Spectral Sensitivity of Cone Vision in the Diurnal Murid Rhabdomys Pumilio Annette E

Home , Spectral sensitivity

RESEARCH ARTICLE Spectral sensitivity of cone vision in the diurnal murid Rhabdomys pumilio Annette E. Allen1,*, Joshua W. Mouland2, Jessica Rodgers1, Beatriz Baño-Otálora1, Ronald H. Douglas3, Glen Jeffery4, Anthony A. Vugler4, Timothy M. Brown2 and Robert J. Lucas1

ABSTRACT an array of non-image-forming light responses (e.g. An animal’s temporal niche – the time of day at which it is active – is photoentrainment of the circadian clock). Collectively, these known to drive a variety of adaptations in the visual system. These photoreceptors allow organisms to sense and respond to light include variations in the topography, spectral sensitivity and density of across the broad variations in illumination that they would retinal photoreceptors, and changes in the eye’s gross anatomy and commonly encounter in the natural world. Nevertheless, striking spectral transmission characteristics. We have characterised visual variations in mammalian photoreception have emerged throughout spectral sensitivity in the murid rodent Rhabdomys pumilio (the four- evolution, and the spectral sensitivity, anatomical distribution and striped grass mouse), which is in the same family as (nocturnal) mice relative number of each photoreceptor type can vary greatly and rats but exhibits a strong diurnal niche. As is common in diurnal amongst species (Peichl, 2005). In many cases, this can be ’ species, the R. pumilio lens acts as a long-pass spectral filter, attributedtoashiftinaspecies temporal niche (the time of day at providing limited transmission of light <400 nm. Conversely, we found whichananimalismostlikelytobeactive),whichdefinesboththe strong sequence homologies with the R. pumilio SWS and MWS quality and quantity of environmental light exposure an animal opsins and those of related nocturnal species (mice and rats) whose experiences day to day. SWS opsins are maximally sensitive in the near-UV. We continued Whether they are diurnal or nocturnal, most mammals have to assess in vivo spectral sensitivity of cone vision using retinas that contain two classes of cone photoreceptor, which are electroretinography and multi-channel recordings from the visual preferentially sensitive to different spectral bands owing to their thalamus. These revealed that responses across the human visible expression of either short or medium/long wavelength-sensitive range could be adequately described by those of a single pigment photopigments (SWS and MWS, respectively; Jacobs, 1993). (assumed to be MWS opsin) maximally sensitive at ∼500 nm, but that Within these classes, there are substantial species differences in sensitivity in the near-UV required inclusion of a second pigment spectral sensitivity (Jacobs, 1993; Hunt et al., 2009). There is some evidence to suggest that, at least for SWS pigments, a diurnal whose peak sensitivity lay well into the UV range (λmax<400 nm, probably ∼360 nm). We therefore conclude that, despite the UV- temporal niche is associated with a shift in spectral sensitivity λ – filtering effects of the lens, R. pumilio retains an SWS pigment with a towards longer wavelengths (from max=350 370 nm in nocturnal animals to λmax>400 nm in diurnal animals; Emerling et al., 2015). UV-A λmax. In effect, this somewhat paradoxical combination of long- pass lens and UV-A λ results in narrow-band sensitivity for SWS By comparison, the spectral tuning of rod pigments remains largely max λ cone pathways in the UV-A range. invariant amongst terrestrial mammals, with max values remaining close to 500 nm. As well as the spectral tuning of the visual KEY WORDS: Diurnality, Photoreceptor, Opsin pigments, pre-receptoral filtering by the lens constrains the spectral sensitivity of mammalian vision (Douglas and Jeffery, 2014), and is INTRODUCTION strongly associated with temporal niche. Nocturnal species’ lenses The vast majority of mammalian retinas contain three classes of typically transmit the majority of UV-A light (∼315–400 m), while photoreceptor: the outer-retinal rods and cones, that mediate form day-dwelling mammals have a ‘long-pass’ lens which prevents vision in dim and bright conditions, respectively; and the inner- transmission of shorter wavelength light. Indeed, this filtering retinal intrinsically photosensitive retinal ganglion cells (ipRGCs), property can be used as a good predictor of species’ temporal niche which contribute a lower spatiotemporal resolution representation (Hut et al., 2012). It is thought that limiting UV-A transmission in of the visual environment, supporting aspects of vision as well as diurnal species could serve to reduce damage from UV light (van Norren and Gorgels, 2011) and/or to aid higher acuity vision in diurnal species by minimising the impact of chromatic aberration 1Division of Neuroscience and Experimental Psychology, Faculty of Biology (Lind et al., 2014) and reducing the amount of Rayleigh scatter Medicine and Health, University of Manchester, Manchester, M13 9PT, UK. (Douglas and Jeffery, 2014). The density of cone photoreceptors 2Division of Diabetes, Endocrinology and Gastroenterology, Faculty of Biology Medicine and Health, University of Manchester, Manchester, M13 9PT, UK. across the retina also shows dramatic shifts in nocturnal versus 3Department of Optometry and Visual Science, City, University of London, London, diurnal species (Hut et al., 2012), with the latter classically having a EC1V 0HB, UK. 4Institute of Ophthalmology, University College London, London, greater cone density to match their increased exposure to bright EC1V 9EL, UK. light. Sometimes, that increased density is apparent across the entire *Author for correspondence ([email protected]) retina (such as in the thirteen-lined ground squirrel; Kryger et al., 1998), but it may also occur in spatially localised regions, such as A.E.A., 0000-0003-0214-7076 the primate fovea (reviewed by Ahnelt and Kolb, 2000). This is an Open Access article distributed under the terms of the Creative Commons Attribution Here, we asked whether these general rules hold for a murid License (https://creativecommons.org/licenses/by/4.0), which permits unrestricted use, – – distribution and reproduction in any medium provided that the original work is properly attributed. rodent Rhabdomys pumilio (the four striped grass mouse) which is closely related to (nocturnal) mice and rats, but exhibits a strong

Received 26 September 2019; Accepted 20 April 2020 diurnal niche (Dewsbury and Dawson, 1979; Schumann et al., Journal of Experimental Biology

1 RESEARCH ARTICLE Journal of Experimental Biology (2020) 223, jeb215368. doi:10.1242/jeb.215368

2005, 2006). The R. pumilio visual system shows several Cloning full-length cone opsin coding sequences adaptations that are consistent with a diurnal niche, including an PCR of full-length cone opsin coding sequences was performed on increased cone to rod ratio and high cone density (van der Merwe R. pumilio retinal cDNA using Q5 High-Fidelity DNA polymerase et al., 2018). However, the question of whether the visual system of (NEB), according to the manufacturer’s instructions. The following R. pumilio has ‘diurnal’ type spectral sensitivity remains primers were used: for SWS forward 5′-ACTTAAGCTTCACCAT- outstanding. Here, we found that, consistent with its diurnal GTCGGGAGAGGACGAGT and reverse 5′-TCGAGCGGCCGC- niche, the R. pumilio retina is cone rich, and its lens transmits little TTAGTGAGGGCCAACTTTGCT; and MWS forward 5′-ACTT- UV light. In contrast, electrophysiological recordings indicate that AAGCTTCACCATGGCCCAAAGGCTTACAGGT and reverse R. pumilio SWS and MWS cones probably have surprisingly similar 5′-TCGAGCGGCCGCTTATGCAGGTGACACTGAAG. PCR spectral sensitivities (predicted λmax≈360 nm and 500 nm) to those products were run on a 1.5% agarose gel, and suitable-sized bands of their closely related nocturnal counterparts. The outcome is that were removed and gel extracted using QIAquick Gel Extraction Kit R. pumilio spectral sensitivity is biased against UV-A wavelengths (Qiagen). These were then cloned into a pcDNA3 plasmid vector thanks to lens filtering, but not cone spectral sensitivity. linearised with HindIII and NotI restriction enzymes using NEB HiFi DNA assembly according to the manufacturer’s instructions. A 3 μl MATERIALS AND METHODS sample of the cloning reaction was then transformed in XL10 Gold Animals cells (Agilent) and the plasmid DNA was prepared using a QIAprep Animal care was in accordance with the UK Animals, Scientific Spin miniprep kit (Qiagen). Full-length coding sequence of Procedures Act of 1986, and the study was approved by the R. pumilio SWS and MWS cone opsin was confirmed by Sanger University of Manchester ethics committee. Animals were housed sequencing of the plasmid insert using the following primers: CMV on a 12 h:12 h light:dark cycle at 22°C with food and water available forward 5′-GGAGGTCTATATAAGCAGAGC and BGH reverse ad libitum. All experiments were performed in adult Rhabdomys 5′-GGCACCTTCCAGGGTCAAGG. pumilio (Sparrman 1784) (aged 3–8 months). Immunohistochemistry RNA extraction and sequencing Rhabdomys pumilio were anaesthetised with urethane and perfused Primer design with 4% paraformaldehyde (methanol free). Eyes were then stored in Primers were designed to amplify the first and last 100–200 bp of SWS methanol-free 4% paraformaldehyde prior to further processing. For and MWS cone opsins from genomic DNA (gDNA). These primers retinal wholemounts, retinas were dissected from fixed eyes and were based on conserved regions of the mouse (Mus musculus)andrat immunohistochemistry performed on free-floating retinas. For retinal (Rattus norvegicus) SWS and MWS sequences (genes obtained from sections, whole eyes were embedded in Historesin and were sectioned NCBI GenBank: 12057 mouse SWS; 14539 mouse MWS; 81644 rat at 5 µm thickness. For general histology, fixed eyes were dehydrated SWS and 89810 rat MWS). Based on gDNA PCR sequencing results, through a graded series of alcohols and infiltrated with Technovit subsequent primers were designed for cloning the full-length coding 7100 (Historesin TAAB Labs UK). Blocks were sectioned at 5 µm sequence of R. pumilio SWS and MWS cone opsin from retinal and mounted onto clean slides, stained with Cresyl Violet and cDNA.Eachprimerincludedanadditional overlapping sequence to coverslipped under DPX. For immunohistochemistry, R. pumilio allow cloning of the full-length sequence into a linearised plasmid retinas were labelled using polyclonal antibodies against MWS/LWS vector using Gibson assembly (Gibson et al., 2009). opsin raised in chicken (PA1-9517, ThermoFisher; 1:250 dilution) and against SWS opsin raised in rabbit (AB5407, Abcam; 1:300 Genomic DNA PCR dilution), and left overnight at room temperature. Tissues were then Genomic DNA was obtained from R. pumilio ear biopsies. Genomic washed and incubated for 2 h in ﬂuorescent secondary antibodies at a DNA PCR was performed using Q5 High-Fidelity DNA dilution of 1:2000 made up of 2% NDS, 3% Triton X-100 and PBS. polymerase (NEB) according to the manufacturer’s instructions. Sections were imaged with an Axio Imager.D2 upright microscope The PCR products were run on a 1.5% agarose gel, gel extraction and captured using a Coolsnap Hq2 camera (Photometrics) through using QIAQuick Gel extraction (Qiagen) was performed on any Micromanager software v1.4.23. bands of the expected/appropriate size and fragments were sequenced using Sanger sequencing. Lens transmission Lens transmission was assessed as described previously (Douglas and Retina RNA extraction and cDNA synthesis Jeffery, 2014). Briefly, R. pumilio were killed (as above) and both Rhabdomys pumilio were killed via cervical dislocation, and both eyes removed. Lenses were dissected and immediately frozen (n=5 eyes were removed and placed in cold sterile PBS. Each retina was lenses from 3 female R. pumilio). After thawing, lenses were rinsed in then dissected and placed into a separate sterile RNase- and DNase- PBS and mounted in a purpose-built holder in front of an integrating free 1.5 ml tube containing 0.5 ml of RNAlater and placed on ice. sphere, within a Shimadzu 2101 UVPC spectrophotometer. Retina tissue was stored in RNAlater at −20°C until RNA Transmission at 700 nm was set to 100%, and lenses were scanned extraction, which was performed using an RNeasy Mini Kit at 1 nm intervals from 300 to 700 nm. An equivalent procedure was (Qiagen) according to the manufacturer’s instructions, with used to calculate the transmission from n=16 mouse eyes. additional on-column DNase digest (Qiagen) to eliminate potential genomic DNA contamination. Tissue was disrupted Electroretinography using mortar and pestle and homogenised with syringe and Electroretinograms (ERGs) were recorded from 6 R. pumilio (4 female, needle. The optional extra elution step was also undertaken. RNA 2 male), using apparatus and methodology as described previously was immediately used for cDNA synthesis or stored at −80°C. (Cameron and Lucas, 2009). Anaesthesia was induced with cDNA synthesis was performed using qScript cDNA Synthesis Kit isofluorane (2% in oxygen), and maintained with an intraperitoneal (QuantaBio) according to the manufacturer’s instructions, and injection of urethane (1.6 g kg−1, 30% w/v; Sigma-Aldrich). A topical stored at −20°C until use. midriatic (tropicamide 1%; Chauvin Pharmaceuticals, Kingston upon Journal of Experimental Biology

2 RESEARCH ARTICLE Journal of Experimental Biology (2020) 223, jeb215368. doi:10.1242/jeb.215368

Thames, UK) and hypromellose eye drops were applied to the 2012). Anaesthesia was induced with 2% isofluorane in oxygen, and recording eye prior to placement of a corneal contact lens-type maintained with an intraperitoneal injection of urethane (1.6 g kg−1, electrode (Sagdullaev et al., 2004). A needle reference electrode was 30% w/v; Sigma-Aldrich). A topical mydriatic (as with ERGs) and inserted approximately 5 mm from the base of the contralateral eye, mineral oil (Sigma-Aldrich) were applied to the left eye prior to and a bite-bar was used for head support and also acted as a ground recording. After placement into a stereotaxic frame, the R. pumilio electrode. Electrodes were connected to a Windows PC via a signal skull was exposed and a small hole drilled ∼2.5 mm posterior and conditioner (model 1902 Mark III, Cambridge Electronic Design, ∼2.5 mm lateral to bregma. A 256-channel recording probe (A4x64- Cambridge, UK) that differentially amplified and filtered (band-pass Poly2-5mm-23s-250-177-S256, NeuroNexus Technologies, Inc., filter cut-off 0.5–200 Hz) the signal, and a digitiser (model 1401, Ann Arbor, MI, USA) consisting of 4 shanks spaced 200 µm apart, Cambridge Electronic Design). Core body temperature was maintained each with 64 recording sites, was lowered a depth of ∼3–3.5 mm into at 37°C throughout recordings via a homeothermic heat mat (Harvard the brain, targeting the R. pumilio dLGN. Broadband neural signals Apparatus). were then acquired using a SmartBox recording system (NeuroNexus Technologies, Inc.), sampling at 20 kHz. Following recordings, data Visual stimuli: ERG from each of the four electrode shanks were pre-processed by A CoolLED pe-4000 was used to present 13 stimuli of distinct common median referencing, high-pass filtered at 250 Hz and then spectra, with peak wavelengths ranging from 365 to 660 nm. The passed to an automated template-matching-based algorithm for single output was passed through a filter wheel containing a range of neutral unit isolation (Kilosort; Pachitariu et al., 2016preprint). Isolated units density filters, which allowed the light to be modulated across a 6 log were then extracted as virtual tetrode waveforms for validation in unit range. The intensities of each channel were made approximately Offline Sorter (V3, Plexon, Dallas, TX, USA). Here, unit isolation isoquantal by adjusting the absolute power of each LED, and by using was confirmed by reference to MANOVA F statistics, J3 and Davies- an Arduino Uno to further adjust the pulse width modulation (PWM) Bouldin validity metrics and the presence of a distinct refractory of each channel on an 8 bit scale. Stimuli were measured at the period (greater than 1.5 ms) in the interspike interval distribution. corneal plane using a spectroradiometer (SpectroCAL MSII, Spike sorted data were further analysed in MATLAB R2018a Cambridge Research Systems, Rochester, UK). All stimuli used (The MathWorks). Peri-event response histograms for each stimulus were quantified in terms of their photon flux, after accounting for the were calculated (250 ms bins; mean of 20 trials) with response spectral transmission of the R. pumilio lens. quantified as the maximum absolute change in spike rate during or Stimuli were presented following 30 min dark adaptation. Stimuli in the 1 s following visual stimulation relative the baseline (mean of different spectra were presented in a pseudorandom order, at 6 spike rate in the 1 s prior to visual stimulation). This approach intensity levels (moving from dim to bright using a neutral density therefore captured both ON and OFF responses. To identify filter wheel). Dark-adapted stimuli were presented either as a flash significant changes in spike rate, responses calculated in this manner (10 ms every 1 s) or as a 32 Hz flicker. Stimuli were also presented were compared with the distribution of ‘response’ values at a range of frequencies (1–50 Hz), using a broadband white quartz determined from 1000 repeats using trial×trial time-shuffled spike halogen light (8.6×1015 photons cm−2 s−1) coupled to a mechanical counts. The mean of the shuffled response distribution was shutter to modulate stimulus frequency. Spectral stimuli were also subsequently subtracted from the actual response such that, on measured in light-adapted conditions, whereby the filtered output of average, a lack of response would give a value of 0 spikes s−1. a quartz halogen light source (500 nm short-pass filter; 4.6×1014 photons cm−2 s−1) was superimposed upon narrowband Visual stimuli: dLGN spectra. Stimuli were combined using a bifurcated mixed fibre optic Experiments employed a custom-built light source (all components with opal diffuser at the output. from Thorlabs, Ely, UK) consisting of a cold white LED A further set of stimuli were designed using the principles of (MCWHLP1) with an automated narrowband filter wheel receptor silent substitution (as used previously; Allen et al., 2014; (FW102C, loaded with bandpass filters at 425, 450, 495, 530, Allen and Lucas, 2016). Briefly, a pair of spectra was generated 560 and 600 nm; bandwidth: ±10 nm) and a second adapting cold using a combinations of CoolLED channels, which were designed white LED fitted with selectable blue and yellow broadband filters to be isoluminant for R. pumilio MWS and SWS opsins (using (centred at 450 and 550 nm, respectively; bandwidth: ±40 nm). putative λmax of 360 and 500 nm; stimuli nominally termed LED intensity was controlled by current modulation via T-Cube ‘stimulus’ and ‘background’ spectra, respectively). A second pair drivers and, where required, neutral density filters. Output from the of spectra was generated, designed to be isoluminant for R. pumilio adapting and probe sources was then combined and delivered to the MWS opsin but present 99% Michelson contrast for the putative subject via a randomised bifurcated light guide (E436, Dolan R. pumilio SWS opsin. ERGs were then recorded whilst transitions Jenner, Boxborough, MA, USA) whose output ferrule (6.3 mm between these pairs of spectra were presented to the R. pumilio eye diameter) was positioned 5 mm from the contralateral eye and (10 ms flash of stimulus spectrum interleaved with 990 ms of enclosed by an internally reflective plastic cone to provide background spectrum). approximately full-field illumination. Stimulus measurements For flash ERGs, b-wave amplitudes were measured relative to the were performed using a calibrated spectroradiometer as above. baseline (value at flash onset) or, when measurable, relative to the Stimulus delivery was controlled using LabVIEW (National trough of the preceding a-wave. For all flicker ERGs, a mean of each Instruments, Austin, TX, USA). Animals were first dark adapted for 1 s cycle was taken; the average amplitude of the first 4 peak to trough 30 min. To assess rod spectral sensitivity we delivered dim 1 s responses was measured, with a period equal the stimulus frequency. narrowband flashes across the 6 available test wavelengths at 6 different intensities (∼108 to 1010.5 photons cm−2 s−1; 20 repeats per In vivo electrophysiological recordings in the dorsal lateral intensity/wavelength). The order of stimulus delivery was geniculate nucleus (dLGN) randomised according to wavelength between each of the 20 trials In vivo electrophysiological recordings were performed in 3 but scheduled such that the lowest intensity trials were completed

R. pumilio, using methods described previously (Brown et al., first and the highest intensity trials last. Subsequent assessment of Journal of Experimental Biology

3 RESEARCH ARTICLE Journal of Experimental Biology (2020) 223, jeb215368. doi:10.1242/jeb.215368 cone spectral sensitivity was performed similarly except in this case wavelengths according to the effective photon flux experienced by 12 we employed 7 rather than 6 intensities at each wavelength (∼10 to a single opsin with arbitrary λmax in the range 350–600 nm (taking 1014.5 photons cm−2 s−1) and stimuli were superimposed on a rod- into account R. pumilio lens transmission). We then calculated the saturating short followed by long wavelength background four-parameter sigmoid curve that best fitted that irradiance–response (∼1013.5 rod effective photons cm−2 s−1 for both). relationship and determined the percentage variance in the data Note that a different set of spectral stimuli were used with dorsal accounted for by that fit. Analysis of a subset of cells using the first lateral geniculate nucleus (dLGN) and ERG experiments, owing to approach described above for ERG produced identical λmax estimates. technical constraints. Nevertheless, our experiments were carefully To add context to the transmission characteristics of the designed with this constraint in mind. Thus, while our ERG studies R. pumilio lens, we calculated the impact of the lens transmission provide a comprehensive description of sensitivity across a wide on the effective photon flux of R. pumilio and mouse SWS and wavelength range, our dLGN experiments were designed to MWS pigments in natural daylight [using spectra measured in determine whether: (1) R. pumilio use a dedicated short wavelength- Manchester, UK (53°21′N, 2°16′W, elevation of 78 m), 2 weeks sensitive receptor (revealed by the presence of neurones responsive to after the summer solstice, at a solar angle of +30 deg published short but not longer wavelength stimuli); and (2) the SWS cone has λmax previously (Allen et al., 2014)]. in the UV range, by determining whether responses to shorter wavelength stimuli survive application of a background that should RESULTS suppress responses from any pigment with peak sensitivity >400 nm. Rhabdomys pumilio SWS and MWS cone opsins We were able to amplify full-length sequences for both SWS and Analysis of spectral stimuli MWS cone opsins from R. pumilio retinal cDNA (Fig. 1). The All spectral stimuli used were quantified in terms of their absolute predicted sequences for these two opsins are 346 and 359 amino photon flux, as described previously (Allen et al., 2014). Two acids long, respectively. When aligned against the corresponding approaches were used to predict the spectral sensitivity of R. pumilio opsin sequence from multiple other rodent species [Mus musculus cone opsins from ERG studies. First, irradiance–response functions (mouse), Rattus norvegicus (rat), Octodon degus (degu), Meriones were plotted for each wavelength, and data fitted with a sigmoidal ungiuculatus (gerbil), Cavia porcellus (guinea pig) and Ictidomys ð Þ dose–response curve: y=a+(b−a)0/(1+10 logEC50x ), where a is the tridecemlineatus (thirteen-lined ground squirrel)], R. pumilio opsins base and b is the top of the curve. For wavelengths that evoked showed highest sequence homology with mouse and rat (∼96% and responses at only one or two intensities, data were not included 97%, respectively) as predicted for the phylogeny of these species because of ambiguous curve fits. Curve parameters were fixed across (Blanga-Kanfi et al., 2009) (sequence homologies are summarised each stimulus, such that the only free parameter was the EC50.EC50 in Table 1). values were then plotted as a function of wavelength. Note, however, A high degree of homology was retained at known spectral tuning that bandwidth was often >25 nm (FWHM), and hence when plotting sites between cone opsins of R. pumilio and other rodent species. response amplitude as a function of wavelength, the peak wavelength The R. pumilio cone opsin sequences had highly conserved opsin of each channel was used. The best-fitting λmax was calculated using a characteristics, such as the chromophore binding site, Lys296, and Govardovskii nomogram (Govardovskii et al., 2000). retinal counter-ion, Glu113 (numbering throughout based on bovine In a second approach, we modelled the sensitivity of two rod opsin). When we examined known spectral tuning sites, we hypothetical cone opsins to find the combination of λmax values that found the R. pumilio sequences were most similar to those of rats best described physiological responses. First, we calculated the and mice. For example, R. pumilio, mice and rats all possessed predicted photon fluxes of SWS and MWS opsins with a range of phenylalanine at position 86, which has been established as an hypothetical λmax values (ranging from 360 to 420 nm and 470 to important site for UV spectral tuning in vertebrates (Cowing et al., 530 nm, respectively), and with a range of weighted contributions, 2002; Fasick et al., 2002; Hunt et al., 2004, 2007). When we using the following formula: examined MWS opsin sequences at the ‘five sites’ involved in spectral tuning differences between MWS/LWS photopigments Effective photon flux ¼ ð (Yokoyama and Radlwimmer, 1998), we found these residues in R. pumilio cone opsin were identical to rat and mouse sequences ðlÞðð ðlÞ Þþð ðlÞ ÞÞ ðlÞ l ð Þ P sA kA sB kB l d , 1 (Ala164, Tyr181, Glu261, Tyr269 and Ser292, respectively). Initial analysis of the predicted protein sequence suggests spectral tuning −2 −1 −1 where P(λ) is spectral irradiance in photons cm s nm , sA(λ) of R. pumilio cone opsins may be similar to that of rat or mouse. and sB(λ) are pigment spectral sensitivity approximated by the Immunohistochemical labelling of cone opsins in the R. pumilio Govardovskii visual template (for two pigments, A and B, retina identified both SWS- and MWS-expressing cones (Fig. 2A). incorporating a beta peak; Govardovskii et al., 2000), kA and kB Unlike in mice (Applebury et al., 2000), we saw no evidence of are relative weighting factor (for pigments A and B), and l(λ)is cones co-expressing the two types of opsin. A recent analysis of R. pumilio lens transmission. cone density in the R. pumilio retina (van der Merwe et al., 2018) For each combination, we plotted the response at each intensity at reported that MWS-expressing cones were more numerous than each wavelength as a function of effective rate of photon flux for a SWS-expressing cones across the retina, and that both cones showed weighted combination of the two hypothetical pigments. We then lower density in the periphery. We did not undertake an extensive tested which combination of λmax and weighted contribution to the validation of those observations, but our immunocytochemistry evoked response allowed the combined intensity–response curve to results did confirm that MWS cones were substantially more be best fitted by a single curve. numerous that SWS cones (Fig. 2A). For dLGN recordings, we used a qualitatively equivalent (but computationally faster) approach to estimate single cell spectral Spectral transmission of R. pumilio lens sensitivity. Hence, here spectral sensitivity was determined by As a prelude to descriptions of R. pumilio spectral sensitivity in vivo, calculating irradiance–response relationships across all test we measured spectral transmission of the R. pumilio lens across the Journal of Experimental Biology

4 RESEARCH ARTICLE Journal of Experimental Biology (2020) 223, jeb215368. doi:10.1242/jeb.215368

Fig. 1. Alignment of Rhabdomys pumilio SWS and MWS opsins with sequences of rodent species. (A) SWS opsin of R. pumilio (Rhabdo) and of the following species: Mus musculus (Mouse, NP_031564.1), Rattus norvegicus (Rat, NP_112277.1), Meriones unguiculatus (Gerbil; XP_021517546.1), Octodon degus (Degu; XP_004642783.1), Cavia porcellus (Guinea pig; NP_001166229) and Ictidomys tridecemlineatus [thirteen-lined ground squirrel (TLG); XP_021578083.1]. Rhabdomys pumilio SWS opsin structure is based on mouse SWS1 opsin structure and is shown by labelled coloured bars: TM, transmembrane domain; IC, intracellular loops; EC, extracellular loops. Key sites are shown in bold and underlined: UV tuning site 86, counter-ion site 113, and retinal binding site 296. (B) MWS opsin of R. pumilio and of the following species: M. musculus (NP_032132.1), R. norvegicus (NP_446000.1), M. unguiculatus (XP_021484930.1), O. degus (XP_023561139.1), C. porcellus (NP_001166460.1) and I. tridecemlineatus (AAW29517.1). Rhabdomys pumilio MWS opsin structure is based on mouse MWS opsin structure and is shown by labelled coloured bars as in A. Key sites are shown in bold and underlined: counter-ion site 113; retinal binding site 296; and LWS/MWS spectral tuning sites: 164, 181, 261, 269 and 292. Numbering of key sites is based on bovine rod opsin. All alignments were performed using MAFFT (Katoh and Standley, 2013).

UV-visible wavelength range (5 adult R. pumilio lenses; mean response characteristics of the R. pumilio ERG by recording dark- diameter along the optic axis 2.6 mm; Fig. 2B). We found that the adapted responses to full-field flicker across a range of frequencies R. pumilio lens acts as a long-pass filter, allowing efficient (ranging from 1 to 50 Hz; 100% contrast). In such conditions, ERGs transmission of wavelengths ≥400 nm (50% transmission at 383.5± were measurable at frequencies ≤40 Hz (Fig. 3A,B). Mice and rats 1.2 nm; Fig. 2C). The R. pumilio lens is therefore substantially less are able to track flicker up to a similar frequency when measured in transmissive for UV light than mouse or rat lenses, both of which cone-isolating (light-adapted) conditions (Krishna et al., 2002; Qian have a 50% transmission point at a wavelength approximately et al., 2008). Across this frequency range, under these conditions, 70 nm shorter (Douglas and Jeffery, 2014). one would expect a switch from rod+cone towards predominantly cone-based responses. We therefore recorded ERG spectral Rhabdomys pumilio in vivo spectral sensitivity: ERG sensitivity at low and high temporal frequencies (1 and 32 Hz) by We continued to assess the spectral sensitivity of R. pumilio vision recording responses to 13 spectrally distinct (∼isoquantal) stimuli using the ERG. To begin, we established the basic temporal across a 6-log unit range of light intensity (Fig. 3C). When presented

Table 1. Sequence homology of Rhabdomys pumilio SWS and MWS opsins following alignment with opsins of nocturnal and diurnal rodents Mus musculus Rattus norvegicus Octodon degus Meriones ungiuculatus Ictidomys tridecemlineatus Cavia porcellus SWS 96% 96% 93% 91% 90% 88% MWS 97% 97% – 93% 93% 89% The table shows the percentage homology between SWS/MWS opsins of R. pumilio and other rodents. Note, there was no comparison with O. degus MWS opsin

because of missing sequence data for the N-terminus. Journal of Experimental Biology

5 RESEARCH ARTICLE Journal of Experimental Biology (2020) 223, jeb215368. doi:10.1242/jeb.215368

A Fig. 2. Anatomical features of R. pumilio retina and transmission of R. pumilio lens. (A) Immunohistochemistry for MWS (cyan) and SWS (pink) opsins on a retinal wholemount. Left: overlay; middle: MWS opsin; right: SWS opsin. Scale bars: 25 µm. (B) Sagittal section of R. pumilio eye following Cresyl Violet staining, showing lens (L) and neural retina (R). (C) Spectral transmission of 5 R. pumilio lenses (black lines) and group mean (purple line), and the group mean of 16 mouse lenses (green line), from 300 to 700 nm. All values were normalised to transmission at 700 nm. MWS SWS MWS SWS 25 μm BC

100

L 50 % Transmission

R. pumilio Mouse 0 400 500 600 700 Wavelength (nm) at 1 Hz, we were able to record measurable ERGs to the brightest The most likely explanation is that the MWS opsin has maximal flash across all wavelengths (Fig. 3D). Irradiance–response curves sensitivity around 500 nm, near peak sensitivity of the 1 Hz response. revealed maximum sensitivity around 500 nm (Fig. 3E), which Extending our spectral sensitivity investigation to conditions would be typical for a rod-driven response across other mammalian favouring cones (32 Hz flicker) confirmed that this is indeed the species. However, when we quantified relative sensitivity across case (Fig. 4A,B). Once again, responses could be recorded across the wavelengths, we found higher sensitivity to the shortest wavelength wavelength range and peak sensitivity lay around 500 nm (Fig. 4C). tested than predicted for a single photopigment with λmax around Applying the same criteria used for 1 Hz responses revealed that the 500 nm when accounting for pre-receptoral filtering by the data could be adequately fitted by a 1:4 combination of opsins with R. pumilio lens (Fig. 3F). The simplest explanation is that there is λmax of 360 and 500 nm (Fig. 4D,E). The prediction that MWS opsin some intrusion of SWS cones to this response. We therefore asked has a greater impact on flicker spectral sensitivity than SWS opsin is whether inclusion of an additional short wavelength pigment consistent with our own (Fig. 2) and published (van der Merwe et al., improved the fit of the data. Given that intensity–response functions 2018) observations that MWS cones are more numerous in the had a qualitatively similar form across the wavelength range R. pumilio retina. The reduction in this ratio compared with that (Fig. 3E), we applied a simple modelling process in which we asked recorded at 1 Hz (at which it is 1:6; Fig. 3G) probably reflects the what combination of pigments would be required to predict the additional contribution of rods to middle/long wavelength sensitivity pattern of relative sensitivity across wavelengths. In brief, we at low temporal frequencies. attempted to describe measured sensitivity across all wavelengths As a further confirmation that the high-frequency flicker stimuli by calculating the effective photon flux for a system in which faithfully reported cone visual sensitivity, we repeated those responses were elicited by the combined activity of two opsin recordings under light-adapted conditions with the goal of pigments with different spectral sensitivity. To achieve the objective saturating any residual rod-evoked responses. We recorded flicker of having the same response to a given effective photon flux ERG responses following adaptation to (and in the presence of) a irrespective of wavelength, we varied two parameters: the peak broad-spectrum background light covering the spectral sensitivity sensitivity (λmax) of each opsin, and their relative contribution to the range expected for rods and the two putative cone pigments (Fig. 5). evoked response for a theoretical spectrally neutral light source The background light had no discernible impact on flicker ERG (contribution weighting ratio). This method achieved a good fit for spectral sensitivity. Thus, modelling the data as the output of a the data using pigments with predicted λmax of 360 and 504 nm at combination of two pigments (as above) returned λmax of 360 and 1:6 contribution weighting (Fig. 3G). The predicted spectral 503 nm. Note that the adapting light is predicted to differentially sensitivity function for this combination of opsins, accounting for impact middle/long wavelength pigments, which probably explains the filtering effects of the lens, is shown in Fig. 3H. the increase in contribution weighting of SWS versus MWS opsins The appearance of a short wavelength cone component to the 1 Hz to 1:10 for this high-frequency flicker stimulus compared with that response might have been expected given the cone-rich nature of the recorded under dark-adapted conditions. R. pumilio retina. More surprising was that there was no requirement As lens filtering of UV light makes it difficult to unambiguously to account for an additional MWS cone contribution to the response. record a short wavelength peak in the composite ERG attributable to Journal of Experimental Biology

6 RESEARCH ARTICLE Journal of Experimental Biology (2020) 223, jeb215368. doi:10.1242/jeb.215368

A B C 400 nm 1 Hz 0.4 370 385

400 μV 402 2 Hz 300 436

) 0.3 459 –2 478 4 Hz 200 500 0.2 506 8 Hz 532 553

16 Hz Amplitude (μV) 597 20 Hz

100 Intensity (W m 0.1 635 30 Hz 660 40 Hz 50 Hz 0 0 0 100 200 300 400 500 0.5 1 2 4 8 16 32 64 400 500 600 700 Time (ms) Flicker frequency (Hz) Wavelength (nm) D nm E nm F λ 370 1.0 370 0 maxa=501 nm 385 385

400 μV 402 402 0.8 436 436 459 459 0.6 478 478 500 –1 500 0.4 506 506 532 532 0.2 553 log(Sensitivity) 553 597 597 635 0 635 660 Normalised b-wave amplitude 660 –2 –1000 100 200 300 9 10 11 12 13 14 15 16 17 360 380 400 500 600 700 Time (ms) log(Intensity) Wavelength (nm) G H nm 370 λ λ a=360 nm 1 maxa=360 nm 0 max 385 λ λ b=504 nm 402 maxb=504 nm max 0.8 436 (1:6) (1:6) 459 478 0.6 500 506 532 –1 0.4 553 597

0.2 635 log(Sensitivity) 660 0 Normalised b-wave amplitude –2 8 9 10 11 12 13 14 15 360 380 400 500 600 700 log(Effective photon flux) Wavelength (nm)

Fig. 3. Spectral sensitivity of electroretinogram (ERG) responses to a dark-adapted flash. (A) Representative ERG responses to flicker stimuli of different frequencies. (B) Response amplitude of flicker stimuli of different frequencies (n=3; means±s.e.m.). (C) Spectral power distribution of 13 stimuli used to track spectral sensitivity. (D) Representative flash ERGs for spectral stimuli presented at maximum intensity. (E) Normalised b-wave amplitude for spectral stimuli −2 −1 presented at up to 6 intensities (photons cm s ; n=3; means±s.e.m.). (F) Mean±s.e.m. EC50 values plotted as a function of wavelength (central peak of each 2 channel). Black line shows the best-fitting spectral sensitivity function (accounting for lens transmission) to describe these data (λmax=501 nm; R =0.978). Note that 635 and 660 nm data points were excluded given the low sensitivity to these wavelengths. (G) Response amplitude as a function of effective photon flux −2 −1 (photons cm s ) for the best-fitting nomogram/pair of nomograms. In this case, the best fit was composed of two pigments with λmax of 360 and 504 nm, at a ratio of 1:6. The curve fit has an R2 of 0.999. (H) Spectral sensitivity function of the best-fitting nomogram/pair of nomograms (used to generate the x-axis in G).

EC50 values were replotted from F for comparison.

SWS cones, we set out to use the approach of receptor silent between these two spectra (10 ms/1000 ms) drove no measurable substitution to record an isolated SWS response. First, we generated ERG response (Fig. 6A,B). We then designed a pair of stimuli that a pair of spectrally distinct stimuli that were designed to be were isoluminant for putative MWS cones, but presented contrast isoluminant for these two proposed photopigments (<5% for an SWS pigment. Transitions between these spectra elicited a

Michelson contrast). In accordance with our prediction, transitions flash ERG response (Fig. 6C,D). This confirms that the R. pumilio Journal of Experimental Biology

7 RESEARCH ARTICLE Journal of Experimental Biology (2020) 223, jeb215368. doi:10.1242/jeb.215368

A nmB nm C 370 1.0 370 385 λ 385 0 maxa=503 nm 402 402 436 0.8 436 459

400 μV 459 0.6 478 478 500 500

flicker amplitude 0.4 506 –1 506 532 532 0.2 553 log(Sensitivity) 553 597

597 Normalised 635 635 0 660 660 0 –2 0 50 100 150 200 91011 12 13 14 15 16 17 360 380 400 500 600 700 Time (ms) log(Intensity) Wavelength (nm) D E nm 1 λ 370 λ a=360 nm 0 maxa=360 nm max λ 385 λ maxb=500 nm maxb=500 nm 0.8 402 (1:4) 436 (1:4) 459 0.6 478 500 506 –1

flicker amplitude 0.4 532 553

597 log(Sensitvity) 0.2 635 660

Normalised 0 –2 8910 13 15 11 12 14 360 380 400 500 600 700 log(Effective photon flux) Wavelength (nm)

Fig. 4. Spectral sensitivity of ERG responses to a 32 Hz flicker. (A) Representative ERG responses to maximum intensity spectral stimuli presented as a 32 Hz flicker. (B) Normalised response amplitude for spectral stimuli presented at up to 6 intensities (photons cm−2 s−1; n=3; means±s.e.m.). Note that 635 and 660 nm data points were excluded given the low sensitivity to these wavelengths. (C) Mean±s.e.m. EC50 values plotted as a function of wavelength (central peak 2 of each channel). Black line shows the best-fitting spectral sensitivity function (accounting for lens transmission) to describe these data (λmax=503 nm; R =0.969). (D) Response amplitude as a function of effective photon flux (photons cm−2 s−1) for the best-fitting nomogram/pair of nomograms. In this case, the best fit was 2 composed of two pigments with λmax of 360 and 500 nm, at a ratio of 1:4. The curve fit has an R of 0.996 (n=3). (E) Spectral sensitivity function of the best-fitting nomogram/pair of nomograms (used to generate the x-axis in D). EC50 values replotted from C for comparison.

ERG cannot be accounted for by a single pigment with λmax around (randomised order) as 1 s full-field flashes across a ∼2 log unit range 500 nm. of intensity (flash intensities ∼1012 to 1014.5 photons cm−2 s−1;note that a different set of spectral stimuli were used with dLGN and ERG Rhabdomys pumilio in vivo spectral sensitivity: dLGN experiments, owing to technical constraints). Light flashes were Our ERG data describe the spectral sensitivity of R. pumilio cone superimposed on a short or long wavelength background light (450 visual responses, but the lens filtering of UV light makes the and 550 nm, respectively; bandwidth ±40 nm), designed to suppress contribution of SWS opsin to the composite spectral sensitivity rod activity (∼1013.5 effective photons cm−2 s−1), and bias responses profile slight. As additional confirmation that there was indeed an in favour of cones. The backgrounds also represented an opportunity independent short wavelength-sensitive contribution to visual to confirm the UV peak of SWS opsin sensitivity. Thus, while the two responses, we turned to recordings in the dLGN, in which a backgrounds had equivalent effective intensity for MWS cones subset of individual units might reasonably be expected to convey (respectively 1013.4 and 1013.6 effective photons cm−2 s−1), even the information only from SWS cones. To this end, we performed large- shorter wavelength should have negligible impact on SWS cones 10.5 −2 −1 scale multielectrode recordings from the R. pumilio dLGN (256- with a λmax of 360 nm (10 effective photons cm s ). In this channel recordings from 3 R. pumilio). Using this approach, we way, we would expect both wavelengths to suppress MWS more than were able to describe the spectral sensitivity of individual neurons, SWS cone responses. Conversely, if the R. pumilio SWS opsin had as opposed to a composite response, and therefore test the prediction λmax >400 nm, we would expect marked suppression of short that some neurons would exhibit specific short wavelength wavelength responses in the presence of our short (but not long) sensitivity in the UV range. wavelength background light. To determine the functional spectral sensitivity of the isolated With this approach, we were able to describe the spectral neurons, we presented a series of 6 spectrally distinct stimuli sensitivity of light-evoked responses from 189 single neurons. Two Journal of Experimental Biology

8 RESEARCH ARTICLE Journal of Experimental Biology (2020) 223, jeb215368. doi:10.1242/jeb.215368

A B nm strong MWS cone bias (Fig. 7B,D). Given that, for both groups of 1.0 365 neurons, responses were essentially identical under short and long 0.004 385 – 405 wavelength backgrounds (Fig. 7A D), subsequent analyses used the 0.8 435 average response across the two backgrounds. Corresponding single ) 460 opsin spectral sensitivity estimates for individual cells (Fig. 7E) were –2 0.6 470 strongly clustered around ∼500 nm (mean±s.e.m. 501±3 nm for the 5 490 0.002 0.4 500 best-fitting cells; >95% variance explained) or <400 nm (tested 525 wavelengths did not provide reliable discrimination at shorter 550 0.2 wavelengths but results are fully compatible with λmax=360 nm). 595 Intensity (W m 635 Consistent then with the ERG data described above, across the entire 0 Normalised flicker amplitude 660 population of dLGN neurons, overall spectral sensitivity could be 0 λ 300 400500 600 700 13 14 15 16 17 very well explained by a combination of two pigments with max of 360 and 501 nm (Fig. 7F,G). In this case, however, effective SWS Wavelength (nm) log(Intensity) C cone contributions were much stronger than observed in ERG studies nm (Fig. 7G, best fit ratio of 65:1; R2=0.99). This can be explained by the 1 365 λ presence of the adapting background lights, which are predicted to maxa=360 nm 385 λ maxb=503 nm suppress sensitivity of pigments with λ >400 nm (in this case 0.8 405 max 435 (1:10) MWS but not UVS cone opsins). This observation (and the similarity 460 0.6 470 in responses under the two tested backgrounds) thus represents 490 further support for the hypothesis of a UV peak sensitivity for 500 0.4 525 R. pumilio SWS opsin. 550 We also applied this protocol under scotopic conditions following 595 0.2 635 30 min dark adaptation, and using stimuli 4 log units dimmer than 660 in light-adapted conditions (flash intensities ∼108 to − − Normalised flicker amplitude 0 1010.5 photons cm 2 s 1). In these conditions, we would expect rod 8 9 10 11 12 13 14 15 photoreception to dictate the sensitivity of the resulting responses. log(Effective photon flux) Across 31 neurons that exhibited robust responses under these conditions (Fig. 8A), we determined which single opsin could best Fig. 5. Spectral sensitivity of ERG responses in light-adapted conditions. account for the observed pattern of responses, using an approach (A) Spectral power distribution of background light. (B) Normalised response −2 −1 equivalent to that described above (Fig. 8B). As expected from the rod amplitude for 32 Hz flicker, measured across 3 intensities (photons cm s ) λ for each spectral stimulus, and in the presence of an adapting background light spectral sensitivity of other mammals, the estimates of max were tightly (n=3; means±s.e.m.). (C) In the presence of background light, response clustered at values just below 500 nm (Fig. 8C). Among these cells, the amplitude as a function of effective photon flux (photons cm−2 s−1) was best group whose responses could be best explained by the spectral λ fitted with a pair of nomograms with max of 360 and 503 nm, at a ratio of 1:10 sensitivity of a single opsin (>80% variance in responses accounted (R2=0.992; n=3). for) had a λmax of 493±3 nm (mean±s.e.m., n=7; Fig. 8C–E). distinct patterns of spectral sensitivity emerged: one group of Estimating the impact of the R. pumilio lens on SWS and MWS neurons (n=42) exhibited strong responses to only the shortest opsins wavelength (425 nm) flashes (Fig. 7A,C), consistent with an SWS Our data all support the notion that the lens of R. pumilio has a low cone-dependent origin. The other group of neurons (n=147) transmission for wavelengths <400 nm, but an SWS opsin with λmax responded to all wavelengths with a sensitivity consistent with a of ∼360 nm. To provide some real-world context to these values, we

A B Fig. 6. Silent substitution ERG responses. (A) Pair of spectra Stimulus R. pumilio 1 (stimulus and background) designed to be isoluminant for ) 100 Background R. pumilio 2 –2 putative R. pumilio SWS and MWS cone opsins (accounting for 10 lens transmission). (B) ERG response of two R. pumilio to a transition between the spectral pair (10 ms flash of stimulus 1 spectrum, interleaved with 990 ms of background spectrum).

0.1 100 μV (C) Pair of spectra designed to be isoluminant for putative R. pumilio MWS cone opsin, but presenting 99% contrast for

Intensity (W m 0.01 putative R. pumilio SWS cone opsin (accounting for lens 400 500 600 700 –100 0 100 200 300 transmission). (D) ERG response of two R. pumilio to a transition Wavelength (nm) Time (ms) between this spectral pair (10 ms flash of stimulus spectrum, interleaved with 990 ms of background spectrum). C D ) 100 R. pumilio 1 –2 Stimulus 10 Background R. pumilio 2 1

0.1 100 μV

Intensity (W m 0.01 400 500 600 700 –100 0 100 200 300 Wavelength (nm)

Time (ms) Journal of Experimental Biology

9 RESEARCH ARTICLE Journal of Experimental Biology (2020) 223, jeb215368. doi:10.1242/jeb.215368

C D A photons cm–2 s–1 B photons cm–2 s–1 <400 nm 501 nm 1014 1015 1014 1015 1014 1015 1014 1015 100 100 1 Short BGN 1 425 nm Long BGN

0 % Variance 0 450 nm % Variance 350 600 350 600 λ λ (nm) –1 –1 max (nm) max 495 nm

530 nm Normalised response 20 spikes s 15 spikes s

560 nm 0 0

600 nm 468101211 12 13 14 15 Short Long Short Long log(Effective photon flux) log(Effective photon flux) 1 s 1 s 1 s 1 s 1 s 1 s 1 s 1 s

E 100 F G –0.5 0.8 λmaxa=360 nm –1 λmaxb=501 nm 0.6 –1.5 (65:1) explained % Variance –2 0 0.4 <400 400 450 500 550 600 –2.5 40 0.2 log(Sensitivity) –3 Normalised response –3.5 0

No. of cells –4 0 350 400 450 500 550 600 <400 400 450 500 550 600 13 14 15 λ max (nm) log(Intensity) Wavelength (nm)

Fig. 7. Spectral sensitivity of dorsal lateral geniculate nucleus (dLGN) neuron responses under light adaptation. (A,B) Representative responses of two R. pumilio dLGN neurons to 1 s moderate and bright light flashes (means of 20 trials) of varying wavelength under short and long wavelength adaptation (450 and 550 nm, respectively, bandwidth ±40 nm; 1013.5 rod-effective photons cm−2 s−1). (C,D) Irradiance–response relationships for neurons in A and B with irradiance −2 −1 quantified according to the effective (lens-corrected) photon flux (photons cm s ) for a single opsin with a λmax of 360 nm (C) and 501 nm (D). Note the differing range on the x-axes. Insets show spectral sensitivity estimates under short and long wavelength adaptation; note that tested wavelengths offered little discriminatory power for λmax <400 nm. (E) Population spectral sensitivity estimates (n=189 neurons, based on average responses across short and long wavelength backgrounds) showing best-fitting single opsin λmax and corresponding response variance explained. (F) Normalised mean±s.e.m. irradiance– response relationships for all dLGN cells that responded to intensity (photons cm−2 s−1) under light-adapted conditions, fitted with 4-parameter sigmoid curves. 2 (G) Sensitivity estimates (from F), best fitted to a pair of R. pumilio lens-corrected opsin templates with λmax of 360 and 501 nm at a ratio of 65:1 (R =0.99). assessed the expected excitation of R. pumilio and mouse SWS and which its visual system is consistent with its diurnal lifestyle. The MWS opsins in daylight. Using an environmentally measured R. pumilio retina contains two classes of cones, rods and ipRGCs. spectrum of sunlight, we asked how the predicted excitation of SWS As with other diurnal species, the R. pumilio eye contains a and MWS opsins was impacted by lens transmission in R. pumilio cone-rich retina. Both amino acid sequence analysis and and mice (Fig. 2, Table 2). We observed a reduction of electrophysiological recordings are consistent with the conclusion approximately 70% in the excitation of the R. pumilio SWS that the spectral sensitivity of SWS and MWS cones is similar to that opsin, compared with ∼15% in the mouse (for MWS opsins in each of closely related nocturnal species. However, the presence of a species, the impact of lens transmission is minimal). Note, however, long-pass lens appears to greatly impact sensitivity to shorter that despite the increased impact of the R. pumilio lens on the SWS wavelengths, producing anomalous narrow-band spectral tuning of opsin, its relative excitation in daylight remained well above R. pumilio SWS cones. threshold (and within the range of Weber adaptation), suggesting Our functional data are consistent with previous reports that the reasonable UV sensitivity despite low transmission of the R. pumilio retina is cone dominated (>50% cone photoreceptors; R. pumilio lens for wavelengths <400 nm. van der Merwe et al., 2018). We reveal robust cone-evoked ERG responses that can track stimuli inverting at high temporal DISCUSSION frequencies (≤40 Hz), and robust, large-amplitude responses We set out to examine the in vivo spectral sensitivity of the visual across the high light levels tested here. Similarly, dLGN responses system of the diurnal rodent R. pumilio and establish the extent to are more numerous and robust under cone-favouring photopic Journal of Experimental Biology

10 RESEARCH ARTICLE Journal of Experimental Biology (2020) 223, jeb215368. doi:10.1242/jeb.215368

A B C

493 nm λ 108 photons cm–2 s–1 1010.5 100 100 max=493±3 nm 1.0 425 nm

450 nm

% Variance 0 350 600

–1 0.5

λ explained 495 nm max (nm) % Variance

0 530 nm 10 spikes s Normalised response t 8 560 nm 600 nm 78910 1 s log(Effective photon flux) No. of cells 0 <400 400 450 500 550 600 λ D E max (nm) λ =493 nm 0.5 max 1.0 0

–0.5

0.5 –1

–1.5 log(Sensitivity)

Normalised response –2 0 –2.5 891011 350 400 450 500 550 600 650 log(Intensity) Wavelength (nm)

Fig. 8. Spectral sensitivity of dLGN neuron responses under scotopic conditions. (A) Representative responses of a R. pumilio dLGN neuron to 1 s dim light flashes (means of 20 trials) of varying intensity and wavelength under dark-adapted conditions. (B) Irradiance–response relationship for neuron in A with −2 −1 irradiance quantified according to the effective photon flux (photons cm s ) for a single opsin with a λmax of 493 nm (corrected for R. pumilio lens transmission). Inset shows spectral sensitivity estimate (quantified as the percentage variance in effective irradiance–response curves explained by the best-fitting

4-parameter sigmoid curve). (C) Population spectral sensitivity estimates showing the best-fitting single opsin λmax and corresponding response variance explained (as in B). (D) Normalised mean±s.e.m. irradiance–response relationships for cells whose responses to light intensity (photons cm−2 s−1) were best explained by a single opsin (>80% variance explained, highlighted in red in C), fitted with 4-parameter sigmoid curves. (E) Sensitivity estimates (from D), fitted to a 2 R. pumilio lens-corrected opsin template with λmax of 493 nm (R =0.99).

conditions. Previous immunohistochemical analyses have λmax around 500 nm, responses to near-UV wavelengths were established that the R. pumilio retina contains two cone opsins anomalously sensitive. One obvious potential origin for high UV (SWS and MWS; van der Merwe et al., 2018), with higher sensitivity is intra-ocular fluorescence. However, this does not expression of MWS opsin (as often observed in such rodent provide an adequate explanation for our data, as we found that a species). We were able to clone and sequence both R. pumilio cone subset of dLGN neurons respond only to 425 nm, not the longer opsins, and a comparison with related rodent species (both nocturnal wavelengths that should be the product of fluorescence. Moreover, a and diurnal) revealed very close sequence homology with mouse background light that should suppress responses from any SWS and rat SWS/MWS opsins, predicting similarities in their spectral pigment with peak sensitivity in the human visible range did not sensitivity. In agreement with this prediction, both ERG and dLGN impact responses to the shorter wavelengths. These findings argue recordings revealed that, while sensitivity across the human visible that there is indeed a photoreceptor specifically sensitive to very spectrum was consistent with that of a single photopigment with short wavelength light and that the R. pumilio SWS pigment has a λmax of <∼400 nm. Direct electrophysiological or microspectrophotometrical Table 2. Impact of Rhabdomys pumilio and mouse lens transmission on the excitation of SWS and MWS pigments assessments of cone photoreceptors ex vivo, or absorbance spectroscopy of purified cone pigments in vitro, would be a SWS effective MWS effective valuable complement to the current dataset in refining our estimate photons cm−2 s−1 photons cm−2 s−1 for cone opsin spectral sensitivity. In particular, while our data Without lens With lens Without lens With lens clearly show that SWS opsin sensitivity peaks in the near-UV, the R. pumilio 6.44×1014 1.93×1014 4.73×1014 4.36×1014 UV light filtering properties of the R. pumilio lens make it 14 14 14 14 Mouse 7.35×10 4.9×10 4.98×10 4.49×10 challenging to precisely define its λmax based upon in vivo The table shows the predicted effective photon flux for R. pumilio and mouse physiological responses. Unfortunately, our attempts to overcome

SWS and MWS opsins, with and without lens transmission, in natural daylight. this by recording retinal ganglion cell activity ex vivo using a Journal of Experimental Biology

11 RESEARCH ARTICLE Journal of Experimental Biology (2020) 223, jeb215368. doi:10.1242/jeb.215368 multielectrode array were hindered by the thick inner limiting can enhance contrast detection for light coming from the sky (Baden membrane of R. pumilio. Our best estimate is that the SWS opsin et al., 2013), which could improve detection of overhead predators. λmax lies around 360 nm. First, the ERG revealed photopic spectral Our findings have implications for using R. pumilio as a sensitivity that was best described by the weighted sum of two laboratory organism. Diurnal rodents could be useful alternatives nomograms, with λmax of 360 and ∼500 nm, and ratio of ∼1:4. to non-human primates and companion-animal species for Second, we assessed the spectral sensitivity in the visual thalamus examining cone/photopic vision. Rhabdomys pumilio can be of anaesthetised R. pumilio, and responses of individual neurons maintained as a breeding colony in standard rodent facilities could be well described by single opsin spectral sensitivity (provided that they receive appropriate environmental enrichment) estimates: approximately 75% of neurons with λmax of ∼500 nm, and are reliably diurnal in both the laboratory and wild. This first and the remaining neurons with λmax of <400 nm (tested description of their visual physiology confirms the presence of wavelengths did not provide reliable discrimination at shorter adaptations to a diurnal niche in their visual system and their wavelengths but results are fully compatible with λmax=360 nm). potential for studies of cone-based vision. Likewise, across the population of dLGN neurons we recorded, overall spectral sensitivity could be very well explained by a Acknowledgements We would like to thank the Hoekstra lab at Harvard University for the original R. combination of two pigments with λmax of 360 and 501 nm. Lastly, λ pumilio breeding pairs used to establish our colony, and members of the BSF at the we were able to validate these putative max values by applying the University of Manchester for assistance in husbandry and colony maintenance. We technique of receptor silent substitution. In this case, a pair of would also like to thank Jonathan Wynne, Dr Krys Procyk and Dr Nina Milosavljevic spectrally distinct stimuli, designed to be isoluminant for pigments for their assistance with immunohistochemistry. with λmax of 360 nm and 500 nm, evoked no measurable ERG response. Competing interests The authors declare no competing or financial interests. We also explored the spectral sensitivity of R. pumilio vision in the dLGN under conditions of dark adaptation. These data indicated Author contributions a λmax of ∼493 nm, which is typical for rod vision in terrestrial Conceptualization: A.E.A., J.R., T.M.B., R.J.L.; Methodology: A.E.A., J.W.M., J.R., mammals (classically ∼500 nm). However, light adaptation and/or B.B., R.H.D., G.J., A.A.V., T.M.B., R.J.L.; Software: T.M.B.; Validation: A.E.A.; a change in temporal frequency to bias responses towards cones Formal analysis: A.E.A., J.W.M., J.R., B.B., R.H.D., G.J., A.A.V., T.M.B.; Investigation: A.E.A., J.W.M., J.R., B.B., R.H.D., G.J., A.A.V.; Resources: R.J.L.; produced only a small shift in spectral sensitivity, with MWS cones Data curation: A.E.A., J.W.M., J.R.; Writing - original draft: A.E.A., J.R., T.M.B., having a λmax shifted approximately 7 nm towards longer R.J.L.; Writing - review & editing: A.E.A., J.W.M., J.R., B.B., R.H.D., G.J., T.M.B., wavelength. This similarity indicates that there is a limited R.J.L.; Visualization: A.E.A., J.R., G.J., A.A.V., T.M.B.; Supervision: A.E.A., T.M.B., adjustment in the spectral sensitivity of R. pumilio vision across R.J.L.; Project administration: A.E.A., T.M.B., R.J.L.; Funding acquisition: T.M.B., the day–night cycle – or a low-amplitude Purkinje shift. R.J.L. While the presumed spectral sensitivity of R. pumilio cone (and Funding rod) opsins is remarkably similar to those of its close nocturnal This work was supported by grants from the Biotechnology and Biological Sciences relatives, the filtering properties of the R. pumilio lens attenuates the Research Council (BB/P009182/1) and the Wellcome Trust (210684/Z/18/Z) to amount of short wavelength light actually reaching the R. pumilio R.J.L., and the Biotechnology and Biological Sciences Research Council (B/ retina. To put this into context, the R. pumilio lens attenuates the N014901/1) to T.M.B. and R.J.L. A.E.A. was supported by a University of Manchester Dean’s prize Fellowship. Deposited in PMC for immediate release. activation of the SWS cone to natural daylight by ∼70% (compared ∼ with the mouse lens which is close to 15%). While a long-pass References property is a common feature of lenses in diurnal animals, it is most Ahnelt, P. K. and Kolb, H. (2000). The mammalian photoreceptor mosaic-adaptive commonly paired with a concurrent shift in opsin spectral sensitivity design. Prog. Retin. Eye Res. 19, 711-777. doi:10.1016/S1350-9462(00)00012-4 towards longer wavelengths. To our knowledge, a combination of Allen, A. E. and Lucas, R. J. (2016). Using silent substitution to track the mesopic λ transition from rod- to cone-based vision in mice. Invest. Ophthalmol. Vis. Sci. 57, <400 nm SWS opsin max and UV-filtering lens is highly unusual 276-287. doi:10.1167/iovs.15-18197 within the animal kingdom (Ellingson et al., 1995). This pairing, in Allen, A. E., Storchi, R., Martial, F. P., Petersen, R. S., Montemurro, M. A., effect, means that SWS cone sensitivity is dramatically curtailed at Brown, T. M. and Lucas, R. J. (2014). Melanopsin-driven light adaptation in shorter wavelengths to leave it responsive to only a narrow portion mouse vision. Curr. Biol. 24, 2481-2490. doi:10.1016/j.cub.2014.09.015 of the spectrum. But despite this narrowing in sensitivity, we found Applebury, M. L., Antoch, M. P., Baxter, L. C., Chun, L. L. Y., Falk, J. D., Farhangfar, F., Kage, K., Krzystolik, M. G., Lyass, L. A. and Robbins, J. T. evidence that the R. pumilio SWS cone contributes to activity (2000). The murine cone photoreceptor: a single cone type expresses both S and throughout the visual projection. The utility of this more narrow- M opsins with retinal spatial patterning. Neuron 27, 513-523. doi:10.1016/S0896- band UV-sensitive pigment in R. pumilio, however, remains a 6273(00)00062-3 matter of speculation. The most parsimonious explanation is that Baden, T., Schubert, T., Chang, L., Wei, T., Zaichuk, M., Wissinger, B. and Euler, this combination is a compromise, on the one hand restricting the T. (2013). A tale of two retinal domains: near-optimal sampling of achromatic contrasts in natural scenes through asymmetric photoreceptor distribution. amount of UV light reaching the R. pumilio retina (to protect the Neuron 80, 1206-1217. doi:10.1016/j.neuron.2013.09.030 retina from damage and/or enhance acuity) and on the other, Blanga-Kanfi, S., Miranda, H., Penn, O., Pupko, T., DeBry, R. W. and Huchon, D. retaining enough ‘functional’ UV sensitivity for a particular (2009). Rodent phylogeny revised: analysis of six nuclear genes from all major purpose. One possible reason for this UV sensitivity could be to rodent clades. BMC Evol. Biol. 9, 71. doi:10.1186/1471-2148-9-71 – Brown, T. M., Tsujimura, S.-I., Allen, A. E., Wynne, J., Bedford, R., Vickery, G., allow violet green colour discrimination (e.g. Joesch and Meister, Vugler, A. and Lucas, R. J. (2012). Melanopsin-based brightness discrimination 2016). The presence of separate cone classes expressing SWS and in mice and humans. Curr. Biol. 22, 1134-1141. doi:10.1016/j.cub.2012.04.039 MWS opsins supports this notion. We have not explicitly tested that Cameron, M. A. and Lucas, R. J. (2009). Influence of the rod photoresponse on hypothesis in the current study, though it is notable that SWS- and light adaptation and circadian rhythmicity in the cone ERG. Mol. Vis. 15, MWS-evoked responses appear to remain separate at least at the 2209-2216. Cowing, J. A., Poopalasundaram, S., Wilkie, S. E., Robinson, P. R., Bowmaker, level of the visual thalamus, implying that chromatic discrimination J. K. and Hunt, D. M. (2002). The molecular mechanism for the spectral shifts would be available to higher level visual processing. An alternative between vertebrate ultraviolet- and violet-sensitive cone visual pigments. function could relate to evidence that shorter wavelength sensitivity Biochem. J. 367, 129-135. doi:10.1042/bj20020483 Journal of Experimental Biology

12 RESEARCH ARTICLE Journal of Experimental Biology (2020) 223, jeb215368. doi:10.1242/jeb.215368

Dewsbury, D. A. and Dawson, W. W. (1979). African 4-striped grass mice Katoh, K. and Standley, D. M. (2013). MAFFT multiple sequence alignment (Rhabdomys Pumilio), a diurnal-crepuscular muroid rodent, in the behavioral software version 7: improvements in performance and usability. Mol. Biol. Evol. laboratory. Behav. Res. Meth. Instr. 11, 329-333. doi:10.3758/BF03205671 30, 772-780. doi:10.1093/molbev/mst010 Douglas, R. H. and Jeffery, G. (2014). The spectral transmission of ocular media Krishna, V. R., Alexander, K. R. and Peachey, N. S. (2002). Temporal properties of suggests ultraviolet sensitivity is widespread among mammals. Proc. Biol. Sci. the mouse cone electroretinogram. J. Neurophysiol. 87, 42-48. doi:10.1152/jn. 281, 20132995. doi:10.1098/rspb.2013.2995 00489.2001 Ellingson, J. M., Fleishman, L. J. and Loew, E. R. (1995). Visual pigments and Kryger, Z., Galli-Resta, L., Jacobs, G. H. and Reese, B. E. (1998). The topography spectral sensitivity of the diurnal gecko Gonatodes albogularis. J. Comp. Physiol. of rod and cone photoreceptors in the retina of the ground squirrel. Vis. Neurosci. 15, 685-691. doi:10.1017/S0952523898154081 A 177, 559-567. doi:10.1007/BF00207185 Lind, O., Mitkus, M., Olsson, P. and Kelber, A. (2014). Ultraviolet vision in birds: Emerling, C. A., Huynh, H. T., Nguyen, M. A., Meredith, R. W. and Springer, M. S. the importance of transparent eye media. Proc. R. Soc. B 281, 20132209. doi:10. (2015). Spectral shifts of mammalian ultraviolet-sensitive pigments (short 1098/rspb.2013.2209 wavelength-sensitive opsin 1) are associated with eye length and photic niche Pachitariu, M., Steinmetz, N., Kadir, S., Carandini, M. and Harris, K. D. (2016). evolution. Proc. R. Soc. B 282, 20151817. doi:10.1098/rspb.2015.1817 Kilosort:realtime spike-sorting for extracellular electrophysiology with hundreds of Fasick, J. I., Applebury, M. L. and Oprian, D. D. (2002). Spectral tuning in the channels. BioRxiv. doi:10.1101/061481 mammalian short-wavelength sensitive cone pigments. Biochemistry 41, Peichl, L. (2005). Diversity of mammalian photoreceptor properties: adaptations to 6860-6865. doi:10.1021/bi0200413 habitat and lifestyle? Anat. Rec. A Discov. Mol. Cell Evol. Biol. 287A, 1001-1012. Gibson, D. G., Young, L., Chuang, R.-Y., Venter, J. C., Hutchison, C. A., , III and doi:10.1002/ar.a.20262 Smith, H. O. (2009). Enzymatic assembly of DNA molecules up to several Qian, H., Shah, M. R., Alexander, K. R. and Ripps, H. (2008). Two distinct hundred kilobases. Nat. Methods 6, 343-345. doi:10.1038/nmeth.1318 processes are evident in rat cone flicker ERG responses at low and high temporal Govardovskii, V. I., Fyhrquist, N., Reuter, T., Kuzmin, D. G. and Donner, K. frequencies. Exp. Eye Res. 87, 71-75. doi:10.1016/j.exer.2008.04.011 (2000). In search of the visual pigment template. Vis. Neurosci. 17, 509-528. Sagdullaev, B. T., DeMarco, P. J. and McCall, M. A. (2004). Improved contact lens doi:10.1017/S0952523800174036 electrode for corneal ERG recordings in mice. Doc. Ophthalmol. 108, 181-184. Hunt, D. M., Cowing, J. A., Wilkie, S. E., Parry, J. W. L., Poopalasundaram, S. doi:10.1007/s10633-004-5734-1 and Bowmaker, J. K. (2004). Divergent mechanisms for the tuning of shortwave Schumann, D. M., Cooper, H. M., Hofmeyr, M. D. and Bennett, N. C. (2005). sensitive visual pigments in vertebrates. Photochem. Photobiol. Sci. 3, 713-720. Circadian rhythm of locomotor activity in the four-striped field mouse, Rhabdomys doi:10.1039/b314693f pumilio: a diurnal African rodent. Physiol. Behav. 85, 231-239. doi:10.1016/j. Hunt, D. M., Carvalho, L. S., Cowing, J. A., Parry, J. W. L., Wilkie, S. E., Davies, physbeh.2005.03.024 W. L. and Bowmaker, J. K. (2007). Spectral tuning of shortwave-sensitive visual Schumann, D. M., Cooper, H. M., Hofmeyr, M. D. and Bennett, N. C. (2006). Light- induced Fos expression in the suprachiasmatic nucleus of the four-striped field pigments in vertebrates. Photochem. Photobiol. 83, 303-310. doi:10.1562/2006- mouse, Rhabdomys pumilio: a southern African diurnal rodent. Brain Res. Bull. 06-27-IR-952 70, 270-277. doi:10.1016/j.brainresbull.2006.04.009 Hunt, D. M., Carvalho, L. S., Cowing, J. A. and Davies, W. L. (2009). Evolution and van der Merwe, I., Lukáts, A., Bláhová, V., Oosthuizen, M. K., Bennett, N. C. and spectral tuning of visual pigments in birds and mammals. Phil. Trans. R. Soc. B Němec, P. (2018). The topography of rods, cones and intrinsically photosensitive 364, 2941-2955. doi:10.1098/rstb.2009.0044 retinal ganglion cells in the retinas of a nocturnal (Micaelamys namaquensis) and Hut, R. A., Kronfeld-Schor, N., van der Vinne, V. and De la Iglesia, H. (2012). In a diurnal (Rhabdomys pumilio) rodent. PLoS ONE 13, e0202106. doi:10.1371/ search of a temporal niche: environmental factors. Prog. Brain Res. 199, 281-304. journal.pone.0202106 doi:10.1016/B978-0-444-59427-3.00017-4 van Norren, D. and Gorgels, T. G. M. F. (2011). The action spectrum of Jacobs, G. H. (1993). The distribution and nature of colour vision among the photochemical damage to the retina: a review of monochromatic threshold data. mammals. Biol. Rev. Camb. Philos. Soc. 68, 413-471. doi:10.1111/j.1469-185X. Photochem. Photobiol. 87, 747-753. doi:10.1111/j.1751-1097.2011.00921.x 1993.tb00738.x Yokoyama, S. and Radlwimmer, F. B. (1998). The “five-sites” rule and the Joesch, M. and Meister, M. (2016). A neuronal circuit for colour vision based on evolution of red and green color vision in mammals. Mol. Biol. Evol. 15, 560-567. rod-cone opponency. Nature 532, 236-239. doi:10.1038/nature17158 doi:10.1093/oxfordjournals.molbev.a025956 Journal of Experimental Biology