Parsons et al. BMC Res Notes (2017) 10:753 https://doi.org/10.1186/s13104-017-3089-4 BMC Research Notes

RESEARCH NOTE Open Access Identifcation of 24 new microsatellite loci in the sweat bee Lasioglossum malachurum (Hymenoptera: Halictidae) Paul J. Parsons1,2*, Christelle Couchoux1, Gavin J. Horsburgh2, Deborah A. Dawson2 and Jeremy Field1

Abstract Objective: The objective here is to identify highly polymorphic microsatellite loci for the Palaearctic sweat bee Lasioglossum malachurum. Sweat bees (Hymenoptera: Halictidae) are widespread pollinators that exhibit an unusually large range of social behaviours from non-social, where each female nests alone, to eusocial, where a single queen reproduces while the other members of the colony help to rear her ofspring. They thus represent excellent models for understanding social evolution. Results: 24 new microsatellite loci were successfully optimized. When amplifed across 23–40 unrelated females, the number of alleles per locus ranged from 3 to 17 and the observed heterozygosities 0.45 to 0.95. Only one locus showed evidence of signifcant deviation from Hardy–Weinberg equilibrium. No evidence of linkage disequilibrium was found. These 24 loci will enable researchers to gain greater understanding of colony relationships within this spe- cies, an important model for the study of eusociality. Furthermore, 22 of the same loci were also successfully amplifed in L. calceatum, suggesting that these loci may be useful for investigating the ecology and evolution of sweat bees in general. Keywords: Halictidae, Microsatellite, Lasioglossum malachurum, Lasioglossum calceatum, Sweat bee

Introduction Western Palaearctic and because it often occurs in large, Sweat bees (Hymenoptera: Halictidae) are widespread dense nesting aggregations that facilitate behavioural pollinators which exhibit an unusually large range of research [3–6]. Microsatellite markers are widely used in social behaviours from non-social, where each female social evolution research, for example to investigate pop- nests alone, to eusocial, where a single queen reproduces ulation structure, estimate genetic relatedness and assign while the other members of the colony help to rear her ofspring to parents [7–9]. Microsatellite loci have been ofspring [1]. Sweat bees are also unusual in that social developed for this species previously [3, 10] but most of and non-social species are often closely related, with mul- them have comparatively low heterozygosities and are tiple evolutionary transitions having occurred between difcult to combine into multiplex reactions because of sociality and non-sociality [2]. Sweat bees thus represent highly specifc annealing temperatures and polymer- excellent models for understanding social evolution [1, ase chain reaction (PCR) mixes. Here, we report 24 new 2]. Here we present a new set of microsatellite loci devel- microsatellite markers developed for L. malachurum, 14 oped from Lasioglossum malachurum (Kirby, 1802), a of which have been efciently amplifed in two multiplex haplodiploid eusocial species that has been particularly sets. Tese markers should substantially aid future stud- well studied, mainly because it is widely distributed in the ies on sweat bee behaviour and ecology.

Main text *Correspondence: [email protected] 1 Centre for Ecology and Conservation, University of Exeter, Penryn Lasioglossum malachurum females were sampled Campus, Cornwall TR10 9EZ, UK from a feld site at Denton in East Sussex, UK in 2015. Full list of author information is available at the end of the article Genomic DNA was extracted from head, abdomen

© The Author(s) 2017. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/ publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Parsons et al. BMC Res Notes (2017) 10:753 Page 2 of 7

and/or legs using an ammonium acetate extraction be scored reliably across the test sample (23–40 females method [11, 12]. DNA concentration was quanti- all from the same feld site at Denton) (Table 1). Te fed using a Fluostar Optima fuorimeter and its qual- remaining 29 were found to be either monomorphic or ity assessed using gel electrophoresis. DNA from one unreliable following our PCR methodology (Table 2). It foundress (female M4) from Denton was digested using is possible that with more specifc optimization, some MboI and the fragments enriched for dinucleotide and of these could be used in future studies. We success- tetranucleotide repeat motifs (following [13]). An Illu- fully incorporated 14 of the optimized markers into mina paired end library was then compiled using this two multiplex panels (using the above PCR reagents repeat-enriched genomic DNA. Te NEBNext Ultra and concentrations) with no dropout or artifacts pro- library preparation kit (New England Biolabs Inc. duced (Table 1). Cat. No. E7370S) protocol was followed and DNA Te numbers of alleles and heterozygosities were cal- sequencing was conducted using a MiSeq Benchtop culated for each of the 24 loci using CERVUS v3.0.6 and Sequencer (Illumina). Primer sets were designed from with the sample sizes shown in Table 1 [17]. Tests for 53 microsatellite sequences using PRIMER3 v0.4.0 [14]. deviation from Hardy–Weinberg equilibrium (HWE) Sequences were confrmed to be unique using BLAST and linkage disequilibrium (LD) were conducted using software [15]. GENEPOP web version 4.2 [18]. To correct p-values in Each 2 µl PCR contained approximately 10 ng of multiple tests, the Q Value was applied to LD p-values. air-dried genomic DNA, 0.2 µM of each primer and Te q value is a measure of the signifcance in terms of 1 µl QIAGEN Multiplex PCR mix (QIAGEN Inc. Cat. false discovery rate, rather than conventional Bonfer- No. 20614) following [16]. As we required loci that roni correction which attempts to measure signifcance could be reliably multiplexed together for efcient use in terms of false positives only [19]. Observed levels of we designed primers with very similar melting tem- heterozygosity ranged from 0.45 to 0.95 with 3–17 alleles peratures (± 2 °C) enabling these to be amplifed at per locus (Table 1). Only Lma31 deviated from HWE the same annealing temperature (57 °C). Te follow- (p = 0.049). No groups of loci displayed LD, providing ing PCR profle was used: 95 °C for 15 min, followed no evidence of physical linkage based on the individuals by 44 cycles of 94 °C for 30 s, 57 °C for 90 s, 72 °C for genotyped. 90 s and fnally 60 °C for 30 min. PCR amplifcation Tese loci are likely to be useful for investigating was performed using a DNA Engine Tetrad ®Ter- the ecology and behaviour of L. malachurum and also mal Cycler (MJ Research, Bio-Rad, Hemel Hempstead, potentially that of other sweat bees. Indeed, we have Herts, UK). PCR products were genotyped on an ABI successfully amplifed 22 of the 24 loci in L. calceatum 3730 48-well capillary DNA Analyser using the LIZ size (Scopoli) individuals sampled in the UK; only Lma20 standard (Applied Biosystems Inc. Cat. No. 4322682). and Lma21 failed to amplify and 17 of the 22 loci that Alleles were scored using GENEMAPPERv3.7 software did amplify were polymorphic (Table 1; Davison & (Applied Biosystems Inc.). Of the 53 markers, 24 could Field, in prep.). Parsons et al. BMC Res Notes (2017) 10:753 Page 3 of 7 c L. cal ­ success P P P F F M P P P M P P P P P P 0.017 0.035 0.007 0.003 0.034 0.032 0.084 0.027 Est. F (null) Est. − 0.037 − 0.026 − 0.017 − 0.026 − 0.063 − 0.075 − 0.009 − 0.034 HWE p value 0.712 0.413 0.186 0.087 0.053 0.179 0.723 0.725 0.103 0.162 0.071 0.854 0.049 0.718 0.298 0.68 HExp 0.83 0.701 0.896 0.889 0.85 0.838 0.891 0.883 0.745 0.727 0.804 0.407 0.664 0.684 0.785 0.75 HObs 0.87 0.667 0.825 0.872 0.868 0.85 0.925 0.868 0.816 0.649 0.737 0.447 0.55 0.675 0.737 0.789 , size range , size b Expected allele ­ size 150 150 170 210 137 167 172 204 154 169 189 237 146 176 188 205 139–185 131–181 162–192 196–262 135–156 154–218 141–181 201–231 137–167 165–177 177–199 225–235 142–164 165–179 185–199 205–237 7 6 9 3 6 6 8 7 N alleles 10 10 14 17 11 11 13 12 tested a N 23 38 37 39 40 39 38 40 40 38 38 38 40 40 38 38 Primer sequence (5 ′ –3 ) sequence Primer R: TTGATTATCAGCGAGATGAGC R: CTCCCGGGTTGTCATGTAAG R: CGGCTACGTTCCACTATGAAG R: TTGCGCAAGCCGTTCTAC R: CCGATTCCTTCACAGACACG R: TTAACATCGTTCGCTTCTCG R: TTCGGGTACCGTTCAGTCTC R: GTATCGTGCGTGCGTGTC F: CCGAGTTCATCAACATCCTC F: AAAGCGTTGCGAGACACC F: CGTTACCGCGTTGGTTTC F: CCAACCGAACACCAACTTTC F: CAACGCGTGACAGGTGATAC F: AGCGCTCGATGACTGTCG F: CGGTAAACTTGCTTCGACCTG F: GATAATCAATGGTAATCGGTTGG F: TCCTCGGACAAGGAGATACG F: GCTGGCAGCTCTGGAGAAG F: F: CTCGTCCCTCGTGTGACTC F: TCCGTCTCTGGTCGATACTG F: CGCACTCCGCTTTTCCTC TCTGAACAGTACGGAACAATGC F: GGCCCTTCGACTTTGTTGF: CGAGCCTATGCAGAGAACAG F: R: AGCATAATGGAAACCCAACG R: GTCTTGTCTAACCGCAACAGC R: TGACGGCCATTTAGTTCGTC R: ACAGCAGCATCTGAACTTGC R: CGTCACCAGGAGAGCAAGG R: ACCGACACGGGAGAGAGAG R: GAATCTCTGGGTGCTCTAACG R: TGGATGGCTGCTGAGTAAAC 6 10 8 6 9 CA TT 16 13 13 13 14 14 19 12 4 12 16 12 13 (GA) (CT) Repeat Repeat motif (TC) (AG) (AG) (AG) (GA) (GA) (GA) (GA) (GACGA) (TG) (CT) (CT) (TCTT) (CT) (CT) (CTAT ) Panel Panel and dye 1 NED PET 6-FAM NED 6-FAM PET PET VIC PET 1 1 2 2 2 1 1 2 GenBank sequence accession number MG273262 MG273263 MG273266 MG273267 MG273268 MG273269 MG273270 MG273271 MG273273 MG273264 MG273265 MG273272 MG273274 MG273275 MG273285 MG273276 microsatellites L. malachurum of 24 new Characterisation 1 Table name Locus Lma02 Lma03 Lma14 Lma20 Lma21 Lma23 Lma24 Lma27 Lma30 Lma04 Lma12 Lma29 Lma31 Lma34 Lma36 Lma39 Parsons et al. BMC Res Notes (2017) 10:753 Page 4 of 7 c L. cal ­ success P P M M P P M P 0.051 0.066 0.057 Est. F (null) Est. − 0.029 − 0.016 − 0.043 − 0.055 − 0.056 HWE p value 0.74 0.623 0.14 0.786 0.726 0.259 0.575 0.053 HExp 0.906 0.733 0.722 0.62 0.763 0.545 0.732 0.759 HObs 0.947 0.75 0.763 0.684 0.684 0.475 0.8 0.675 , size range , size b Expected allele ­ size 150 167 206 209 181 243 156 228 155–189 161–169 193–209 189–209 163–209 237–243 151–159 217–241 5 6 4 8 4 5 9 N alleles 14 tested a N 38 40 38 38 38 40 40 40 Primer sequence (5 ′ –3 ) sequence Primer R: CAGAGTGCGTCGCTTGTTAG F: CGTTCGTTCGTTCGTTACTG F: F: ACCATCGCCCTTCCACTAC GTTGGATGCATCTGGAGGAC F: GAGAGGGTGGTTGCACTACG F: CGTTTAACCGGCTCGCTAC F: GAGAAATTGCCAGCAAACATC F: CGGCAACTGCTTGCATAAC F: ACGCGGGATTACTTTCAATC F: R: CCGAAACTATTCGCCCATC R: TGCGGTGGTTATTGATTTCC R: CTCGTGGAATCGAACTCACC R: CCGCGAATAAGTGGAGTGTC R: AGTTTCGTGGAAGGGAACG R: CCCGTAGCACTCGCATACTC R: CCAATTATCGGGTGAAGGAG 10 12 CG 12 13 12 3 11 11 14 (CT) Repeat Repeat motif (GA) (AG) (TC) (GAAA) (CT) (CT) (TG) (AC) Panel Panel and dye 2 VIC NED 6-FAM VIC NED 2 1 1 1 GenBank sequence accession number MG273277 MG273278 MG273279 MG273280 MG273281 MG273282 MG273283 MG273284 continued value when testing for deviation from Hardy–Weinberg equilibrium; F(Null): Estimated frequency equilibrium; of F(Null): Estimated Hardy–Weinberg from deviation individual (sample M4); Hobs and HExp: observed for Based on the sequenced when testing HWE: p value and expected heterozygosities; females genotyped (all from the same population at Denton) at the same population genotyped (all from females L. malachurum unrelated N: number of diploid, monomorphic, p polymorphic M monomorphic, amplify, individuals: F failed to 14 L. calceatum across success Amplifcation

null alleles 1 Table name Locus Lma40 a b c Lma42 Lma48 Lma49 Lma50 Lma51 Lma52 Lma53 Parsons et al. BMC Res Notes (2017) 10:753 Page 5 of 7 dropping (tested (tested dropping Reason for in 23–24 individuals) Monomorphic Monomorphic peaks False No product No product Monomorphic Stutter peaks False peaks False No product Monomorphic peaks/Stutter False peaks False peaks/Stutter False No product Monomorphic No product peaks False † size 108 178 184 189 192 201 206 111 154 179 187 189 193 203 151 180 188 193 Expected allele ­ R: TCGAGTTCTCCCTCCTCGTATC R: AACAAAGAATGAACGAACGTG R: ACGGGTCTGTTCACCCTTTG R: CAATCTCAACCGTGTTCGTC R: ATCTGAAATCGTGGCTGGTC R: TACTTCGCGTGCCTGTCTC R: AACCTCAACCGTGTTCGTC R: GCCCTGCGTCTTCTCCTC R: GCGGTTGGCTGTCATAAGTG R: GCTTCATCCCTTTACTCCATAGC R: CGTCGAGGATAAGGTTACGG R: TGATACACCGGGAACCATTC R: GAATGAACCACGCCGAAG R: ACAATGTGTGTTCCGGTCAG R: AAAGACGAGGCTCAAAGAAGC R: TAAAGTGGCGAGTGATGGAC R: TTCCGGCACGTTTATGTAGC R: CAAACGCGAGTCAATAAATCC F: AACGCCTCGGTGAACCTG F: ATGCGTCTAAATCGTTCCTG F: CGGGAACGACGGAGAGAG F: GTCATGGAGAGGGTGGTTG F: CTATCCGAGGCCTGTACACTG F: ACGGGACTGAAAGGGACAC F: GAGACAACGAGGGAGAAAGC F: CTTGTACCACGCGTACACACC F: GCTCATCGAGGACGAGGTG F: GGACAGTCCGACGAAGGAG F: ACATTGTTCACCGGACAAATC F: GTCAACGGTAATCCGAGGTG F: GGGATACTAGACAGCCGGAATATAG F: TGTAAACGGCCGAAGTGTC F: GCCGGACCAGATTAAATGC F: CGAAATACCGTTAACCAACATC F: CTTCGATTCCTCGGGTCAC F: ATTCGCGACAATGAACGAG F: Primer sequence Primer 5 5 7 7 5 7 5 7 6 7 11 16 16 18 17 20 11 20 (TGAC) (TTTC) (AG) (GAAA) (TTCT) (AGAA) (AAAG) (GA) (CT) (TGCT) (TC) (TC) (AG) (TC) (TCTT) (CTAT ) (AG) (CT) Repeat motif Repeat MG273287 MG273288 MG273289 MG273286 MG273290 MG273291 MG273292 MG273293 MG273294 MG273295 MG273296 MG273297 MG273298 MG273299 MG273300 MG273301 MG273302 MG273303 GenBank sequence accession accession GenBank sequence number multiplex panels multiplex for rejected and not considered were of a further that Identifcation 29 markers Lma01 Lma05 Lma06 Lma07 Lma08 Lma09 Lma10 Lma11 Lma13 Lma15 Lma16 Lma17 Lma18 Lma19 Lma22 Lma25 Lma26 Lma28 2 Table name Locus Parsons et al. BMC Res Notes (2017) 10:753 Page 6 of 7 dropping (tested (tested dropping Reason for in 23–24 individuals) Stutter peaks False No product Monomorphic peaks/Stutter False Stutter peaks False peaks False peaks/Stutter False Monomorphic Stutter † size 152 167 181 190 197 152 178 182 189 190 197 Expected allele ­ F: CGACGTACCTCTGCTTCCTC R: AGGTCACTTAAATGGTGGTTGG F: CTCTTCTCGATTCCGTCTGG R: TTTCGGCTCTTTGCTCTCTC CCTTCGAGAGGTCAGAGCTAAAG F: R: CACGTGGCACCACAAATTC F: GTGGCCTATGCTCCTCTCC R: ATCTGAAATCGTGGCTGGTC AGAGACAAAGGCGGAGACAG F: R: TATCTGCGAGACCGACGA AATGATTGTGAACAGTTTGGTATG F: R: CGAGACTGCAAGAAGTTTCAC TTCAGCCGAGGGTAGCAC F: R: CGTACCATCATCTCGTGTCG ATGAGACTGGCACGACTGTG F: R: ATGCGTCGCTCCCTTAATC F: TTTCGCATCCATCTTCCTTC R: CGCGAATTTCGGTATCTTTC F: TCCCTTTACCTTCCTTTCTCG R: TGCAACATTTGTACCGAACAG CTATCCGAGGCCTGTACACTG F: R: GGGTAAGCAAGCATCGTTTC Primer sequence Primer 5 9 5 5 5 19 17 15 15 16 20 (TC) (GA) (GAGT) (TTCT) (GACA) (TC) (AG) (AG) (CT) (TCCT) (CTTT) Repeat motif Repeat MG273304 MG273305 MG273306 MG273307 MG273308 MG273309 MG273310 MG273311 MG273312 MG273313 MG273314 GenBank sequence accession accession GenBank sequence number continued Based on the sequenced individual (sample M4) Based on the sequenced

Lma32 Lma33 Lma35 Lma37 Lma38 Lma41 Lma43 Lma44 Lma45 Lma46 Lma47 2 Table name Locus † Parsons et al. BMC Res Notes (2017) 10:753 Page 7 of 7

Limitations 2. Danforth BN. Evolution of sociality in a primitively eusocial lineage of bees. Proc Natl Acad Sci USA. 2002;99:286–90. Due to the relatively short read length of the MiSeq 3. Paxton RJ, Arevalo E, Field J. Microsatellite loci for the eusocial Lasioglos- Benchtop Sequencing system we were unable to design sum malachurum and other sweat bees (Hymenoptera, Halictidae). Mol Ecol Notes. 2003;3:82–4. primer sets to amplify greater than 300 bases. Tis may 4. Strohm E, Bordon-Hauser A. Advantages and disadvantages of large however be somewhat fortuitous; the incorporation of colony size in a halictid bee: the queen’s perspective. Behav Ecol. larger markers into multiplex panels often proves prob- 2003;14:546–53. 5. Wyman LM, Richards MH. Colony social organization of Lasioglossum lematic, since they are generally harder to amplify than malachurum Kirby (Hymenoptera, Halictidae) in southern Greece. Insect markers with smaller products and are more susceptible Soc. 2003;50:201–11. to dropout [20]. 6. Zobel MU, Paxton RJ. Is big the best? Queen size, usurpation and nest closure in a primitively eusocial sweat bee (Lasioglossum malachurum). Behav Ecol Sociobiol. 2007;61:435–47. Abbreviations 7. Paxton RJ, Ayasse M, Field J, Soro A. Complex sociogenetic organization HWE: Hardy–Weinberg equilibrium; LD: linkage disequilibrium; PCR: polymer- and reproductive skew in a primitively eusocial sweat bee, Lasioglossum ase chain reaction. malachurum, as revealed by microsatellites. Mol Ecol. 2002;11:2405–16. 8. Field J, Paxton RJ, Soro A, Bridge C. Cryptic plasticity underlies a major Authors’ contributions evolutionary transition. Curr Biol. 2010;20:2028–31. PP: Tested and optimised the primers, scored loci, performed the analysis, 9. Soro A, Field J, Bridge C, Cardinal SC, Paxton RJ. Genetic diferentiation co-wrote the paper. CC: Collected samples, scored loci and assisted with the across the social transition in a socially polymorphic sweat bee, Halictus analysis. GJH: prepared the MiSeq library and designed primer sets. DAD: rubicundus. Mol Ecol. 2010;19:3351–63. Assisted with marker development, primer design, analysis and manuscript 10. Soro A, Ayasse M, Zobel MU, Paxton RJ. Complex sociogenetic organiza- preparation. JF: Wrote the grant application, collected samples and co-wrote tion and the origin of unrelated workers in a eusocial sweat bee, Lasio- the paper. All authors read and approved the fnal manuscript. glossum malachurum. Insect Soc. 2009;56:55–63. 11. Nicholls JA, Double MC, Rowell DM, Magrath RD. The evolution of coop- Author details erative and pair breeding in thornbills Acanthiza (Pardalotidae). J Avian 1 Centre for Ecology and Conservation, University of Exeter, Penryn Campus, Biol. 2000;31:165–76. Cornwall TR10 9EZ, UK. 2 NERC Biomolecular Analysis Facility, Department 12. Richardson DS, Jury FL, Blaakmeer K, Komdeur J, Burke T. Parentage of Animal and Plant Sciences, University of Shefeld, Western Bank, Shef- assignment and extra-group paternity in a cooperative breeder: the feld S10 2TN, UK. Seychelles warbler (Acrocephalus sechellensis). Mol Ecol. 2001;10:2263–73. 13. Armour JAL, Neumann R, Gobert S, Jefreys AJ. Isolation of human simple Acknowledgements repeat loci by hybridization selection. Hum Mol Gen. 1994;3:599–605. We thank Paul Davison for assisting with sample collection and the NERC 14. Rozen S, Skaletsky HJ. PRIMER version 3 on the WWW for general users Biomolecular Analysis Facility—Shefeld, UK for their facilities. and for biologist programmers. In: Krawetz S, Misener S, editors. Bioin- formatics methods and protocols: methods in molecular biology. New Competing interests Jersey: Humana Press; 2000. p. 365–86. The authors declare that they have no competing interests. 15. Altschul SF, Madden TL, Schäfer AA, Zhang J, Zhang Z, Miller W, et al. Gapped BLAST and psi–BLAST: a new generation of protein database Availability of data and materials search programs. Nucleic Acids Res. 1997;25:3389–402. The sequences acquired herein have been submitted to Genbank, Accession 16. Kenta T, Gratten J, Haigh NS, Hinten GN, Slate J, Butlin RK, et al. Multiplex Numbers MG273262–MG273314. SNP-SCALE:a cost-efective medium-throughput single nucleotide poly- morphism genotyping method. Mol Ecol Res. 2008;8:1230–8. Consent for publication 17. Kalinowski ST, Taper ML, Marshall TC. Revising how the computer Not applicable program CERVUS accommodates genotyping error increases success in paternity assignment. Mol Ecol. 2007;16:1099–106. Ethics approval and consent to participate 18. Rousset F. Genepop’007: a complete reimplementation of the Genepop Not applicable software for Windows and Linux. Mol Ecol Res. 2008;8:103–10. 19. Storey J. A direct approach to false discovery rates. J R Stat Soc Series B Funding Stat Methodol. 2002;64:479–98. This work was funded by the UK Natural Environment Research Council (NERC 20. Toouli CD, Turner DR, Grist SA, Morley AA. The efect of cycle number and Grant NE/M003191/1 to J.F.). This project has also received funding from the target size on polymerase chain reaction amplifcation of polymorphic European Research Council (ERC) under the European Union’s Horizon 2020 repetitive sequences. Anal Biochem. 2000;280:324–6. research and innovation programme (Grant Agreement No. 695744 to JF). Submit your next manuscript to BioMed Central Publisher’s Note Springer Nature remains neutral with regard to jurisdictional claims in pub- and we will help you at every step: lished maps and institutional afliations. • We accept pre-submission inquiries Received: 24 August 2017 Accepted: 13 December 2017 • Our selector tool helps you to find the most relevant journal • We provide round the clock customer support • Convenient online submission • Thorough peer review • Inclusion in PubMed and all major indexing services References 1. Schwarz MP, Richards MH, Danforth BN. Changing paradigms in insect • Maximum visibility for your research social evolution: insights from halictine and allodapine bees. Annu Rev Submit your manuscript at Entomol. 2007;52:127–50. www.biomedcentral.com/submit