y., Creson, T., Zhang, L., Li, P., Du, F., Yuan, P., Gould, T.D., et al. (2004). Mood Stabilizer Valproate Promotes ERK PathwayDependent Cortical Neuronal Growth and Neurogenesis, J. Neurosci. 24, 6590 – 6599.

Harrington, A.J., Yacoubian, T.A., Slone, S.R., Caldwell, K.A., Caldwell, G.A. (2012). Functional Analysis of VPS41-Mediated Neuroprotection in Caenorhabditis elegans and Mammalian Models of Parkinson’s Disease. J. Neurosci. 32, 2142–2153

Hsuan, S., Klintworth, H.M., Xia, Z. (2006). Basic Fibroblast Growth Factor Protects against Rotenone- Induced Dopaminergic Cell Death through Activation of Extracellular Signal- Regulated Kinases 1/2 and Phosphatidylinositol-3 Kinase Pathways. J. Neurosci. 26, 4481– 4491.

145

Hunsberger, J., Austin, D.R., Henter, I.D., Chen, G. (2009). The neurotrophic and neuroprotective effects of psychotropic agents, Dialogues in Clinical Neuroscience 11, 333-348. Iwata, A., Maruyama, M., Kanazawa, I., Nukina, N. (2001). alpha-Synuclein affects the MAPK pathway and accelerates cell death. J.Biol.Chem. 276, 45320–45329.

Kamath, S.R., Fraser, A.G., Dong, Y., Poulin, G., Durbin, R., Gotta, M., et al. (2003). Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. Nature 421, 231–237.

Kidd, S.K., Schneider, J.S. (2011). Protective effects of valproic acid on the nigrostriatal dopmine system in a 1-methyl-4-phenyl-1, 2, 3, 6-tetrahydropyridine mouse model of Parkinson's disease. Neuroscience 194, 189-194.

Lackner, M.R., Kornfeld, K., Miller, L.M., Horvitz, H.R., Kim, S.K. (1994). MAP kinase homolog, mpk-1, is involved in ras-mediated induction of vulval cell fates in Caenorhabditis elegans. Genes Dev. 8, 160–173.

Lee, M.H., Ohmachi, S., Arur, S., Nayak, S., Franci, R., Church, D., Lambie, E., Schedl, T. (2007). Multiple functions and dynamic activation of MPK-1 extracellular signal-regulated kinase signaling in Caenorhabditis elegans germline development. Genetics 177, 2039-2062.

Locke, C.J., Kautu, B.B., Berry, K.P., Lee, S.K., Caldwell, K.A. Caldwell, G.A. (2009). Pharmacogenetic Analysis Reveals a Post-Developmental Role for Rac GTPases in Caenorhabditis elegans GABAergic Neurotransmission. Genetics 183, 1357–1372.

Lin, E., Cavanaugh, J.E., Leak, R.K., Perez, R.G., Zigmond, M.J. (2008). Rapid activation of ERK by 6-hydroxydopamine promotes survival of dopaminergic cells. J. Neurosci. Res. 86, 108- 117.

Monti, B., Gatta, V., Piretti, F., Raffaelli, S.S., Virgili, M., Contestabile, A. (2010). Valproic Acid is Neuroprotective in the Rotenone Rat Model of Parkinson’s Disease, Involvement of α- Synuclein. Neurotoxicity Research 17, 130-141.

Monti, B., Mercatelli, D., Contestabile, A. (2012). Valproic acid neuroprotection in 6-OHDA lesioned rat, a model for Parkinson’s disease. HOAJ Biology 1, 1-4.

Okuyama, T., Inoue, H., Ookuma, S., Satoh, T., Kano, K., et al. (2010). The ERK-MAPK pathway regulates longevity through SKN-1 and insulin-like signaling in Caenorhabditis elegans. J. Biol. Chem. 30, 274-281.

Ostrerova, N., Petrucelli, L., Farrer, M., Mehta, N., Choi, P., Hardy, J., Wolozin, B. (1999). alpha-Synuclein shares physical and functional homology with 14-3-3 proteins. J. Neurosci. 19, 5782–5791.

146

Polymeropoulos, M.H., Lavedan, C., Leroy, E., Ide, S.E., Dehejia, A., et al. (1997). Mutation in the alpha-synuclein gene identified in families with Parkinson's disease. Science 276, 2045– 2047.

Singleton, A.B., Farrer, M., Johnson, J., Singleton, A., Hague, S., Kachergus, J., et al. (2003). Alpha-synuclein locus triplication causes Parkinson’s disease. Science 302, 841.

Waxman, E.A., Giasson, B.I. (2009). Molecular mechanisms of α-synuclein neurodegeneration. Biochimica et Biophysica Acta 1792, 616–624.

Wu, Y., Han, M. (1994). Suppression of activated Let-60 ras protein defines a role of Caenorhabditis elegans. Sur-1 MAP kinase in vulval differentiation, Genes Dev. 8, 147–159.

Wu, Y., Han, M., Guan, K.L. (1995). MEK-2, a Caenorhabditis elegans MAP kinakinase, functions in Ras-mediated vulval induction and other developmental events. Genes. Dev. 9, 742- 755.

Yan, Z., Feng, J., Fienburg, A.A., Greengard, P. (1999). D2 dopamine receptors induce mitogenactivated protein kinase and cAMP response element-binding protein phosphorylation in neurons. Proc. Natl. Acad. Sci. U.S.A. 196, 11607–11612.

Yuan, P., Huan, L., Jian, Y., Silvio, J., Husseini, G., Manji, K., Chen, G. (2001).The Mood Stabilizer Valproic Acid Activates Mitogen-activated Protein Kinases and Promotes Neurite Growth, J. Biol.Chem. 276, 31674–31683.

Zhu, J., Kulich, S.M., Oury, T.D., Chu, C.T. (2002). Cytoplasmic Aggregates of Phosphorylated Extracellular Signal-Regulated Protein Kinases in Lewy Body Diseases. American Journal of Pathology 161, 2087- 2098.

147

CHAPTER 6

CONCLUSION

C. elegans neuromuscular activity is controlled by the antagonistic actions of GABAergic and cholinergic motor neurons (Schuske et al. 2004; Locke et al. 2008) and I demonstrated how two neural stimulants, aldicarb and PTZ, can be used complimentarily to better characterize altered neuromuscular signaling in C. elegans (Chapter 2). Historically, the nature of neurotransmission was dissected using traditional laser ablation techniques and the aldicarb assay. It was found that acute exposure of wildtype (WT) animals to aldicarb leads to paralysis due to the build-up of excitatory transmission at the synapse. Yet, inactivation of pathways that positively regulate acetylcholine (ACh) release in WT animals results in resistance to aldicarb.

Moreover, due to the antagonistic nature of GABA and ACh at the neuromuscular junction(NMJ), either diminished levels of GABA, or a failure to negatively regulate ACh release at the NMJ, lead to aldicarb hypersensitivity (Vashlishan et al. 2008; Locke et al. 2008;

Locke and Kautu et al. 2009). Although the aldicarb assay has been the standard method for characterizing synaptic transmission in C. elegans, this method alone cannot determine whether the defect in synaptic activity is due to either altered levels of inhibitory transmission or a generalized inability to negatively regulate ACh release at the NMJ. Moreover, the role of aldicarb assay is limited to the C. elegans NMJ. For this reason, we have introduced a complimentary approach using PTZ and aldicarb together to characterize synaptic transmission mutants.

148

Using PTZ and aldicarb assays, we characterized the nature of neurotransmitter

alterations in several key synaptic mutants. We showed that inactivation of genes that negatively

regulate ACh release (e.g tom-1, and unc-43) resulted in hypersensitivity to aldicarb. Similarly,

GABA mutants such as unc-25 displayed similar phenotypes on aldicarb. Interestingly, tom-1

mutants did not exhibit convulsions on PTZ while unc-25 mutants did. Based on this

observation, we reasoned that the defects associated with inactivation of tom-1 are not attributed

to diminished GABA transmission, whereas the defects in unc-25 mutants are attributed to both

diminished levels of GABA, and the overwhelming effect of acetylcholine or excitatory

transmission at the NMJ. Conversely, positive regulators of general synaptic transmission such

as snb-1, and an acetylcholine specific mutant (unc-4) were hypersensitive to aldicarb.

Interestingly, unc-4 mutants were not hypersensitive to PTZ but snb-1 mutants were. We therefore reasoned that snb-1 mutants are deficient in both inhibitory and excitatory transmission whereas the nature of the synaptic transmission defect in unc-4 mutants is specifically associated with the failure to positively regulate presynaptic acetylcholine release. It is important to note though that PTZ binds to a GABAA receptor, therefore the effect of PTZ is not limited to the

motor neurons along the body wall muscles as there are GABAergic neurons present in the nerve

ring as well (Locke and Kautu et al. 2009). For this reason, aldicarb cannot always predict the

result of PTZ assay. These experimental pharmacological paradigms can be further applied to

characterize defects in synaptic transmission in an array of mutants.

Characterizing the post-developmental role of Rac GTPase signaling in GABA neurotransmission

In Chapter 3, we showed that a conserved Rac GTPase signaling plays a role in GABA

neurotransmission. This work implicates the post-developmental role of this signaling pathway

149

in the proper maintenance of neuronal synchrony. Many neurological disorders associated with

defects in cytoskeletal function often have developmental basis. For example, defects in neuronal

migration associated mutations in LIS1 and dynein, as well as with actin regulators, including

Rac GTPases and integrins, cause epileptic seizures. However, it is plausible that even after the

cessation of neuronal migration, these proteins may continue to act in the adult brain to regulate

the intrinsic aspects of a neuron. Our findings in C. elegans showed that function-altering

mutations in the Rac GTPase genes ced-10 and mig-2 caused epileptic-like convulsions when the

animals were exposed to the GABA receptor antagonist PTZ. These mutants also exhibited

hypersensitivity to aldicarb, suggesting that there is a lack of inhibitory signaling at the NMJ in

these animals. Interestingly, we showed that mutations in genes that encode the regulators of Rac

GTPase proteins ina-1, mig-15, and unc-73, elicited the same behavioral responses when

exposed to both PTZ and aldicarb. These findings implicate the role of Rac GTPase signaling in

GABAergic neurotransmission. To better understand the specificity of Rac signaling at the

NMJ, future experiments will require the use of electrophysiology tools to measure miniature

postsynaptic currents from both the excitatory and inhibitory neurons of Rac deficient mutants.

Redundant functions of Rac GTPase ced-10 and mig-2 in GABAergic neurotransmission

An interesting finding in our work revealed that Rac gain-function mutants, but not Rac

loss-of-function mutants, were hypersensitive to PTZ and aldicarb. Prior studies have demonstrated the redundant functions of Rac genes (ced-10, mig-2, and rac-2) in multiple

developmental pathways, including axon guidance in D-type motor neurons (Lunquist et al.

2001). The ced-10 (n1993) and mig-2(mu28) loss-of-function alleles did not confer

hypersensitivity to PTZ and aldicarb. On the other hand, ced-10(n3246) and mig-2(gm103) gain-

150

of-function alleles conferred hypersensitivity to aldicarb and PTZ. We therefore reasoned that the products of ced-10 and mig-2 act redundantly to modulate GABAergic neurotransmission.

These findings are consistent with cross inhibition of redundant functions of the Rac pathway in

multiple developmental processes. However, in this assay, we did not test other redundant

members of the Rac family such as rac-2. It is not known whether knocking out or knocking down rac-2 will lower the epileptic-like seizure threshold. This is something that can be part of future experiments.

The role of specific Rac regulators in GABAergic neurotransmission

The pleiotropic nature of Rac GTPases suggests that they affect multiple pathways in different tissues. Numerous putative interactors of Rac GTPases have been identified in C. elegans and other systems. In our work, we showed that mutations involving putative interactors of Rac GTPases, including integrin alpha (INA-1), Nck interacting kinase (NIK) MIG-15, and

Rho/Rac GEF UNC-73, exhibited hypersensitivity to PTZ and aldicarb, suggesting that these proteins function in a common pathway with Rac GTPases to regulate GABAergic neurotransmission. Specificity of Rac signaling at the NMJ, future experiments will need electrophysiology tools to measure miniature postsynaptic currents from both the excitatory and inhibitory neurons at different stages of the animals. Cell-specific knockdown of Rac in the

GABAergic neurons will help address the question whether Rac GTPases are indeed required in the GABAergic neurons to regulate neurotransmission.

Not all Rac regulators display defects in GABAergic neurotransmission

151

Rac GTPases interact with multiple other proteins to affect a number of cellular and

developmental events, including cell corpse engulfment and axon guidance. We showed,

however, that Rac regulators in the context of apoptosis signaling, including ced-2(n1994) and

ced-5(n1812), did not cause PTZ-induced convulsions in the corresponding mutants. In addition,

mutations involving other interactors of Rac GTPases in axon guidance including the netrin

receptor UNC-40, and the proteins UNC-34, SWAN-1, UNC-5 and UNC-115, did not confer

hypersensitivity to PTZ. These findings imply that the function of Rac GTPases, with respect to

GABAergic neurotransmission in C. elegans, may be independent of its role in cell corpse

development, and axon guidance. Future experiments will look at other interactors of Rac

GTPases

The role of Rac GTPases and putative regulators in GABAergic vesicle motility

In our work, we also found that Rac mutants ced-10 and mig-2 exhibited synaptic vesicle misacummulations in the GABAergic nervous system. We showed this by examination of synaptic vesicle transport using SNB-1:: GFP as a molecular reporter. In addition, we also examined the architecture of the GABAergic nervous system for possible developmental anomalies using soluble diffused GFP driven under a GABAergic specific promoter. We found that ced-10 and mig-2 mutants exhibited significant neuronal abnormalities; however, we were surprised to see that synaptic vesicle misacummulations in the GABAergic neurons were significantly greater than developmental anomalies. In addition, the Rac regulator mutants ina-1, and unc-73 also displayed synaptic vesicle mislocalizations in the GABAergic neurons. These findings suggest that the role Rac GTPase signaling pathway is to promote synaptic vesicle transport or motility in the GABAergic nervous system. To further test this hypothesis, one can

152

use a cell-specific RNAi method to knock down Rac signaling the GABAergic neurons only.

This will address the question whether or not Rac acts cell-autonomously to regulate vesicle

motility.

The post-developmental role of Rac signaling in GABAergic neurotransmission

We hypothesized that misaccumulation of SNB-1::GFP in the GABAergic nervous system contributed to PTZ-induced convulsive behavior, and the aldicarb hypersensitivity displayed in Rac mutants and regulators. However, these findings are difficult to interpret due to the subtle nature of the developmental defects associated with the GABAergic neurons in Rac mutant animals. Thus we proceeded to resolve this issue by using an RNAi feeding approach whereby the induction of double stranded RNA was controlled by applying a specific concentration of the inducer beta-lactose in the media. This RNAi approach produced weaker neuronal phenotypes than that of the actual mutants. Using this method we then showed that combinatorial knockdown of ced-10 and rac-2 resulted in SNB-1::GFP mislocalization, yet developmental anomalies were insignificant in the GABAergic motor neurons. Similarly, knockdown of putative Rac interactors also resulted in SNB-1::GFP misacumulation in the

GABAergic nervous system, while no significant neuronal developmental problems were observed in these animals. These results postulated the plausible postdevelopmental functions of

Rac GTPase signaling in GABAergic vesicle transport. Follow-up experiments will aim at either knocking down Rac or activating Rac at different developmental stages of the animal. This can be achieved by RNAi, or by using inducible promoters.

Link between Rac GTPases and the Dynein Motor Complex

153

Dynein motor complex mutants lis-1 and dhc-1 showed robust hypersensitivity to both

PTZ and aldicarb, suggesting that the dynein motor complex may function in a common pathway with Rac signaling to regulate GABA transmission. Moreover, these mutants also displayed aberrant vesicle transport in the GABAergic neurons. We tested the hypothesis that there may be a functional interaction between the Rac signaling pathway and the dynein motor complex. This hypothesis was examined by knocking down members of the dynein motor complex in Rac hypomorphs. Genetic interaction studies were then performed using aldicarb and PTZ assays.

Our results showed that RNAi depletions of lis-1, dynein, and bicaudal D, in Rac and Rac

regulator mutants greatly exacerbated the sensitivity of these mutants to both PTZ and aldicarb.

These results imply the functional link between Rac signaling pathway and the dynein motor

complex in the regulation of GABA neurotransmission. These genetic interactions are congruent

with the presumed role of Rac-dependent control of actin and microtubule networks. For future

experiments, it will be important to examine mutants that are defective in anterograde transport,

such as kinesin mutants. Examination of GABAergic vesicle motility pattern or dynamics will be

examined in kinesin mutants using synaptic vesicle reporter proteins.

Neuroanatomy of the C. elegans GABAergic nervous system and PTZ-induced convulsive behavior

The anterior convulsive behavior observed in GABA and Rac mutants raised a question whether such behavioral response is a result of aberrant neuronal signaling in the D-type motor

neurons that innervate the body wall muscles or is it due to lack of inhibitory signaling in the

RME neurons in the nerve ring. This question was addressed by examining neurotransmission

deficits in unc-30 null mutant animals which lack GABA in the D-type motor neurons but not in

the RME neurons (Jin et al. 1994). Our results showed that unc-30 mutants did not display

154

hypersensitivity to PTZ, implying that the lack of inhibitory signaling in RME neurons may be

chiefly accountable for the PTZ-induced convulsive behavior. This result suggests that

perturbation of GABAergic transmission in the nerve ring of C. elegans may contributed to the

nature of the anterior convulsions observed in both Rac signaling and GABA mutants. For

future experiments, neuronal ablation of different classes of GABAergic (RME and D type motor

neurons) will help to identify the neuronal circuits that control the epileptic convulsive behavior

of the worms in response to PTZ.

Potential contribution of glutamate-gated chloride channels to PTZ-induced convulsions

Our work showed that Rac GTPase mutants responded to PTZ in a dose-dependent manner. This phenotype was also observed in GABA mutants such as unc-25 and unc-49. An

argument then arises as to whether PTZ may also bind to other non-GABA receptors. As a

matter of fact, the C. elegans genome contains protein sequences that show high homologies to

GABA receptors, such as the glutamate-gated chloride channels, which may function redundantly with GABA (Schuske et al. 2004). This revelation suggests that GABA may not be the only source of inhibitory transmission in the C. elegans nervous system. We tested this hypothesis by exposing the triple GluCl channel mutants [avr-14(ad1302); avr-15(ad1051) glc-

1(pk54)] on PTZ and showed that these mutants were convulsive. However, we noted that the percentage of convulsions observed in these triple mutant animals was significantly lower and less frequent than what was seen with Rac mutants. For this reason, we postulated that Rac mutants are greatly deficient in GABA signaling. However, this finding is also significant because it partially explains the failure of unc-49 and unc-25 mutants to spontaneously convulse in the absence of PTZ. Despite that other glutamate and tyramine mutants have not been tested.

155

PTZ-induced convulsion associated with Rac signaling mutants is specific to GABA deficiency

We argued that the PTZ-induced convulsive behavior observed in Rac mutants is solely

due to lack of GABA signaling. We first tested this hypothesis by examining an array of mutants

that lack signaling in other neurotransmitter systems including acetylcholine, dopamine,

serotonin, and presynaptic glutamate signaling. The mutants that systemically lacking ACh

[unc-17(e245)], DA [cat-2(e1112)], glutamate [eat-4(ky5)] or serotonin [tph-1(mg280)], did not exhibit PTZ-induced convulsions. Moreover, rab-3 mutants which are defective in general synaptic transmission are resistant to aldicarb further supporting our theory that the effect of perturbing Rac signaling is more specific to the GABA system than to general synaptic transmission. In corroboration of this result, we showed that inactivation of a heterotrimeric G protein, goa-1 (which functions to negatively regulate acetylcholine release) did not confer hypersensitivity to PTZ, although goa-1 mutants are hypersensitive to aldicarb. This data argues that the hypersensitivity of Rac mutants to aldicarb is not ascribed to excessive accumulation of

ACh at the synapse. In support of this finding, a thrashing assay using an array of mutants revealed that Rac mutants have significantly lower thrashing rates than wiltdype (N2) animals, goa-1 mutants, and rab-3 mutants. Despite these results, we found that the thrashing rate of a systemic GABA null mutant (unc-25) is significantly higher than unc-49 mutants, which lack

GABA along the body wall muscle. For this reason, we think that perhaps unc-25 animals may have sufficient levels of GABA (undetectable with immunocytochemistry), acting to maintain the spontaneous convulsive threshold that can only be overcome by PTZ. Taken together, these results suggested that Rac signaling acts to modulate GABAergic neurotransmission. For future experiments, examination of other types of GABA receptor mutants with PTZ or aldicarb will be

156

key to discover wether other homolgous receptors encoded in the genome of C. elegans act

redundantly with GABAA receptors to modulate the convulsive threshold.

Modulation of dopaminergic neuroprotection by EGL-30 (Gαq) in a C. elegans model of Parkinson’s disease

In Chapter 4, I tested the hypothesis that Gαq (EGL-30) may modulate the protection of dopaminergic neurons against the human PD protein α-Syn. In our PD model we overexpressed human α-Syn in the dopaminergic neurons of C. elegans, which results in the age-and dose- dependent degeneration of these cells. We showed in this particular experiment that reduction of function of EGL-30 caused enhanced degeneration of the dopaminergic neurons in the presence of α-Syn. Conversely, activation of EGL-30 by a gain-of-function mutation significantly results in the protection of dopaminergic neurons. These results implicate the neuroprotective function of EGL-30 or Gαq in the dopaminergic neurons. For future experiments it will be essential to look at other mutant alleles of egl-30.

The role of downstream effectors of EGL-30 in neuroprotection

The downstream effectors of Gαq in the C. elegans nervous system are the phospholipase enzyme PLC-β, and Protein Kinase C (PKC-1) (Miller et al. 1999; Lackner et al. 1999; Kindt et al. 2007). In addition, the second messenger inositol 1, 4, 5-trisphosphate (IP3) adds another

branch of this pathway downstream of Gαq, but independent of PLC-β, and Protein Kinase C

(PKC-1) (reviewed by McMullan and Nurrish, 2007). In our work, we showed that inactivation of PLC-β (EGL-8), and (PKC-1) by loss-of-function mutations enhanced the degeneration of the dopaminergic neurons in the overexpression of α-Syn. In addition, cell specific depletion of egl-

30, egl-8, and pkc-1 by RNAi in the dopaminergic neurons also conferred enhanced

157

neurodegeneration. The conclusion of this study is EGL-8 and PKC-1 act in a common pathway with EGL-30, in the dopaminergic neurons to mediate neuroprotection. Other downstream effectors of EGL-30 have been proposed, such as RHO-1. Therefore it will be important in the future to examine the role of RHO-1 in neurodegeneration or neuroprotection.

ERK-MAPK as a downstream effector of Gαq signaling in the dopaminergic neurons

Mammalian neuronal studies showed that Gαq signaling activates ERK-MAPK in the dopaminergic neurons through PLC-β, and PKC (Figure 6.1). This linear signaling cascade leads to modulation of nuclear gene expression (Yan et al. 1998). Similarly, the C. elegans ortholog of

ERK-MAPK, MPK-1, functionally interacts with PKC-1 in the C. elegans nervous system to modulate mechanosensory response (Hyde et al. 2011). This functional interaction has also been observed in other cells types. For instance, during starvation, Gαq activates PKC and MPK-1 in muscle cells downstream of a cholinergic receptor. Based on this evolutionary conserved relationships between ERK-MAPK and Gαq, we tested the hypothesis that ERK-MAPK may function in a common pathway with Gαq to modulate neuroprotection. Cell specific knockdown of mpk-1 in the dopaminergic neurons resulted in enhanced neurodegeneration, suggesting that

ERK-MAPK acts in the dopaminergic neurons to provide neuroprotection. Moreover, we showed that combinatorial RNAi knockdown of mpk-1 and pkc-1 produced a non-additive effect on dopaminergic neurodegeneration. We therefore concluded that ERK-MAPK functions in a common pathway with Gαq signaling to modulate dopaminergic neuroprotection. For future experiments it will be important to look at the phenotype of double mutants of egl-30 and erk- mapk in the context of neurodegeneration.

158

Figure 6.1 Gαq regulates signal transduction activities in the mammalia dopaminergic neurons (Yan et al. 1999). Gαq functions upstream of PLC, PKC, and ERK-MAPK to contro signal transduction events in the mammalian brain. The red arrows showed the neuroprotective path that we discovered in our C. elegans model of PD.

159

Established role of ERK-MAPK and some PKC family members in neuroprotection

The roles of ERK-MAPK and some PKC family members in neuroprotection have been

previously elucidated using neurodegenerative disease animal and cell culture models. For

instance, in cellular models of PD, ERK-MAPK is important for protection against PD-linked

toxins. In one study, it was revealed that rapid activation of ERK-MAPK provided a protective mechanism for the survival of dopaminergic neurons when these neurons were exposed to the neurotoxin 6-OHDA (Lin et al. 2008). These findings supported the neuroprotective role of

ERK-MAPK in the cell. Similarly, some of the PKC family members have been studied extensively in the context of neuroprotection. For instance, using immortalized hippocampal cell lines, it was reported that PKC and ERK act in a linear pathway, to provide neuroprotection against oxidative-induced cell death (Maher et al. 2001). Moreover, in the study of Alzheimer’s disease using mouse models, PKC-ε (a homolog of C. elegans PKC-1) was shown to prevent synaptic loss, Aβ accumulation and cognitive deficits (Hongpaisan et al. 2011). These data provided evidence supporting the neuroprotective function of several PKC species including

PKC-ε in cellular protection.

Negative regulation of EGL-30 (Gαq) by GOA-1 (Gαo)

EGL-30 and GOA-1 mediate neurotransmission in C. elegans. In the motor neurons,

GOA-1 both negatively regulates, and antagonizes EGL-30 through independent routes (Miller et al. 1999). With respect to dopamine signaling, EGL-30 and GOA-1 regulate C. elegans locomotion by antagonizing each other through their downstream effectors (Chase et al. 2005).

Our findings here revealed that goa-1 mutants showed protection of the dopaminergic neurons in our α-Syn overexpression C. elegans PD model. Interestingly, we showed that a combination of

160

egl-30 reduction-of-function and goa-1 loss-of-function mutations produced a doubly mutant animal whose phenotype exhibited severe neurodegeneration. This data implies the role of GOA-

1 in the repression of EGL-30. In corroboration of this finding, we showed that overexpression of GOA-1 in the dopaminergic neurons exacerbated neurodegeneration. Furthermore, inactivation of a negative regulator of GOA-1, EGL-10 exacerbated neurodegeneration in the overexpresssion of α-Syn. These data assert the repressive function of GOA-1 on EGL-30. The next logical step to take for this experiment is to overexpress GOA-1 in EGL-30 LF mutants.

This will allow us to determine whether EGL-30 is downstream of GOA-1 in this pathway.

Neuroprotective role and mechanism of valproic acid in a C. elegans α-Syn model of PD

In chapter 5, I showed that the anti-epileptic and mood stabilizing compound valproic acid (VA) has a significant neuroprotective effect on C. elegans dopaminergic neurons. VA has more than one molecular target or pathway (Table 6.1). One of the established molecular targets of VA is ERK-MAPK. In the previous chapter, we learned that ERK-MAPK has a neuroprotective function in the nervous system. Coincidentally, numerous studies showed that

VA can also have a neuroprotective effect on the nervous system. Based on this information, and the established molecular interaction between VA and ERK-MAPK, we proceeded to test the hypothesis that VA may confer neuroprotection through ERK-MAPK. This hypothesis was tested using the C. elegans α-Syn model of PD.

161

Table 6.1 Key molecular targets of Valproic Acid. The list is reviewed by Christian et al. Neuroscience & Medicine, 2012, with primary references not shown here but shown in the original article.

Main molecular targets of VA

HDACs

GSK-3

Akt/ERK pathways

GABA/Glutamate neurotransmitters

Na+ and Ca2+ voltage-dependent channels

Phosphoinositol/TCA pathways

OXPHOS system

162

Previous studies implicating the neuroroprotective function of VA

A number of studies have provided evidence related to the neuroprotective function of

VA. For instance, chronic dietary administration of VA was found to reduce dopaminergic cell

death induced by rotenone in a rat model of PD. Moreover, treatment of rats (that have been

exposed to the neurotoxin 6-OHDA) with VA ameliorated neurodegeneration (Monti et al.

2012). In a mice model of PD, VA attenuated nigrostriatal dopaminergic neurodegeneration in

the presence of the toxin 1-methyl-4-phenyl-1, 2, 3, 6-tetrahydropyridine (MPTP) (Kidd et al.

2011). In our study, we provided evidence that VA can significantly attenuate dopaminergic

neurodegeneration in the overexpression of α-Syn. These findings affirmed the neuroprotective

effect of VA on the dopaminergic neurons.

The link between VA and ERK-MAPK and impact on neuroprotection

VA activates ERK-MAPK in vivo and in vitro (Zhang et al. 2003; Einat 2003; Boeckeler

et al. 2006; Christian et al. 2012). For instance, treatment of endothelial cells with VA activates

ERK-MAPK to counter apoptosis (Michaelis et al. 2006). In Dictyostelium discoideum, application of VA caused transient activation and phosphorylation of ERK-MAPK (Boeckeler et al.et al. 2006). With respect to neurons and the nervous system, administration of VA provided neuroprotections and facilitated the regeneration of injured retinal ganglion cells (Biermann et al.

2010). In other independent studies, VA positively affects neurite growth through ERK, and promotes cortical neuronal growth, and hippocampal neurogenesis in adult mice (Yuan et al.2001 Hao et al. 2004). In our work, we presented evidence that VA ameliorated dopaminergic neurodegeneration in a C. elegans model of PD. This neuroprotection was abolished by inactivation of ERK-MAPK in the dopaminergic neurons. This data implies that the

163

neuroprotection afforded by VA is partly mediated by ERK-MAPK. It would be intriguing to

take these findings and test them in mammalian cellular models of PD.

Summary of Dissertation

In this dissertation, I demonstrated how C. elegans can be used to unravel the molecular

basis of neurotransmission and neurodegeneration. Moreover, I showed the amenability of this

organism in the genetic dissection of neuronal networks associated with neurodegeneration and

neuromuscular excitability. Since many neuronal pathways are conserved between C. elegans

and humans, we hope that the knowledge acquired from our study can be used to further advance

our understanding of the various functions and aspects of the mammalian nervous system, and

implications on neurological diseases. Moreover, we hope that C. elegans can serve as the

foundation for the rapid screening of compounds that may offer positive impacts on the treatment

of neurological diseases.

Current and future directions with Gαq project

I am currently investigating the biochemical impact of mammalian Gαq/Gq11 on α-Syn

aggregation (ongoing study) using an in vitro system. To do this, I am transfecting mammalian

H4 neuroglioma cell lines with Gq11 along with a truncated version of α-Syn. The aggregations

in H4 cells are induced upon transfection of α-Syn. With overexpression of Gq11, we have

previously shown that Gq11 has the potential to suppress aggregation. Currently, we are running

western blot (SDS page) analysis to determine how Gq11 may impact α-Syn protein. We hypothesized that Gq11 could be downregulating α-Syn protein levels. Using densitometry, we

164

will compare the band intensities between the amount of proteins isolated from cells that were transfected with α-Syn alone, and cells that were transfected with both α-Syn and Gq11.

165

REFERENCES

Boeckeler, K., Adley, K., Xu, X., Jenkins, A., Jin, T., R. Williams, S. (2006). The neuroprotective agent, valproic acid, regulates the mitogen-activated protein kinase pathway through modulation of protein kinase A signalling in Dictyostelium discoideum. Eur. J. Cell Biol. 85, 1047–1057.

Chase, D.L., J.S. Pepper, M.R. Koelle. (2004). Mechanism of extrasynaptic dopamine signaling in Caenorhabditis elegans. Nature Neurosci. 7, 1096–1103.

Einat, H., Yuan, P., Gould, T.D., Li, J., et al. (2003). The Role of the Extracellular Signal- Regulated Kinase Signaling Pathway in Mood Modulation. J. Neurosci. 23, 7311-7316.

Hao, Y.T., Creson, L., Zhang, P., et al. (2004). Mood Stabilizer Valproate, Promotes ERK Pathway-Dependent Cortical Neuronal Growth and Neurogenesis. J. Neurosci. 24, 6590-6599.

Hongpaisan, J., Sun, M-K., Alkon, D.L. (2011). PKC ε Activation Prevents Synaptic Loss, Aβ Elevation, and Cognitive Deficits in Alzheimer's Disease Transgenic Mice. J.Neurosci. 31, 630-643.

Hyde, R., Corkins, M.E., Somers, G.A., Hart, A.C. (2011). PKC-1 acts with the ERK MAPK signaling pathway to regulate Caenorhabditis elegans mechanosensory response. Genes, Brain and Behavior 10, 286–298.

Jin, Y., Hoskins, R., and Horvitz, H.R. (1994). Control of type-D GABAergic neuron differentiation by C. elegans UNC-30 homeodomain protein. Nature 372, 780–783.

Kidd, S. K., Schneider, J.S. (2011). Protective effects of valproic acid on the nigrostriatal dopamine system in a 1-methyl-4-phenyl-1, 2, 3, 6-tetrahydropyridine mouse model of Parkinson's disease, Neuroscience 194, 189-194.

166

Lackner, M. R., Nurrish, S.J., Kaplan, J.M. (1999). Facilitation of synaptic transmission by EGL- 30 Gqα and EGL-8 PLCβ: DAG binding to UNC-13 is required to stimulate acetylcholine release. Neuron 24, 335–346.

Locke, C. J., Berry, K., Kautu, B., Lee, K., and Caldwell, K., et al. (2008). Paradigms for pharmacological characterization of C. elegans synaptic transmission mutants. J. Vis. Exp.18, 837.

Locke, C. J., Kautu, B.B., Berry, K.P., Lee, S.K., Caldwell, K.A., Caldwell, G.A. (2009). Pharmacogenetic Analysis Reveals a Post-Developmental Role for Rac GTPases in Caenorhabditis elegans GABAergic Neurotransmission. Genetics 183, 1357–1372.

Lundquist, E. A., Reddien, P.W., Hartwieg, E., Horvitz, H.R., and Bargmann, C.I. (2001). Three C. elegans Rac proteins and several alternative Rac regulators control axon guidance, cell migration, and apoptotic cell phagocytosis. Development 128, 4475–4488.

Maher, P. (2001). How Protein Kinase C Activation Protects Nerve Cells from Oxidative Stress-Induced Cell Death. J. Neurosci. 21, 2929–2938.

McMullan, R., Nurrish, S.J. (2007). Rho deep in thought. Genes Dev. 21, 2677–2682.

Michaelis, M., Suhan, T., Michaelis, U.R., Beek, K., Rothweiler, F., Tausch, L., et al. (2006). Valproic acid induces extracellular signal-regulated kinase 1/2 activation and inhibits apoptosis in endothelial cells. Cell Death Differ. 13, 446-53.

Miller, K.G., Emerson, M.D., Rand, J.B. (1999). Goα and diacylglycerol kinase negatively regulate the Gqα pathway in C. elegans. Neuron 24, 323–333.

Monti, B. V., Gatta, F., Piretti, S.S., Virgili, M., Raffaelli, A. ( 2010). Contestabile, Valproic Acid is Neuroprotective in the Rotenone Rat Model of Parkinson’s Disease: Involvement of α- Synuclein. Neurotoxicity Research 17, 130-141.

Monti, B., Mercatelli, D., Contestabile, A. (2012). Valproic acid neuroprotection in 6-OHDA lesioned rat, a model for Parkinson’s disease. HOAJ Biology 1, 1-4.

Schuske, K., Beg, A.A., Jorgensen, E.M. (2004). The GABA nervous system in C. elegans. Trends Neurosci. 27, 407–414.

Vashlishan A. B., Madison, J.M., Dybbs, M., Bai, J., Sieburth, D., Ch’ng, Q., Tavazoie, M., Kaplan, J.M. (2008). An RNAi Screen Identifies Genes that Regulate GABA Synapses. Neuron 58, 346-61.

167

Yuan, P., Huan, L., Jian, Y., Silvio, J., Husseini, G., Manji, K., Chen, G. (2001). The Mood Stabilizer Valproic Acid Activates Mitogen-activated Protein Kinases and Promotes Neurite Growth. J. Biol. Chem. 276, 31674–31683.

Zhang, F., Phiel, C.J., Spece, L., Gurvich, N., and Klein, P.S. (2003). Inhibitory Phosphorylation of Glycogen Synthase Kinase-3 (GSK-3) in Response to Lithium. Evidence for Autoregulation of GSK-3. J. Biol. Chem. 278, 33067-33077.

168