DOCSLIB.ORG

Human Genomic Library Screened with 17-Base Oligonucleotide Probes Yields a Novel Interferon Gene

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Human Genomic Library Screened with 17-Base Oligonucleotide Probes Yields a Novel Interferon Gene Proc. Natl. Acad. Sci. USA Vol. 81, pp. 6451-6455, October 1984 Genetics Human genomic library screened with 17-base oligonucleotide probes yields a novel interferon gene (DNA hybridization/synthetic oligonucleotides/DNA sequencing/lac promoter) RICHARD M. TORCZYNSKI, MOTOHIRo FUKE*, AND ARTHUR P. BOLLONt Department of Molecular Genetics, Wadley Institutes of Molecular Medicine, Dallas, TX 75235 Communicated by S. M. McCann, July 2, 1984 ABSTRACT A method is presented that has permitted a mitted us to identify conserved regions common to several of human genomic library to be screened for low-copy genes us- the genes and has served as the basis for constructing probes ing 17-base synthetic oligonucleotides as probes. Parallel for IFN-a genes (2, 7). screening with two different 17-base probes permitted the un- One of the IFN-a genes that we have isolated from the ambiguous identification of clones containing interferon-a human genomic library has not been reported previously, (IFN-a) genes. The isolated human IFN-a genes were se- and another appears to code for IFN-aL (13). A new IFN-a quenced, and one appears to be IFN-aL; the other is one not gene, IFN-aWA, has been sequenced and compared to the previously described, which we have designated IFN-aWA. lFN-a genes A-L previously described (9, 13). It is most ho- The IFN-aWA sequence differs from those of IFN-a genes A- mologous overall with IFN-aC and with the 5' and 3' regions L at -10% of the positions and is most similar to IFN-aC, of IFN-aF and -alH, respectively. The IFN-aWA gene codes -aF, and -alH. IFN-aWA has been found to encode amino ac- for a functional interferon, which has been expressed in E. ids that differ from those conserved at each of five positions in coli using the M13-lacZ fusion as an expression vector. all previously reported IFN-a species. The IFN-aWA gene codes for an active interferon, which has been expressed in MATERIALS AND METHODS Escherichia coli using an M13-lacZ fusion as an expression vector. About 5 x 106 units of IFN-aWA were obtained per Strains and General Methods. M13mp8 bacteriophage and liter of bacterial culture. The described screening procedure E. coli K-12 JM103 (Alac-pro thi strA endA sbcB15 hsdR4 using short probes should permit the isolation of genes for supE F'traD36 proAB lacI ZA mlS) were obtained from Be- which sequence information is available from animal or plant thesda Research Laboratories. M13mpll bacteriophage genomic libraries. DNA was obtained from P-L Biochemicals. Restriction en- donucleases were obtained from Bethesda Research Labora- Although short synthetic oligonucleotides have been used to tories except for Xmn I, which was obtained from New En- screen cDNA libraries and cDNA probes have been used to gland Biolabs. Interferon was assayed at the Interferon screen human genomic libraries (1, 2), synthetic oligonucleo- Production Laboratory at Wadley Institutes using the cyto- tides of less than 20 bases have not been used for isolation of pathic effect-reduction assay (14) on WISH cells (obtained low-copy genes from human genomic libraries. The obvious from Flow Laboratories) challenged with vesicular stomati- advantage of genomic libraries over cDNA libraries is the tis virus. presence of specific genes independent of gene expression. Oligonucleotide Synthesis and Labeling. Probe A (see Re- The synthesis of short oligonucleotides either by the phos- sults) was obtained from BioLogicals (Toronto). Probe B photriester (3) or the phosphoramidite (4) method is a conve- (see Results) was synthesized by the solid-phase phospho- nient technique for generating probes for screening pur- triester method using a Bachem DNA Synthesizer (Bachem poses, especially since the chemistry involved has become Fine Chemicals, Torrance, CA) and purified as described by reliably automated. The improved sensitivity of hybridiza- Itakura and Riggs (3). The two probes were labeled at the 5' tion techniques has resulted in the detection of single-base ends with [y-32P]ATP (New England Nuclear; 5000 Ci/ differences using probes less than 20 nucleotides long (5), mmol, 1 Ci = 37 GBq) using T4-infected E. coli polynucleo- permitting the use of such probes for diagnosis of genetic tide 5'-hydroxyl-kinase (P-L Biochemicals). The end-labeled diseases (6). They have also been used for screening cDNA DNA probes were separated from unincorporated [y- libraries that have been enriched in specific gene sequences 32P]ATP by gel filtration through a Sephadex G-50 column (1). and filtration through a 0.2-gm Acrodisc filter (Gelman) (2, Utilizing 17-base oligonucleotides, we have optimized the 7). Specific activities of the probes were 2-5 x 108 cpm/,ug. plaque-hybridization screening procedure and have been Screening the A Phage Library for IFN Clones. The human able to isolate several interferon-a (IFN-a) genes from the genomic library in Charon 4A (15) was obtained from T. human in 4A Maniatis. Phage were used to infect E. coli DP-50 [supF genomic library contained Charon (2, 7). Previ- supE dapD8 lacY (gal-uvrB) thyA nalAr hsd] at a density of 1 ously, human IFN-a genes have been isolated from cDNA x 104 plaque-forming units (pfu) per 80-cm2 dish. A total of libraries made using mRNA from virus-induced leukocytes 180,000 pfu were screened separately with each probe using (8, 9). Certain IFN-a genes isolated from such a human a modification (7) of the plaque-hybridization method of cDNA library and expressed in Escherichia coli are undergo- Benton and Davis (16). Duplicate nitrocellulose-filter ing extensive analysis in preclinical (10) and clinical trials (Schleicher & Schuell BA85-SD) copies were made from (11) of their utility in producing IFN-as as antiviral and anti- on filter tumor agents. IFN-a genes have also been isolated from a each plate. The DNA was alkali-denatured paper human genomic library using IFN-a cDNAs as probes (12). A detailed comparison of the different IFN-a genes has per- Abbreviations: IFN, interferon; pfu, plaque-forming units; kb, kilo- base pair(s). *Present address: Biotechnology Division, Phillips Research Cen- The publication costs of this article were defrayed in part by page charge ter, Phillips Petroleum Company, Bartlesville, OK 74004. payment. This article must therefore be hereby marked "advertisement" tTo whom correspondence and reprint requests should be ad- in accordance with 18 U.S.C. §1734 solely to indicate this fact. dressed. 6451 Downloaded by guest on October 1, 2021 6452 Genetics: Torczynski et aL Proc. NatL Acad. Sci. USA 81 (1984) saturated with 0.5 M NaOH/1.5 M NaCl, neutralized on pa- 100,000 x g for 1 hr at 40C. The supernatant was assayed for per saturated with 1 M Tris HCl, pH 7.5, and again neutral- IFN activity as described above. ized on paper saturated with 0.5 M Tris HCl, pH 7.5/1.5 M NaCl. The filters were baked in a vacuum oven at 80'C for 2 RESULTS hr. Prehybridization was performed at 37TC in 0.9 M Construction of Synthetic Probes. Part of the strategy em- NaCl/6.0 mM Na2EDTA/19.8 mM Tris-HCl, pH 8.0/0.1% ployed in our isolation of human IFN-a genes from a human Ficoll/0.1% polyvinylpyrrolidone/0.1% bovine serum albu- genomic library involved the construction of short synthetic min/0.1% NaDodSO4/10% dextran sulfate. After overnight probes homologous to well-conserved regions of IFN-a prehybridization, the solution was removed and new hybrid- genes A-H (9). From the published sequences for part of the ization solution (identical to prehybridization solution) con- IFN-a genes A-H (9), two (G + C)-rich regions of homology taining labeled probe at a concentration of 2 ng/ml was add- contained within the gene sequences defined by bases 401- ed. Hybridizations were performed at 370C for 20 hr with 500 were selected as the bases for probe synthesis. constant agitation by rotation. Filters were washed four Probe A (5'-C-A-G-C-C-A-G-G-A-T-G-G-A-G-T-C-C-3') times (20 min per wash) at room temperature in 0.9 M is homologous to IFN-aB, -aC, -aE, -aH, and -aL and con- NaCl/90 mM sodium citrate, pH 7, and twice at 450C (1 hr tains one mismatch with IFN-aA, -aD, -aF, and -aK and two per wash) in the same buffer containing 0.1% NaDodSO4. mismatches with IFN-aG (9, 13). Probe B (5'-C-C-T-C-C-C- Autoradiography was done for 64 hr at -80'C using Kodak A-G-G-C-A-C-A-A-G-G-G-3') is homologous to IFN-aA, XAR film plus two intensifying screens (DuPont Cronex Hi- -aC, -aD, -aH, -aK, and -aL and has one mismatch with Plus). Positive clones were identified and isolated by several IFN-aB, -aE, -aF, and -aG. cycles of plaque purification and phage DNA stocks were -Screening the Human Genomic Library. A human genomic prepared as described (17). library contained in Charon 4A (15) was screened for IFN-a Restriction and Hybridization Analysis of Cloned DNA. genes using the synthetic probes A and B. From -180,000 Phage DNA from isolated recombinants was digested with pfu, the phage DNA of five foci appeared to hybridize to BamHI, Xmn I, EcoRI, or Dde I under the conditions recom- both probe A and probe B. One example is shown in Fig. 1. mended by the supplier. The digested DNA was fractionated When phage from the five foci were replated at lower den- on agarose gels, transferred to nitrocellulose paper as de- sities (500 pfu/dish), three clones were isolated that hybrid- scribed by Southern (18), and hybridized with probes A and ized to both A and B and were designated X-77, X-85, and X- B under the conditions described for the screening proce- 105.
Load more

Recommended publications
  • New York Science Journal 2016;9(10) 19 Gene Library Ma Hongbao Brookdale University Hospital A
    New York Science Journal 2016;9(10) http://www.sciencepub.net/newyork Gene Library Ma Hongbao Brookdale University Hospital and Medical Center, Brooklyn, New York 11212, USA [email protected] Abstract: A gene library is a collection of gene clones that represents the genetic material of an organism. There are different types of gene libraries, including cDNA libraries, genomic libraries and randomized mutant libraries. The applications of these libraries depend on the source of the original DNA fragments. Generally in a gene library each DNA fragment is uniquely inserted into a cloning vector and the pool of recombinant DNA molecules is then transferred into a population of bacteria or yeast such that each organism contains on average one construct. As the population of organisms is grown in culture, the DNA molecules contained within them are copied and propagated. [Ma Hongbao. Gene Library. N Y Sci J 2016;9(10):19-23]. ISSN 1554-0200 (print); ISSN 2375-723X (online). http://www.sciencepub.net/newyork. 4. doi:10.7537/marsnys091016.04. Keywords: gene; library; clone; organism; DNA; molecule; copy A gene library is a collection of gene clones that cDNA libraries are useful in reverse genetics, but they represents the genetic material of an organism. In only represent a very small (less than 1%) portion of molecular biology, a library is a collection of DNA the overall genome in a given organism. The fragments stored and propagated in a population of applications of cDNA libraries include: (1) Discovery micro-organisms through the process of molecular of novel genes; (2) Cloning of full-length cDNA cloning.
    [Show full text]
  • Library Construction and Screening
    Library construction and screening • A gene library is a collection of different DNA sequences from an organism, • which has beenAlso called genomic libraries or gene banks. • cloned into a vector for ease of purification, storage and analysis. Uses of gene libraries • To obtain the sequences of genes for analysis, amplification, cloning, and expression. • Once the sequence is known probes, primers, etc. can be synthesized for further diagnostic work using, for example, hybridization reactions, blots and PCR. • Knowledge of a gene sequence also offers the possibility of gene therapy. • Also, gene expression can be used to synthesize a product in particular host cells, e.g. synthesis of human gene products in prokaryotic cells. two types of gene library depending upon the source of the DNA used. 1.genomic library. 2.cDNA library Types of GENE library: • genomic library contains DNA fragments representing the entire genome of an organism. • cDNA library contains only complementary DNA molecules synthesized from mRNA molecules in a cell. Genomic Library : • Made from nuclear DNA of an organism or species. • DNA is cut into clonable size pieces as randomly possible using restriction endonuclease • Genomic libraries contain whole genomic fragments including gene exons and introns, gene promoters, intragenic DNA,origins of replication, etc Construction of Genomic Libraries 1. Isolation of genomic DNA and vector. 2.Cleavage of Genomic DNA and vector by Restriction Endonucleases. 3.Ligation of fragmented DNA with the vector. 4.Transformation of
    [Show full text]
  • Construction of Small-Insert Genomic DNA Libraries Highly Enriched
    Proc. Natl. Acad. Sci. USA Vol. 89, pp. 3419-3423, April 1992 Genetics Construction of small-insert genomic DNA libraries highly enriched for microsatellite repeat sequences (marker-selected libraries/CA repeats/sequence-tagged sites/genetic mapping/dog genome) ELAINE A. OSTRANDER*tt, PAM M. JONG*t, JASPER RINE*t, AND GEOFFREY DUYKt§ *Department of Molecular and Cellular Biology, 401 Barker Hall, University of California, Berkeley, CA 94720; tHuman Genome Center, Lawrence Berkeley Laboratory, 1 Cyclotron Road, 74-157, Berkeley, CA 94720; and §Department of Genetics, Howard Hughes Medical Institute, Harvard Medical School, 25 Shattuck Street, Boston, MA 02115 Communicated by Philip Leder, January 8, 1992 ABSTRACT We describe an efficient method for the con- Generation of a high-density map of markers for an entire struction of small-insert genomic libraries enriched for highly genome or a single chromosome requires the isolation and polymorphic, simple sequence repeats. With this approach, characterization of hundreds of markers such as microsatel- libraries in which 40-50% of the members contain (CA). lite repeats (10, 11). Two simple yet tedious approaches have repeats are produced, representing an =50-fold enrichment generally been used for this task. One approach is to screen over conventional small-insert genomic DNA libraries. Briefly, a large-insert genomic library with an end-labeled (CA),, or a genomic library with an average insert size of less than 500 (TG),, oligonucleotide (n > 15). Clones that hybridize to the base pairs was constructed in a phagemid vector. Ampliflcation probe are purified and divided into subclones, which are of this library in a dut ung strain ofEscherchia coli allowed the screened by hybridization for a fragment containing the recovery of the library as closed circular single-stranded DNA repeat.
    [Show full text]
  • Cdna Libraries and Expression Libraries
    Solutions for Practice Problems for Recombinant DNA, Session 4: cDNA Libraries and Expression Libraries Question 1 In a hypothetical scenario you wake up one morning to your roommate exclaiming about her sudden hair growth. She has been supplementing her diet with a strange new fungus purchased at the local farmer’s market. You take samples of the fungus to your lab and you find that this fungus does indeed make a protein (the harE protein) that stimulates hair growth. You construct a fungal genomic DNA library in E. Coli with the hope of cloning the harE gene. If you succeed you will be a billionaire! You obtain DNA from the fungus, digest it with a restriction enzyme, and clone it into a vector. a) What features must be present on your plasmid that will allow you to use this as a cloning vector to make fungal genomic DNA library. Your vector would certainly need to have a unique restriction enzyme site, a selectable marker such as the ampicillin resistance gene, and a bacterial origin of replication. Other features may be required depending upon how you plan to use this library. b) You clone your digested genomic DNA into this vector. The E. coli (bacteria) cells that you will transform to create your library will have what phenotype prior to transformation? Prior to transformation, the E. coli cells that you will transform will be sensitive to antibiotic. This allows you to select for cells that obtained a plasmid. c) How do you distinguish bacterial cells that carry a vector from those that do not? Cells that obtained a vector will have obtained the selectable marker (one example is the ampicillin resistance gene).
    [Show full text]
  • Genomic Organization of Borna Disease Virus
    Proc. Natl. Acad. Sci. USA Vol. 91, pp. 4362-4366, May 1994 Neurobiology Genomic organization of Borna disease virus (central nervous system Infection/behavioral disorders/negative-strand RNA viruses) THOMAS BRIESE*t, ANETTE SCHNEEMANN*, ANN J. LEWIS*, YOO-SUN PARK*, SARA KIM*, HANNS LUDWIGt, AND W. IAN LIPKIN**§¶ Departments of *Neurology, *Anatomy and Neurobiology, and Microbiology and Molecular Genetics, University of California, Irvine, CA 92717; and tInstitute of Virology, Freie Universitit Berlin, Nordufer 20, D 13353 Berlin, Germany Communicated by Hilary Koprowski, January 27, 1994 ABSTRACT Borna disease virus is a neurotropic negative- RNA. The 5'-terminal sequence from each library was used strand RNA virus that infects a wide range ofvertebrate hosts, to design an oligonucleotide primer for construction of the causing disturbances in movement and behavior. We have next library. cloned and sequenced the 8910-nucleotide viral genome by DNA Sequencing and Sequence Analysis. Plasmid DNA was using RNA from Borna disease virus particles. The viral sequenced on both strands by the dideoxynucleotide chain- genome has complementary 3' and 5' termini and contains termination method (13) using a modified bacteriophage T7 antisense information for five open reading frames. Homology DNA polymerase (Sequenase version 2.0; United States to Filoviridae, Paramyxoviridae, and Rhabdoviridae is found Biochemical). Five to 10 independent clones from each in both cistronic and extracistronic regions. Northern analysis library were sequenced with overlap so that each region of indicates that the virus transcribes mono- and polycistronic the genomic RNA was covered by at least 2 clones. Four RNAs and uses terminatlon/polyadenylylation signals remi- libraries were analyzed, yielding =8.9 kb of continuous niscent ofthose observed in other negative-strand RNA viruses.
    [Show full text]
  • Recombinant DNA Resources for the Comparative Genomics of Ancylostoma Ceylanicum
    bioRxiv preprint doi: https://doi.org/10.1101/092494; this version posted December 17, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Title: Recombinant DNA resources for the comparative genomics of Ancylostoma ceylanicum. Authors: Wadim J. Kapulkin1,5,6#, Adriana Magalska1, Ewa Janecka1, Arkadiusz Ciesielski2,4, Malgorzata Lobocka2, Jerzy M. Behnke3, Halina Wedrychowicz1 # corresponding author 1. Faculty of Veterinary Medicine, Grochowska 272, 03-849 Warsaw, Poland 2. Institute for Biochemistry and Biophysics –PAS, Pawinskiego 5a, 02-106 Warsaw, Poland 3. School of Life Science, University of Nottingham, University Park, NG7 2RD Nottingham, U.K. 4. Department of Chemistry, University of Warsaw, Pasteura 1, 02-093 Warsaw, Poland Present affiliation: 5. Veterinary Consultancy, Conrada 16/65, 01-922 Warsaw, Poland 6. Mobile Veterinary Consultancy, Nottingham, U.K. Phone: (+44)7466449215 e-mail: [email protected] Keywords: Ancylostoma ceylanicum, Recombinant DNA library, SL1 spliced leader, cDNA, Bacterial Artificial Chromosome library, NUMTs 1 bioRxiv preprint doi: https://doi.org/10.1101/092494; this version posted December 17, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under
    [Show full text]
  • Construction of Plant Bacterial Artificial Chromosome (Bac) Libraries: an Illustrated Guide
    1 22nd EEDDIITTIIOONN ((22000022)) CONSTRUCTION OF PLANT BACTERIAL ARTIFICIAL CHROMOSOME (BAC) LIBRARIES: AN ILLUSTRATED GUIDE Daniel G. Peterson1, Jeffrey P. Tomkins2, David A. Frisch3, Rod A. Wing2, and Andrew H. Paterson1, 4 1 Center for Applied Genetic Technologies (CAGT), University of Georgia, Athens, GA 30602 2 Clemson University Genomics Institute (CUGI), Clemson University, Clemson, SC 29634 3 Biotechnology Center, University of Wisconsin, Madison, WI 53706 4 Department of Crop and Soil Sciences, and Department of Genetics, University of Georgia, Athens, GA 30602 Corresponding author: Daniel G. Peterson; Plant Genome Mapping Laboratory; University of Georgia; Room 162, Riverbend Research Center; 110 Riverbend Road; Athens, GA 30602, USA Phone: (706) 583-0167, Fax: (706) 583-0160, e-mail: [email protected] 2 PRINCIPAL REVISIONS MADE SINCE ORIGINAL PUBLICATION IN THE JOURNAL OF AGRICULTURAL GENOMICS (JAG), VOLUME 5, 2000: 1) CHAPTER 7 (a) Recent experiments have shown that the Percoll gradient step is not necessary to get nuclear preparations of sufficient quality. Thus this step has been deleted. (b) EGTA and L-lysine have been made standard components of MEB and MPDB solutions. These compounds greatly reduce DNA damage caused by endogenous nucleases. 2) CHAPTERS 7, 9, and 10 - PVP is no longer added to the lysis buffer or wash buffers (WB-A, WB- B, and WB-C). PVP often precipitates out of solution to form a brown gel in which the agarose/nuclei plugs may get stuck. Lysis buffer is now made 6 mM EGTA and 200 mM L-lysine. 3) CHAPTER 13 - We no longer recommend the use of GELase to isolate BAC insert DNA from plugs.
    [Show full text]
  • Construction and Characterization of a Half Million Clone BAC Library of Durum Wheat (Triticum Turgidum Ssp
    Theor Appl Genet (2003) 107:931–939 DOI 10.1007/s00122-003-1331-z A. Cenci · N. Chantret · X. Kong · Y. Gu · O. D. Anderson · T. Fahima · A. Distelfeld · J. Dubcovsky Construction and characterization of a half million clone BAC library of durum wheat (Triticum turgidum ssp. durum) Received: 10 January 2002 / Accepted: 14 March 2003 / Published online: 27 June 2003 Springer-Verlag 2003 Abstract Durum wheat (Triticum turgidum ssp. durum, randomly selected BAC clones was 131 kb, resulting in a 2n =4x = 28, genomes AB) is an economically important coverage of 5.1-fold genome equivalents for each of the cereal used as the raw material to make pasta and two genomes, and a 99.4% probability of recovering any semolina. In this paper we present the construction and gene from each of the two genomes of durum wheat. Six characterization of a bacterial artificial chromosome known copy-number probes were used to validate this (BAC) library of tetraploid durum wheat cv. Langdon. theoretical coverage and gave an estimated coverage of This variety was selected because of the availability of 5.8-fold genome equivalents. Screening of the library substitution lines that facilitate the assignment of BACs to with 11 probes related to grain storage proteins and starch the A and B genome. The selected Langdon line has a 30- biosynthesis showed that the library contains several cM segment of chromosome 6BS from T. turgidum ssp. clones for each of these genes, confirming the value of the dicoccoides carrying a gene for high grain protein library in characterizing the organization of these impor- content, the target of a positional cloning effort in our tant gene families.
    [Show full text]
  • Solutions for Recombinant DNA Unit Exam
    Solutions for Recombinant DNA Unit Exam Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves after the first G. Does cleavage by BamHI result in a 5’ or 3’ overhang? What is the sequence of this overhang? 5’ GGATCC 3’ 3’ CCTAGG 5’ Cleavage by BamHI results in a 5’ overhang as seen here: 5’ G 3’ CCTAG b) BclI cleaves after the first T. Does cleavage by BclI result in a 5’ or 3’ overhang? What is the sequence of this overhang? 5’ TGATCA 3’ 3’ ACTAGT 5’ 5’ T Cleavage by BclI results in a 5’ overhang as seen here: 3’ ACTAG c) You are given the DNA shown below. 5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’ i) If this DNA was cut with BamHI, how many DNA fragment would you expect? Write out the sequence of these double-stranded DNA fragments. 5’ ATTGAG 3’ 5’ GATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAG 5’ 3’ GCATTACACAGGACTAGTGCGAGGTGC 5’ ii) If the DNA shown above was cut with BclI, how many DNA fragment would you expect? Write out the sequence of these double-stranded DNA fragments. 5’ ATTGAGGATCCGTAATGTGTCCT 3’ 5’ GATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAG 5’ 3’ TGCGAGGTGC 5’ d) You can ligate the smaller restriction fragment produced in (c, i) to the smaller restriction fragment produced in (c, ii). Write out the sequence of the resulting recombinant fragment. 5’ ATTGAGGATCACGCTCCACG 3’ 3’ TAACTCCTAGTGCGAGGTGC 5’ e) Could you cut the fragment from (d) with either BamHI or BclI? Explain.
    [Show full text]
  • DNA Libraries (PART-I)
    NPTEL – Biotechnology – Fundamentals of Biotechnology Lecture 10: DNA Libraries (PART-I) Introduction-Gene sequence are arranged in genome in a randon fashion and selecting or isolating a gene is a big task especially when the genomic sequences are not known. A small portion of genome is transcribed to give mRNA where as a major portion remained untranscribed. Hence, there are two ways to represent a genomic sequence information into the multiple small fragments in the form of a library: (1) Genomic library (2) cDNA library. Preparation of Genomic Library-A genomic library represents complete genome in multiple clones containing small DNA fragments. Depending upon organism and size of genome, this library is either prepared in a bacterial vector (discussed later in future lectures) or in yeast artificial chromosome (YAC). An outline of the construction of genomic library is given in Figure 10.1. it has following steps: 1. Isolation of genomic DNA 2. Generation of suitable size DNA fragments 3. Cloning in suitable vector system (depending on size) 4. Transformation in suitable host . Joint initiative of IITs and IISc – Funded by MHRD Page 1 of 65 NPTEL – Biotechnology – Fundamentals of Biotechnology Figure 10.1: Contruction of Genomic library. Joint initiative of IITs and IISc – Funded by MHRD Page 2 of 65 NPTEL – Biotechnology – Fundamentals of Biotechnology 1. Isolation of genomic DNA- Isolation of genomic DNA has following steps: 1. Lysis of cells with detergent containing lysis buffer. 2. Incubation of cells with digestion buffer containing protease-K, SDS to release genomic DNA from DNA-protein complex. 3. Isolation of genomic DNA by absolute alchol precipitation.
    [Show full text]
  • Practice Problems for Recombinant DNA, Session 4: Cdna Libraries and Expression Libraries
    Practice Problems for Recombinant DNA, Session 4: cDNA Libraries and Expression Libraries Question 1 In a hypothetical scenario you wake up one morning to your roommate exclaiming about her sudden hair growth. She has been supplementing her diet with a strange new fungus purchased at the local farmer’s market. You take samples of the fungus to your lab and you find that this fungus does indeed make a protein (the harE protein) that stimulates hair growth. You construct a fungal genomic DNA library in E. Coli with the hope of cloning the harE gene. If you succeed you will be a billionaire! You obtain DNA from the fungus, digest it with a restriction enzyme, and clone it into a vector. a) What features must be present on your plasmid that will allow you to use this as a cloning vector to make fungal genomic DNA library. b) You clone your digested genomic DNA into this vector. The E. coli (bacteria) cells that you will transform to create your library will have what phenotype prior to transformation? c) How do you distinguish bacterial cells that carry a vector from those that do not? d) How do you distinguish bacterial cells that carry a recombinant vector from those that carry the original cloning vector? e) You could screen your library by hybridization with a probe. • What information would you need to do this screen? • What would you use as a probe? You would use a segment of SS DNA or denatured DS DNA complementary to the harE gene. • Would the entire harE gene need to be present in a recombinant vector for your screen to work? Explain.
    [Show full text]
  • Construction of Genomic Library Mcba P7 T
    CONSTRUCTION OF GENOMIC LIBRARY Sources: 1. Biotechnology By B.D. Singh, 2. Gene cloning and DNA analysis By TA Brown, 3. Advance and Applied Biotechnology By Marian Patrie, 4. Molecular Biotechnology By Glick et al and 5. Principle of Gene Manipulation By sandy b Primrose et al. Dr. Diptendu Sarkar [email protected] Introduction • A genomic library is an organism specific collection of DNA, covering the entire genome of an organism. • A genomic library is a set of recombinant clones that contains all of the DNA present in an individual organism. • Genomic libraries can be retained for many years,and propagated so that copies can be sent from one research group to another. • It contains all DNA sequences such as : 1. expressed genes, 2. non-expressed genes, 3. exons and introns, 4. promoter and terminator regions and 5. intervening DNA sequences. 12/10/2019 DS/RKMV/MB 2 Construction of genomic library • Construction of a genomic DNA library involves o isolation, o purification and fragmentation of genomic DNA o followed by cloning of the fragmented DNA using suitable vectors. • The eukaryotic cell nuclei are purified by digestion with protease and organic (phenol- chloroform) extraction. • The derived genomic DNA is too large to incorporate into a vector, and needs to be broken up into desirable fragment sizes. • Fragmentation of DNA can be achieved by physical method and enzymatic method. Preparation of a gene library in a cosmid • The library created contains representative vector. copies of all DNA fragments present within the genome. 12/10/2019 DS/RKMV/MB 3 Mechanisms for cleaving DNA (a) Physical method It involves mechanical shearing of genomic DNA using a narrow-gauge syringe needle or sonication to break up the DNA into suitable size fragments that can be cloned.
    [Show full text]