DOCSLIB.ORG
Explore
Sign Up
Log In
Upload
Search
Home
» Tags
» Free fatty acid receptor
Free fatty acid receptor
Edinburgh Research Explorer
Targeting Lysophosphatidic Acid in Cancer: the Issues in Moving from Bench to Bedside
Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
When Simple Agonism Is Not Enough: Emerging Modalities of GPCR Ligands Nicola J
Phosphorylation of G Protein-Coupled Receptors: from the Barcode Hypothesis to the Flute
Microbiota Signals During the Neonatal Period Forge Life-Long Immune Responses
Pharmacology of Free Fatty Acid Receptors and Their Allosteric Modulators
FFA2-, but Not FFA3-Agonists Inhibit GSIS of Human Pseudoislets
The Pharmacology and Function of Receptors for Short-Chain Fatty Acids
A Biased Agonist at Immunometabolic Receptor GPR84 Causes Distinct Functional Effects in Macrophages † ‡ ‡ ‡ † ‡ Daniel Lucy, , Gareth S
Membrane Estrogen Receptor (GPER) and Follicle-Stimulating Hormone
Seven Transmembrane G Protein-Coupled Receptor Repertoire of Gastric Ghrelin Cells%
Flavonoids: Structure–Function and Mechanisms of Action and Opportunities for Drug Development
Oxygenated Fatty Acids Enhance Hematopoiesis Via the Receptor GPR132
Lysophosphatidic Acid Signaling in Cancer Cells: What Makes LPA So Special?
FFAR1 and FFAR4 Signaling in Cancer and Diabetes
Fatty Acid Receptors
The Role of Gpcrs in Bone Diseases and Dysfunctions
Top View
Of the Pattern Recognition Formyl Peptide Receptors in Neutrophils
Mutations in G Protein–Coupled Receptors: Mechanisms, Pathophysiology and Potential Therapeutic Approachess
RT² Profiler PCR Array (384-Well Format) Mouse G Protein Coupled Receptors 384HT
Short-Chain Fatty Acids and Their Association with Signalling Pathways in Inflammation, Glucose and Lipid Metabolism
(5' to 3') TLR4 F: AACAGTGGGTACAGGATGCAATT R
Inhibition of Store-Operated Calcium Channels by N-Arachidonoyl Glycine
2017Raihanphd (2).Pdf
The N-Terminus of GPR37L1 Is Proteolytically Processed by Matrix
G Protein-Coupled Receptor Systems As Crucial Regulators of DNA Damage
Human G Protein Coupled Receptors 384HT
The Endocannabinoid System and Ppars: Focus on Their Signalling Crosstalk, Action and Transcriptional Regulation
1 Supplementary Material Figure S1. Volcano Plot of Differentially
Free Fatty Acid Receptor G-Protein–Coupled Receptor 40 Mediates Lipid Emulsion-Induced Cardioprotection
Targeting Lysophosphatidic Acid in Cancer: the Issues in Moving from Bench to Bedside
Discovery and Validation of Potential Drug Targets Based on the Phylogenetic Evolution of Gpcrs
Shermado, Fairouz M
The Role of Free Fatty Acid Receptors in the Immune System ⇑ ⇑ Elisa Alvarez-Curto , Graeme Milligan
YAP and Endothelin-1 Signaling: an Emerging Alliance in Cancer Piera Tocci1, Giovanni Blandino2 and Anna Bagnato1*
Free Fatty Acid Receptors 2 and 3 As Microbial Metabolite Sensors to Shape Host Health: Pharmacophysiological View
Supplementary Materials
(12) Patent Application Publication (10) Pub. No.: US 2016/0116468 A1 RYU Et Al
Role of Lysophosphatidic Acid and Its Receptors in Health and Disease: Novel Therapeutic Strategies
G Protein-Coupled Receptors
The Relevance of Adhesion G Protein-Coupled Receptors In
The Microbiota and the Gut–Brain Axis in Controlling Food Intake and Energy Homeostasis
O 2011/091272 a L
PDF-Document
G Protein-Coupled Receptors
A Potent Antagonist of Protease-Activated Receptor 2 That Inhibits Multiple Signaling Functions in Human Cancer Cells S
Free Fatty Acid Receptors: Structural Models and Elucidation of Ligand Binding Interactions Irina G
Gα12/13 Signaling in Metabolic Diseases Yoon Mee Yang1,Da-Solkuen2, Yeonseok Chung 2,Hitoshikurose3 and Sang Geon Kim2
Free Fatty Acid Receptors:Structural Models and Elucidation of Ligand Binding Interactions
Phosphorylation of G Protein-Coupled Receptors: from the Barcode Hypothesis to the Flute Model
G Protein–Coupled Receptor 30 Mediates the Anticancer Effects Induced by Eicosapentaenoic Acid in Ovarian Cancer Cells