Frank Eric Tatsing Foka

Assessment of feedlots cattle in the development and spread of Vancomycin resistant Enterococci

Orcid ID: 0000-0001-6577-2827

Thesis submitted in fulfilment of requirements for the degree of Doctor of Philosophy in Biology at the North-West University

Promoter: Professor C.N. Ateba

Examination: December 2019 Student number: 28035348 SUMMARY

Enterococci are commensals of the gastrointestinal tract of warm-blooded animals. They have been incriminated in a wide range of community-aquired infections and nosocomial diseases, especially in immunocompromised individuals and stressed animals. If enterococci have been able to survive and thrive in different ecological niches to date, it is due mainly to their outstanding capability to adapt to these various environmental settings by incorporating into their genetic constitution, resistance genes to many currently used antimicrobials. The widespread use of antibiotics in industrial animal husbandry has contributed significantly to the emergence of resistant isolates, such as vancomycin-resistant enterococci (VREs) worldwide and in South Africa, specifically. Despite the fact that Avoparcin, which is a glycopeptide and analogue of vancomycin, was identified as the source of the emergence of

VREs and was forbidden worldwide in industrial animal farming decades ago, VREs are regularly screened in environmental samples in the North West Province, South Africa. This study, therefore, sheds some light on the various reasons why VREs are continuously detected in environmental samples in the North West Province of South Africa. Very few studies in

South Africa have focused on the involvement of cattle feedlots in the spread and dissemination of such strains in the environment. In this regard, we aseptically collected 384 faecal samples,

24 drinking troughs water and 24 soil/liter samples from six registered feedlots of the North

West Province, South Africa. Thereafter, we used biochemical and molecular methods to identify and categorise the isolated enterococci. Furthermore, we determined their antibiotic resistance and their virulence profiles with phenotypic and genotypic methods as well as Next

Generation Sequencing platforms. Five humdred and twenty-seven (527) presumptive isolates were recovered, while two hundred and eighty-nine (289) isolates were confirmed as members of the genus Enterococcus. Species specific PCR protocols were used to identify them as E. faecalis (9%), E. faecium (10%), E. durans (69%), E. gallinarum (6%), E. casseliflavus (2%),

E. mundtii (2%) and E. avium (2%). Vancomycin resistance genes were detected through PCR assays in 176 isolates, precisely vanA (62%), vanB (17%) and vanC (21%). Moreover, four

Tetracycline efflux pump genetic determinants were also detected through PCR methods in

138 of the screened VREs and these included tetK (26), tetL (57), msrA/B (111) and mefA (9).

All the VREs of this study were multidrug resistant and four antibiotic resistance profiles were identified. Furthermore, cylA, hyl, esp, gelE and asa1 virulence genes were detected in 86

VREs, with some harbouring more than one virulence gene. The cluster analysis of the VREs of this study was based on the diameters of the antibiotic inhibition zones and revealed a similar exposure history to the antibiotics tested. Data on antimicrobials currently used in the feedlots under investigation, either for prophylactic purposes or for therapeutic purposes as well as for growth promoting purposes, was collected. Data was assessed along with the bioinformatical analysis of the whole genome sequences of VR E. durans strain NWUTAL1 and VR E. gallinarum strain S52016, isolated from feedlot cattle faeces and feedlot soil/liter samples respectively. The data derived from these analyses revealed that some of the antibiotics used in the feedlots, were responsible for the resurgence of VREs. Specifically, plasmids with resistance genes to Tetracycline, Tylosin and Erythromycin were detected in these VREs.

These antibiotics wield a sort of selective pressure on their specific antibiotic resistance genetic determinants that are co-selected with Vancomycin resistance genes. The fact that potentially pathogenic multidrug resistant VREs were detected in this study, demonstrates that practices such as the extensive usage of antibiotics in industrial animal husbandry, have a significant impact on the environment and its ecological niches. This may, consequently, affect humans and other living organisms since it enhances the availability of antimicrobial resistance genes in the environment, which is taken up and exchanged among commensals that were not initially harmful. Since such commensals find their way through direct and indirect contacts into the

3 food chain, issues of this nature cannot be undermined, especially in the context of South

Africa, where the occurrence of AIDS/HIV and diabetes is high.

DECLARATION

I, the undersigned, declare that the thesis hereby submitted to the North-West University,

Mafikeng Campus, for the degree of Doctor of Philisophy (PhD) in Biology and the work contained herein, is my own original work in design and execution. I further declare that the thesis has not previously, in its entirety or in part, been submitted to any other institution for an academic qualification. All materials used in the study have been duly acknowledged.

Signed at ...... on this ...... Day of

...... 2019

______

F. E. Tatsing Foka

(Student)

Signed at ...... on this...... Day of ......

2019

______

Professor C.N. Ateba

(Supervisor)

DEDICATION

I dedicate this study to my parents, Mr and Mrs Foka, who, against all odds, gave me the headstart I needed in life by providing and teaching me the importance of education. Your unconditional love, care and support throughout every single step of my life, made me stronger as I faced every challenge. Without you, I would not have realised this endeavour.

ACKNOWLEDGEMENTS

I wish to thank the Heavenly Father, for my life and most especially, my studies; you stood firm and next to me and never failed me. You are worthy my Lord to receive Glory for you are above all living beings and your power is beyond any other power. All things shall pass but you were, you are and you will forever be.

I would like to express my gratitude to my supervisor, Professor C.N. Ateba, for giving me the opportunity to do a PhD in his research group, for his constant support, patience and encouragement throughout my studies. It has truly been inspiring and uplifting working with him throughout these years.

Institutionally, I would like to acknowledge the financial support provided by the North-West

University Institutional Bursary and the North-West University merit bursary. Moreover, I acknowledge all the members of staff of the School of Biological Sciences, North-West

University, Mafikeng Campus. I appreciate their support in the realisation of this project.

The assistance offered by Dr Ayanbgero Ayansina, Mr Peter Montso, Mr Alayande Kazeem,

Mr Akinola Stephen, Mr Christ Donald Kaptchouang and my colleagues of the Molecular

Microbiology laboratory is fully appreciated. I would also like to acknowledge Professor

Noutchie Okouomi Suarez Clovis and Dr Yah S. Clarence, for their kind assistance and support during this journey. I am eternally grateful to Professor Carlos Bezendehout, Dr Charlotte

Minnie and Mr Rudolph of the North-West University, Potchefstroom Campus, for the guidance and support provided in the 16S rRNA and NGS analysis of my isolates.

I also deeply appreciate Dr K. S. Bet, Department of Geography, North-West University, for providing a map of my sampling points and the Cameroonian community in Mafikeng, for their constant words of encouragement.

Finally, I thank my parents and my sisters, for their prayers, love and unending support throughout this journey. I would also like to express my appreciation to Mr and Mrs Chongang,

7 for their support and prayers throughout these years. To my wife and my children, I know how hard it must have been for you to bear my absence throughout these years, without your love and your support, I would not have made it.

TABLE OF CONTENTS

...... 1

SUMMARY ...... 2

DECLARATION ...... 5

DEDICATION ...... 6

ACKNOWLEDGEMENTS ...... 7

TABLE OF CONTENTS ...... 9

LIST OF TABLES ...... 15

LIST OF FIGURES ...... 16

CHAPTER 1...... 18

General introduction and problem statement ...... 18

1.1 Introduction ...... 19

1.2 Problem statement ...... 21

1.3 Research questions ...... 22

1.4 Hypotheses ...... 23

1.5 Aim and objectives of the study ...... 23

1.5.1 Aim of the study ...... 23

1.5.2 Objectives of the study ...... 23

REFERENCES ...... 24

CHAPTER 2...... 28

LITERATURE REVIEW ...... 29

2.1 General characteristics of enterococci ...... 29

2.2 Characterisation of enterococci...... 32

2.2.1 Phenotypic methods of characterisation ...... 32

2.2.2 Genotypic methods of characterisation ...... 36

2.2 Pathogenic attributes of enterococci ...... 43

2.2.1 Virulence factors in enterococci ...... 43

2.2.1.2 Virulence factors that affect host tissues ...... 46

2.3 Enterococcal infections ...... 48

2.3.1 Enterococcal infections in humans ...... 48

2.3.2 Enterococcal infections in cattle ...... 49

2.3.3 Therapeutic management of enterococcal infections...... 50

2.5 Antibiotic resistance in enterococci ...... 51

2.5.1. Historical backgroumd of antibiotic resistance ...... 51

2.5.2 Development and dissemination of AMR ...... 52

2.5.3 Antimicrobial resistance in enterococci ...... 54

2.5.4 Vancomycin resistance in enterococci ...... 55

2.6 Antimicrobials and growth promoters in cattle rearing ...... 62

2.7. Growth promoters and animal husbandry in the Republic of South Africa ...... 65

2.7.1. Regulation of antimicrobial usage in the farming sector in South Africa ..... 65

2.7.2. Antibiotics and antimicrobial usage in intensive animal rearing in South Africa 65

2.8. Extensive usage of antibiotics in farming: Implications on public health ...... 67

2.9. Therapeutic options of VRE infections ...... 70

2.9.1. Daptomycin ...... 70

2.9.2. Telavancin dalbavancin and oritavancin ...... 70

2.9.3. Oxazolidinones linezolid and tedizolid ...... 71

2.9.4. Streptogramins ...... 71

2.10. Epidemiological overview of glycopepetide resistant enterococci (GREs) ...... 72

2.11. Antibiotic resistance: The way forward ...... 73

REFERENCES ...... 75

CHAPTER 3...... 99

Emergence of Vancomycin-resistant enterococci in South Africa: Implications for public health...... 99

Abstract ...... 100

3.1 Introduction ...... 101

3.2 Mechanism of resistance to Vancomycin ...... 102

3.3 Studies of Vancomycin-resistant enterococci in South Africa ...... 103

3.3.1 Vancomycin-resistant enterococci in food items and the environment ...... 104

3.3.2 Vancomycin-resistant enterococci in hospital settings ...... 105

3.3.3 Vancomycin-resistant enterococci in farming and agricultural practices ...... 106

3.4 Pathways of antimicrobial resistance transmission ...... 106

3.5 Current status of the management of antimicrobial resistance in South Africa ...... 108

3.5.1 Regulation of antimicrobial usage in humans ...... 110

3.5.2 Regulation of antimicrobial usage in animals ...... 110

3.6 Measures to reduce the incidence and prevalence of Vancomycin-resistant enterococci .... 113

3.6.1 Step 1: Enforcement of the legislation on drug distribution and usage ...... 113

3.6.2 Step 2: Prioritisation of the use of alternatives to antibiotics ...... 113

3.6.3 Step 3: Implementation of a nationwide effective antimicrobial resistance surveillance system ...... 114

3.7 Conclusion ...... 116

REFERENCES ...... 118

CHAPTER 4...... 126

Detection of virulence genes in multidrug resistant Enterococci isolated from feedlots dairy and beef cattle: Implications for human health and food safety ...... 126

Abstract ...... 127

4.1 Introduction ...... 128

4.2 Materials and methods ...... 131

4.2.1 Collection of samples and study area ...... 131

4.2.2 Isolation of VRE from the samples ...... 132

4.2.3 Genomic Enterococcus DNA isolation and identification ...... 132

4.2.4 Species-specific PCR assay for the identification of Enterococcus sp...... 133

4.2.5 PCR detection of Vancomycin resistance, Tetracycline efflux pump and virulence genes ...... 133

4.2.6 Gel electrophoresis of the amplicons ...... 134

4.2.7 Antimicrobial susceptibility test ...... 134

4.2.8 Data analysis ...... 135

4.3. Results ...... 139

4.3.1 Species distribution and occurence of Vamcomycin-resitant enterococci in feedlots and feedlots cattle ...... 139

4.3.2 Antibiotic resistance profile of VRE isolates ...... 142

4.3.3 Virulence profiles of VRE isolates ...... 144

4.3.4 Data analysis ...... 147

4.4 Discussion ...... 149

4.5 Conclusion ...... 154

REFERENCES ...... 156

CHAPTER 5...... 163

Genomic analysis of Vancomycin-resistant enterococci from a cattle feedlot: Impact of intensive cattle rearing on the environment and its microbiomes ...... 163

Abstract ...... 164

5.1 Background ...... 165

5.2 Materials and methods ...... 168

5.2.1 Ethical clearance ...... 168

5.2.2 Sample collection and isolation of presumptive isolates ...... 169

5.2.3 Genomic DNA extraction and detection of Vancomycin-resistant enterococci (VREs) ...... 169

5.2.4 Sequencing and library preparation of whole genome ...... 169

5.2.5. Sequence quality checking, trimming and assembly ...... 170

5.2.6. Genome annotation and comparative analysis ...... 170

5.2.7 Data analysis ...... 171

5.3 Results ...... 171

5.3.1 Species identification and enumeration of VR E. durans and VR E. gallinarum ...... 171

5.3.2 Genomic assembly features of E. durans NWUTAL1 and E. gallinarum S52016 ...... 171

5.3.3 Genomic annotation of strains NWUTAL1 and S52016 ...... 172

5.4 Discussion ...... 182

5.5 Conclusion ...... 186

REFERENCES ...... 189

CHAPTER 6...... 200

General discussion, concluding remarks and future perspectives ...... 200

6.1 General discussion ...... 201

6.1.1 Antibiotic stewardship and current regulation of antimicrobials in South Africa ...... 203

6.1.2 Screening of Vancomycin-resistance attributes in enterococci isolated from cattle feedlots in the North West Province, South Africa ...... 206

6.1.3 Antimicrobial susceptibility testing and detection of Tetracycline resistance genes in VREs ...... 208

6.1.4 Virulence profiles of the VRE isolates ...... 210

6.1.5 Whole genome sequencing of E. durans strain NWUTAL1 and E. gallinarum strain S52016 ...... 210

6.2 Concluding remarks ...... 213

6.3 Future perspectives ...... 214

REFERENCES ...... 214

LIST APPENDICES...... 222221

Appendix 1: Map of the different sampling points ...... 222221

Appendix 2: Details of materials, chemicals enzymes, reagents and culture media used in this study...... 223

Appendix 3: Raw results ...... 229

LIST OF TABLES

Table 2.1: Species of the genus Enterococcus………………………………………………29

Table 2. 2: Antibiotics used as growth promoters in the European community, past and present ...... 64

Table 2. 3: Growth promoters used in intensive animal rearing in South Africa ...... 65

Table 3. 1: Antimicrobials used in South Africa as growth promoters ...... 108

Table 3. 2 : Antibiotics sold in the private and public sector (from 2014 to 2016) ...... 112

Table 3. 3: Actions prioritised at the Third World Healthcare Associated Infections Forum with respect to antimicrobial resistance...... 115

Table 4. 1: Types of samples used in this study ...... 131

Table 4. 2: Oligonucleotide primers used in this study ...... 136

Table 4. 3: Distribution of enterococcal species per sampling site ...... 139

Table 4. 4: Predominant multidrug resistance patterns observed among isolates ...... 143

Table 4. 5: Virulence genes patterns in VRE isolates from different sampling sites ...... 146

Table 4. 6: Cluster distribution of isolates ...... 147

Table 5. 1: Assembly reports of E. durans NWUTAL1 and E. gallinarum S52016 genomes

...... 165

Table 5. 2: Protein features of E. durans NWUTAL1 and E. gallinarum S52016...... 172

Table 5. 3: Antibiotic resistance genes detected in strains NWUTAL1 and S52016 ...... 177

LIST OF FIGURES

Figure 2. 1: Illustration of genetic elements involved in the spread of ARG as a result of selective pressure from the use of antibiotics...... 54

Figure 2. 2: VanA resistance gene cluster and resistance mechanism...... 58

Figure 2. 3: Comparisons of several Vancomycin resistance clusters found in enterococci. . 62

Figure 2. 4: Transmission pathway of antimicrobial resitance genes ...... 69

Figure 3. 1: Vancomycin resistance gene clusters and resistance mechanism...... 103

Figure 3. 2: Transmission pathway of antimicrobial resistance within agriculture, the environment and the food-processing industry...... 107

Figure 4. 1: Trend in Vancomycin resistance genes among enterococcal isolates from the feedlots ...... 140

Figure 4. 2: Multiplex PCR positive isolates...... 141

Figure 4. 3: Distribution of Tetracycline-resistant VREs...... 142

Figure 4. 4: Tetracycline resistant VRE isolates...... 142

Figure 4. 5: Proportions of antibiotic resistant VRE isolates ...... 143

Figure 4. 6: Enterococcal strains with virulence genes ...... 144

Figure 4. 7: Dendogram depicting the relationship between 72 multidrug resistant VREs isolated from the feedlots...... 148

Figure 5. 1: Subsystem analysis of strain NWUTAL1 and strain S52016 ...... 173

Figure 5. 2: Circular graphical display of the distribution of the annotated genomes of strain

NWUTAL1 and strain S52016 ...... 175

Figure 5. 3: Phylogenetic tree determining the relationship between strains NWUTAL1,

S52016 and other enterococci of the same species...... 182

CHAPTER 1

General introduction and problem statement

Chapter one

General introduction and problem statement

1.1 Introduction

The beef industry is an important value-added enterprise worldwide and millions of farms and ranches benefit directly from the sale of slaughtered animals, thus contributing significantly to the economic output of their respective countries (Economou and Gousia, 2015). Enterococci are extremely versatile organisms that occur as commensals in the gastrointestinal tract of warm-blooded animals and humans (Aarestrup, 2000) and as opportunistic pathogens in immunocompromised persons (Acar et al., 2012). Also known to be ubiquitous organisms, enterococci can survive under adverse environmental conditions (Acar et al., 2012) and can, therefore, be isolated from environmental samples such as water, soil or plant surfaces (Ateba and Mohapi, 2013; Matlou et al., 2019). Their dominance in the digestive tract of warm- blooded animals and humans (Ateba and Maribeng, 2011), has resulted in some strains being used as potential indicators of faecal contamination in food and water (Ateba and Maribeng,

2011; Ateba and Mohapi, 2013).

The discovery of antibiotics was a corner stone in the evolution of humanity since antibiotics became life-saving substances for both animals and humans (Gonzalez-Zorn and Escudero,

2012). Chemotherapy had a positive and deep impact on the society since availability of antibiotics and antimicrobial agents prolonged life expectancy through the ability to treat common infections, thus allowing rapid population growth (Gonzales-Zorn and Escudero,

2012). Antibiotics have since then, become a key element not only in the success of surgical interventions, but also in successful intensive animal rearing (Acar and Moulin, 2012;

Economou and Gousia, 2015). For instance, antimicrobials are extensively used in cattle rearing for prevention, control and treatment of infections; but most importantly, to improve

19 growth and feed efficiency (USFDA, 2014). Although it has been demonstrated somehow, that various types of resistance attributes and resistant bacterial strains were present long before the production and usage of antimicrobials (Acar et al., 2012), the extensive use of antimicrobial agents, especially antibiotics, has unfortunately, led to the rise of resistant isolates (Rzewuska et al., 2015). This has resulted in severe consequences on consumers and, therefore, undermines the importance of the positive effects of antimicrobials in both animals and humans

(Jui-Chang et al., 2005). Consequently, antibiotic-resistant bacterial strains have made therapeutic alternatives for the treatment of infections caused by multi-drug resistant organisms limited and their subsequent antimicrobial resistance genes (ARG’s) available in the environment (Tao et al., 2014). In fact, extended spectrum beta-lactamase-producing (ESBL)

E. coli resistant to category I antibiotics, have been detected among farm animals in Canada and the United States of America (Mollenkopf et al., 2012). In addition, Taucer-Kapteijin and his colleagues (2016) isolated Vancomycin resistant enterococci (VRE) from surface water intended for drinking water production in the Netherlands. Similarly, Vancomycin resistance genes have also been detected in VRE strains isolated from ground water intended for human consumption and food products in Mafikeng, South Africa (Ateba and Maribeng, 2011; Ateba and Mohapi, 2013).

Avoparcin, a growth promoter and analogous compound to Vancomycin (Bager et al., 1997), was banned worldwide due to its association with a high prevalence of VRE, both in faeces of exposed animals and in meat products (Bager et al., 1997; Wegener et al., 1998; Aarestrup,

2000). Despite this, the constant detection of VRE as well as the confirmation of Vancomycin resistance gene determinants in isolates from environmental samples, even in countries with strict drug usage policies and advance public health facilities, is a cause for concern (Borgen et al., 2002a; Borgen et al., 2002b). The detection of antimicrobial resistant bacteria has potentially impacted negatively on animal agriculture (Nilsson et al., 2009). Moreover, the

20 controversy over antimicrobial resistant pathogens and the use of antimicrobials in food animals may also have severe trade implications on beef and food industries (Economou and

Gousia, 2015). However, the detection of antibiotic resistance phenotypes and determinants does not always result from the usage of a particular antibiotic (Nilsson et al., 2009). For instance, Streptococcus pyogenes remains fully sensitive to Penicillin despite the presence of selective pressure (Bager et al., 1997) while E. coli is, most often, resistant to Chloramphenicol despite the removal of selective pressure (Ateba and Mohapi, 2013). In addition, due to coselection of resistance determinants, problems associated with antibiotic resistance is worsened since resistance traits in bacteria cannot be reversed by discontinued use of a particular antibiotic (Gonzalez-Zorn and Escudero, 2012).

Based on the aforementioned, two types of Vancomycin resistance in enterococci have been demonstrated as follows: intrinsic; and acquired resistance (Aarestrup, 2000). Intrinsic resistance is characterised by low-level resistance to Vancomycin and this type of resistance is commonly detected in Enterococcus gallinarum, Enterococcus casseliflavus and Enterococcus flavescens (Jui-Chang et al., 2005). On the contrary, strains of E. faecium and E. faecalis and less often, E. raffinosus, E. avium and E. durans, are known to display acquired resistance to

Vancomycin (Jui-Chang et al., 2005), resulting from the acquisition of genetic determinants, either from other organisms or from the environment (Jui-Chang et al., 2005; Sónia et al.,

2014).

1.2 Problem statement

Public awareness related to antimicrobial usage (AMU) in livestock continues to increase, as does continuing pressure for governments and industries to address these concerns, given the constant rise in antimicrobial resistance in bacteria (USFDA, 2014). In the past decades,

Vancomycin was utilised to treat Methicilin Resistant Staphylococcus aureus (MRSA) worldwide while its analogue (Avoparcin) was used as a growth promoter in cattle feeds

(Aarestrup, 2000). Due to the emergence of VRE, resulting from the misuse of Avoparcin, the use of Vancomycin, as the first choice drug in the treatment of resistant enteroccocci infections, was affected while Avoparcin was banned (Bager et al., 1997; Wegener et al., 1998; Aarestrup,

2000; Nilsson et al., 2009). Despite the fact that Vancomycin and its analogue (Avoparcin) are currently not in use in both veterinary and human medicine worldwide and in South Africa, in particular, a number of scientific investigations revealed the presence of VRE as well as other resistant bacterial strains that possess VRGs from animals (Moneoang and Bezuidenhout,

2009; Bekele and Ashenafi, 2010), meat (Sudeep et al., 2014), ground and surface water (Ateba and Maribeng, 2011; Taucer-Kapteijin et al., 2016; Matlou et al., 2019) and fresh vegetables

(Ateba and Mohapi, 2013). As a matter of fact, results obtained from two studies conducted in

Mafikeng, North West Province, South Africa revealed that VRE strains from lettuce and spinach leaves collected from some supermarkets (Ateba and Mohapi, 2013) as well as those isolated from ground water, intended for human consumption (Ateba and Maribeng, 2011), were resistant to multiple antibiotics, including Amoxicillin, Ampicillin, Chloramphenicol,

Teicoplanin, Tetracycline, Penicillin and Erythromycin. In addition, multidrug-resistant enterococci have also been detected in food-producing animals in South Africa (Moyane et al.,

2013). Therapeutic difficulties presented by VRE, especially strains that portray high-level aminoglycoside resistance traits, outlines the need to determine the source of VRGs detected among enterococci. This study was, therefore, designed to determine the contribution of feedlots cattle in the development and dissemination of VRGs in the environment, thus, the importance of this study cannot be overemphasised.

1.3 Research questions

The following research questions were asked:

 Does antimicrobial usage in cattle feedlots promote the dissemination of Vancomycin

resistance genes? and

 What are the causes of phenotypic and genotypic Vancomycin resistance in enterococci

from feedlots environments?

1.4 Hypotheses

The following research hypotheses were stated in the study:

 H0: Antimicrobial usage in cattle feedlots has a strong impact on the availability and

dissemination of Vancomycin resistance genes in the environment .

 H1: Vancomycin resistance genes are not expressed in VREs as a result of antimicrobial

usage in intensive animal rearing.

1.5 Aim and objectives of the study

1.5.1 Aim of the study

The aim of this study was to assess the impact of antibiotic usage in cattle feedlots of the North

West Province with regard to the development and spread of VRE strains in the environment.

1.5.2 Objectives of the study

The specific objectives of the study were to:

 Isolate Vancomycin resistant enterococci from faecal samples and drinking water

troughs and soil samples of feedlots and feedlots cattle;

 Identify the species identity of VREs isolated through species-specific PCR protocols;

 Determine the genetic antibiotic resistance profiles of isolates through PCR protocols

and disc diffusion assays;

 Determine virulence gene determinants of VRE isolates; and

 Assess genetic determinants involved in the propagation of Vancomycin resistance in

VREs isolated through Whole Genome Sequencing.

REFERENCES

Aarestrup, F.M. (2000). Characterization of glycopeptide-resistant Enterococcus faecium

(GRE) from broilers and pigs in Denmark: genetic evidence that persistence of GRE in

pig herds is associated with coselection by resistance to macrolides. J. Clin. Microbiol.

38, 2774 – 2777.

Ateba, C.N. and Maribeng, M.D. (2011). Detection of Enterococcus species in groundwater

from some rural communities in the Mmabatho area, South Africa: a risk analysis. Afr.

J. Microbiol. Rev. 5 (23), 3930 – 3935.

Ateba, C.N. and Mohapi, M.I. (2013). Isolation of vancomycin resistant enterococci isolated

from leafy vegetables (lettuce) from North West Province. Life Sci. 10 (4), 1163-1170.

Acar, J.F. and Moulin, G. (2012). Antimicrobial resistance: a complex issue. Rev. Sci. Tech.

31, 23 – 31.

Acar, J.F., Moulin, G., Page, S.W. and Pastoret, P.P. (2012). Antimicrobial resistance in

animal and public health: introduction and classification of antimicrobial agents. Rev.

Sci. Tech. 31, 15 – 21.

Bager, F.M., Madsen, J.C. and Aarestrup, F.M. (1997). Avoparcin used as a growth promoter

is associated with the occurrence of vancomycin-resistant Enterococcus faecium on

Danish poultry and pig farms. Prev. Vet. Med. 31, 95 – 112.

Bekele, B. and Ashenafi, M. (2010). Distribution of drug resistance among enterococci and

Salmonella from poultry and cattle in Ethiopia. Trop. Anim. Health Prod. 42, 857 – 864.

Borgen, K., Sorum, M., Wasteson, Y., Kruse, H. and Oppegaard, H. (2002). Genetic linkage

between erm(B) and vanA in Enterococcus hirae of poultry origin. Microb. Drug Resist.

8, 363 – 368.

Borgen, K., Wasteson, Y., Kruse, H. and Willems, R.J. (2002). Vancomycin-resistant

Enterococcus faecium (VREF) from Norwegian poultry cluster with VREF from

poultry from the United Kingdom and The Netherlands in an amplified fragment

length polymorphism genogroup. Appl. Environ. Microbiol. 68, 3133 – 3137.

Economou, V. and Gousia, P. (2015). Agriculture and food animals as a source of

antimicrobial-resistant bacteria. Infect. Drug Resist. 8, 49 – 61.

Gonzalez-Zorn, B. and Escudero, J.A. (2012). Ecology of antimicrobial resistance: humans,

animals, food and environment. Int. microbial. 15, 101 – 109.

Jui-Chang, T., Po-Ren, H., Hsiao-Mann, L., Hui-Jen, C., Shen-Wu, H. and Lee-Jene, T. (2005).

Identification of Clinically Relevant Enterococcus Species by Direct Sequencing of

groES and Spacer Region. J. Clin. Microbiol. 43, 235 – 241.

Matlou, D.P., Bissong M.E.A., Tchatchouang C.K., Adem, M.R., Foka, F.E.T. and Ateba, C.N.

(2019). Virulence profiles of vancomycin-resistant enterococci isolated from surface

and ground water utilized by humans in the North-West Province, South Africa: a

public health perspective. Environ. Sci. Pollut. Res. 26 (15), 15105 – 15114.

Mollenkopf, D.F., Weeman, M.F., Daniels, J.B., Abley, M.J., Mathews, J.L. and Gebreyes,

W.A. (2012). Variable within and between herd diversity of CTX-M cephalosporinase-

bearing Escherichia coli isolates from dairy cattle. Appl. Environ. Microbiol. 78, 4552

– 4560.

Moneoang, M.S. and Bezuidenhout, C.C. (2009). Characterisation of enterococci and

Escherichia coli isolated from commercial and communal pigs from Mafikeng in the

North-West Province, South Africa. Afr. J. Microbiol. Res. 3 (3), 88 – 86.

Moyane, J.N., Jideani, A.I.O. and Aiyegoro, O.A. (2013). Antibiotic usage in food producing

animals in South Africa and impact on human: antibiotic resistance. Afr. J. Microbiol.

Res. 7 (24), 2990 – 2997.

Nilsson, O., Grekol, C., Top, J., Franklin, A. and Bengtsson, B. (2009). Spread without known

selective pressure of a vancomycin-resistant clone of Enterococcus faecium among

broilers. J. Antimicrob. Chemother. 10, 1 – 5.

Rzewuska, M., Stefanska, I., Kizerwetter-Swida, M., Chrobak-Cmiel, D., Szczygielska, P.,

Lesniak, M., and Binek, M. (2015). Characterization of extended-spectrum-beta-

lactamases produced by Escherichia coli strains isolated from dogs in Poland. Pol. J.

Microbiol. 64, 285 – 288.

Sónia, R., Ingrid, C., Nuno, S., Michel, H., Hugo, S., José-Luis C.M., Patrícia, P. and Gilberto,

I. (2015). Effect of vancomycin on the proteome of the multiresistant Enterococcus

faecium SU18 strain. J. Proteomics. 113, 378 – 387.

Sudeep, G., Bahadur, B.H., Lok-Raj, J. and Maheshwar, S. (2014). Prevalence of vancomycin-

resistant enterococci species in minced buffalo meat of Chitwan, Nepal. Int. J. Appl.

Sci. Biotechnol. 2 (4), 409 – 412.

Tao, C.W., Bing-Mu, H., Wen-Tsai, J., Tsui-Kang, H., Po-Min, K., Chun-Po, H., Shu-Min, S.,

Tzung-Yu, S., Tern-Jou, W. and Yu-Li, H. (2014). Evaluation of five antibiotic

resistance genes in wastewater treatment systems of swine farms by real-time PCR. Sci.

Total Environ. 496, 116 – 121.

Taucer-Kapteijin, M., Hoogenboezem, W., Heiliegers, L., Danny de Bolster, H. and Medema,

G. (2016). Screening municipal wastewater effluent and surface water used for drinking

water production for the presence of ampicillin and vancomycin resistant enterococci.

Int. J. Hyg. Environ. Health. 16, 1 – 7.

US Food and Drug Administration Center for Veterinary Medicine. Judicious use of

antimicrobials for beef cattle veterinarians. Available from:

www.fda.gov/downloads/Animal veterinary/Safety health/Antimicrobial

resistance/pdf. Accessed on June 10, 2016.

Wegener, H.C., Madsen, N. and Aarestrup, F.M. (1997). Isolation of vancomycin resistant

Enterococcus faecium from food. Int. J. Food Microbiol. 35, 57 – 66.

CHAPTER 2

Literature review

CHAPTER TWO

LITERATURE REVIEW

2.1 General characteristics of enterococci

Members of the genus Enterococcus were described for the first time in 1899 by Thiercelin as

“coccoid-shaped bacteria from the human intestine”. The appellation “entérocoque” was then used to point out their intestinal origin, even though the term Streptococcus was still regularly used (Thiercelin, 1899). Later on classified as “group-D streptococci”, Sherman had a brilliant idea in 1937 as he developed a new method of classification of the genus Streptococcus into four main categories as follows: pyogenic; viridans; lactic and enterococci (Sherman, 1937;

Salminen et al., 2004). Later on, in 1984, the term “Enterococcus” was introduced due to the difference demonstrated between Streptococci and Enterococci after DNA-DNA and DNA-

RNA hybridisation experiments (Ogier and Serror, 2008). Based on the comparative analysis of the 16S rRNA gene sequences, 43 species of enterococci have been identified so far. The following enterococcal species are of medical importance:

Table 2. 1: Species of the genus Enterococcus

Group Examples of species in group

E. faecium group E. faecium, E. durans, E. hirae, E. mundtii, E. villorum, E.

canis, E. azikeev;

E. faecalis group E. faecalis, E. haemoperoxidus, E. moraviensi, E. ratti;

E. avium group E. avium, E. malodoratus, E. pseudoavium, E. raffinosus, E.

gilvus;

E. gallinarum group E. gallinarum, E. casseliflavus, E. flavescens;

E. dispar group E. dispar, E. asini, E. pallens ;

E. saccharolyticus group E. saccharolyticus, E. sulfures;

E. cecorum group E. cecorum, E. columbae;

Source: Salminen et al., 2004

Enterococci are Gram-positive, catalase negative and facultative anaerobic cocci that occur either singly, in pair or in chains (Aarestrup, 2000). They are commensals of the intestinal microbial flora of warm-blooded animals and humans (Taucer-Kapteijin et al., 2016).

Enterococci can also colonise the genito-urinary tract as well as the oral and vaginal cavities of immune-compromised patients (Manero et al., 2002). These organisms are ubiquitous in nature, thus enterococci can survive in a variety of environmental niches such as soil, water

(usually as faecal pollutants), food products and plants (Kühn et al., 1995; Müller et al., 2001;

Ateba and Mohapi, 2013; Ateba et al., 2013; Chajęcka-Wierzchowska et al., 2016). In fact, enterococci were extensively screened from cattle and pigs (Manero et al., 2002), dogs, horses and chicken (Hammerum et al., 2000), sheep, swine, rabbits and wild birds (Poeta et al., 2005).

Certain species such as the yellow-pigmented E. casseliflavus and E. mundtii are most frequently associated with plants (Müller et al., 2001; Salminen et al., 2004).

In Mafikeng, North West Province, South Africa, enterococci have also been isolated from ground water intended for human consumption and food products (Ateba and Maribeng, 2011;

Ateba and Mohapi, 2013; Ateba et al., 2013). Their morphological characteristics can be clearly viewed when cultured on brain heart infusion agar for 18 to 24 hrs at 37°C. They do not produce catalase, except for a few strains (Devriese et al., 2002). In addition, some enterococcal species are motile (E. casseliflavus, E. gallinarum) with a scanty flagellum; enterococci are facultative anaerobes (chemo-organotrophs) and lactic acid producers as a result of glucose fermentation through the Embden-Meyerhof-Parnas pathway (Holt et al.,

1994). All species, with the exception of E. faecalis, possess Lysine-D-asparagine bonds; E. faecalis has a peptidoglycan of the lysine-alanine 2-3 type (Domig et al., 2003). Enterococci

30 thrive under extreme temperatures, ranging from 5ºC to 50ºC. They display optimal growth at pH 7.5 but can also survive harsh conditions that could be lethal to other bacteria such as media with high salt concentrations. In fact, enterococci grow optimally at 37°C in media supplemented with 6.5% (w/v) NaCl and 40% (w/v) bile salts.

According to Devriese and his colleagues (2002), enterococci can be differentiated through many phenotypic attributes, except for some few strains. For instance, some species have demonstrated intolerance to NaCl (E. avium, E. cecorum and E. columbae). Moreover, the

Lancefield group D antigen cannot be verified in numerous isolates that belong to the avium species group and enzymatic activity might vary from one species to the other (Devriese et al.,

2002). Bile esculin agar (BEA) has been used for presumptive identification and differentiation of enterococcal isolates from non-group D streptococci based on the fact that enterococci tolerate bile salts and hydrolyse esculin. Esculin iron agar and 0.05% (w/v) K-tellurite agar have been used as alternative selective media for enterococci (Domig et al., 2003). According to Domig and his colleagues (2003), trypticase soy agar and Columbia agar supplemented with

5% (v/v) defibrinated sheep blood can be used to assess enterococcal isolates ability to rupture red blood cells. However, cytolysin mediated hydrolysis demonstrates β-haemolysis on human and horse blood agar (Domig et al., 2003; Mundy et al., 2000). The yellow coloration displayed by some enterococcal species (E. casseliflavus, E. flavescens and E. mundtii) can be assessed using Trypticase/Tryptone soy agar incubated for 18-24hrs at 35°C (Messer and Dufour, 1998).

Last but not the least, enterococcal species such as E. faecalis, E. faecium, E. gallinarum and

E. casseliflavus produce bacteriocins referred to as enterocins that are active against certain bacteria (De Vuyst et al., 2003).

E. faecalis is presently the most investigated enterococcal species because of its prevalence in nosocomial settings (Zhang et al., 2012). Until recently, the only publicly sequenced genome available was that of E. faecalis V583, which was the first reported clinical VRE in the USA

(Aakra et al., 2005). The genomes of the other enterococcal strains, including E. faecium, E. casseliflavus and E. gallinarum, among others, became available later on (Zhang et al., 2012;

Beukers et al., 2017).

2.2 Characterisation of enterococci

2.2.1 Phenotypic methods of characterisation

A variety of phenotypic methods have been used to characterise enterococci from different sources (Kuzucu et al., 2005). Some of these methods include the assessment of sugar utilization and enzyme production (biotyping) (Tomayko and Murray, 1995), sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE), multilocus enzyme electrophoresis (MLEE), antimicrobial susceptibility testing, serotyping, long-chain fatty acid analysis, fatty acid methyl esters analysis (FAME), enterocin typing, pyrolysis mass spectrometry (pyMS), vibrational spectroscopic methods and proton magnetic resonance spectroscopy (1H MRS) (Lancefield, 1933; Pompei et al., 1992; Tomayko and Murray, 1995;

Goodacre et al., 1996; Morrison et al., 1999; Bourne et al., 2001; Kirschner et al., 2001; Tyrell et al., 2002; Kuzucu et al., 2005; Macovei and Zurek, 2006). These methods are fully discussed in the following sections.

2.2.1.1 Assessment of sugar utilization and enzyme production (biotyping)

This method of identifying and typing is a traditional way of differentiating bacteria, and enterococci in the present situation since it consists of a battery of bacteriological tubes containing different carbohydrates and indicator dyes and the identity of the isolates relies on a numerical analysis of the results (Manero and Blanch, 1999). A number of miniaturised test kits have been developed to characterise enterococci based on data generated from routine analysis of clinical specimens (Domig et al., 2003). The principle of these kits relies on the ability to produce colour changes from the metabolism of specific types of sugar or when a

32 given enzymatic activity occurs (Domig et al., 2003; Salminen et al., 2004). Specific tests kits frequently used include the API 20 Strep (Bio-Merieux, France), the API 50 CH (Bio-Merieux,

France) and the Rapid ID32 Strep (Bio-Merieux, France) (Devriese et al., 2002). Moreover, test kits such as the API zym (Bio-Merieux) can be used to determine the potential of isolates to produce the esculinase and pyrase enzymes (Manero et al., 2002). Although these kits are time-saving and some of them such as the PhenePlateTM PhP plate system (PhPlate microplate

Techniques, Stockholm, Sweden) have been reported to produce results that are similar to those of pulsed-field gel electrophoresis (PFGE) (Künh et al., 1995), a huge disadvantage is the fact that they merely identify a limited number of Enterococcus species, thus making additional assays necessary for a fine-tuned differentiation.

2.2.1.2 Sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE)

Even though phenotypic methods have yielded reliable results in the characterisation of enterococcal strains (Domig et al., 2003). They have proved to be time-consuming and ambiguous (Salminen et al., 2004). Thus, a vast array of methods have been developed to achieve a less time-consuming and a more precise differentiation scheme for these bacterial species (Donabedian et al., 2010). According to Domig and his colleagues (2003), standard

SDS-PAGE assays can be use to characterise cellular protein and the generated fingerprints can be used for a rapid screening of strains. This is accurate when comparing and typing isolates at both species and strain levels (Domig et al., 2003; Hendrickx et al., 2009). Relatively cheap and simple, SDS-PAGE has been used to differentiate between strains and has, therefore, become a reference method in the characterisation of enterococci (Latasa et al., 2006).

2.2.1.3 Multilocus enzyme electrophoresis (MLEE)

The Multilocus enzyme electrophoresis (MLEE) is one of the first non-DNA method that has been used for genetic typing of bacterial isolates (Pujol et al., 1997). According to Hall and his colleagues (1996), fifty percent of the enzymes studied until date exist in numerous forms.

These enzymes may differ slightly in their chemical structures and thus, their kinetic or catalytic properties, providing opportunities for considerable varietions in their electrophoretic mobility patterns (Domig et al., 2003). This is based on the fact that genetic factors determine enzyme multiplicity (Araujo and Sampaio-Maia, 2018) and there is a possibility that isoenzymes could be dispersed among the various cellular parts and could be regulated by no less than two dissimilar genetic factors (Pujol et al., 1997). The presence of manifold loci that regulate enzymes which are specific to a similar substrate, is due to the replication of genetic determinants (Rathnayake et al., 2011) and as a result of these point mutations, duplicated genetic factors cause a discrepancy in the composition of amino acids. The main implication is that different enzyme types can be separated by electrophoresis based on variabilities of their charge or sizes (Domig et al., 2003; Rathnayake et al., 2011).

2.2.1.4 Antimicrobial susceptibility testing

Most enterococci isolated from different sources have demonstrated resistance to antimicrobials (Hughes, 2003). This has urged scientists to assess their antibiotic susceptibility profiles since their disease-causing abilities cannot be underestimated (Huttner et al., 2013).

Generally, antibiotic resistance in enterococci and most bacterial species are either intrinsic or acquired from other strains or the environment (Courvalin, 2006). A number of studies have revealed that antibiotic resistance patterns of isolates can be as a tool for characterisation of

Enterococcus isolates from diverse sources and geographical locations (Arvanitido, 2003; Choi et al., 2003). For instance, Choi et al. (2003) and Arvanitido (2003) used the antibiotic resistance profiles of enterococci to characterise isolates from the Huntington Beach in

California, USA and in swimming seawaters in Greece, respectively. The Kirby-Bauer disc diffusion assay is most frequently used to assess antibiotic resistance in isolates (Rathnayake et al., 2011), followed by Frank’s E-test (Franz et al., 2001) and the minimum inhibitory concentration method (MIC) (Rathnayake et al., 2011).

2.2.1.5 Serotyping

In 1933, Rebecca Lancefield was the first to report that β-haemolytic faecal streptococci typically possessed the group D antigen (Lancefield, 1933). The recent trend nowadays, is to use the numerical chemotaxonomy and genetic techniques to classify streptococci in taxa

(Cocconcelli et al., 1996).

2.2.1.6 Long-chain fatty acid analysis

Long chain fatty acids are a group of important metabolites found in most living cells, which are involved in energy production (Nagy et al., 2004). Gas chromatography or High-pressure liquid chromatography are used to generate long-chain fatty acid profiles of microrganisms

(Tyrrell et al., 2002; Nagy et al., 2004). Tyrrell and his colleagues (2002) described the new enterococcal isolates, E. gilvus and E. pallens by comparing their long-chain fatty acid features with that of related group 1 enterococci that also possessed long-chain fatty acid.

2.2.1.7 Fatty acid methyl esters analysis (FAME)

Fatty acid methyl esters analysis (FAME) is the assessment of microbial fatty acid methyl esters extracts using gas chromatography (Lang et al., 2001). Initially, the samples for gas chromatography are prepared through two protocols, which involve extraction and methylation

(Lang et al., 2001). FAME profiles generated are used alongside biotyping and ribotyping to analyse enterococcal isolates from cheese (Lang et al., 2001). They were used to demonstrate a significant overlap between the groups, characterised through the aforementioned methods

(Chajecka-Wierzchowska et al., 2017).

2.2.1.8 Spectroscopic methods

Spectroscopic assays come in handy in the characterisation of enterococcal isolates besides the other phenotypic methods. Spectroscopic methods include pyrolysis mass spectrometry

(pyMS), vibrational spectroscopic methods and proton magnetic resonance spectroscopy (1H

MRS). Spectroscopic methods are used to determine the structure or molecular features of a sample through the interaction of light with matter. The magnetic field around an atom in a molecule is unique and affects its resonance frequency in such a way that the molecular electronic structure of functional compounds such as proteins, can be determined (Kirschner et al., 2001). Morrison and his colleagues (1999) used pyMS to differentiate Vancomycin- resistant E. faecium strains that have similar PFGE groupings. Moreover, rapid identification of isolates as Enterococcus spp. rather than Streptococcus spp. was achieved by Goodacre et al. (1996) through “Fourier Transform Infrared Spectroscopy” combined with “Artificial

Neural Network” (FT-IR, vibrational spectroscopy).

2.2.2 Genotypic methods of characterisation

Despite the fact that phenotypic methods are reasonably efficient in the characterisation of enterococci, genotypic methods have fine-tuned the characterisation of enterococci, mainly due to their high specificity and sensitivity (Kirschner et al., 2001). Genotypic methods are founded on the nucleic acid characteristics of an isolate instead of any phenotypic trait and are highly reproducible and reliable (Rathnayake et al., 2011). Examples of genotypic methods that have been used for the characterisation and typing of enterococci are as follows: “Restriction

Endonuclease Analysis” (REA) of the entire chromosome in the DNA (Ke et al., 1999);

“Plasmid Profiling” (Hammerum et al., 2000); “Pulsed-field Gel Electrophoresis” (Kirschner et al., 2001); “Ribosomal RNA gene Restriction Analysis” also known as ribotyping (Hughes,

2003); “PCR assays”; Nucleic Acid Hybridisation; Partial Sequence Analysis and Multilocus

Sequence Typing (MLST) (Ke et al., 1999; Hammerum et al., 2000; Getachew et al., 2013).

2.2.2.1 Restriction Endonuclease Analysis (REA)

This technique is among the main methods of characterising genomic DNA that were ever used for genetic typing of bacterial species (Price et al., 2002). Chromosomal DNA from an isolate is extracted and chunked off with a specific restriction enzyme (Price et al., 2002). After analysis, DNA fragments are resolved by agarose gel electrophoresis based on differences on their size, resulting in a banding pattern called DNA fingerprints or DNA profiles (Domig et al., 2003). Eventhough this technique was not recommended as an ideal method, several authors used REA to type enterococcal isolates. For instance, differentiation of E. faecium strains from different sources has been used to group isolates from different sources into REA- based clusters (Price et al., 2002; Chajecka-Wierzchowska et al., 2017).

2.2.2.2 Plasmid profiling

Eventhough plasmid profiling is not a trustworthy assay for strain characterisation, due to the fact that plasmids are rearranged during conjugation processes (Domig et al., 2003; Mannu et al., 1999; Wardal et al., 2010), to enhance its reliability, plasmid profiling has been used in combination with Restriction Assay of plasmid DNA and PFGE of genomic DNA, to type E. faecium strains in epidemiological surveys (Domig et al., 2003; Mannu et al., 1999 and

Morrison et al., 1999). It could also be used as a complementary technique to RAPD-PCR

(Domig et al., 2003).

2.2.2.3 Pulsed-field gel electrophoresis

This technique is used to separate large DNA fragments obtained through an enzymatic digestion process since they are larger than 20 kb and are thus, able to display the same mobility during an electrophoretic run (Hammerum et al., 2000). Basically, purified genomic DNA is digested with specific restriction enzymes to produce large DNA fragments, ranging from 10 to 800 kb (Gelsomino et al., 2002) that are resolved by electrophoresis under alternating electric fields, with subsequent production of isolate-specific DNA banding patterns (Tomayko et al., 1995). Due to its high discriminatory power, this method is considered a gold standard

37 technique for genotyping of bacterial isolates, especially during epidemiological investigations

(Tomayko et al., 1995). Although there are many different restriction enzymes available, SmaI and ApaI are the suitable and frequently utilised restriction enzymes that have produced reliable results in the PFGE typing of enterococci (Hammerum et al., 2000). PFGE can be considered as a very effective method for assessing the genetic filiation between various enterococcal strains (Hammerum et al., 2000). Furthermore, it is thought to be an indispensable instrument for the characterisation of enterococci originating from various sources, Vancomycin resistant enterococci from sick individuals and animal food (Gelsomino et al., 2002; Hammerum et al.,

2000). PFGE is fairly easy to do, straightforward, reliable and inexpensive but presents, however, some setbacks due to the fact that some bacteria may transform rapidly and get genomic transposons or other genetic material through integration, thus developing dissimilar banding arrangements (Rathnayake et al., 2011).

2.2.2.4 Ribosomal RNA gene Restriction Analysis or Ribotyping

Through this method, nucleic acid probes are used to identify ribosomal genetic elements in bacterial isolates (Price et al., 2002). Ribosomal RNA is inherent to all bacteria and is categorised into three types (23S, 16S and 5S rRNA). The genes encoding for rRNA are highly conserved (Domig et al., 2003) thus, these genetic features are very alike in most bacteria (Price et al., 2002; Oana et al., 2002). The rRNA operons can be present in 2 to 11 copies in a given bacterium, 5 to 6 operons in the case of enterococci (Domig et al., 2003; Hammerum et al.,

2000). Practically, genomic DNA is extracted and digested into smaller sizes with restriction endonucleases; the fragments obtained are separated as they undergo gel electrophoresis

(Domig et al., 2003) and dried onto a nylon or nitrocellulose membrane (Domig et al., 2003;

Price et al., 2002). Subsequent detection is achived with the aid of probes containing 16S, 23S or 5S rRNA sequences. Each portion of bacterial genetic material containing a gene of the ribosome is highlighted, creating a unic fingerprint. The endonucleases; EcoRI, HindIII, PvuII,

BamHI and BscI are commonly used in ribotyping analysis (Rathnayake et al., 2011).

Ribotyping is relatively advantageous as compared to other probe-based DNA fingerprinting assays for characterising enterococci due to its potential to allow intraspecies and interspecies discrimination (Price et al., 2002). This is mainly due to the fact that rRNA genes are highly conserved and the use of a particular probe can characterise at subspecies level, all enterococci

(Hammerum et al., 2000). However, ribotyping is time-consuming and laborious because many stages are involved and the restriction endonucleases have to be species-specific (Price et al.,

2002).

2.2.2.5 PCR-based typing techniques

There are numerous PCR-based typing techniques that have been developed to study genotypic polymorphisms in enterococci and these are outlined in the sections that follow.

2.2.2.5.1 Randomly Amplified Polymorphic (RAPD) DNA - PCR

This typing technique is different from arbitrarily primed PCR (AP-PCR) and DNA amplification fingerprinting (DAF) (Domig et al., 2003). The size of the primers utilised, the quality of the yields obtained and the DNA amplification conditions are specific to each of these techniques (Gelsomino et al., 2002). Arbitrarily designed primers of not more than 7 to

10 base pairs targeting an unspecific genome sequence are used with a subsequent display of polymorphism by the sizes of the amplified genes that were yielded, referred to as “Random

Amplified Polymorphic DNA” (RAPD), which could be utilised to compare bacterial strains

(Domig et al., 2003). This method differs from classic PCR in the sense that a unic primer is used rather than two and there is a low-stringency annealing temperature. This technique was proved to be very reliable in the screening and characterisation of enterococcal strains from food (Gelsomino et al., 2002 and Mannu et al., 1999) and clinical samples as well as the assessment of the epidemiological factors of VREs.

2.2.2.5.2 Amplified Fragment Length Polymorphism (AFLP)

This fingerprinting technique is basically a PCR amplification of restriction fragments of digested whole genomic DNA (Vos et al., 1995). First, the whole genomic DNA undergoes restriction and ligation of oligonucleotide adapters; followed by selective amplification and gel assay of the amplified genetic material (Vos et al., 1995). Antonishyn and his colleagues (2002) used a novel fluorescence-based AFLP for the characterisation of Vancomycin-resistant E. faecium strains.

2.2.2.5.3 Rep-PCR

The foundation of this technique is the fact that bacteria harbour particular replicas of DNA sequences dispersed within the genome (Petroziello et al., 1996). These “interspersed repetitive

(rep) DNA elements” are separated by various distances and these vary from one bacterium to another. DNA fragments of varying sizes are obtained on subsequent amplification of the regions between the repetitive elements and the PCR products undergo size-separation using gel electrophoresis, yielding DNA specific fingerprint patterns (Lee et al., 1999). This technique was used to produce a DNA fingerprinting pattern of E. faecalis and E. faecium and to type VRE strains by Petroziello et al. (1996) and Lee et al. (1999) respectively.

2.2.2.5.4 PCR-ribotyping

Because spacer regions between 23S, 16S and 5S rRNA genes in genomes of microorganisms are heterogenous, the discriminatory power of this PCR technique is improved when restriction enzymes are used (Rathnayake et al., 2011). Most bacterial classes harbour several replicas of the operon for rRNA in such a way that there is a difference in spacer regions lengths and/or sequences within a particular strain. Thus, Oana et al., (2002) suggested that multiple bands yielded from a single strain after DNA amplification, represent spacer regions of different sizes in different ribosomal RNA coding operons.

2.2.2.5.5 PCR Amplification of Intergenic rRNA Spacer Regions (ITS-PCR)

Tyrrell and his colleagues (2000) found that the PCR amplification of the intergenic spacer between 16S and 23S rRNA yield features that characterise enterococci when examined with

6% non-denaturing acrylamide-bisacrylamide gel electrophoresis.

2.2.2.5.6 Amplified ribosomal DNA Restriction Analysis (ARDRA)

This method is founded on the amplification of a gene segment containing the 16S, the spacer region in between 16S and 23S and a portion of the 23S rDNA, with restriction enzyme digestion. This technique was used to type several dairy-related enterococci (Heyndrickx et al.,

1996).

2.2.2.5.7 RFLP of PCR-amplified 16S rDNA

This method is a blend of PCR-ribotyping, SDS PAGE and 16S rDNA sequence; it was used to screen enterococci isolated from plants (Müller et al., 2001).

2.2.2.5.8 Broad-range PCR-restriction fragment length polymorphism (PCR-RFLP)

Teng et al. (2001) introduced this method to categorise eight frequently known enterococcal isolates. Restriction fragments were produced by HaeIII and RsaI.

2.2.2.6 PCR-based identification techniques

Genus-specific PCR is used for the characterisation at the genus level by targeting genus genes such as the tuf gene (Ke et al., 1999) while species-specific PCR targets species-specific genes such as the D-alanine/D-alanine ligase (ddl) gene or the groESL gene (Teng et al., 2001 and

Domig et al., 2003).

2.2.2.7 Reverse Transcription Polymerase Chain Reaction (RT-PCR)

This technique was developped in order to detect specific mRNA in enterococci, with a particular focus on vanA and vanB genes (Privitera et al., 1999). It is based on the fact that transcription of mRNA associated to vanA gene occurs only once induction with Vancomycin

41 or Teicoplanin has occured. Moreover, mRNA associated to vanB gene is only transcribed in the presence of Vancomycin (Domig et al., 2003).

2.2.2.8 Nucleic acid hybridization rRNA molecules, especially 16S rRNA and 23S rRNA, contain highly conserved regions that are found in all eubacteria as well as regions that are species-specific. This, therefore, gives an outlet to the design from these highly conserved regions, of universal probes or primers specific for all eubacteria. Complementary oligonucleotide probes were synthesised and used by

Cocconcelli et al. (1996) to detect strains of E. faecalis and E. faecium in the microflora of cheese. Frahm et al. (2001) suggested a procedure for the screening of enterococci and

Pseudomonas aeruginosa in water.

2.2.2.9 Multilocus sequence typing (MLST)

Eventhough the aforementioned typing methods are reliable in the characterisation of enterococci, in some instances, they do present some setbacks (Rathnayake et al., 2011). For instance, comparison of DNA fragments between labs can be difficult and the type of the genetic dissimilarity indexed, is frequently poorly assimilated (Ochoa et al., 2013). MLST solves these issues in the sense that, it relies on the identification of genetic variations (called alleles) in the portions of inner pieces of housekeeping genetic attributes. Each allele is given a number to produce an allelic profile, the allelic profile or grouping of alleles at each loci, determines the sequence type (ST) of each organism and can be used to characterise a specific strain (Dingle et al., 2001; Ochoa et al., 2013). Data are saved, shared and updated from a central database (www.mlst.net). This technique is ideal for the assessment of population structure, mutation and recombination rates within a microbial species. It can also be of great help in the study of host-pathogen relationships (Dingle et al., 2001). However, the disadvantages of this technique lay in the fact that the PCR primers used in this technique, are unique for particular sequences in a species or narrowly related strain groups. Moreover, it is

42 expensive because of the expenses related to the DNA polymerase, the sequencing reaction apparatuses and its repairs (Dingle et al., 2001; Rathnayake et al., 2011).

2.2 Pathogenic attributes of enterococci

The sole occurrence of resistance genetic elements in a particular strain is not indicative of its ability to be pathogenic. Rather, the pathogenicity of a strain requires a combination of these genetic attributes with virulence factors (O’Driscoll and Crank, 2015; Heidari et al., 2016).

Genes conferring resistance to antimicrobials are harboured on the same mobile genetic elements with genes coding for virulence factors. In fact, virulence factors and antibiotic resistance plasmids are transmitted through very efficient mechanisms of gene transfer (Eaton and Gasson, 2001).

2.2.1 Virulence factors in enterococci

According to Upadhyaya et al., (2009), “pathogenesis of most illnesses does not depend solely on colonisation but requires colonisation, attachment to the host’s cells, invasion of the tissues and resistance to non-specific defensive mechanisms”. There is substantial proof that enterococci that possess virulence factors are more infectious than those without. Two types of virulence factors have been identified and characterised in enterococci as follows: surface factors (involved in the colonisation of the host cell); and substances that cause tissular necrosis

(Sava et al., 2010).

2.2.1.1 Virulence factors that promote colonisation of host cells

The adhesion ability of enterococci to their host tissues, coupled with their resistance to low pH and high concentrations of bile salts, makes them one of the most common bacteria in the colon (Tomita and Ike 2004; Foulkié et al., 2006). Their adhesins, without which they could be removed by the peristaltic movement of the intestines, allow their attachment to receptors of the mucosal membranes or to proteins of the extracellular matrix thus, favouring

43 colonisation of the epithelial cells (Franz et al., 2003). Some virulence factors that promote colonisation of host cells are as follows: aggregation substance (AS); collagen-binding protein

(Ace); cell wall adhesin (EfaA); and enterococcal surface protein (esp) (Strzelecki et al., 2011;

Hollenbeck and Rice, 2012).

2.2.1.1.1 Aggregation substance (AS)

Although it is still a current subject of intense research, it is a protein that is encoded on plasmids that act as enterococcal sex pheromones. It facilitates plasmid exchange by mediating aggregation between bacteria (Galli et al., 1990). Sequencing assays have revealed that it encompasses two Arg-Gly-Asp components that play the role of ligands to enterococcal binding substances or “integrins” (Strzelecki et al., 2011). The molecular weight of this peptide is 137 kDa and it displays a hairpin-like structure (Wierzchowska et al., 2017). LPXTG is an important part of its molecular assemblage which is highly conserved and its distinctive sequence is regarded as the site of recognition and cleavage by sortases (Dramsi et al., 2005), which connects them covalently to the cell wall (Dramsi et al., 2005). Aggregation substances or adhesins confer high virulence attributes to enterococci while protecting them from destruction by leukocytes (Rakita et al., 1999; Strzelecki et al., 2011) and thus, are considered as superantigens (Kozlowicz et al., 2006; Clewell et al., 2000; Dunny et al., 1995). Adhesins are involved in the dissemination of plasmids harbouring antimicrobial resistance genetic determinants and other virulence factors such as cytolysin among other enterococci (Wardal et al., 2010). Finally, aggregation substance and cytolysin altogether increase the strain's virulence by regulating cytolysin through the quorum-sensing system, causing destruction of deeper tissues (Gilmore et al., 2002; Foulquié et al., 2006). The plasmids harbouring genetic determinants that regulate AS proteins are as follows: pAD1 (asa1 protein); pPD1 (asp1 protein); and pCF10 (asc10 protein) (Clewell, 2007; Dunny, 2007).

2.2.1.1.2 Collagen binding protein (Ace)

With a molecular weight of 74 kDa, Ace (adhesin to collagen) is an adhesin encoded by the ace gene (Rich et al., 1999). This protein could be used to identify species since it was isolated from E. faecalis strains, both from healthy carriers and from people with enterococcal infections (Duh et al., 2001). As it is the case with AS protein, Ace facilitates the adhesion of enterococci during the colonisation process, to proteins of the extracellular matrix; it plays a role mostly in binding type I and IV collagens of (Nallapareddy et al., 2000). Ace is part of the family of surface proteins refered to as “microbial surface component recogniing adhesive matrix molecules” (MSCRAMMs) (Patti et al., 1994; Hendrickx et al., 2009; Nallapareddy et al., 2008).

2.2.1.1.3 Endocarditis specific antigen (EfaA)

Encoded by the efAfs gene in E. faecalis strains and by efArm in E. faecium strains, it is a protein that weighs 34 kDa (Eaton and Gasson, 2001; Sava et al., 2010). This genetic determinant is attached to the afaCBA operon that codes for ABC permease (Abrantes et al.,

2013). The EfaA protein shows similarities with the adhesins present in the streptococcal cell wall like the FimA protein of Streptococcus parasanguis, the ScaA in S. gorgonii, the PsaA in

S. pneumonia and the SsaB in S. sanguis (Archimbaud et al., 2002). It has been demonstrated through genetic assays that efaA genes have homologues in E. avium, E. asini, E. durans and

E. solitaries strains (Semedo et al., 2003; Jiménez et al., 2013).

2.2.1.1.4 Enterococcal Surface protein (Esp)

Esp is a surface adhesin which weighs about 200 kDa, it is the biggest protein ever to be screened in enterococci (Toledo-Arena et al., 2001). The esp gene that codes this peptide is present on the pathogenicity island (PAI), which also encompasses proteins involved in the active flushout of antibiotics/antimicrobials (Leavis et al., 2004). This most likely resulted from the horizontal exchange of genes between E. faecalis and E. faecium. The components of Esp protein ressemble that of other adhesins encountered in Gram positive bacteria (Wierzchowska

45 et al., 2017; Donlan and Costerton, 2002). For instance, C-α in β-haemolytic Streptococcus agalactiaceae controlled by the bca gene (Wierzchowska et al., 2017), R28 in Streptococcus pyogenes and Bap in Staphylococcus aureus; a protein involved in biofilm development

(Toledo-Arana et al., 2001; Donlan and Costerton, 2002; Hendrickx et al., 2009). Esp protein’s involvment in the development of biofilm is vital for the transfer of genetic material among cells and high antimicrobial resistance (Donlan and Costerton, 2002; Foulquié et al., 2006;

Latasa et al., 2006). Resistance to Ampicillin, Ciprofloxacin and Imipenem in E. faecium is associated to esp gene (Billström et al., 2008) and esp gene is exchanged via plasmid conjugation or chromosomal transposition (Oancea et al., 2004). Studies of clinical strains have shown that 83.3% of Vancomycin-resistant strains of E. faecium (VREF) have the esp gene

(Ochoa et al., 2013).

2.2.1.2 Virulence factors that affect host tissues

After the colonisation process, pathogenic enterococci produce exotoxins, which destroy the tissues of the host (Teixera et al., 2012). Such virulence factors include the following: cytolysin

(cyl); gelatinase (gelE); and hyaluronidase (hyl) (Chajecka-Wierzchowska et al., 2017).

2.2.1.2.1 Cytolysin (cyl)

Cytolysin is a bacteriocin-type exotoxin, which destroys Gram negative bacteria and has haemolytic attributes towards erythrocytes, leukocytes and macrophages (De Vuyst et al.,

2003). Cytolysin excretion is regulated by an operon of eight genes: cylR1, cylR2, cylLl, cylLs, cylM, cylB, cylA and cylI (Shankar et al., 2004). The operon is situated on pheromone- dependent conjugative plasmids that are highly conserved (e.g. pAD1) or upon the pathogenicity island in the bacterial chromosome next to virulence factors such as the surface protein Esp and the aggregation substance AS (Eaton and Gasson, 2001; Shankar et al., 2004).

For cytolysin to be expressed as a functional protein, its subunits CylLL and CylLS are encoded by cylLl and cylLs genes and these subunits are rearranged through post-translation by a protein

46 encoded by the cylM gene (Eaton and Gasson, 2001). Extracellular cytolysin is produced and excreted with the help of a protein encoded by the cylM gene (Semedo et al., 2003). The two units interplay to form pores on the host cell membrane.

2.2.1.2.2 Gelatinase (gelE)

Gelatinase is an extracellularly secreted Zn-dependent metalloendopeptidase, with a molecular weight of about 30 kDa (Hancock and Perego, 2004). This enzyme solubilises gelatine, elastin, collagen, haemoglobin and other bioactive peptides (Archimbaud et al., 2002). GelE expression is regulated by the “fsr-quorum sensing” system (Waters et al., 2003; Hancock &

Perego, 2004; Pillai et al., 2004) and the level of the “gelatinase biosynthesis activation pheromone” (GBAB) (Pinkston et al., 2011; Teixeira et al., 2012). It is density-dependent and the presence of the gelE gene is one of those determinants of virulence assayed in enterococci, which is found both in clinical strains and in those isolated from food (Pinkston et al., 2011).

It is mainly expressed in E. faecalis and specific strains of E. faecium (Waters et al., 2003).

The fsr system encompasses three genes namely fsrA, fsrB and fsrC which ressemble agrA, agrB and agrC genes of S. aureus respectively.

2.2.1.2.3 Hyaluronidase (hyl)

Hyaluronidase is one of those exotoxins that play a significant role in pathogenesis by initiating cell membrane destruction of the host cell. It weighs about 45 kDa and is regulated by the hyl gene (Trivedi et al., 2011; Archimbaud et al., 2002). It is similar to the hyaluronidases of other cocci such as Streptococcus pyogenes, Staphylococcus aureus, and Streptococcus pneumoniae

(Archimbaud et al., 2002). This enzyme plays a role in the necrosis of connective tissues and cartilage by distintegrating mucopolysaccharides of these tissues, and consequently, allowing bacteria to disseminate and affect the neighboring cells. Hyl gene occurs most strains of

Enterococcus species isolated from food such as E. casseliflavus, E. mundtii and E. durans

(Trivedi et al., 2011).

2.3 Enterococcal infections

Members of the genus Enterococcus are common commensals of the digestive tract of both humans and animals (Lebreton et al., 2014). They are known as opportunistic pathogens that can only cause infections in immunocompromised patients (Wierzchowska et al., 2017) and in animals with injuries or severe lesions (Castillo-Rojas et al., 2013). Among the species documented, enterococcal infections are predominantly caused by E. faecium and E. faecalis

(Courvalin, 2006) while other species such as E. gallinarum, E. durans, E. casseliflavus and E. raffinosus are less frequently associated with diseases in their hosts (Rathnayake et al., 2011).

In fact, E. faecalis accounts for 80-90% of enterococcal isolates, while E. faecium accounts for the majority of the remainder of enterococcal infection documented (Franz et al., 2003).

However, recent data indicate that an increase in the number of enterococcal infections associated with E. faecium, is probably due to the significantly higher resistance displayed by this organsism against antimicrobials as well as the emergence of Vancomycin-resistant E. faecium strains (Kayser, 2003).

2.3.1 Enterococcal infections in humans

Enterococci mainly cause illnesses in patients who are in hospitals, or those who are immunocompromised or suffering from severe underlying diseases (Kuzucu et al., 2005;

Castillo-Rojas et al., 2013). Enterococcus species are, therefore, considered to be among the most prevalent organisms that cause nosocomial diseases, especially in humans (Teng et al.,

2001). These organisms are responsible for endocarditis, urinary tract infections, bacteraemia, intra-abdominal and pelvic infections, burn wound and deep tissue infections in humans (Dahl et al., 1999; Heidari et al., 2016). Despite these, they have been rarely associated with meningitis and respiratory tract infections (Duh et al., 2001). Mortality in humans from enterococcal bacteraemia is very high probably because of the underlying complications that may arise during infection (Rathnayake et al., 2011).

2.3.2 Enterococcal infections in cattle

Environmental streptococci and enterococci are highly implicated in intramammary infections

(IMI) and clinical mastitis in dairy herds and the methods used to control these pathogens are currently less than adequate (Myllys and Rautala, 1995). Mastitis occurs when white blood cells (leukocytes) circulate into the mammary gland, usually in response to bacteria invading the teat canal (Laven, 2015). Milk-secreting tissues and various ducts throughout the mammary gland are affected as a result of the effect of the bacterial toxins (Kandasamy et al., 2011).

Mastitis can also be due to chemical, mechanical, or thermal damage (Myllys and Rautala,

1995). Symptoms of this disease include abnormalities in the udder such as swelling, heat, redness, hardness, or pain, especially in clinical mastitis (Kandasamy et al., 2011). Other indications of mastitis may be abnormalities in milk produced by the infected animal such as milk that is watery in appearance, and in some instances may contain flakes, or clots

(Kandasamy et al., 2011; Laven, 2015). When infected with subclinical mastitis, a cow does not show any visible signs of infection or abnormalities (Laven, 2015). Despite the abnormalities associated with the udder and milk produced by infected animals, the California mastitis test, which is designed to measure the milk's somatic cell count, is a reliable and highly recommended technique for detecting mastitis (Laven, 2015).

The Enterococcus species most often isolated are E. faecium and E. faecalis (Holt et al., 1994).

These environmental enterococci have been isolated from the intestinal tract, manure, infected udders, and the general dairy environment (Hogan et al., 1999; Gelsomino et al., 2002; Hasman and Aarestrup, 2005; Lebreton et al., 2014). The enterococci are generally only a minor component of the environmental streptococcal/enterococcal mastitis complex and a major herd problem caused by the enterococci is relatively rare (Laven, 2015). Currently, control of mastitis caused by Enterococcus species is achieved through the proper and healthy nutrition, proper milking hygiene, and the culling of chronically infected cows (Hogan et al., 1999;

Laven, 2015). In addition, ensuring that cows have clean, dry bedding lowers the risk of infection and transmission of pathogens caused by mastitis (Hogan et al., 1999; Laven, 2015).

Mastitis can also be controlled by either decreasing the exposure of teat ends to potential pathogens or by increasing the resistance of dairy cows to infections (Hogan et al., 1999).

Conversely, factors that increase teat end exposure or reduce the resistance of cows to infection are very likely to result in greater mastitis in the herd and are, therefore, considered to be risk factors (Hogan et al., 1999; Pankey et al., 1996; Laven, 2015). The environmental enterococci have been isolated from bedding materials, soil, rumen, faeces, vulva, lips, nares, mammary glands and teats (Myllys and Rautala, 1995; Pankey et al., 1996; Bates, 1997). Feed such as silage can also be a source of these pathogens and infections of the reproductive tract and may contribute to environmental contamination (Pankey et al., 1996).

2.3.3 Therapeutic management of enterococcal infections

As far as human enterococcal infections are concerned, in clinical practice, a combination therapy comprising a cell wall active agent and a synergistic aminoglycoside should be considered as the preferred treatment for serious enterococcal infections in critically ill patients and those with evidence of sepsis, as well as in patients with endocarditis, meningitis, osteomyelitis, or joint infections (Kuzucu et al., 2005; Castillo-Rojas et al., 2013). Infections that do not require bactericidal therapy are usually managed with a single antibiotic that will eradicate enterococci and these infections include UTIs, most intra-abdominal infections, and uncomplicated wound infections (Sava et al., 2010; Heidari et al., 2016). Surgery may be indicated for the treatment of some enterococcal infections. For instance, valve-replacement surgery may be indicated for the management of refractory congestive heart failure, failure of medical therapy to clear bacteraemia, valve ring abscess, or development of septic emboli after initiation of therapy in patients with enterococcal endocarditis. Surgery may also be indicated

50 in enterococcal intra-abdominal infections, cholecystitis or intra-abdominal abscess (Duh et al., 2001; Donlan and Costerton, 2002; Heidari et al., 2016).

In cattle, therapy requires long-acting antibiotics/antimicrobials, but milk from such cows will not be marketable until the level of antibiotic residues in the cow is very low or even unnoticeable (Sears and Wilson, 1994; Laven, 2015). Antibiotics may be systemic (injected into the body), or they may be forced upwards into the teat through the teat canal

(intramammary infusion) (Sears and Wilson, 1994; Laven, 2015 and Kandasamy et al., 2011).

Cows that are being treated have to be marked or even excluded from healthy herd to warrant that their milk is disposed off and rejected (Laven, 2015; Kandasamy et al., 2011). Despite the fact that there is vaccinations for mastitis, they only reduce the severity of the condition but do not prevent new infections (Kandasamy et al., 2011; Laven, 2015).

2.5 Antibiotic resistance in enterococci

2.5.1. Historical backgroumd of antibiotic resistance

The discovery of antibiotics is a tremendous advancement in science as far as humanity and the need to protect public health is concerned (Economou and Gousia, 2015). In fact, ever since they were discovered, antibiotics became life-saving agents for humans and animals as they have deeply changed our society, ameliorating life expectancy and favouring population growth through a better management of life-threatening infections (Miller et al., 2014). The importance of antibiotics for humans and animals cannot be overemphasised at present thus, chemotherapy is vital for successful surgical interventions, for the management of infections in immunocompromised patients and intensive animal rearing, be it as growth promoters or as prophylactic agents (Moyane et al., 2013; Economou and Gousia, 2015).

The extensive usage of antimicrobials, especially antibiotics, has unfortunately led to the rise of resistant isolates (Rzewuska et al., 2015). This is known to have severe consequences on consumers, thus undermining the importance of the positive effects of the usage of

51 antimicrobials in both animals and humans (Micallef et al., 2013). Consequently, antibiotic resistant bacterial strains have emerged, making therapeutic alternatives for the treatment of infections caused by such organisms limited and their subsequent antimicrobial resistance genes (ARG’s) available in the environment (Tao et al., 2014). Although antimicrobial resistance was a proven fact as time went by, there is a recent idea which states that ressistance mechanisms and resistant bacteria existed already long before the production and use of antibiotics (Acar and Moulin, 2012; Andersson and Hughes, 2012). Pre-therapeutic secretion of antibiotics by non-pathogenic isolates that had the ability to do so might have been the instigation of resistance mechanisms since they had to be resistant to their own antibiotics

(Huttner et al., 2013). However, there is a possibility that the frequency at which bacteria mutated was so low for antimicrobial resistance to occur, making this fact to remain ignored.

Antimicrobial resistance is not a new problem in the scientific arena (Huttner et al., 2013). In his acceptance speech after winning the Nobel Prize, Alexender Fleming, who discovered the first antibiotic, warned as follows: “It is not difficult to make microbes resistant to Penicillin in the lab by exposing them to subtherapeutic doses that do not kill them” (Huttner et al., 2013).

Thus, the historical background of AMR indicates that for every antibiotic used, resistance develops over time (Uttley et al., 1988). A course for concern is the fact that AMR has evolved in a scary way, and the term “superbug” is used nowadays to refer to highly resistant bacteria that are no longer susceptible to most classes of antimicrobial agents initially used to treat infections caused by such bacteria (Davies and Davies, 2010). AMR has, unfortunately, become a public health issue of utmost importance worldwide, that should be addressed accordingly.

2.5.2 Development and dissemination of AMR

AMR is a natural but complex phenomenon, which happens as a result of the bacterial instinct to adapt rapidly to its environment (Partridge, 2011). It is believed that the abuse and misuse

52 of antibiotics in the treatment of community acquired infections and in intensive animal rearing has led to the selection, dissemination and rise of resistant isolates (Rzewuska et al., 2015).

Resistance arises either as a result of spontaneaous mutation or through the acquisition of resistant determinants from other resistant strains by horizontal gene transfer (HGT). Three possible mechanisms have been demonstrated in HGT processes as follows: conjugation; transduction; and transformation (Tao et al., 2014). Through HGT, considerable amounts of genetic material can be deleted or inserted into the bacterial chromosome, thus creating more dynamic genomes (Schubert et al., 2009). Some bacteria are very prone to the exchange of genetic material and, in such organisms, this is done through a shared pool (Partridge, 2011).

Genes of such pools are not intrinsic genetic determinants and appear in the chromosome of different isolates (Schubert et al., 2009; Tao et al., 2014). Mobile genetic determinants are classified as those that transfer genetic information between DNA molecules (insertion sequences, gene cassettes, integrons and transposons) and as those that transfer genetic information between cells (plasmids, integrative and conjugative elements) (Partridge, 2011).

Integrons are not mobile genetic elements per se, but are made of components of a site-specific recombination system that enables them to capture and mobilise resistance genes (Davies and

Davies, 2010). Transposons are mobile genetic elements that can excise themselves from a genetic locus to another one, be it in the same isolate or in an isolate belonging to another taxa, and plasmid mediated resistance is by far the most encountered type of HGT mechanism (Tao et al., 2014). These are extra-chromosomal genetic determinants that can transfer genes by conjugation among isolates of the same species (Davies and Davies, 2010). Moreover, they can harbour many genes that confer resistance to many antibiotics, leading to multidrug resistance observed in many isolates that infect humans (Clewell, 2014). AMR gene pool has never been this accessible nor its selective pressure so intense (Huttner et al., 2013). All antibiotic resistance determinants (ARD) in the environment are in this gene pool. Besides the fact that

ARD can be incorporated in a replicable gene transfer unit in microbes, strong selective

pressures due to the use of antibiotics, can cause a diversification of the gene pool. Figure 2.1

is an illustration of the genetic determinants involved in the spread of ARG as a result of

selective pressure from the use of antibiotic.

Figure 2. 1: Illustration of the genetic elements involved the spread of ARG as a result of selective pressure from the use of antibiotics. (a) The gene pool contains all potential sources of DNA encoding ARD in the environment (hospitals, farms and other places where antibiotics are used for bacterial growth control). (b) HGT is involved in the dissemination of antibiotic resistance among other strains. Moreover, mobile genetic determinants are involved in keeping and spreading ARG (c) which can be captured by intergrons (d) and inserted in a transposon

(e) which can be part of a plasmid (f).

2.5.3 Antimicrobial resistance in enterococci

Basically, E. faecium and E. faecalis are the two main potential enterococcal pathogens of

Enterococcus species (Salminen, 2004). Enterococci are generally not susceptible to Penicillin,

Ampicillin, Cephalosporins and other β-lactams (Kristich et al., 2014) and this results from

mutations in the Penicillin-binding protein (PBP5) as well as the presence of other genetic

54 determinants, leading to the synthesis of a PBP5 with low affinity for β-lactams (Zhang et al.,

2012; Miller et al., 2014).

Enterococci achieve resistance to Tetracycline with the aid of two groups of resistance genes such as those that confer resistance due to ribosomal protection [tet(M), tet(O) and tet(S) genes] and those that mediate an energy-dependent efflux of Tetracycline from the cells [tet(K) and tet(L) genes] (Chopra and Roberts, 2001; Wilcks et al., 2005). Enterococci, therefore, demonstrates an in vivo resistance to Clindamycin by efflux pumps, while resistance to

Trimethoprim-sulfamethoxazole occurs through enzymatic degradation (Hollenbeck and Rice,

2012).

In the case of Gentamycin, the gene conferring resistance results from the transfer of genes encoding aminoglycoside-modifying enzymes, through conjugative plasmids and transposons

(Simjee and Gill, 1997). Examples of such enzymes include aminoglycoside phosphotransferase (APH), aminoglycoside acetyltransferase (AAC) and aminoglycoside adenyltranferase (AAD). Moreover, E. faecium demonstrates resistance to Rifampicin,

Quinolones and Chloramphenicol by mutation or through acquisition of genetic resistance determinants (Lautenbach et al., 1998 and Deshpande et al., 2007).

2.5.4 Vancomycin resistance in enterococci

Isolated from Amycolatopsis orientalis in 1953 as a cell wall compound active against Gram- positive bacteria, Vancomycin was considered a secondary therapeutic option because the antimicrobials used at the time had a good bactericidal profile. It became a drug of choice with

Teicoplanin (which is isolated from Actinoplanes teichomyceticus) after MRSA emerged in the late 1970s (Parenti et al., 1978; Moellering, 2006; Moellering et al., 1981 and Bardone et al.,

1978). It was extensively used in the 1980s until the first report of VRE in 1988, whereby the occurrence of a plasmid-mediated Vancomycin resistant determinant was described for the first time (Leclercq et al., 1988). The spread of VRE occurred swiftly across USA while in Europe

55 and the other parts of the world, it arose because of the extensive usage of Avoparcin (a homologous compound) as a growth promoter in animal farms (Nilsson et al., 2009; Noble et al., 1992).

2.5.4.1 Glycopeptides (Vancomycin and Teicoplanin) mechanism of action

Glycopeptides are large polar molecules, which explains why they cannot penetrate the outer membrane of Gram-negative organisms. They are, therefore, strictly indicated for both anaerobic and aerobic Gram-positive organisms (Reynolds, 1985) although recent research on

Vancomycin analogues demonstrate that modifications by increased polarity could circumvent this issue (Yarlagadda et al., 2016). All glycopeptides inhibit the latter stages of cell wall synthesis by forming complexes with peptidoglycan precursors. In the cell, a dipeptide called

D-Ala-D-Ala, which will later on bind to UDP-N-acetylmuramyl-L-Ala-γ-D-Glu-L-Lys, is produced by D-alanyl-D-alanine (D-Ala-D-Ala) ligases (Walsch, 1989). This is followed by the translocation of the completed peptidoglycan precursor by a lipid carrier across the cytoplasmic membrane. It is at this stage that the glycopeptides inhibit cell wall synthesis

(Arthur et al., 1996), by binding to the carboxy-terminal D-alanine residues of cell wall precursors, thus blocking the incorporation of the peptidoglycan precursors into the nascent cell wall by transglycosylation and leading to the accumulation of cytoplasmic precursors.

Binding of the antibiotics to D-Ala-D-Ala-terminating peptide stems within nascent peptidoglycan, also believed to inhibit cell wall synthesis through inhibition of the transpeptidase and carboxypeptidase steps of cell wall synthesis.

2.5.4.2 Resistance mechanism to Vancomycin

Two fundamental types of resistance mechanisms have been described so far in enterococci as far as Vancomycin is concerned. These include “intrinsic resistance” and “acquired resistance”.

Intrinsic resistance refers to an antimicrobial drug not working due to inherent features in a species, such as restricting accessibility of drugs to the target or not having the drug target at

56 all. Acquired resistance occurs when the bacterium is originally susceptible, but develops resistance either by somatic mutation or by acquisition of genes through horizontal transfer.

The first report of high-level resistance to glycopeptides was that of clinical enterococcal isolates in 1988. This was later on referred to as VanA phenotype glycopeptide resistance, characterised by high-level inducible resistance to both Vancomycin and Teicoplanin. Though predominant in E. faecium, VanA-type resistance is also found in E. faecalis and occasionally in the other enterococcal species (Courvalin, 2006; Xu et al., 2010). A year later, another phenotype was discovered and described as VanB phenotype, characterised by low to moderate levels of Vancomycin resistance but with susceptibility to Teicoplanin and found predominantly in E. faecalis and E. faecium (Williamson et al., 1989; Johnsen et al., 2005;

Courvalin, 2006). VanA and VanB gene clusters encode for the two most significant and clinical forms of glycopeptides resistance in enterococci: VanA and VanB resistance phenotypes.

However, other glycopeptide resistance phenotypes have been described so far. In fact, ten gene clusters have been reported to confer Vancomycin resistance: VanA, VanB, VanC, VanD,

VanE, VanF, VanG, VanL, VanM and VanN. VanC phenotype glycopeptide resistance is an intrinsic property (vanC gene cluster) of E. casseliflavus, E. gallinarum and E. flavescens, and is characterised by low-level resistance to Vancomycin and susceptibility to Teicoplanin

(Dutka-Malen, 1992; Navarro and Courvalin, 1994). VanA, VanB and the recently described

VanD, VanE and VanG phenotypes are acquired resistance characteristics seen in E. faecium,

E. faecalis and some other enterococci as opposed to VanC resistance, which is intrinsic

(Courvalin, 2006; Boyd et al., 2008 ; Xu et al., 2010 ; Lebreton et al., 2011; Arias and Murray,

2013).

The resistant phenotypes share the same basic mechanism of resistance (Figure 2.2). The glycopeptides bind to the carboxy-terminal D-Ala residues of cell wall precursors, thus preventing their incorporation into the nascent peptidoglycan. Substituting the terminal D-Ala

57 residue with either D-lactate (VanA, VanB and VanD phenotypes) or D-serine (VanC and VanE, phenotypes) confers resistance (Arthur et al., 1996). The D-lactate (D-Lac) substitution causes the replacement of a peptide bond by an ester bond within the cell wall precursor. This replacement causes the loss of a single hydrogen bond that ordinarily forms between

Vancomycin and the cell wall precursor (Bugg et al., 1991). The loss of this hydrogen bond results in a 1000-fold decrease in affinity for Vancomycin binding, thus resulting in

Vancomycin resistance (Bugg et al., 1991). In comparison with other antibiotic resistance traits conferred by a single gene product or mutation in a single gene, acquired glycopeptide resistance occurs by a complex mechanism involving a series of enzymatic reactions.

Figure 2.2: VanA resistance gene cluster and resistance mechanism. Functions of the proteins encoded by each gene in the vanA gene cluster (Hughes, 2003)

Strains of the VanA phenotype demonstrate high levels of inducible resistance to both

Vancomycin and Teicoplanin, whereas those of the VanB phenotype demonstrate variable levels of inducible resistance to Vancomycin only. VanD phenotypes are characterised by

58 constitutive resistance to moderate levels of the 2 glycopeptides (Depardieu et al., 2003b).

VanC-, VanE-, and VanG phenotypes are resistant to low levels of Vancomycin but remain susceptible to Teicoplanin. Although the 6 types of resistance involve related enzymatic functions, they can be distinguished by the location of the corresponding genes and by the mode of regulation of gene expression (Figure 2.2). The vanA and vanB operons are located on plasmids or in the chromosome (Arthur et al., 1996), whereas the vanD (Depardieu et al.,

2003b), vanC (Arias et al., 2000), vanE (Abadia et al., 2002), and vanG (Depardieu et al.,

2003a) operons have, thus far, been found only in the chromosome.

2.5.4.2.1 VanA

It is the most common type of glycopeptides resistance in enterococci. It is the unic

Vancomycin resistance gene screened in Staphylococcus aureus (Arthur et al., 1996). The prototype Tn1546 VanA-type resistance element, which was originally detected on a plasmid in an Enterococcus faecium clinical isolate, is an 11-kb transposon. It controls 9 polypeptides that can be assigned various functions: transposition (ORF1 and ORF2) and regulation of resistance gene expression (VanR and VanS); synthesis of the d-Ala-d-Lac depsipeptide (VanH and VanA) and hydrolysis of peptidoglycan precursors (VanX and VanY); the function of

VanZ remains unknown (Arthur et al., 1996). The VanR and VanS proteins form a 2- component regulatory system that modulates transcription of the resistance gene cluster (Arthur et al., 1996). This system includes a cytoplasmic VanR response regulator, which acts as a transcriptional activator, and a membrane-bound VanS histidine kinase. The vanA gene cluster was found mainly in E. faecium and Enterococcus faecalis but also in Enterococcus avium,

Enterococcus durans, Enterococcus raffinosus, and atypical isolates of E. gallinarum and E. casseliflavus, which are highly resistant to both Vancomycin and Teicoplanin (Courvalin,

2006).

2.5.4.2.2 VanB

As in VanA strains, acquired VanB resistance is due to synthesis of peptidoglycan precursors ending in the depsipeptide d-Ala-d-Lac instead of the dipeptide d-Alad- Ala (Arthur et al.,

1996). The organisation and functionality of the vanB cluster is similar to that of vanA but differs in its regulation, since Vancomycin, but not Teicoplanin, is an inducer of the vanB cluster (Dahl et al., 1999). The vanB operon contains genes encoding a dehydrogenase, a ligase, and a dipeptidase, all of which have a high level of sequence identity (67%–76% identity) with the corresponding deduced proteins of the vanA operon and the vanRBSB regulatory genes that encode a 2-component system only distantly related to VanRS (34% and 24% identity) (Evers et al., 1996). The function of the additional VanW protein found only in the vanB cluster is unknown, and there is no gene related to vanZ. Based on sequence differences, the vanB gene cluster can be divided into 3 subtypes as follows: vanB1; vanB2; and vanB3 (Dahl et al., 1999;

Patel et al., 1998).

2.5.4.2.3 VanD

The VanD-type of resistance is due to the excretion of peptidoglycan precursors which end in d-Ala-d-Lac (Depardieu et al., 2004). The structure of the vanD operon, situated only in the strain’s chromosome in strains that have been investigated so far, ressembles that of vanA and vanB (Depardieu et al., 2004). VanD strains have negligible D,D-dipeptidase activity, which should result in a susceptible phenotype, since these bacteria cannot remove peptidoglycan precursors that end in d-Ala-d-Ala, which are targeted by glycopeptides. However, in VanD strains, the susceptible pathway does not function, since the Ddl is inactive because of multiple mutations in the chromosomal ddl gene (Depardieu et al., 2004, Dahl et al., 1999). Another unusual feature of VanD-type strains is that they are lowly susceptible to Teicoplanin (MIC, 4 mg/mL) despite the fact that they produce peptidoglycan precursors that terminate mostly in d-

Ala-d-Lac. VanD-type strains that constantly activate the vanD operon, by mutation in the 2- component regulatory system, and that have erased the susceptibility pathway, by inactivation

60 of the Ddl, provide a remarkable example of “tinkering” in both intrinsic and acquired genes to achieve higher levels of antibiotic resistance (Courvalin, 2006).

2.5.4.2.4 VanC

E. gallinarum, E. casseliflavus, and E. flavescens are intrinsically resistant to low levels of

Vancomycin but remain susceptible to Teicoplanin. The VanC phenotype is expressed constitutively or inducibly due to the production of peptidoglycan precursors ending in d-Ser

(Reynolds et al., 2005). Three vanC genes encoding d-Ala-d-Ser ligases have been described as follows: vanC-1 in E. gallinarum; vanC-2 in E. casseliflavus; and vanC- 3 in E. flavescens.

The organisation of the vanC operon, which is chromosomally located and not transferable, is distinct from those of vanA, vanB and vanD. Three proteins are required for VanC-type resistance as follows: VanT, a membranebound serine racemase, which produces d-Ser; VanC, a ligase that catalyses synthesis of d-Ala-d-Ser; and VanXYC, which possesses both D, D- dipeptidase and D,D-carboxypeptidase activities and allows hydrolysis of precursors ending in d-Ala.

2.5.4.2.5 VanE

The VanE phenotype corresponds to low-level of resistance to Vancomycin and susceptibility to Teicoplanin due to synthesis of peptidoglycan precursors terminating in d-Ala-d- Ser as in intrinsically resistant Enterococcus species. The vanE cluster has an organisation identical to that of the vanC operon (Abadia et al., 2002).

2.5.4.2.6 VanG

Acquired VanG type is characterised by resistance to low levels of Vancomycin (MIC, 16 mg/mL) but susceptibility to Teicoplanin (MIC, 0.5 mg/mL) (McKesser et al., 2000) and by inducible synthesis of peptidoglycan precursors ending in d-Ala-d-Ser. The chromosomal vanG cluster is composed of 7 genes recruited from various van operons (Depardieu et al.,

2003b). In contrast to the other van operons, the cluster contains 3 genes (vanUG, vanRG, and vanSG) encoding a putative regulatory system. vanRG and vanSG have the highest similarity to vanRD and vanSD, and the additional vanUG gene encodes a predicted transcriptional activator. This type of protein has not previously been associated with glycopeptide resistance.

Figure 2.3: Comparisons of several Vancomycin resistance clusters found in enterococci, showing the variation in organisation of the operons of vanA, vanB, vanC, vanD, vanE and vanG gene clusters. Genes with similar functions share colours (Depardieu et al., 2004)

2.6 Antimicrobials and growth promoters in cattle rearing

Shortly after antibiotics were introduced for therapeutic purposes, their growth-promoting attributes were discovered and since then, most of them have been used as growth promoters in animal farming (Butaye et al., 2003). There are four stipulated hypotheses that justify the use of growth promoters in industrial animal farming: (i) nutrients may be preserved from bacterial destruction; (ii) there may be an improvement in the absorption of nutrients as a result of the thinning of the intestinal barrier; (iii) the antibiotics may decrease the production of toxins by intestinal bacteria; and (iv) they may reduce the incidence of subclinical intestinal infections (Feighner and Dashkevicz, 1987).

Although growth promoters as feed additives have been the hallmark in modern animal husbandry, the wide use of these products has raised a lot of criticisms. For instaince, in the late 60s, with concerns about the emergence of antimicrobial resistance, resulting from the rise in their usage. Consequently, it was suggested to discontinue the use of certain growth promoters such as Tylosin, Penicillin, Sulfonamides and Tetracycline (Butaye et al., 2003). In fact, a list of allowable products with their minimum and maximum dosages, the withdrawal period from slaughter and the animal species for which the product should be used was drafted and implemented alongside a well-drafted legislation on the issue within the European community then. Preferring to be on the safer side, some countries such as Sweden banned the use of all growth promoters then while some still allowed the use of Tetracyclins and penicillins. Avoparcin, an antibiotic that was only used then as a growth promoter in animal husbandry, demonstrated full cross-resistance with its analogue Vancomycin and Teicoplanin

(another glycopeptide) used in the treatment of human infections. Avoparcin and several feed additives were banned in Europe from 1997 as infections caused by glycopeptide resistant enterococci (GRE) in hospital settings became a serious public health issue in most countries

(Bates, 1997; Butaye et al., 1999; Uttley et al., 1988 and Huyke et al., 1998).

Table 2.2: Antibiotics used as growth promoters within the European community, past and

present

Banned Antibiotic Antibiotic Related therapeutics Mechanism of action since group Inhibition of cell wall Bambermycin Glycolipid synthesis Cyclic Inhibition of cell wall Bacitracin 1999 Bacitracin peptide synthesis Disintegration of cell Monensin Ionophore membrane Disintegration of cell Salinomycin Ionophore membrane Inhibition of protein Virginiamycin 1999 Streptogramin Quinupristin/Dalfopristin synthesis Inhibition of protein Tylosin 1999 Macrolide Erythromycin and others synthesis Inhibition of protein Spiramycin 1999 Macrolide Erythromycin and others synthesis Inhibition of protein Avilamycin Orthosomycin Everninomycin synthesis Vancomycin, Inhibition of cell wall Avoparcin 1997 Glycopeptide Teicoplanin synthesis Vancomycin, Inhibition of cell wall Ardacin 1997 Glycopeptide Teicoplanin synthesis Inhibition of protein Efrotomycin Elfamycin synthesis Inhibition of DNA Olaquindox 1999 Quinoxaline synthesis Inhibition of DNA Carbadox 1999 Quinoxaline synthesis

Source: Butaye et al., 2003

2.7. Growth promoters and animal husbandry in the Republic of South

Africa

2.7.1. Regulation of antimicrobial usage in the farming sector in South Africa

The Department of Agriculture, Forestry and Fisheries and the National Department of Health regulated the use of antibiotics in animal farming by administering the fertilizers, farm feeds, agricultural remedies and stock remedies Act (Act 36 of 1947) and the medicines and related substances Control Act (Act 101 of 1965) respectively. In fact, antibiotics to be used by the lay public, comprising mainly of farmers, are registered under the Act 36 as stock remedies and are available over the counter. This was so because of the scarcity of farmers before the promulgation of this Act. These items are indicated for the treatment of specific conditions and can be administered by untrained persons without endangering their lives with that of the animal to which it is being administered. Antibiotics that can be used and prescribed only by veterinarians are registered under Act 101. This situation gave rise to some abnormalities.

Stock remedies are distributed to veterinary wholesalers, distributors, farmers’ cooperatives and feed mix companies by the manufacturer. Consequently, stock remedies have become freely available and no record has been kept of their use.

2.7.2. Antibiotics and antimicrobial usage in intensive animal rearing in South Africa

Records of the amount of antibiotics used in animal farming and more specifically cattle rearing, are very scarce in South Africa (Moyane et al., 2013). Accurate information is also lacking on the pattern of consumption of antibiotics. This is mostly because antibiotic usage in animal farming is controlled by two separate Acts and because pharmaceutical companies protect sensitive information (Henton et al., 2011). 29% of antibiotics used in livestock in

South Africa are premixes and most of such antibiotics sold are those that are used as growth promoters and for the treatment/prevention of diseases in pig and poultry (Eagar, 2008 and

Picard & Sinthumule, 2002). Tylosin, one of the growth promoters banned in Europe, is extensively sold and used in South Africa (Table 2.2) followed by Tetracyclines,

Sulphonamides and penicillins (Henton et al., 2011 and Eagar, 2008).

Table 2.3: Growth promoters used in intensive animal rearing in South Africa

Antibiotic Treatment objective Food animal

Feed efficiency, growth promoter and Swine, Lincomycin disease control poultry

Tylosin Feed efficiency and growth promoter Poultry, cattle

Feed efficiency, growth promoter and Swine, Penicillin disease control poultry

Feed efficiency, growth promoter and Swine, Virginiamycin disease control poultry, cattle

Feed efficiency, growth promoter and Swine, Tetracyclin disease control poultry, cattle

Swine, Chlortetracycline Feed efficiency, growth promoter poultry, cattle

Oxytetracycline Feed efficiency, growth promoter Cattle

Swine,

Erythromycin Disease control poultry, cattle,

sheep

Swine, Bacitracin Feed efficiency, growth promoter poultry, cattle

Lasalocid Feed efficiency, growth promoter Cattle

Monensin Feed efficiency, growth promoter Cattle

Source: Moyane et al., 2013

It has also been reported that the antibiotics sold in a period of three years from eight companies accounted for 1.5 million kg active ingredients where in terms of total volumes of sales, the macrolides, lincosamides and pleuromultilins represented 42.4% of antibiotics sold. In the last four years, there have been annual increases in the sale of Carbacephems, Carbapenems,

Penems, Fluoroquinolones, broad-spectrum penicillins and glycopeptides in South Africa

(Essack et al., 2011). Moreover, counterfeit of pharmaceuticals is a serious issue in South

Africa with at least 20% of the products sold, which are believed to be counterfeited. This makes the data on the usage of antimicrobials too general and underestimated to provide enough ground for scientific investigation on the link between the various types of farm use and the emergence and spread of resistance (Union of

ConcernedScientists,www.document;http://www.ucsusa.org/assets/documents/food_and_agri culture/hog_chaps.pdf. Accessed 24/August/2017). It has been revealed that 68.5% of antibiotics are administered as in-feed medications, 17.5% are utilised as parenteral antibiotics while 12% are topical or oral forms used for water medication (Eagar et al., 2012). This is a cause for concern in the sense that farmers administer these growth promoters for long periods of time at sub-therapeutic dosages to the entire herds of animals with the belief that it will counter disease-driven losses and increase profit margins (Carlet et al., 2012 and Mellon et al.,

2001). However, if there is an improvement in the farming industry yield, the issue of disease control/prevention and antimicrobial resistance is left undermined. This is because in most cases, overcrowded and unhygienic conditions of intensive animal rearing result in the emerging and spreading of microbes. Thus, the prophylactic usage of antimicrobials would not be necessary if the conditions were ameliorated (Moyane et al., 2013).

2.8. Extensive usage of antibiotics in farming: Implications on public

health

The fact that the use of antibiotics in both animal and human medicine favours the selective pressure of resitance has been proved, it has become an evergrowing source of concern worldwide as far as public health is concerned. The implications on the environment and on humans can be undermined. Antimicrobials do not go complete degradation into inactive molecules in the body of animals when used for therapeutic or growth-promoting purposes. As a result of this, they are excreted in the droppings where they revert to their initial state after some time, making manure a hotspot for bacteria harbouring resistance genetic determinants.

When soil is mixed with manure in agricultural processes, resistance genes can be transferred either vertically or horizontally to soil microbiota (Aarestrup et al., 2000; Thanner et al., 2016).

Through this process, commensals and human pathogens pick up genetic resistance determinants in the already polluted soil and environment. Moreover, antibiotics are not completely deactivated in the process of waste water treatment hence, when released into the environment, it pollutes other water bodies with resistance genes. Whenever water from such sources is used in irrigation processes, antibiotic resistance genes are propagated unto crops, which will later on be eaten by humans (Ding et al., 2014). The mechanisms of ARG exchange and transmission are illustrated in Figure 2.4.

Figure 2. 4: Transmission pathway of antimicrobial resitant genes (Tatsing et al., 2018)

ARGs get to humans through the food chain, direct or indirect contact with people working in close proximity with animals and environmental items polluted through agricultural wastes.

The environment plays a key role in the dissemination of resistance genes as it is a reservoir whereby exchange of genetic resistance determinants occur among bacteria, which will be taken up by animals and humans (Forsberg et al., 2014; Shah et al., 2016). Most antibiotics can stay in milk and in meat of food animals for extended periods of time and the process of antibiotic testing system of meat in South Africa is still very poor (McDermid, 2012). This is a great concern, especially with the established fact that residues of most antibiotics persist at chemically detectable levels in food even after prolonged cooking as this only decreases its amount (Eagar et al., 2012 and Javadi, 2011). Antibiotics have disastrous effects on the consumer’s health such as allergic reactions, liver damage, kidney damage, yellowing of teeth and gastrointestinal disturbances (Jing et al., 2009). Moreover, over time, intake of food products containing these antibiotic residues, even at small doses, favours antimicrobial resistance development of strains that may be part of the intestinal flora or of other commensals

69 that may inhabit the human body; rendering therapeutic regimes in case of an illness ineffective. The consequences of such a situation should not be undermined, especially with the fact that HIV/AIDS is a serious health issue in South Africa. It would be disastrous for an immunocompromised patient to be infected by resistant bacteria. Enterococci are potentially opportunistic pathogens that can cause infections in immunocompromised humans in a hospital environment (Chajecka-Wierzchowska et al., 2017).

2.9. Therapeutic options of VRE infections

Ever since resistance to Vancomycin became common, researchers have focused restlessly on the development of new molecules that could be effective against VREs. Hence, many therapeutic regimes have been tried and made available for such purpose.

2.9.1. Daptomycin

It is a lipopeptide that acts against enterococci through disturbance of the bacterial cell membrane. Although resistance towards this antibiotic, through mutations in genes associated with cell membrane construction pathways (liaFSR, yycFG) arose as a result of long exposure to it over time, it is used either in combination with ß-lactams or alone to treat VREs (Miller et al., 2016).

2.9.2. Telavancin dalbavancin and oritavancin

These are Lipoglycopeptide that (modified versions of glycopeptides such as Vancomycin) bind to the same target as the glycopeptides but act through closer association with the cell membrane by appendage of a lipophilic moiety. Both Telavancin and Dalbavancin have poor antimicrobial effects against VREs due to the altered biding site provided by Vancomycin resistance gene clusters, and are thus, not used clinically. Oritavancin, on the other hand, shows

70 activity against both vanA and vanB-containing enterococci due to wider interactions to the peptidoglycan precursors. Since it has recently been introduced into the market, large studies describing Oritavancin activity have not been published yet. Oritavancin is consequently not in wide therapeutic use.

2.9.3. Oxazolidinones linezolid and tedizolid

They act by binding to ribosomes and prohibiting mRNA-protein translation through abrogation of aminoacyl-tRNA docking. This mechanism ensures bacteriostasis in enterococci unless specific mutations occur in the 23S rRNA gene. Such mutations generally confer cross- resistance to linezolid and tedizolid (Silva Del-Toro et al., 2016). Enterococci possess several copies of 23S rDNA, and become increasingly resistant as more of the gene copies gain these mutations. The horizontally transmissible resistance determinants cfr and optrA, respectively encoding an rRNA methylase conferring resistance to linezolid and an ABC transporter pumping out both linezolid and tedizolid have also been found in enterococci (Locke et al.,

2014 and Wang et al., 2015).

2.9.4. Streptogramins

These drugs also attack the ribosome through binding to the 50S subunit, and the two drugs,

Dalfopristin and Quinopristin (Q/D), are delivered together since they synergistically provide bactericide by irreversible inhibition of the ribosome. Resistance towards Q/D is mediated by multiple identified resistance determinants that alter the ribosome, provide hindrance to target, pump Q/D out of the cell or break either one or both Q and D thus, hampering the synergistic effects and, therefore, bactericide. Tigecycline also binds to the ribosomal subunit 16S and prohibits docking of aminoacyl-transfer RNA, resulting in translation halt. Reservations against the use of this drug has arisen since it has a high volume of distribution, which causes low concentrations of free Tigecycline at infection sites. This becomes a problem as observed

71 mutations in relevant ribosomal genes, which slightly increases MIC for this antimicrobial, rapidly creates problems since obtainable antibiotic levels are so low.

2.10. Epidemiological overview of glycopepetide resistant enterococci

(GREs)

With the first case of resistance to glycopeptides reported in the 1980s, it was thought to be exclusively a nosocomial trait until more studies revealed the presence of GREs in non-hospital sources. Although the epidemiology of GREs is extremely complex and depends on several other factors, GREs have become a major public health issue worldwide. The list of reports of

GREs isolated from environmental sources and food products is exhaustive. As a matter of fact, GREs were isolated from a variety of sources, including raw and treated sewage in

Norway, USA and China (Kühn et al., 2005; Goldstein et al., 2014; Tao et al., 2014); from ground water in South Africa (Ateba and Maribeng, 2011; Ateba et al., 2013; Matlou et al.,

2019); surface water used for drinking water production in the Netherlands (Taucer-Kapteijin et al., 2016); leafy vegetables and tomatoes in South Africa and USA respectively (Mohapi and Ateba, 2013 and Micallef et al., 2013); from farm chicken in Sweden and Malaysia (Nillson et al., 2009 and Getachew et al., 2013); and finally, from Pigs in Malaysia and USA (Getachew et al., 2013 and Donabedian et al., 2010). A prospective review of these findings suggests that

GREs frequently inhabit the gastrointestinal tract of healthy non-hospitalised humans and have become community-acquired with a remarkable ability to survive once they have entered the food chain.

Little focus has been placed on the fact that E. faecium wasused a long time ago as a feed supplement in order to modulate the intestinal flora of livestock. It was thought to confer colonisation resistance, lactic acid and bacteriocin production against potential pathogens.

There is a possibility that GREs were present among these strains used since routine testing of

72 enterococcal strains for this resistance trait is not common. Therefore, E. faecium strains might not have been screened for resistance to glycopeptides. Moreover, Avoparcin went into use as a growth promoter in animal husbandry in 1975, disregarding the recommendations concerning the non-usage of antibiotics in animal feed due to potential risks of resistance development

(Aaerestrup et al., 1996). Although it is well proved that animals reared in germ-free environments grow faster than those that reared in unmonitored environments, the exact mechanism by which antibiotics ameliorate the growth is still poorly understood. However, it is thought that subtherapeutic levels administered are able to control mild diseases, which would otherwise stunt the growth of the animals (Mellon et al., 2001). All effects are limited to the intestinal bacteria, as the agents used are administered orally and are poorly absorbed.

While the benefits of the usage of antibiotics as growth promoters have been praised, there is strong evidence of the contrary. Aaerestrup et al. (1996) isolated Avoparcin and Vancomycin resistant isolates from faecal samples of animals. Several studies have revealed the link between the use of Avoparcin as a growth promoter and the detection of VanA phenotypes in farm animals (Klare et al., 1995 and Aaerestrup, 2000). Thus, Avoparcin was banned and other growth promoters have been used since then. Nevertheless, Tylosin, which is one of the main growth promoters banned in Europe, is still used in animal husbandry in South Africa (Moyane et al., 2013). Although there is little information about the pattern of antibiotic usage in animal farming in South Africa, there is a strong possibility that the use of alternative growth promoters would continue to select GRE if resistance to these antimicrobials is linked to glycopeptides resistance genes, as was the case in Denmark, whereby the use of the macrolide tylosin in pigs was suggested to co-select for Vancomycin resistance among enterococci (since genes encoding the two resistances are located on the same plasmid) (Aarestrup, 2000).

2.11. Antibiotic resistance: The way forward

The beef industry is an important value-added enterprise worldwide. As a matter of fact, millions of farms and ranches benefit directly from the sale of slaughtered animals, thereby contributing significantly to the economic output of their respective countries. Antimicrobials have been used in human and veterinary medicine for more than 60 years (Economou and

Gousia, 2015). In fact, the intensive usage of antibiotics in industrial animal husbandry and specifically in cattle rearing, has gained grounds in developing countries such as South Africa, with their negative impact on food safety and human health (Moyane et al., 2013).

Epidemiological studies have demonstrated the link between antimicrobial usage and the detection of resistant isolates in the environment (Rzewuska et al., 2015), making therapeutic alternatives for the treatment of infections caused by such organisms limited and their subsequent antimicrobial resistance genes (ARG’s) available in the environment (Tao et al.,

2014). Illnesses resulting from antimicrobial resistant strains are nowadays a serious public health issue as their prevalence is gaining grounds in communities and hospital environments.

Although there is no current study that assesses the economic burden of antibiotic-resistant bacterial infections on health care systems, their cost impact on the society, health insurances and hospitals is highly significant. Moreover, the increased levels of resistance and the failure to design new molecules are not encouraging perspectives for humankind. Furthermore, it might sound gloomy, but humanity could be at the eve of a post-antibiotic era whereby common infections and injuries might be lethal.

However, several propositions have been outlined in order to tackle the issue of antimicrobial resistance (Tatsing et al., 2018) and these include the following:

 The enforcement of drug legislation on its distribution and usage in developing

countries such as South Africa;

 The prioritisation of the usage of alternative therapeutic options instead of antibiotics;

 The implementation of a worldwide antimicrobial resistance surveillance system; and

 The funding of research and development of new drugs and vaccines.

In addition to these recommendations, the golden advice would be the adoption of a healthy lifestyle and environment-friendly behaviours as these will significantly reduce the outbreak of diseases and, consequently, the usage of antibiotics (Tatsing et al., 2018).

REFERENCES

Aakra, A., Vebø, H., Snipen, L., Hirt, H., Aastveit, A., Kapur, V., Dunny, G. et al., (2005).

Transcriptional response of Enterococcus faecalis V583 to erythromycin.

Antimicrob. Agents Chemother. 49 (6), 2246 – 2259.

Aarestrup, F.M. (2000). Characterization of glycopeptide-resistant Enterococcus faecium

(GRE) from broilers and pigs in Denmark: genetic evidence that persistence of

GRE in pig herds is associated with coselection by resistance to macrolides. J. Clin.

Microbiol. 38 (7), 2774 – 2777.

Aarestrup, F.M., Ahrens, P., Madsen, M., Pallesen, L.V., Poulsen, R.L. and Westh, H. (1996).

Glycopeptide susceptibility among Danish Enterococcus faecium and

Enterococcus faecalis isolates of animal and human origin and PCR identification

of genes within the VanA cluster. Antimicrob. Agents Chemother. 40, 1938 – 1940.

Abadia-Patino, L., Courvalin, P. and Perichon, B. (2002). vanE gene cluster of vancomycin-

resistant Enterococcus faecalis BM4405. J. Bacteriol. 184, 6457 – 6464.

Abrantes, M.C., Kok, J. and Lopes M.F. (2013). EfaR is a major regulator of Enterococcus

faecalis manganese transporters and influences processes involved in host

colonization and infection. Infect. Immun. 81, 935 – 944.

Acar, J.F. and Moulin, G. (2012). Antimicrobial resistance: a complex issue. Rev. Sci. Tech.

31, 23 – 31.

Andersson, D.I. and Hughes, D. (2012). Evolution of antibiotic resistance at non-lethal drug

concentrations. Drug resistance updates: reviews and commentaries in

antimicrobial and anticancer chemotherapy. 15, 162 – 172.

Andrighetto, C., Knijff, E., Lombardi, A., Torriani, S., Vancanneyt, M., Kerster, K., Swings,

J. and Dellagio, F. (2001). Phenotypic and genotypic diversity of enterococci

isolated from Italian cheese. J. dairy. Res. 68, 303 – 316.

Antonishyn, N.A., McDonald, R.R., Chan, E.L., Horsman, G., Woodmansee, C.E., Falk, P.S.

and Mayhall, C.G. (2002). Evaluation of fluorescence-based amplified fragment

length polymorphism analysis for molecular typing in hospital epidemiology:

comparison with pulsed field gel electrophoresis for typing strains of vancomycin

resistant Enterococcus faecium. J. Clin. Microbiol. 38, 4058 – 4065.

Araujo, R. and Sampaio-Maia, B. (2018). Fungal genomes and genotyping. Adv. Appl.

Microbiol. 102, 37 – 81.

Archimbaud, C., Shankar, N., Forestier, C., Baghdayan, A., Gilmore, M. S., Charbonne, F., et

al. (2002). In vitro adhesive properties and virulence factors of Enterococcus

faecalis strains. Res. Microbiol. 153, 75 – 80.

Arias, C.A., Courvalin, P. and Reynolds, P.E. (2000). vanC cluster of vancomycin- resistant

Enterococcus gallinarum BM4174. Antimicrob. Agents Chemother. 44,1660 –

1666.

Arthur, M., Reynolds, P. and Courvalin, P. (1996). Glycopeptide resistance in enterococci.

Trends Microbiol. 4, 401 – 407.

Arvanitido, M.V.A. (2003). Antibiotic resistance patterns of enterococci isolated from coastal

bathing waters. J. Med. Microbiol. 50, 1001 – 1005.

Ateba, C.N., Lekoma, K.P., and Kawadza, D.T. (2013). Detection of vanA and vanB genes in

vancomycin-resistant enterococci (VRE) from groundwater using multiplex PCR

analysis. J. Water Health. 11 (4), 684 – 691.

Ateba, C.N. and Maribeng, M.D. (2011). Detection of Enterococcus species in groundwater

from some rural communities in the Mmabatho area, South Africa: a risk analysis.

Afr. J. Microbiol. Rev. 5 (23), 3930 – 3935.

Ateba, C.N. and Mohapi, M.I. (2013). Isolation of vancomycin resistant enterococci isolated

from leafy vegetables (lettuce) from North West Province. Life Sci. 10 (4), 1163 –

1170.

Bardone, M.R., Paternoster, M. and Coronelli, C. (1978). Teichomycins, new antibiotics from

Actinoplanes teichomyceticus nov. sp. II. Extraction and chemical

characterization. J. Antibiot. 31, 170 – 177.

Bates, J. (1997). Epidemiology of vancomycin resistant enterococci in the community and

relevance of farm animals for human infections. J. Hosp. Infect. 37, 89 – 101.

Ben Omar, N., Castro, A., Lucas, R., Abriouel, H., Yousif, N. M. K., Franz, C. M. et al. (2004).

Functional and safety aspects of enterococci isolated from different Spanish foods.

Syst. Appl. Microbiol. 27, 118 – 130.

Beukers, A.G., Zaheer, R., Goji, N., Amoako, K.K., Chaves, A.V., Ward, M.P. and McAllister,

T.A. (2017). Comparative genomics of Enterococcus sp. isolated from bovine

feces. BMC Microbiol. 17 (1), 52.

Billström, H., Lund, B., Sullivan, A., and Nord, C. E. (2008). Virulence and antimicrobial

resistance in clinical Enterococcus faecium. Int. J. Antimicrob. Agents, 32, 374 –

377.

Bourne, R., Himmelreich, U., Sharma, A., Mountford, C. and Sorrell, T. (2001). Identification

of Enterococcus, Streptococcus, and Staphylococcus by multivariate analysis of

proton magnetic resonance spectroscopic data from plate cultures. J. Clin.

Microbiol. 39, 2916.

Bugg, T.D., Wright, G.D., Dutka-Malen, S., Arthur, M., Courvalin, P. and Walsh, C.T. (1991).

Molecular basis for vancomycin resistance in Enterococcus faecium BM4147:

biosynthesis of a depsipeptide peptidoglycan precursor by vancomycin resistance

proteins VanH and VanA. Biochemistry. 30, 10408 – 10415.

Butaye, P., Devriese, L.A. and Haesebrouck, F. (1999). Glycopeptide resistance in

Enterococcus faecium strains from animals and humans. Rev. Med. Microbiol. 10,

235 – 243.

Butaye, P., Devriese, L.A. and Haesebrouck, F. (2003). Antimicrobial growth promoters used

in animal feed: effects of less well-known antibiotics on gram positive bacteria.

Clin. Microbiol. Rev. 16 (2), 175 – 188.

Carlet, J., Jarlier, V., Harbarth, S., Voss, A., Goossens, H., and Pittet, D. (2012). Ready for a

world without antibiotics? The Pensieres antibiotic resistance call to action.

Antimicrob. Resist. Infect. Control. 1, 11.

Castillo-Rojas, G., Mazari-Hiríart, M., Ponce de León, S., Amieva-Fernández, R.I., Agis-

Juárez, R.A. and Huebner, J. (2013). Comparison of Enterococcus

faecium and Enterococcus faecalis strains isolated from water and clinical samples:

Antimicrobial Susceptibility and Genetic Relationships. Plos one. 8 (4), 59491.

Chajęcka-Wierzchowska, W., Zadernowska, A., and Łaniewska-Trokenheim, Ł. (2016).

Virulence factors, antimicrobial resistance and biofilm formation in Enterococcus

spp. isolated from retail shrimps. LWT - Food Sci. Technol. 69, 117 – 122.

Choi, S., Chu, W., Brown, J., Becker, S., Harwood, V.J. and Jiang, S.C. (2003). Application of

enterococci antibiotic resistance patterns for contamination source identification at

Huntington beach, California. Mar. Pollut. Bull. 46 (6), 748 – 755.

Chopra, I. and Roberts, M. (2001). Tetracycline antibiotics: mode of action, applications,

molecular biology and epidemiology of bacterial resistance. Microbiol. Biol. Mol.

Rev. 65 (2), 232 – 260.

Clewell, D.B. (2007). Properties of Enterococcus faecalis plasmid pAD1, a member of a

widely disseminated family of pheromone-responding, conjugative, virulence

elements encoding cytolysin. Plasmid, 58, 205 – 227.

Clewell, D.B. (2014). Antibiotic Resistance Plasmids in Bacteria. John Wiley & Sons, Ltd.

Clewell, D.B., An, F.Y., Flannagan, S.E., Antiporta, M. & Dunny, G.M. (2000). Enterococcal

sex pheromone precursors are part of signal sequences for surface lipoproteins.

Mol. Microbiol. 35, 246 – 247.

Cocconcelli, P.S., Senini, L., Bottazzi, V. (1996). Study of the lactic microflora of toma cheese:

use of rRNA targeted oligonucleotides for the identification of isolated strains.

Ann. Microbiol. Enzymol. 46, 21 – 28.

Courvalin, P. (2006). Vancomycin resistance in gram-positive cocci. Clin. Infect. Dis. 42 (1),

25 – 34.

Dahl, K.H., Simonsen, G.S., Olsvik, O. and Sundsfjord, A. (1999). Heterogeneity in the vanB

gene cluster of genomically diverse clinical strains of vancomycin-resistant

enterococci. Antimicrob. Agents Chemother. 43, 1105 – 1110.

Davies, J. and Davies, D. (2010). Origins and evolution of antibiotic resistance. Microbiol.

Mol. Biology Rev. 74, 417 – 433.

Depardieu, F., Bonora, M.G., Reynolds, P.E. and Courvalin, P. (2003a). The vanG

glycopeptides resistance operon from Enterococcus faecalis revisited. Mol.

Microbiol. 50, 931 – 948.

Depardieu, F., Kolbert, M., Pruul, H., Bell, J. and Courvalin, P. (2004). VanD-type

vancomycin-resistant Enterococcus faecium and Enterococcus faecalis.

Antimicrob. Agents Chemother. 48, 3892 – 3904.

Depardieu, F., Reynolds, P.E. and Courvalin, P. (2003b). VanD-type vancomycin-resistant

Enterococcus faecium 10/96A. Antimicrob. Agents Chemother. 47, 7 – 18.

Deshpande, L.M., Fritsche, T.R., Moet, G.J., Biedenbach, D.J. and Jones, R.N. (2007).

Antimicrobial resistance and molecular epidemiology of vancomycin-resistant

enterococci from North America and Europe: a report from the SENTRY

antimicrobial surveillance program. Diagn. Microbiol. Infect. Dis. 58, 163 – 170.

Devriese, L.A., Vancanneyt, M., Descheemaeker, P., Baele, M., Van Landuyt, H.W., Gordts,

B., Butaye, P., Swings, J. and Haesebrouck, F. (2002). Differentiation and

identification of Enterococcus durans, E. hirae and E. villorum. J. Appl. Microbiol.

92, 821 – 827.

De Vuyst, L., Foulquie-Moreno, M. R., & Revets, H. (2003). Screening for enterocins and

detection of hemolysin and vancomycin resistance in enterococci of different

origins. Int. J. Food Microbiol. 84, 299 – 318.

Dingle, K.E., Colles, F.M., Wareing, D.R.A., Ure, R., Fox, A.J., Bolton, F.E. et al. (2001).

Multilocus Sequence Typing System for Campylobacter jejuni. J. Clin. Microbiol.

39 (1), 14 – 23.

Domig, K.J., Mayer, H.K. and Kneifel, W. (2003). Methods used for the isolation, enumeration,

characterization and identification of Enterococcus spp. Int. J. Food Microbiol.

88(2003), 165 – 188.

Donabedian, S.M., Perri, M.B., Abdujamilova, N., Gordoncillo, M.J., Naqvi, A., Reyes, C.K.,

Zervos, M.J. and Bartlett, P. (2010). Characterization of Vancomycin-Resistant

Enterococcus faecium Isolated from Swine in Three Michigan Counties. J. Clin.

Microbiol. 48 (11), 4156 – 4160.

Donlan, R.M., and Costerton, J.W. (2002). Biofilms: Survival mechanisms of clinically

relevant microorganisms. Clin. Microbiol. Rev. 15, 167 – 193.

Dramsi, S., Trieu-Cuot, P., and Bierne, H. (2005). Sorting sortases: A nomenclature proposal

for the various sortases of gram-positive bacteria. Res. Microbiol. 156, 289 – 297.

Duh, R., Singh, K.V., Malathum, K. and Murray, B.E. (2001). In vitro activity of 19

antimicrobial agents against enterococci from healthy subjects and hospitalized

patients and use of an ace gene probe from Enterococcus faecalis for species

identification. Microb. Drug Res. 7, 39 – 46.

Dunny, G.M. (2007). The peptide pheromone-inducible conjugation system of Enterococcus

faecalis plasmid pCF10: Cell-cell signalling, gene transfer, complexity and

evolution. Philosophical Transactions of the Royal Society of London. 362, 1185 –

1193.

Dutka-Malen, S., Molinas, C., Arthur, M. and Courvalin, P. (1992). Sequence of the vanC gene

of Enterococcus gallinarum BM4174 encoding a D-alanine:D-alanine ligase-

related protein necessary for vancomycin resistance. Gene.112, 53 – 58.

Eagar, H.A., Swan, G. and Van Vuuren, M.A. (2012). Survey of antimicrobial usage in animals

in South Africa with specific reference to food animals. J. S. Afr. Vet. Assoc. 83

(1).

Eaton, T.J. and Gasson, M.J. (2001). Molecular screening of Enterococcus virulence

determinants and potential for genetic exchange between food and medical isolates.

Appl. Environ. Microbiol. 67(4), 1628 – 1635.

Economou, V. and Gousia, P. (2015). Agriculture and food animals as a source of

antimicrobial-resistant bacteria. Infect. Drug Resist. 8, 49 – 61.

Essack, S.Y., Schellack, N., Pople, T., van der Merwe, L., Suleman, F., Meyer, J.C., Gous,

A.G. and Benjamin, D. (2011). Part III. Antibiotic supply chain and management

in human health. S. Afr. Med. J. 101(8), 562 – 566.

Evers, S. and Courvalin, P. (1996). Regulation of VanB-type vancomycin resistance gene

expression by the VanS(B)-VanR(B) two-component regulatory system in

Enterococcus faecalis V583. J. Bacteriol. 178, 1302 – 1309.

Feighner, S.D. and Dashkevicz, M.P. (1987). Subtherapeutic levels of antibiotics in poultry

feeds and their effects on weight gain, feed efficiency and bacterial cholyltaurine

hydrolase activity. Appl. Environ. Microbiol. 53, 331 – 336.

Foulquié-Moreno, M. R., Sarantinopoulos, P., Tsakalidou, E., and De Vuyst, L. (2006). The

role and application of enterococci in food and health. Int. J. Food Microbiol. 106,

1 – 24.

Frahm, E., Heiber, I., Ludwig, W., Obst, U. (2001). Rapid parallel detection of hygienically

relevant microorganisms in water samples by PCR and specific hybridisation in

microtiter plates. Syst. Appl. Microbiol. 24, 423 – 429.

Franz, C., Stiles, M.E., Schleifer, K.H. and Holzapfel, W.H. (2003). Enterococci in foods: a

conundrum for food safety. Int. J. Food Microbiol. 88(2-3), 105 – 122.

Galli, D., Lottspeich, F. and Wirth, R. (1990). Sequence analysis of Enterococcus

faecalis aggregation substance encoded by the sex pheromone plasmid pAD1. Mol.

Microbiol. 4, 895 – 904.

Gelsomino, R., Vancanneyt, M., Cogan, T.M., Condon, S. and Swings, J. (2002). Source of

enterococci in a farm house raw milk cheese. Appl. Environ. Microbiol. 68 (7),

3560 – 3565.

Getachew, Y., Hassan, L., Zunita, Z. and Abdul-Aziz S. (2013). Genetic Variability of

Vancomycin-Resistant Enterococcus faecium and Enterococcus faecalis Isolates

from Humans, Chickens, and Pigs in Malaysia. Appl. Environ. Microbiol. 79 (15),

4528 – 4533.

Gilmore, S.M., Coburn, P.S., Nallapareddy, S.R. and Murray, B.E. (2002). Enterococcal

virulence. In M. S. Gilmore (Ed.), The enterococci: Pathogenesis, molecular

biology, and antibiotic resistance (pp. 301 – 354). Washington: American Society

for Microbiology.

Goldstein, R.E.R., Micallef, S.A., Gibbs, S.G., George, A., Claye, E., Sapkota, A., Joseph,

S.W., Sapkota, A.R. (2014). Detection of vancomycin-resistant enterococci (VRE)

at four United States wastewater treatment plants that provide effluent for reuse.

Sci. Total Environ. 466 – 467, 404 – 411.

Goodacre, R., Timmins, E.M., Rooney, R.J., Rowland, J.J. and Kell, D.B. (1996). Rapid

identification of Streptococcus and Enterococcus species using diffuse reflectance

– absorbance Fourier transform infrared spectroscopy and artificial neural

networks. FEMS Microbiol. Lett. 140, 233 – 239.

Hall, L.M., Whiley, R.A., Duke, B., George, R.C. and Efstratiou, A. (1996). Genetic

relatedness within and between serotypes of Streptococcus pneumonia from the

UK: analysis of multilocus enzyme electrophoresis, pulsed-field gel

electrophoresis and antimicrobial resistance patterns. J. Clin. Microbiol. 34 (4),

853 – 859.

Hammerum, A.M., Fussing, V., Aarestrup, F.M. and Wegener, H.C. (2000). Characterisation

of vancomycin-resistant and vancomycin-susceptible Enterococcus faecium

isolates from humans, chicken and pigs by riboprinting and pulsed field gel

electrophoresis. J. Antimicrob. Chemother. 45(5), 677 – 680.

Hancock, L. E. and Perego, M. (2004). The Enterococcus faecalis fsr two-component system

controls biofilm development through production of gelatinase. J. Bacteriol. 186,

5629 – 5639.

Hasman, H. and Aarestrup, F.M. (2005). Relationship between copper, glycopeptide, and

macrolide resistance among Enterococcus faecium strains isolated from pigs in

Denmark between 1997 and 2003. Antimicrob. Agents Chemother. 49(1), 454 –

456.

Heidari, H., Emaneini, M., Dabiri, H. and Jabalameli, F. (2016). Virulence factors,

antimicrobial resistance pattern and molecular analysis of enterococcal strains

isolated from burn patients. Microb. Pathogen. 90, 93 – 97.

Hendrickx, A.P., Willems, R.J., Bonten, M.J. and Van Schaik, W. (2009). LPxTG surface

proteins of enterococci. Trends Microbiol. 17, 423 – 430.

Henton, M.M., Eagar, H.A., Swan, G.E. and Van Vuuren, M. (2011). Part VI: Antibiotic

management and resistance in livestock production. S. Afr. Med. J. 101 (8), 583 -

586.

Hogan, J.S., Smith, K.L. Todhunter, D.A. and Schoenberger, P.S. (1999). Efficacy of a barrier

teat dip containing 55% chlorhexidine for prevention of bovine mastitis. J. Dairy

Sci. 78, 2502.

Hollenbeck, B.L. and Rice, L.B. (2012). Intrinsic and acquired resistance mechanisms in

Enterococcus. Virulence. 3, 421 – 433.

Holt, J.G., Krieg, N.R., Sneath, P.H.A., Staley, J.T. and Williams, S.T. (1994). In: Hensyl,

W.R. (Ed.), Bergey’s Manual of Determinative Bacteriology, 9th ed. Williams and

Wilkins, Baltimore, MD, USA, pp. 528 – 539.

Hughes, D. (2003). Exploiting genomics, genetics and chemistry to combat antibiotic

resistance. Nat. Rev. Genet. 4, 432 – 441.

Huttner, A., Harbarth, S., Carlet, J., Cosgrove, S., Goossens, H., Holmes, A., Jarlier, V., Voss,

A. and Pittet, D. (2013). Antimicrobial resistance: a global view from the 2013

World Healthcare-Associated Infections Forum. Antimicrob. Resist. Infect.

Control. 2, 31.

Huyke, M.M., Sham, F. and Gilmore, M.S. (1998). Multiple-drug resistant enterococci: the

nature of the problem and an agenda for the future. Emerg. Infect. Dis. 4, 239 –

249.

Javadi, A. (2011). Effect of roasting, boiling and microwaving cooking method on Doxycline

residues in edible tissues of poultry by microbial method. Afr. J. Pharm.

Pharmacol. 5 (8), 1034 – 1037.

Jiménez, E., Ladero, V., Chico, I., Maldonado-Barragán, A., López, M., Martín, V., et al.

(2013). Antibiotic resistance, virulence determinants and production of biogenic

amines among enterococci from ovine, feline, canine, porcine and human milk.

BMC Microbiol. 13, 288.

Jing, T., Gaol, X.D., Wang, P., Wang, Y., Lin, Y.F., Hu, X.Z., Halo, Q.L., Zhou, Y.K. and Mei,

S.R. (2009). Determination of trace tetracycline antibiotics in foodstuffs by liquid

chromatography–tandem mass spectrometry coupled with selective molecular-

imprinted Solid-phase extraction. Anal. Bioanal. Chem. 393, 2009 – 2018.

Johnsen, P.J., Osterhus, J.I., Sletvold, H., Sorum, M., Kruse, H., Nielsen, K., Simonsen, G.S.

and Sundsfjord, A. (2005). Persistence of animal and human glycopeptides-

resistant enterococci on two Norwegian poultry farms formerly exposed to

avoparcin is associated with a widespread plasmid-mediated vanA element within

a polyclonal Enterococcus faecium population. Appl. Environ. Microbiol. 71 (1),

159 – 168.

Kandasamy, S., Green, B.B., Benjamin, A.L. and Kerr, D.E. (2011). Between-cow variation in

dermal fibroblast response to lipopolysaccharide reflected in resolution of

inflammation during Escherichia coli mastitis. J. Dairy Sci. 94 (12), 5963 – 5975.

Kayser, F.H. (2003). Safety aspects of enterococci from the medical point of view. Int. J. Food

Microbiol. 88(2-3), 255 – 262.

Ke, D., Picard, F.J., Martineau, F., Menard, C., Roy, P.H., Ouellette, M., Gergeron, M.G.

(1999). Development of a PCR assay for rapid detection of enterococci. J. Clin.

Microbiol. 37, 3497 – 3503.

Kirschner, C., Maquelin, K., Pina, P., Thi, N.A.N., Choo-Smith, L.-P., Sockalingum, G.D.,

Sandt, C., Ami, D., Orsini, F., Doglia, S.M., Allouch, P., Mainfait, M., Puppels,

G.J. and Naumann, D. (2001). Classification and identification of enterococci: a

comparative phenotypic, genotypic, and vibrational spectroscopic study. J. Clin.

Microbiol. 39, 1763 – 1770.

Klare, I., Heier, H., Claus, H., Bohme, G., Marin, S., Seltmann, G., Hakenbeck, R.,

Antanassova, V. and Witte, W. (1995). Enterococcus faecium strains with vanA-

mediated high-level glycopeptide resistance isolated from animal foodstuffs and

fecal samples of humans in the community. Microb. Drug Resist. 1, 265 – 272.

Kozlowicz, B. K., Dworkin, M., & Dunny, G. M. (2006). Pheromone inducible conjugation in

Enterococcus faecalis: A model for the evolution of biological complexity? Int. J.

Med. Microbiol. 296, 141 – 147.

Kristich, C.J., Rice, L.B. and Arias, C.A. (2014). Enterococcal Infection—Treatment and

Antibiotic Resistance, p. 1–63. In Enterococci: From Commensals to 56 Leading

Causes of Drug Resistant Infection. Massachusetts Eye and Ear Infirmary, Boston.

Kühn, I., Iversen, A., Finn, M., Greko, C., Burman, G.L., Blanch, A.R., Vilanova, X., Manero,

A., Taylor, H., Caplin, J., Domìnguez, L., Herrero, I.A., Moreno, M.A. and Möllby,

R. (1995). Occurrence and Relatedness of Vancomycin-Resistant Enterococci in

Animals, Humans, and the Environment in Different European Regions. Appl.

Environ. Microbiol. 71 (9), 5383 – 5390.

Kuzucu, C., Cizmeci, Z., Durmaz, R., Durmaz, E. and Ozerol I.H. (2005). The prevalence of

faecal colonization of enterococci, the resistance of the isolates to ampicillin,

vancomycin and high-level aminoglycosides and the clonal relationship among

isolates. Microb. Drug Resist. 11 (2), 159 – 164.

Lancefield, R.C. (1933). A serological differentiation of human and other groups of hemolytic

streptococci. J. Exp. Med. 57, 571 – 595.

Lang, M.M., Ingham, S.C. and Ingham, B.H. (2001). Differentiation of Enterococcus spp. by

cell membrane fatty acid methyl ester profiling, biotyping and ribotyping. Lett.

Appl. Microbiol. 33, 65 – 70.

Latasa, C., Solano, C., Penade, S.J.R. and Lasa, I. (2006). Biofilm associated proteins. C. R.

Biol. 329, 849 – 857.

Lautenbach, E., Schuster, M.G., Bilker, W.B. and Brennan, P.J. (1998). The role of

chloramphenicol in the treatment of bloodstream infection due to vancomycin-

resistant Enterococcus. Clin. Infect. Dis. 27, 1259 – 1265.

Laven, R. (2015). Mastitis control and management: mastitis part 4- detecting and treating

clinical mastitis. National animal disease information service.

Leavis, H., Top, J., Shankar, N., Borgen, K., Bonten, M., van Embden, J. et al. (2004). A novel

putative pathogenicity Island linked to esp virulence gene of Enterococcus faecium

and associated with epidemicity. J. Bacteriol. 186, 672 – 682.

Lebreton, F., Willems, R.J.L. and Gilmore, M.S. (2014). Enterococcus diversity, origins in

nature and gut colonization. In M.S. Gilmore, D.B. Clewell, Y. Ike et al. (Eds.),

Enterococci: from commensals to leading causes of drug resistant infections (pp 1

– 46) Boston: Massachusetts Eye and Ear infirmary.

Leclercq, R., Derlot, E., Duval, J. and Courvalin, P. (1988). Plasmid-mediated resistance to

vancomycin and teicoplanin in Enterococcus faecium. N. Engl. J. Med. 319, 157 –

161.

Lee, H.K., Lee, W.G., Cho, S.R. (1999). Clinical and molecular biological analysis of a

nosocomial outbreak of vancomycin-resistant enterococci in a neonatal intensive

care unit. Acta Paediatr. 88, 651 – 654.

Locke, J.B., Zurenko, G.E., Shaw, K.J. and Bartizal, K. (2014). Tedizolid for the management

of human infections: in vitro characteristics. Clin. Infect. Dis. 58 (1), 35 – 42.

Macovei, L. and Zurek, L. (2006). Ecology of antibiotic resistance genes: characterization of

enterococci from houseflies collected in food settings. Appl. Environ. Microbiol.

72 (6), 4028 – 4035.

Manero, A. and Blanch, A.R. (1999). Identification of Enterococcus sp. with a biochemical

key. Appl. Environ. Microbiol. 65 (10), 4425 – 4430.

Manero, A., Vilanova, X., Cerdà-Cuéllar, M. and Blanch A.R. (2002). Characterisation of

sewage waters by biochemical fingerprinting of enterococci. Water Res. 36 (11),

2831 – 2835.

Mannu, L., Paba, A., Pes, M., Floris, R., Scintu, M.F. and Morelli, L. (1999). Strain typing

among enterococci isolated from home made pecorino sardo cheese. FEMS

Microbiol. Lett. 170 (1), 25 – 30.

Matlou, D.P., Bissong, M.E.A., Tchatchouang, C.K., Adem, M.R., Foka, F.E.T. and Ateba,

C.N. (2019). Virulence profiles of vancomycin-resistant enterococci isolated from

surface and ground water utilized by humans in the North-West Province, South Africa:

a public health perspective. Environ. Sci. Pollut. Res. 26 (15), 15105 – 15114.

McDermid, L. (2012). You are what you eat: Food and the problem of antibiotic

resistance.http://www.allabouthealth.co.za. Accessed on the 9th August 2017.

McKessar, S.J., Berry, A.M., Bell, J.M., Turnidge, J.D. and Paton, J.C. (2000). Genetic

characterization of vanG, a novel Vancomycin resistance locus of Enterococcus

faecalis. Antimicrob. Agents Chemother. 44, 3224 – 3228.

Mellon, M., Benbrook, C. and Benbrook, K.L. (2001). Hogging It! Estimates of antimicrobial

abuse in livestock. Cambridge: Union of Concerned Scientists Publications.

http://www.ucsusa.org/assets/documents/food_and_agriculture/hog_chaps.pdf

Accessed 24/April/2017

Messer, J.W. and Dufour, A.P. (1998). A rapid, specific membrane filtration procedure for

enumeration of enterococci in recreational waters. Appl. Environ. Microbiol. 64,

678 – 680.

Micallef, S.A., Goldstein, R.E., Ashish, G., Ewing, L., Tall, B.D., Boyer, M.S., Sam, S.J. and

Sapkota, A.R. (2013). Diversity, distribution and antibiotic resistance of

Enterococcus species recovered from tomatoes, leaves, water, and soil on U.S.

Mid-Atlantic farms. Food Microbiol. 36, 465 – 474.

Miller, W.R., Munita, J.M. and Arias, C.A. (2014). Mechanisms of antibiotic resistance in

enterococci. Expert. Rev. Anti. Infect. Ther. 12, 1221 – 1236.

Miller, W.R., Murray, B.E., Rice, L.B. and Arias, C.A. (2016). Vancomycin-Resistant

Enterococci: Therapeutic Challenges in the 21st Century. Infect. Dis. Clin. 30, 415

– 439.

Moellering, R.C. (2006). Vancomycin: a 50-year reassessment. Clin. Infect. Dis. 42 (1), 3 – 4.

Moellering, R.C., Krogstad, D.J. and Greenblatt, D.J. (1981). Vancomycin therapy in patients

with impaired renal function: a nomogram for dosage. Ann. Intern. Med. 94, 343 –

346.

Mohamed, J.A. and Huang, D.B. (2007). Biofilm formation by enterococci. J. Med. Microbiol.

56: 1581 – 1588.

Morrison, D., Woodford, N., Barrett, S.P., Sisson, P., Cookson, B.D. (1999). DNA banding

pattern polymorphism in vancomycin- resistant Enterococcus faecium and criteria

for defining strains. J. Clin. Microbiol. 37, 1084 – 1091.

Moyane, J.N., Jideani, A.I.O., Aiyegoro, O.A. (2013). Antibiotic usage in food producing

animals in South Africa and impact on human: antibiotic resistance. Afr. J. Microb.

Res. 7 (24), 2990 – 2997.

Müller, T., Ulrich, A., Ott, E-M., Müller, M. (2001). Identification of plant-associated

enterococci. J. Appl. Microbiol. 91, 268 – 278.

Mundy, L.M., Sahm, D.F. and Gilmore, M. (2000). Relationship between enterococcal

virulence and antimicrobial resistance. Clin. Microbiol. Rev. 13, 513 – 522.

Myllys, V. and Rautala, H. (1995). Characterization of clinical mastitis in primiparous heifers.

J. Dairy Sci. 78, 538 – 545.

Nagy, K., Jakab, A., Fekete, J. and Vekey, K. (2004). An HPLC-MS approach for analysis of

very long chain fatty acids and other apolar compounds on octadecyl-silica phase

using partly miscible solvents. Anal. Chem. 76 (7), 1935 – 1941.

Nallapareddy, S.R., Qin, X., Weinstock, G.M., Hook, M. and Murray, B.E. (2000).

Enterococcus faecalis adhesin, Ace, mediates attachment to extracellular matrix

proteins collagen type IV and laminin as well as collagen type I. Infect. Immun. 68,

5218 – 5224.

Nallapareddy, S.R., Singh, K.V., Okhuysen, P.C. and Murray, B.E. (2008). A functional

collagen adhesin gene, acm, in clinical isolates of Enterococcus faecium correlates

with the recent success of this emerging nosocomial pathogen. Infect. Immun. 76,

4110 – 4119.

Navarro, F. and Courvalin, P. (1994). Analysis of genes encoding D-alanine-D-alanine ligase-

related enzymes in Enterococcus casseliflavus and Enterococcus flavescens.

Antimicrob. Agents Chemother. 38, 1788 – 1793.

Nilsson, O., Grekol, C., Top, J., Franklin, A., and Bengtsson, B. (2009). Spread without known

selective pressure of a vancomycin-resistant clone of Enterococcus faecium among

broilers. J. Antimicrob. Chemother.10, 1 – 5.

Noble, W.C., Virani, Z. and Cree, R.G. (1992). Co-transfer of vancomycin and other resistance

genes from Enterococcus faecalis NCTC 12201 to Staphylococcus aureus. FEMS

Microbiol. Lett. 72, 195 – 198.

Oana, K., Okimura, Y., Kawakami, Y., Hayashida, N., Shimosaka, M., Okazaki, M., Hayashi,

T. and Ohnishi, M. (2002). Physical and genetic map of Enterococcus faecium

ATCC 19434 and demonstration of intra- and interspecific genomic diversity in

enterococci. FEMS Microbiol. Lett. 207, 133 – 139.

Oancea, C., Klare, I., Witte, W. and Werner, G. (2004). Conjugative transfer of the virulence

gene, esp, among isolates of Enterococcus faecium and Enterococcus faecalis. J.

Antimicrob. Chemother. 54, 232 – 235.

Ochoa, S.A., Escalona, G., Cruz-Córdova, A., Dávila, L.B., Saldaña, Z., Cázares- Domímguez,

V., et al. (2013). Molecular analysis and distribution of multidrugresistant

Enterococcus faecium isolates belonging to clonal complex 17 in a tertiary care

center in Mexico City. BMC Microbiol. 13, 291.

O'Driscoll, T., and Crank, C.W. (2015). Vancomycin-resistant enterococcal infections:

Epidemiology, clinical manifestations, and optimal management. Infect. Drug

Resist. 8, 217 – 230.

Ogier, J.C. and Serror, P. (2008). Safety assessment of dairy microorganisms: the Enterococcus

genus. Int. Food Microbiol. 126 (3), 291 – 301.

Pankey, J.W., Pankey, P.B., Barker, R.M., Williamson, J.H. and Woolford, M.W. (1996). The

prevalence of mastitis in primiparous heifers in eleven Waikato dairy herds. N.Z.

Vet. J. 44:41.

Parenti, F., Beretta, G., Berti, M. and Arioli, V. (1978). Teichomycins, new antibiotics from

Actinoplanes teichomyceticus nov sp - Description of the producer strain,

fermentation studies and biological properties. J. Antibiot. 31, 276 – 283.

Partridge, S.R. (2011). Analysis of antibiotic resistance regions in Gram-negative bacteria.

FEMS Microbiol. Rev. 35, 820 – 855.

Patti, J.M., Allen, B.L., McGavin, M.J. and Hook, M. (1994) MSCRAMM-mediated adherence

of microorganisms to host tissues. Annu. Rev. Microbiol. 48, 585 – 617.

Petroziello, J.M., Gress, M.J., Mc Cleskey, F.K., Namdari, H., Del Vecchio, V.G. (1996).

Genetic fingerprinting of clinical strains of Enterococcus faecalis and

Enterococcus faecium by Rep-PCR. Infect. Control Hosp. Epidemiol. 17, 46.

Picard, J.A. and Sinthumule, E. (2002). Antimicrobial Database Report 2002. Pretoria:

University of Pretoria.

Pillai, S. K., Sakoulas, G., Eliopoulos, G. M., Moellering, R. C., Murray, B. E. and Inouye, R.

T. (2004). Effects of glucose on fsr-mediated biofilm formation in Enterococcus

faecalis. J. Infect. Dis. 190, 967 – 970.

Pinkston, K. L., Gao, P., Diaz-Garcia, D., Sillanpa, J., Nallapareddy, S. R., Murray, B.E., et al.

(2011). The Fsr quorum-sensing system of Enterococcus faecalis modulates

surface display of the collagen-binding MSCRAMM Ace through regulation of

gelE. J. Bacteriol. 193, 4317 – 4325.

Podbielski, A. and Kreikemeyer, B. (2004). Cell density-dependent regulation, basic principles

and effects on the virulence of Gram positive cocci. Int. J. Infect. Dis. 8, 81 – 95.

Poeta, P., Costa, D., Sáenz, Y., Klibi, N., Ruiz-Larrea, F., Rodriguez, J. et al. (2005).

Characterization of antibiotic resistance genes and virulence factors in faecal

enterococci of wild animals in Portugal. J. Vet. Med. 52 (9), 396 – 402.

Pompei, R., Thaller, M.C., Pittaluga, F., Flore, O., Satta, G. (1992). Analysis of bacterioloytic

activity patterns, a novel approach to the taxonomy of enterococci. Int. J. Syst.

Bacteriol. 42, 37 – 43.

Price, C.S., Huynh, H., Paule, S., Hollis, R.J., Noskin, G.A., Pfaller, M.A., Peterson, L.R.

(2002). Comparison of an automated ribotyping system to restriction endonuclease

analysis and pulsed-field gel electrophoresis for differentiating vancomycin-

resistant Enterococcus faecium isolates. J. Clin. Microbiol. 40, 1858 – 1861.

Privitera, O., Sisto, F., Giuffrida, V., Puntorieri, M., Cascone, C., Di Silvestro, I., Rappazzo,

G., Stefani, S. (1999). Reverse transcription polymerase chain reaction method for

the detection of glycopeptides resistance in enterococci. J. Microbiol. Methods. 35,

95 – 100.

Pujol, C., Joly, S., Lockhart, S.R., Noel, S., Tibavrenc, M. and Soll, D.R. (1997). Parity among

the randomly amplified polymorphic DNA method, multilocus enzyme

electrophoresis and southern blot hybridization with moderately repetitive DNA

probe Ca3 for fingerprinting Candida albicans. J. Clin. Microbiol. 35 (9), 2248 –

2258.

Rakita, R.M., Vanek, N.N., Jacques-Palaz K., Mee, M., Mariscalco, M.M., Dunny, G.M. et al.

(1999). Enterococcus faecalis bearing aggregation substance is resistant to killing

by human neutrophils despite phagocytosis and neutrophil activation. Infect.

Immun. 67, 6067 – 6075.

Rathnayake, I.U., Hargreaves, M. and Huygens, F. (2011). Antibiotic resistance and virulence

traits in clinical and environmental Enterococcus faecalis and Enterococcus

faecium isolates. Syst. Appl. Microbiol. 35 (5), 326 – 333.

Reynolds, P.E. and Courvalin, P. (2005). Vancomycin resistance by synthesis of precursors

terminating in d-alanyl-d-alanine. Antimicrob. Agents Chemother. 49, 21 – 25.

Rich, C., Favre-Bonte, S., Sapena, F., Joly, B. and Forestier, C. (1999). Characterization of

enteroaggregative Escherichia coli isolates. FEMS Microbiol. Letters, 173, 55 –

61.

Rzewuska, M., Stefanska, I., Kizerwetter-Swida, M., Chrobak-Cmiel, D., Szczygielska, P.,

Lesniak, M. and Binek, M. (2015). Characterization of extended-spectrum-beta-

lactamases produced by Escherichia coli strains isolated from dogs in Poland. Pol.

J. Microbiol. 64, 285 – 288.

Salminen, S., Wright, A.V. and Ouwehand, A. (2004). Lactic acid bacteria, Microbiological

and functional aspects (Third Ed.). New York: Mercel Dekker.

Sava, I.G., Heikens, E. and Huebner, J. (2010). Pathogenesis and immunity in enterococcal

infections. Clin. Microbiol. Infect. 16, 533 – 540.

Schubert, S., Darlu, P., Clermont, O., Wieser, A., Magistro, G., Hoffmann, C., Weinert, K.,

Tenaillon, O., Matic, I. and Denamur, E. (2009). Role of intraspecies

recombination in the spread of pathogenicity islands within the Escherichia coli

species. PLoS Pathogens 5: e1000257.

Sears, P.M. and Wilson, D.J. (1994). Heifer mastitis. Bov. Practitioner. 28, 56 – 58.

Semedo, T., Santos, M.A., Lopes, M.F., Marques, J.J.F., Crespo, M.T. and Tenreiro, R. (2003).

Virulence factors in food, clinical and reference enterococci: A common trait in the

genus? Syst. Appl. Microbiol. 26, 13 – 22.

Shankar, N., Coburn, P., Pillar, C., Haas, W. and Gilmore, M. (2004). Enterococcal cytolysin:

Activities and association with other virulence traits in a pathogenicity island. Int.

J. Med. Microbiol. 293, 609 – 618.

Sherman, J.M. (1937). The Streptococci. Bacteriol. Rev. 1 (1), 3 – 97.

Silva-Del Toro, S.L., Greenwood-Quaintance, K.E. and Patel, R. (2016). In vitro activity of

tedizolid against linezolid-resistant staphylococci and enterococci. Diagn.

Microbiol. Infect. Dis. 85, 102 – 104.

Simjee, S. and Gill, M.J. (1997). Gene transfer, gentamicin resistance and enterococci. J. Hosp.

Infect. 36 (4), 249 – 259.

Strzelecki, J., Sadowy, E. and Hryniewicz, W. (2011). Enterococcal surface proteins

responsible for interactions with host tissues. Adv. Microbiol. 50, 31 – 42.

Tao, C.W., Bing-Mu, H., Wen-Tsai, J., Tsui-Kang, H., Po-Min, K., Chun-Po, H., Shu-Min, S.,

Tzung-Yu, S., Tern-Jou, W.and Yu-Li, H. (2014). Evaluation of five antibiotic

resistance genes in wastewater treatment systems of swine farms by real-time PCR.

Sci. Total Environ. 496, 116 – 121.

Tatsing F.F.E., Kumar, A. and Ateba, C.N. (2018). Emergence of vancomycin-resistant

enterococci in South Africa: Implications for public health. S. Afr. J. Sci. 114(9-10), 20

– 26.

Taucer-Kapteijin, M., Hoogenboezem, W., Heiliegers, L., Danny de Bolster, H. and Medema,

G. (2016). Screening municipal wastewater effluent and surface water used for

drinking water production for the presence of ampicillin and vancomycin resistant

enterococci. Int. J. Hyg. Environ. Health. 16, 1 – 7.

Teixeira, N., Santos, S., Marujo, P., Yokohata, R., Iyer, V.S., Nakayama, J. et al. (2012). The

incongruent gelatinase genotype and phenotype in Enterococcus faecalis are due

to shutting off the ability to respond to the gelatinase biosynthesisactivating

pheromone (GBAP) quorum-sensing signal. Microbiol. 158, 519 – 528.

Teng, L-J., Hsueh, P-R., Wang, Y-H., Lin, H-M., Luh, K-T. and Ho, H-M. (2001).

Determination of Enterococcus faecalis groESL full-length sequence and

application for species identification. J. Clin. Microbiol. 39, 3326 – 3331.

Thiercelin, M. (1899). Sur un diplocoque saprophyte de l'intestin susceptible de devenir

pathogene. C. R. Seances Soc. Biol. Fil. 51, 269 – 271.

Toledo-Arana, A., Valle, J., Solano, C., Arrizubieta, M.J., Cucarella, C., Lamata, M. et al.

(2001). The enterococcal protein, Esp, is involved in Enterococcus faecalis

biofilms formation. Appl. Environ. Microbiol. 67, 4538 – 4545.

Tomayko, J.F. and Murray, B.E. (1995). Analysis of Enterococcus faecalis isolates from

intercontinental sources by multilocus enzyme electrophoresis and pulsed-field gel

electrophoresis. J. Clin. Microbiol. 33, 2903 – 2907.

Tomita, H. and Ike, Y. (2004). Tissue-specific adherent Enterococcus faecalis strains that show

highly efficient adhesion to human bladder carcinoma T24 cells also adhere to

extracellular matrix proteins. Infect. Immun. 72, 5877 – 5885.

Trivedi, K., Cupakova, S. and Karpiskova, R. (2011). Virulence factors and antibiotic

resistance in Enterococci isolated from food-stuffs. Vet. Med. 56, 352 – 357.

Tyrrell, G.J., Turnbull, L.A., Teixeira, L.M., Lefebvre, J., Carvalho, M.G.S., Facklam, R.R.

and Lovgren, M. (2002). Enterococcus gilvus sp. nov. and Enterococcus pallens

sp. nov. isolated from human clinical specimens. J. Clin. Microbiol. 40, 1140 –

1145.

Upadhyaya, P.M., Ravikumar, K.L. and Umapathy, B.L. (2009). Review of virulence factor of

Enterococcus: An emerging nosocomial pathogen. Ind. J. Med. Microbiol. 27, 301

– 305.

Uttley, A.H., Collins, C.H., Naidoo, J. and George, R.C. (1988). Vancomycin-resistant

enterococci. Lancet. 10, 57 – 58.

Van Horn, K., Tóth, C., Kariyama, R., Mitsuhata, R. and Komon, H. (2002). Evaluation of 15

motility media and a direct microscopic method for detection of motility in

enterococci. J. Clin. Microbiol. 40, 2476 – 2479.

Vos, P., Hogers, R., Bleeker, M., Reijans, M., Van De Lee, T., Hornes, M., Frijters, A., Pot, J.,

Peleman, J., Kuiper, M. and Zabeau, M. (1995). AFLP: a new concept for DNA

fingerprinting. Nucleic Acids Res. 23, 4407 – 4414.

Walsh, C.T. (1989). Enzymes in the D-alanine branch of bacterial cell wall peptidoglycan

assembly. J. Biol. Chem. 264, 2393 – 2396.

Wang, Y., Liu, Y., Cai, J., Schwarz, S., Cui, L., Hu, Z., Zhang, R., Li, J., Zhao, Q., He, T.,

Wang, D., Wang, Z., Shen, Y., Li, Y., Wu, C., Yu, H., Deng, X., Xia, X. and Shen,

J. (2015). A novel gene, optrA, that confers transferable resistance to

oxazolidinones and phenicols and its presence in Enterococcus faecalis and

Enterococcus faecium of human and animal origin. J. Antimicrob. Chemother. 70,

2182 – 2190.

Wardal, E., Sadowy, E. and Hryniewicz, W. (2010). Complex nature of enterococcal

pheromone-responsive plasmids. Pol. J. Microbiol. 59, 79 – 87.

Waters, C.M., Antiporta, M.H., Murray, B.E. and Dunny, G.M. 2003. Role of the Enterococcus

faecalis GelE Protease in Determination of Cellular Chain Length, Supernatant

Pheromone Levels, and Degradation of Fibrin and Misfolded Surface Proteins. J.

Bacteriol. 185, 3613 – 3623.

Williamson, R., Al-Obeid, S., Shlaes, J.H., Goldstein, F.W. and Shlaes, D.M. (1989). Inducible

resistance to vancomycin in Enterococcus faecium D366. J. Infect. Dis. 159, 1095

– 1104.

Wilcks, A., Andersen, S.R. and Licht, T.R. (2005). Characterisation of transferable tetracycline

resistance genes in Enterococcus faecalis isolated from raw food. FEMS Microbiol.

Lett. 243 (1), 15 – 19.

Xu, X., Lin, D., Yan, G., Ye, X., Wu, S., Guo, Y., Zhu, D., Hu, F., Zhang, Y., Wang, F., Jacoby,

G.A. and Wang, M. (2010). vanM, a New Glycopeptide Resistance Gene Cluster

Found in Enterococcus faecium. Antimicrob. Agents Chemother. 6054, 4643 –

4647.

Yarlagadda, V., Manjunath, G.B., Sarkar, P., Akkapeddi, P., Paramanandham, K., Shome,

B.R., Ravikumar, R. and Haldar, J. (2016). Glycopeptide antibiotic to overcome

the intrinsic resistance of Gram-negative bacteria. ACS Infect. Dis. 2, 132 – 139.

Zhang, X., Paganelli, F.L., Bierschenk, D., Kuipers, A., Bonten, M.J.M., Willems, R.J.L. and

Schaik, W. (2012). Genome-wide identification of ampicillin resistance

determinants in Enterococcus faecium. PLoS Genet. 8, e1002804.

CHAPTER 3

Emergence of Vancomycin-resistant enterococci in South

Africa: Implications for public health

South African Journal of Sciences, 2018; 114(9/10) https://doi.org/10.17159/sajs.2018/4508

Chapter 3 Emergence of Vancomycin-resistant enterococci in South Africa: Implications for public health

This chapter has been published in the " South African Journal of Sciences, 2018, 114(9/10):

1-7. https://doi: 10.3389/fcimb.2019.00333 with contributions from the following authors:

Tatsing Foka F.E., Kumar A. and Ateba C.N.

Abstract

South Africa is among the countries with the highest prevalence of debilitating diseases such as HIV/Aids and diabetes. In this context, the emergence of Vancomycin-resistant enterococci

(VREs) in most South African ecological niches is quite disturbing, taking into consideration the fact that therapeutic options in a case of resistant-enterococci infection would be limited.

Agricultural practices, coupled with the misuse of antibiotics in intensive animal rearing and in hospital facilities, have led to the creation of reservoirs of VREs in the environment. VREs can cause serious health problems by transmitting their resistance genes to susceptible pathogens; they are transmitted to humans by direct or indirect contact and through the food chain. We screened thoroughly the AJOL and the PubMed databases for studies on VRE incidence in South Africa. This review provides insights into the current status of antimicrobial resistance management in South Africa; it explores the different pathways involved in the spread of VREs and proposes possible solutions to tackle the issue of VREs and antimicrobial resistance in South Africa and other parts of the world.

Significance of the study

100

 The recent detection of Vancomycin-resistant enterococci in most South African

ecological niches poses a serious threat to public health and, is therefore, an issue of

great concern.

 This study not only addresses the causes and patterns of resistance to antimicrobial

agents, particularly in South Africa, but also outlines a holistic approach to potential

strategies to tackle antimicrobial resistance in South Africa and the world at large.

Keywords: Antimicrobial resistance, glycopeptide resistance, emerging pathogens

3.1 Introduction

Shortly after antibiotics were introduced for therapeutic purposes, their growth-promoting attributes were discovered; ever since, most antibiotics and their analogues have been used as growth promoters in animal farming (Butaye et al., 2003). Growth promoters are believed to improve feed conversion, promote animal growth and reduce mortality and morbidity rates, resulting from clinical and subclinical illnesses, although the mechanisms through which these effects are achieved are still poorly understood (Marshall and Levy, 2011). This effect of antibiotics motivated the use of Avoparcin as a growth promoter for many decades before it was banned worldwide due to the emergence of Vancomycin-resistant enterococci (VREs)

(Rosvoll et al., 2010). The rise of VREs reduced the efficacy of enterococcal infection treatments with Teicoplanin and Vancomycin (which were the drugs of choice until then), making treatment more challenging.

The isolation of VREs in hospitals and environmental samples worldwide and specifically in

South Africa, is a serious health concern (Iweriebor et al., 2015; Ateba and Maribeng, 2013;

Ateba et al., 2013). In fact, VREs were isolated from surface water in the Netherlands, from ground water and from hospital waste water in South Africa (Iweriebor et al., 2015; Ateba and

101

Maribeng, 2013; Ateba et al., 2013; Taucer-Kapteijin et al., 2016). VREs mainly cause illnesses in immunocompromised hosts and in patients admitted into intensive care units for lengthy periods (Kuzucu et al., 2005). For instance, VREs are responsible for endocarditis, urinary tract infections, bacteraemia, intra-abdominal and pelvic infections, burn wounds and deep tissue infections.

Due to the serious implications of VREs on public health, the issue of VREs cannot be underestimated. This review is, therefore, not just a citation of reports of VREs in South Africa and their patterns of spreading and dissemination, but also an insight into the current management of antimicrobial resistance issues in South Africa, with some recommendations on how to tackle the issue of Vancomycin resistance genes in South Africa and other countries.

3.2 Mechanism of resistance to Vancomycin

Two types of Vancomycin resistance in enterococci have been reported so far: intrinsic and acquired resistance. Intrinsic resistance refers to an antimicrobial drug being ineffective due to inherent features in a species, like restricting drug accessibility to the target or not having the drug target. Acquired resistance occurs when the bacterium is initially susceptible, but develops resistance either by somatic mutation or by acquisition of genes by horizontal transfer.

Characterised by low-level resistance to Vancomycin, intrinsic resistance is commonly detected in Enterococcus gallinarum, E. casseliflavus and E. flavescens. As opposed to E. faecium and E. faecalis and less often E. raffinosus, E. avium and E. durans display acquired resistance to Vancomycin, resulting from the acquisition of genetic determinants either from another organism or from the environment (Sónia et al., 2015; Jui-Chang et al., 2005; Arthur et al., 1996). Resistance to Vancomycin is conferred by 10 gene clusters as follows: vanA; vanB, vanC; vanD; vanE; vanF; vanG; vanL; vanM; and vanN. Gene clusters vanA, vanB, vanC, vanD, vanE and vanG have been extensively studied (Figure 3.1). The resistance phenotypes share the same basic mechanism of resistance. The glycopeptides bind to the

102 carboxy-terminal D-Ala residues of cell wall precursors, thus preventing their incorporation into the nascent peptidoglycan. Substituting the terminal D-Ala residue with either D-lactate

(vanA, vanB and vanD genotypes) or D-serine (vanC and vanE genotypes) confers resistance

(Figure 3.1) (Arthur et al., 1996; Bugg et al., 1991).

Figure 3. 1: Vancomycin resistance gene clusters and resistance mechanism (Hughes, 2003)

3.3 Studies of Vancomycin-resistant enterococci in South Africa

103

3.3.1 Vancomycin-resistant enterococci in food items and the environment

Very few reviews actually give an account of the situation in South Africa with regard to VREs in food items and the environment. Enterococci were isolated from lettuce and spinach leaves in the North West Province using polymerase chain reaction techniques (Ateba and Mohapi,

2013). The researchers were motivated by the fact that enterococci had previously been screened from ground water intended for drinking in the same area (Ateba and Maribeng, 2011;

Ateba et al., 2013). Vegetables were contaminated due to their proximity to the soil when grown (Ruimy et al., 2010). Animals and birds were another possible source of contamination but the water used in the irrigation process of these vegetables was also a source of contamination. Moreover, the harvesting, packaging, handling and retail hygiene practices were other sources of contamination (Ruimy et al., 2010). Considering the fact that similar findings were revealed in Oman (Al-Kharousi et al., 2016), detection of VREs in fresh, leafy food items constitutes a serious health issue since lettuce is mostly eaten raw, in the form of salads.

Vancomycin-resistant enterococci were isolated from ground water intended for drinking in rural communities of the North West Province, South Africa (Ateba and Maribeng, 2011). The study revealed that limited access to proper sanitary facilities and lack of hygiene were the causative factors since the sources of water were contaminated by faecal matter. These factors are the same as those that contributed to the contamination by VREs of municipal tap water in

Mafikeng households, also in the North West Province (Matlou, 2016). In addition to these causes, contamination of environmental soil and water bodies by resistant isolates could arise due to farming activities and contamination from other sources such as contaminated waste effluents from clinical settings (Iweriebor et al., 2015; Molale, 2016; Lochan et al., 2016).

104

3.3.2 Vancomycin-resistant enterococci in hospital settings

Vancomycin-resistant enterococci constitute a serious issue in hospitals in South Africa, especially taking into consideration the high incidence of HIV-positive patients and the high prevalence of other debilitating illnesses such as tuberculosis and diabetes. A possible synergistic association between Aids or any of the above-mentioned illnesses and VRE infections is rather unsettling and dreaded. In fact, clinical isolates of VREs were reported in

South Africa for the first time in 1997 (Mahabeer et al., 2016). A few years later, a case report of VRE infections was filed at the paediatric oncology ward of a tertiary-level paediatric hospital in Cape Town and in the haematology unit of a similar type of hospital in Durban

(Lochan et al., 2016; Mahabeer et al., 2016; Budavari et al., 1997; Singh et al., 2013). Based on the results obtained from gene-sequencing assays (PFGE and MLST), it was suggested that a possible transfer of VRE isolates between patients or persistence of this isolate within the haematology/oncology unit were responsible (Lochan et al., 2016). This resistance resulted from previous treatments with broad-spectrum antibiotics (mostly third-generation cephalosporins and carbapenems), prolonged stays in the hospital setting, exposure to

Vancomycin, immunosuppression therapy and young age in the case of children (Lochan et al., 2016; Mahabeer et al., 2016; Budavari et al., 1997; Singh et al., 2013) Moreover, in a recent study, the presence of VREs was reported in wastewater effluents from a hospital facility in Alice, Eastern Cape Province, South Africa (Iweriebor et al., 2015). These findings highlight the poor or inefficient water-treatment system of the facility’s effluents before discharge into the environment. Antibiotics do not undergo total biodegradation in wastewater management processes; waste water from the hospital was, therefore, regarded as a reservoir of resistant pathogens and an ideal environment for exchange of resistance genes or transfer to non- resistant isolates (Ergani-Ozcan et al., 2008; Isogai et al., 2013; Moges et al., 2014). These findings show that waste water at the Victoria hospital was a significant source of VREs in the

105 wastewater treatment plant of Fort Hare. While screening VREs from cow dung and environmental water sources in three selected dairy farms in the Amathole District, it was observed that waste water from the Victoria hospital could have a huge impact on the microbiological quality of water bodies in the neighbouring environment (Ngu, 2016).

3.3.3 Vancomycin-resistant enterococci in farming and agricultural practices

The Eastern Cape Province and part of the North West Province are mostly agrarian areas with countless numbers of piggery, poultry and cattle farms. Antimicrobials are used for the enhancement of productivity in South Africa (Moyane, et al., 2013; Iweriebor et al., 2015).

The shedding of resistant bacteria in the environment, through faecal contamination, is a concern. VREs with vanB and vanC1/C2/C3 resistance genes were screened in pig dung in the

Eastern Cape, South Africa (Iweriebor et al., 2015). Antibiotic resistance genes were spread in the environment through excretion, flushing of out-of-date prescriptions, medical waste, leakage of septic tanks, effluents from waste water treatment plants and agricultural waste discharges (Iweriebor et al., 2015). The subtherapeutic doses of antimicrobials added in animal feed for prophylactic purposes and growth-promoting effects were the major causes of the resistance observed in the isolates (Jackson et al., 2005; Aarestrup et al., 2000). In fact, growth promoters have been associated worldwide with the rise of resistant bacteria, leading to the banning of most growth promoters (Butaye et al., 2003; Marshall and Levy, 2011; Rosvoll et al., 2012; Moyane et al., 2013).

3.4 Pathways of antimicrobial resistance transmission

Antimicrobial agents are not fully transformed into inactive compounds in the systems of treated animals and are excreted in manure where they revert to their initial state after some time (Boxall et al., 2002). This makes manure a hotspot for isolates carrying mobile genetic resistance elements and when mixed with soil for agricultural purposes, antibiotic resistance

106 genes are likely to be vertically and horizontally transferred to soil bacteria. This transference leads to the pollution of soil through antibiotic resistance genes and aids in the uptake of antimicrobial resistance by commensal bacteria and human pathogens such as enterococci

(Ding et al., 2014; Forsberg et al., 2014; Thanner et al., 2014). Moreover, treated waste water is known to harbour antibiotic resistance genes, which can be transferred to vegetables and crops through irrigation water (Drissner and Zurcher, 2014) (Figure 3.2).

Figure 3.2: Transmission pathway of antimicrobial resistance within agriculture, the environment and the food-processing industry

There are several ways through which resistant bacteria could spread to humans. This could be either through food or from farm animals (Figure 2). The most plausible ones are through the food chain; direct or indirect contact with persons working in close proximity with animals such as farmers and animal healthcare professionals; and environmental components contaminated by agricultural waste or manure (Marshall and Levy, 2011; Ding et al., 2014;

Forsberg et al., 2014; Thanner et al., 2014; Drissner and Zurcher, 2014; Soonthornchaikul and

107

Garelick, 2009; Petersen et al., 2002; Shah et al., 2012). The environment plays a key role as a potential reservoir of resistance genes whereby genetic determinants are exchanged among isolates that are taken up by humans and animals (Iweriebor et al., 2015; Rossi et al., 2014).

Also, prolonged stay in a hospital setting can lead to patients acquiring VREs (Iweriebor et al.,

2015).

Minimally processed food items, and raw and fermented food items constitute a potential risk through considerable numbers of viable cells; these food items could interact with other factors, such as cohabitation with pathogens, leading to the appearance of resistant strains of enterococci in the human gastrointestinal tract. The in-vitro transfer of Erythromycin resistance genes from lactic acid bacteria to Listeria monocytogenes has been demonstrated (Toomey et al., 2009; Doucet-Populaire et al., 1991; Rizzotti et al., 2009). Moreover, numerous reports have highlighted the transfer of resistance genes among isolates of the same species in the human gut (Economou and Gousia, 2015).

3.5 Current status of the management of antimicrobial resistance in South

Africa

Although there have been reports of the occurrence of antimicrobial-resistant genes in livestock and food items in South Africa, the quantities of antimicrobials used are not yet monitored.

Despite being banned a long time ago, some antimicrobial agents are still used in animal rearing

(Table 3.1). Providing data on the consumption of antimicrobials is vital in the assessment and/or management of antimicrobial resistance, however, pharmaceutical companies keep secret their data on the amount of antimicrobials sold in the South African market, not to mention the numerous varieties that are available to farmers over the counter.

Table 3.1: Antimicrobials used in South Africa as growth promoters (Moyane et al., 2013)

108

Banned Antibiotic Related Mechanism of

Antibiotic

since group therapeutics action

Inhibition of cell Bambermycin Glycolipid wall synthesis Inhibition of cell Bacitracin 1999 Cyclic peptide Bacitracin wall synthesis Disintegration of Monensin Ionophore cell membrane Disintegration of Salinomycin Ionophore cell membrane Quinupristin/ Inhibition of protein Virginiamycin 1999 Streptogramin dalfopristin synthesis Erythromycin Inhibition of protein Tylosin 1999 Macrolide and others synthesis Erythromycin Inhibition of protein Spiramycin 1999 Macrolide and others synthesis Vancomycin/ Inhibition of cell Avoparcin 1997 Glycopeptide teicoplanin wall synthesis Inhibition of protein Avilamycin Orthosomycin Everninomycin synthesis Vancomycin/ Inhibition of cell Ardacin 1997 Glycopeptide teicoplanin wall synthesis

South Africa is part of the Global Resistance Partnership (GARP) launched in February 2010.

The intention of this Partnership is to address and analyse antimicrobial resistance issues in

South Africa and partnering countries. Moreover, the South African National Veterinary

Surveillance and Monitoring Programme for Resistance to Antimicrobial Drugs (SANVAD) was created alongside the South African Antibiotic Stewardship Programme (SAASP). Reports produced by these entities are still yet to be transcribed into fully operational policies and action plans. However, South Africa remains the most active African country as far as antimicrobial resistance surveillance is concerned. In this regard, the Global Action Plan on antimicrobial resistance initiated in partnership with the World Health Organisation emphasises optimisation, coupled with the strengthening of the knowledge and evidence-base through surveillance and

109 research on antimicrobial usage in humans and animals. However, there is still paucity of consumption data worldwide, including in South Africa (Perumal-Pillay and Suleman, 2017).

Reports of the situational analysis of antibiotic use and resistance carried out in 2011 by stakeholders and the GARP in South Africa, through the Centre for Disease Dynamics

Economics and Policy (CDDEP) project revealed many setbacks in antimicrobial stewardship programmes such as the unavailability of data from intercontinental marketing services, causing a bias in the real picture of antimicrobial consumption in South Africa.

3.5.1 Regulation of antimicrobial usage in humans

Prescriptions in the public sector are guided by the Standard Treatment Guidelines based on the inclusion and availability of medicines on the Essential Medicines List (Perumal-Pillay and

Suleman, 2017). Prescriptions are unrestricted in the private sector with prescribers selecting whatever antimicrobials they feel are most appropriate. Provision is made through the Nursing

Act 33 of 2005, Section 56(6) and makes provision for nurses to also prescribe to patients, especially in public HIV and TB healthcare centres. Act No. 53 of 1974 allows pharmacists to diagnose and prescribe antibiotics to patients if they suffer from common illnesses.45 A comparison of public and private sector data from the past 3 years (from Intercontinental

Marketing Services) reveals an increase in the consumption of certain antibiotics (Table 3.2).

This increase was a result of inappropriate use of antibiotics as first-line medicines and lack of awareness of appropriate prescription of antibiotics or simply a willingness to use new drug formulations based on their availability on the market or based on the emergence of resistance to previous antibiotics.

3.5.2 Regulation of antimicrobial usage in animals

The Department of Agriculture, Forestry and Fisheries and the National Department of Health regulate the use of antibiotics by administering the Fertilizers, Farm Feeds, Agricultural

Remedies and Stock Remedies Act (Act 36 of 1947) and the Medicines and Related Substances

110

Control Act (Act 101 of 1965), respectively. The Stock Remedies Act 36 of 1947 was initiated to control the numerous parasites infesting livestock in South Africa at the time. With time, certain antimicrobials, such as growth promoters, were allowed in order to help farmers in rural areas to access essential livestock medicines. The Medicines and Related Substances Control

Act 101 of 1965 was initiated for prescription-only medicines and veterinary antibiotics are also controlled by this Act.

111

Table 3.2: Antibiotics sold in the private and public sectors from 2014 to 2016 (Schellack et al., 2017)

% Market share MAT unitsa (2014) MAT unitsa (2015) MAT unitsa (2016) CAGRb (2014–2016) (2016) Antibiotic class Private Public Private Public Private Public Private Public Private Public Tetracycline + combinations 307 170 226 993 000 296 428 114 988 400 282 220 168 296 842 -3% 21% 1% 9% Chloramphenicol + combinations 1124 121 983 109 1014 93 -3% -8% 0% 0% Broad-spectrum Penicillin oral 8 249 655 530 513 290 8 607 223 54 045 080 7 826 870 385 061 012 -2% 167% 35% 20% Broad-spectrum Penicillin injectable 520 470 49 241 030 533 780 34 687 670 572 498 54 987 307 3% 26% 3% 3%

Cephalosporin oral 1 951 706 12 221 600 1 854 653 1 455 300 1 705 486 7 300 010 -4% 124% 8% 0% Cephalosporin injectable 2 053 062 16 097 300 2 036 180 10 565 000 2 015 283 76 629 057 -1% 169% 9% 4% Trimethoprim combinations 1 466 062 966 535 1 491 648 783 509 493 1 437 019 700 365 086 -1% -5% 6% 37% Macrolides and similar types 2 822 661 185 162 200 2 935 812 8 019 700 2 874 181 16 427 840 1% 43% 13% 1% Oral fluoroquinolone 3 618 738 11 995 000 3 576 474 23 465 600 3 378 464 33 679 945 -2% 20% 15% 2% Injectable Fluoroquinolone 641 067 58 481 659 363 144 100 560 007 2 158 000 -4% 287% 3% 0% Aminoglycosides 79 908 6578 500 87 101 6 975 300 89 754 6 295 783 4% -5% 0% 0% Penems and carbapenems 1 141 501 1 991 900 1 276 979 460 000 1 093 413 809 878 -1% 33% 5% 0% Glycopeptides 179 134 257 500 182 071 285 700 190 314 651 093 2% 51% 1% 0% Medium-/narrow-spectrum penicillins 280 172 626 304 600 292 893 515 183 440 145 960 424 833 433 -20% -9% 1% 22% All other antibacterials 21 378 2 530 000 25 991 5 899 33 037 28 704 650 16% 6876% 0% 2% Grand total 23 333 808 1 670 911 057 23 857 579 1 553 790 791 22 205 520 1 906 200 029 -2% 11% 100% 100% aMAT, moving annual total, i.e. the total value of the sales figures for the product, over the course of the period displayed bCAGR, compound annual growth rate; this indicator was used as a measure of the market growth over multiple time periods for the two sectors

112

3.6 Measures to reduce the incidence and prevalence of Vancomycin-resistant enterococci

3.6.1 Step 1: Enforcement of the legislation on drug distribution and usage

The dual registration process of medicines through the Agricultural Remedies and Stock

Remedies Act (Act 36 of 1947) and the Medicines and Related Substances Control Act (Act

101 of 1965) presents some flaws and has raised concerns about the exacerbation of the emergence of antimicrobial resistance if there is no effective control. Stock remedies are distributed to veterinary wholesalers, distributors, farmers’ cooperatives and feed mix companies by the manufacturer. Consequently, stock remedies are freely available and no record is kept of their use. Moreover, the South African situation deviates from the 1998 World

Health Organisation best practice guidelines in that: (1) the dual system of regulating veterinary products only partially addresses clear, transparent manufacturing requirements (whereas antibiotics listed under Act 101 of 1965 must be authorised with a Good Manufacturing

Practice licence, stock remedies under Act 36 of 1947 are not); and (2) most authorised veterinary antibiotics are over the counter stock remedies and often administered by farmers.

The World Health Organisation recommends that only trained and licensed professionals decide when and how to use antibiotics.

3.6.2 Step 2: Prioritisation of the use of alternatives to antibiotics

Although vaccination campaigns are often costly, they could reduce the amounts of antimicrobials used in farming (Allen et al., 2014; Callaway et al., 2008). Moreover, the use of probiotics, prebiotics and synbiotics in animal farming should be encouraged as these will improve the gut bacterial flora thus, reducing occurrence of diseases that could necessitate antimicrobial usage (Callaway et al., 2008; Gaggia et al., 2010). It has been shown that healthier gut microbial flora contribute to a better immune system with a better nutrient uptake

113 and less colonisation by pathogens (Seal et al., 2013). Studies have demonstrated the usage of predatory bacteria to counter the pathogenic effects of the same strains or other pathogens after oral administration in chickens, cows and rabbits (Atterbury et al., 2011; Dwidar et al., 2011).

Moreover, specific yeast strains with specific properties could be used as probiotics (Biliouris et al., 2012; Kenny et al., 2011). Due to their specificity and selectivity towards bacterial strains, bacteriophages represent another potential alternative to antimicrobial management of illnesses in animal farming even though they can be used in combination with some antimicrobials as there is no negative interaction between the two treatments (Kenny et al.,

2011; Chan et al., 2013; Goodridge and Bisha, 2011; Balogh et al., 2010). In addition, there is a tremendous amount of research on the potential use of antimicrobial peptides such as bacteriocins as an alternative to antibiotics (Allen et al., 2014; Snyder and Worobo, 2014).

Stakeholders and pharmaceutical companies in South Africa should, therefore, harness substantial research funding in these novel areas as they represent a huge potential for the future.

3.6.3 Step 3: Implementation of a nationwide effective antimicrobial resistance surveillance system

Large databases on antimicrobial resistance could be created and used for risk analyses and management in the different sectors of activity as well as in the different ecological niches that play a role in the dissemination and spread of resistant enterococci. Such surveillance systems have already been put in place within the European Union and in the USA to trace and control the patterns of antimicrobial distribution and the dissemination of antimicrobial-resistant bacteria. The database is playing a significant impact in the decision-making spheres in order to tackle antimicrobial resistance issues within the EU. This particular measure would be efficient if scientists and researchers were at the centre of the process and if international collaboration was encouraged because of the global aspect of antimicrobial resistance issues.

114

In this regard, 70 experts from 33 countries gathered in 2011 at the Third World Healthcare

Associated Infections Forum (WHAIF) dedicated to antibiotic resistance awareness and action

(Jarlier et al., 2012). Actions agreed upon at this Forum are summarised in Table 3.3.

Last but not the least, the adoption of healthy lifestyles and the development of new drugs and vaccines should be encouraged, as these constitute new perspectives as far as the therapeutic management of VRE infections is concerned.

Table 3.3: Actions prioritised at the Third World Healthcare Associated Infections Forum with regard to antimicrobial resistance (Jarlier et al., 2012)

Stakeholder Action to priotise

 In animals, analogues to human medicines should not be utilised

Policymakers and health and antibiotics should be utilised only as therapeutics with certain authorities categories of antimicrobials used solely for human therapy;

 Growth promoters in animal feed should be banned worldwide;

 Commercialisation of antimicrobials used as human medicines

should be regulated and over-the-counter trading should be

prohibited in all countries; and

 International organisations (World Health Organisation,

European Union) should come up with a charter of conduct to

which all countries worldwide will abide, as far as the availability

of antibiotics is concerned.

Human and veterinary  Implement surveillance strategies of antimicrobial usage and healthcare communities monitoring systems of emergence and spread of bacterial

resistance; and

 Promote specific courses in medical and veterinary schools for

training on antimicrobial resistance mechanisms and wise usage

115

of antibiotics, taking into consideration the cultural background

of each country.

General public  Sensitise the general public to the importance of antibiotic

protection and wise usage of antimicrobials, that is, only when it

is necessary;

 Improvement of sanitation systems and teaching of basic hygiene

practices such as hand washing in order to reduce the spread of

illnesses and resistant isolates in the environment; and

 Promote the participation of consumers in the conception and

application of strategies developed.

Industrial companies  Design reliable and rapid diagnostic tests that could be utilised by

a patient or doctor to guide the prescription of antibiotics and

avoid their prescription for viral infections;

 Promote research and development of new Antimicrobials; and

 Determine new economic paradigms that take into consideration

public health interests alongside industrial quests for profits.

3.7 Conclusion

Antimicrobials have been used in human and veterinary medicine ever since they were discovered. The intensive usage of antimicrobials in South Africa, with their negative impact on food safety and human health, has led to the emergence and the spread of VREs and other antimicrobial resistant bacteria. In fact, epidemiological studies have demonstrated the link between antimicrobial usage and the detection of resistant isolates in the environment, making therapeutic alternatives for the treatment of infections caused by such organisms limited and

116 their subsequent antimicrobial resistance genes available in the environment. Since VREs are becoming a serious health threat in South Africa and worldwide, there is an urgent need to address this issue. Although the use of alternatives to antibiotics will effectively slow down the emergence process of resistant bacteria such as VREs, a synergistic approach involving the revision and the enforcement of laws and regulations on drug usage and distribution in South

Africa, the encouragement of the invention of novel therapeutic molecules and the implementation of a critical nationwide antimicrobial resistance surveillance system will have significant impacts on the reduction of the prevalence or incidence of VREs as well as other antimicrobial-resistant bacteria. Considering the fact that awareness among the scientific community and major stakeholders is increasing in South Africa, combined international action is required to tackle this issue once and for all.

Limitations of the study

A limitation of this review was the lack of animal antimicrobial consumption data due to the unavailability or scarcity of data from wholesale suppliers and the Department of Agriculture,

Forestry and Fisheries in South Africa.

Acknowledgements

We acknowledge the financial support of the North-West University towards the realisation of this study.

Contribution of authors

F.E.T.F. carried out the study and wrote the manuscript; A.K. and C.N.A. supervised the study and proofread the manuscript.

117

REFERENCES

Aarestrup, F.M., Kruse, H., Tast, E., Hammerum, A.M. and Jensen, L.B. (2000). Associations

between the use of antimicrobial agents for growth promotion and the occurrence

of resistance among Enterococcus faeciumfrom broilers and pigs in Denmark,

Finland, and Norway. Microb. Drug. Resist. 6, 63 – 70.

Al-Kharousi, Z.S., Guizani, N., Al-Sadi, A.M., Al-Bulushi, I.M. and Shaharoona, B. (2016).

Hiding in fresh fruits and vegetables: Opportunistic pathogens may cross

geographical barriers. Int. J. Microbiol. 2016 (4292417), 14.

Allen, H.K., Trachsel, J., Looft, T. and Casey, T.A. (2014). Finding alternatives to antibiotics.

Ann NY Acad Sci. 1323 (1), 91 – 100.

Arthur, M., Reynolds, P. and Courvalin, P. (1996). Glycopeptide resistance in enterococci.

Trends Microbiol. 4, 401 – 407.

Ateba, C.N., Lekoma, K.P. and Kawadza, D.T. (2013). Detection of vanA and vanB genes in

vancomycin-resistant enterococci (VRE) from groundwater using multiplex PCR

analysis. J. Water Health. 11 (4), 684 – 691.

Ateba, C.N. and Maribeng, M.D. (2011). Detection of Enterococcus species in groundwater

from some rural communities in the Mmabatho area, South Africa: A risk analysis.

Afr. J. Microbiol. Res. 5 (23), 3930 – 3935.

Ateba, C.N. and Mohapi, M.I. (2013). Isolation of vancomycin resistant enterococci isolated

from leafy vegetables (lettuce) from North West Province. Life Sci. 10 (4), 1163 –

1170.

Atterbury, R.J., Hobley, L. and Till, R. (2011). Effects of orally administered Bdellovibrio

bacteriovorus on the well-being and Salmonella colonization of young chicks.

Appl. Environ. Microbiol. 77 (16), 5794 – 5803.

118

Balogh, B., Jones, J.B., Iriarte, F.B. and Momol, M.T. (2010). Phage therapy for plant disease

control. Curr. Pharm. Biotechnol. 11 (1), 48 – 57.

Biliouris, K., Babson, D., Schmidt-Dannert, C. and Kaznessis, Y.N. (2012). Stochastic

simulations of a synthetic bacteria-yeast ecosystem. BMC Syst. Biol. 6(1), 13

pages.

Boxall, A.B., Blackwell, P., Cavallo, R., Kay, P. and Tolls, J. (2002). The sorption and

transport of a sulphonamide antibiotic in soil systems. Toxicol. Lett. 131, 19 – 28.

Budavari, S.M., Saunders, G.L., Liebowitz, L.D., Khoosal, M. and Crewe-Brown, H.H. (1997).

Emergence of vancomycin resistant enterococci in South Africa. S. Afr. Med. J. 87

(11), 1557 - 1573.

Bugg, T.D., Wright, G.D., Dutka-Malen, S., Arthur, M., Courvalin, P. and Walsh, C.T. (1991).

Molecular basis for vancomycin resistance in Enterococcus faecium BM4147:

Biosynthesis of a depsipeptide peptidoglycan precursor by vancomycin resistance

proteins VanH and VanA. Biochemistry. 30, 10408 – 10415.

Butaye, P., Devriese, L.A. and Haesebrouck, F. (2003). Antimicrobial growth promoters used

in animal feed: Effects of less well-known antibiotics on gram-positive bacteria.

Clin. Microbiol. Rev. 16 (2), 175 – 188.

Callaway, T.R., Edrington, T.S. and Anderson, R.C. (2008). Probiotics, prebiotics and

competitive exclusion for prophylaxis against bacterial disease. Anim. Health Res.

Rev. 9 (2), 217 – 225.

Chan, B.K., Abedon, S.T. and Loc-Carrillo, C. (2013). Phage cocktails and the future of phage

therapy. Future Microbiol. 8 (6), 769 – 783.

Ding, G.C., Radl, V., Schloter-Hai, B., Jechalke, S., Heuer, H., Smalla, K. et al. (2014).

Dynamics of soil bacterial communities in response to repeated application of

manure containing sulfadiazine. PLoS One. 9 (3), e92958, 10 pages.

119

Doucet-Populaire, F., Trieu-Cuot, P., Dosbaa, I., Andremont, A. and Courvalin, P. (1991).

Inducible transfer of conjugative transposon Tn1545 from Enterococcus faecalis

to Listeria monocytogenes in the digestive tracts of gnotobiotic mice. Antimicrob.

Agents Chemother. 35 (1), 185 – 187.

Drissner, D. and Zürcher, U. (2014). Microbial safety of fresh fruits and vegetables. In:

Motarjemi Y, editor. Encyclopedia of food safety. Vol 3. Oxford: Elsevier.

Dwidar, M., Monnappa, A.K. and Mitchell, R.J. (2012). The dual probiotic and antibiotic

nature of Bdellovibrio bacteriovorus. BMB Rep. 45 (2), 71 – 78.

Economou, V. and Gousia, P. (2015). Agriculture and food animals as a source of

antimicrobial-resistant bacteria. Infect. Drug Resist. 8, 49 – 61.

Ergani-Ozcan, A., Naas, T., Baysan, B.O., Ogunc, D., Inan, D., Colak, D., et al. (2008).

Nosocomial outbreak of vancomycin-resistant Enterococcus faecium in a

paediatric unit at a Turkish university hospital. J. Antimicrob. Chemother. 61 (5),

1033 – 1039.

Forsberg, K.J., Patel, S., Gibson, M.K., Lauber, C.L., Knight, R., Fierer, N. et al. (2014).

Bacterial phylogeny structures soil resistomes across habitats. Nature. 509, 612 –

616.

Gaggìa, F., Mattarelli, P. and Biavati, B. (2010). Probiotics and prebiotics in animal feeding

for safe food production. Int. J. Food Microbiol. 141 (1), 15 – 28.

Goodridge, L.D. and Bisha, B. (2011). Phage-based biocontrol strategies to reduce foodborne

pathogens in foods. Bacteriophage. 1 (3), 130 – 137.

Hughes, D. (2003). Exploiting genomics, genetics and chemistry to combat antibiotic

resistance. Nat. Rev. Genet. 4, 432 – 441.

Isogai, N., Urushibara, N., Kawaguchiya, M., Ghosh, S., Suzaki, K., Watanabe, N., et al.

(2013). Characterization of Enterococcus faecium with macrolide resistance and

120

reduced susceptibility to quinupristin/dalfopristin in a Japanese hospital: Detection

of extensive diversity in erm(B)-regulator regions. Microb. Drug Resist. 19, 298 –

307.

Iweriebor, B.C., Gaqavu, S., Obi, C.L., Nwodo, U.U. and Okoh, A.I. (2015). Antibiotic

susceptibilities of Enterococcus species isolated from hospital and domestic

wastewater effluents in Alice, Eastern Cape Province of South Africa. Int. J.

Environ. Res. Publ. Health. 12, 4231 – 4236.

Iweriebor, B.C., Obi, C.L. and Okoh, A.I. (2015). Virulence and antimicrobial resistance

factors of Enterococcus spp. isolated from faecal samples from piggery farms in

Eastern Cape, South Africa. BMC Microbiol. 15 (136), 11 pages.

Jackson, C.R., Fedorka-Cray, P.J., Barrett, J.B. and Ladely, S.R. (2005). High-level

aminoglycoside resistant enterococci isolated from swine. Epidemiol. Infect. 133,

367 – 371.

Jarlier, V., Carlet, J. and McGowan, J. (2012). Participants of the 3rd World

HealthcareAssociated Infections Forum. Priority actions to fight antibiotic

resistance: Results of an international meeting. Antimicrob. Resist. Infect. Control.

1 (1), 17 – 20.

Jui-Chang, T., Po-Ren, H., Hsiao-Mann, L., Hui-Jen, C., Shen-Wu, H. and Lee-Jene, T. (2005).

Identification of clinically relevant Enterococcus species by direct sequencing of

groES and spacer region. J. Clin. Microbiol. 43, 235 – 241.

Kenny, M., Smidt, H., Mengheri, E. and Miller, B. (2011). Probiotics: do they have a role in

the pig industry? Animal. 5 (3), 462 – 470.

Kuzucu, C., Cizmeci, Z., Durmaz, R., Durmaz, E. and Ozerol, I.H. (2005). The prevalence of

faecal colonization of enterococci, the resistance of the isolates to ampicillin,

121

vancomycin and high-level aminoglycosides and the clonal relationship among

isolates. Microb. Drug Resist. 11 (2), 159 – 164.

Lochan, H., Moodley, C., Bamford, C., Hendricks, M., Davidson, A. and Eley, B. (2016).

Emergence of vancomycin-resistant Enterococcus at a tertiary paediatric hospital

in South Africa. S. Afr. Med. J. 106 (6), 562 – 566.

Mahabeer, Y., Lowman, W., Govind, C.N., Swe-Swe-Han, K. and Mlisana, K.P. (2016). First

outbreak of vancomycin-resistant Enterococcus in a haematology unit in Durban,

South Africa. S. Afr. J. Infect. Dis. 31 (1), 20 – 24.

Marshall, B.M. and Levy, S.B. (2011). Food animals and antimicrobials: Impacts on human

health. Clin. Microbiol. Rev. 24 (4), 718 – 733.

Matlou, P.D. (2016). Molecular analysis of vancomycin-resistant enterococci isolated from

ground and surface water [MSc thesis]. Mafikeng, North-West University.

Moges, F., Endris, M., Belyhun, Y. and Worku, W. (2014). Isolation and characterization of

multiple drug resistance bacterial pathogens from waste water in hospital and non-

hospital environments, North-West Ethiopia. BMC Res. Notes. 7, 1 – 6.

Molale, L.G. (2016). Characterization of enterococci isolates from water sources in the North

West Province [PhD thesis]. Potchefstroom, North-West University.

Moyane, J.N., Jideani, A.I.O. and Aiyegoro, O.A. (2013). Antibiotic usage in food producing

animals in South Africa and impact on human: antibiotic resistance. Afr. J.

Microbiol. Res. 7 (24), 2990 – 2997.

Ngu, T.G. (2016). Genotypic and phenotypic characterization of enterococci from cow dung

and environmental water sources in three selected dairy farms in Amathole District

[MSc thesis]. Alice, University of Fort Hare.

122

Perumal-Pillay, V. and Suleman, F. (2017). Selection of essential medicines for South Africa:

an analysis of in-depth interviews with national essential medicines list committee

members. BMC Health Serv. Res. 17 (17), 17 pages.

Petersen, A., Andersen, J.S., Kaewmack, T., Somsiri, T. and Dalsgaard, A. (2002). Impact of

integrated fish farming on antimicrobial resistance in a pond environment. Appl.

Environ. Microbiol. 68 (12), 6036 – 6042.

Rizzotti, L., La Gioia, F., Dellaglio, F. and Torriani, S. (2009). Molecular diversity and

transferability of the tetracycline resistance gene tet(M), carried on Tn916-1545

family transposons, in enterococci from a total food chain. Antimicrob. Agents

Chemother. 96 (1), 43 – 52.

Rossi, F., Rizzoti, L., Felis, G.E. and Torriani, S. (2014). Horizontal gene transfer among

microorganisms in food: Current knowledge and future perspectives. Food

Microbiol. 42, 232 – 243.

Rosvoll, T.C.S., Pedersen, T., Sletvold, H., Johnsen, P.J., Sollid, J.E., Simonsen, G.S. et al.

(2010). PCR-based plasmid typing in Enterococcus faecium strains reveals widely

distributed pRE25-, pRUM-, pIP501- and pHTβ-related replicons associatewith

glycopeptide resistance and stabilizing toxin-antitoxin systems. FEMS Immunol.

Med. Microbiol. 58, 254 – 268.

Ruimy, R., Brisabois, A. and Bernede, C. (2010). Organic and conventional fruits and

vegetables contain equivalent counts of Gram-negative bacteria expressing

resistance to antibacterial agents. Environ. Microbiol. 12 (3), 608 – 615.

Schellack, N., Deon, B., Brink, A., Duse, A., Faure, K., Goff, D. et al. (2017). A situational

analysis of current antimicrobial governance, regulation, and utilization in South

Africa. Int. J. Infect. Dis. 64, 100 – 106.

123

Seal, B.S., Lillehoj, H.S., Donovan, D.M. and Gay, C.G. (2013). Alternatives to antibiotics: A

symposium on the challenges and solutions for animal production. Anim. Health

Res. Rev. 14 (1), 78 – 87.

Shah, S.Q.A., Colquhoun, D.J., Nikuli, H.L. and Sørum, H. (2012). Prevalence of antibiotic

resistance genes in the bacterial flora of integrated fish farming environments of

Pakistan and Tanzania. Environ. Sci. Technol. 46 (16), 8672 – 8679.

Singh, J., Esparza, S., Patterson, M., Vogel, K., Patel, B. and Gornick, W. (2013). Vancomycin-

resistant Enteroococcus in paediatric oncology patients: Balancing infection

prevention and family centered care. J. Pediatr. Hematol. Oncol. 35 (3), 227 – 231.

Snyder, A.B. and Worobo, R.W. (2014). Chemical and genetic characterization of bacteriocins:

Antimicrobial peptides for food safety. J. Sci. Food Agric. 94 (1), 28 – 44.

Sónia, R., Ingrid, C., Nuno, S., Michel, H., Hugo, S., José-Luis, C.M. et al. (2015). Effect of

vancomycin on the proteome of the multiresistant Enterococcus faecium SU18

strain. J. Proteom. 113, 378 – 387.

Soonthornchaikul, N. and Garelick, H. (2009). Antimicrobial resistance of Campylobacter

species isolated from edible bivalve molluscs purchased from Bangkok markets,

Thailand. Foodborne Pathog. Dis. 6 (8), 947 – 951.

Taucer-Kapteijin, M., Hoogenboezem, W., Heiliegers, L., Danny de Bolster, H. and Medema,

G. (2016). Screening municipal wastewater effluent and surface water used for

drinking water production for the presence of ampicillin and vancomycin resistant

enterococci. Int. J. Hyg. Environ. Health. 16, 1 – 7.

Thanner, S., Drissner, D. and Walsh, F. (2016). Antimicrobial resistance in agriculture. MBio.

7(2), e02227-15, 7 pages.

Toomey, N., Monaghan, A., Fanning, S. and Bolton, D.J. (2009). Assessment of antimicrobial

resistance transfer between lactic acid bacteria and potential foodborne pathogens

124 using in vitro methods and mating in a food matrix. Foodborne Pathog. Dis. 6 (8),

925 – 933.

125

CHAPTER 4

Detection of virulence genes in multidrug resistant

Enterococci isolated from feedlots dairy and beef cattle:

Implications for human health and food safety

BioMed Research International, Vol 2019, Article ID 5921840, 13 Pages

https://doi.org/10.1155/2019/5921840

126

Chapter 4

Detection of virulence genes in multidrug resistant Enterococci isolated

from feedlots dairy and beef cattle: Implications for human health and

food safety

This chapter has been published in "BioMed Research International, 2019, Article ID

5921840, 13 Pages. https://doi.org/10.1155/2019/5921840 with contributions from following

authors: Tatsing Foka F.E., and Ateba C.N.

Abstract

The misuse/abuse of antibiotics in intensive animal rearing and communities lead to the emergence of resistant isolates such as Vancomycin-resistant enterococci (VREs) worldwide.

This has become a major cause for concern for the public health sector. The aim of this study was to report the antibiotic resistance profiles and highlight the presence of virulence genes in

VREs isolated from feedlots cattle in the North-West Province, South Africa. 384 faecal samples, 24 drinking troughs water and 24 soil samples were collected aseptically from 6 registered feedlots. Biochemical and molecular methods were used to identify and categorise enterococci isolates. Their antibiotic resistance profiles were assessed and genotypic methods used to determine their antibiotic resistance and their virulence profiles. 527 presumptive isolates were recovered. Out of this number, 289 isolates were confirmed as Enterococcus sp.

Specifically, E. faecalis (9%), E. faecium (10%), E. durans (69%), E. gallinarum (6%), E. casseliflavus (2%), E. mundtii (2%) and E. avium (2%) were screened after molecular assays.

VanA (62%), vanB (17%) and vanC (21%) resistance genes were detected in 176 Enterococcus sp, respectively. Moreover, tetK (26), tetL (57), msrA/B (111) and mefA (9) efflux pump genes were detected in 138 VRE isolates. Multiple antibiotic resistance was confirmed in all the VRE

127 isolates of this study, the most common antibiotic resistance phenotype was TETR-AMPR-

AMXR-VANR-PENR-LINR-ERYR. CylA, hyl, esp, gelE and asa1 virulence genes were detected in 86 VREs, with the exception of Vancomycin-resistant E. mundtii isolates that did not display any virulence factor. Most VRE isolates had more than one virulence genes, however, the most encountered virulence profile was gelE-hyl. Potentially pathogenic multidrug resistant VREs were detected in this study; this highlights the the fact that the impact of extensive usage of antimicrobials in intensive animal rearing and its implications on public health cannot be undermined.

Keywords: Vancomycin resistance, multidrug resistance, virulence factors, enterococci.

4.1 Introduction

Known as one of the main causes of nosocomial infections, enterococci are ubiquitous, gram positive, catalase negative and facultative anaerobes that thrive as part of the normal microbiota in the gastro intestinal tract of humans and warm-blooded animals (Domig et al., 2003). Used sometimes as probiotics, they may, therefore, be found in fermented food items; but are very common in the soil, in surface water, on plants and vegetables (Domig et al., 2003; Mannu et al., 2003). Enterococci are opportunistic pathogens that cause diseases in immunocompromised patients as well as those who are admitted in intensive care units for long periods or those who have severe underlying sicknesses (Morrison et al., 1999). In fact, enterococci can induce bacteraemia, endocarditis, urinary tract infections, sepsis, burn wounds and deep tissue infections in such patients (Sharifi et al., 2013). They can also cause intramammary infection and clinical mastitis in dairy cattle (Myllys and Rautala, 1995).

The emergence of multidrug-resistant strains such as Vancomycin-resistant enterococci (VRE), due to the extensive use and misuse of antibiotics in intensive animal rearing and in clinical settings for the treatment of community-acquired infections, has become a major cause for

128 concern worldwide; this is largely due to limited therapeutic options for the treatment of illnesses caused by such strains (Simner et al., 2015) and the ability of such strains to transfer genetic resistance determinants to other commensals of the gastrointestinal tract or to other bacterial strains in the environment (Noble et al., 1992). VRE emerged because of the usage of Avoparcin (a glycopeptide analogue of vancomycin) as a growth promoter in animal husbandry (Bager et al., 1999). Consequently, it was banned worldwide due to the possible transmission of VRE from farm animals to humans. Growth promoters are believed to ameliorate feed conversion, animal growth and reduce mortality and morbidity rates, resulting from clinical and subclinical illnesses; although the mechanism through which this is achieved is still poorly understood (Marshall and Levy, 2011). VREs were isolated for the first time in the late 1980s (Leclercq et al., 1988). Since then, there have been several reports of VRE detection worldwide. In fact, VREs have been detected in food animals, retail meat, vegetables, drinking water, underground and surface water as well as among hospitalised and non- hospitalised people (Seo et al., 2005; Tansuphasiri et al., 2006; Molale and Bezuidenhout,

2016; Matlou et al., 2019; Nateghian et al., 2016; Ateba and Mohapi, 2013). The continuous isolation of VREs worldwide suggests that Avoparcin may not be the absolute cause of the spread and dissemination of VRE in animals and the environment, probably because coselection of resistance genes located on the same mobile genetic elements do occur due to the use of other antibiotics in animal rearing (Seo et al., 2005; Tansuphasiri et al., 2006; Molale and Bezuidenhout, 2016; Matlou et al., 2019; Nateghian et al., 2016; Ateba and Mohapi, 2013).

Resistance to Vancomycin is either intrinsic or acquired through the possession of eight types of Vancomycin resistance genes (vanA, vanB, vanC, vanD, vanE, vanG, vanL, vanM and vanN)

(Noble et al., 1992).

Two groups of Tetracycline resistance genes have been reported so far. The first group comprises tetM, tetO and tetS resistance genes, which confer resistance through ribosomal

129 protection while the second group encompasses msrA/B, mefA, tetK and tetL genes, which confer resistance through efflux pump mechanisms. Although a tetU resistance gene has been reported to trigger low level resistance, the mechanism through which this is achieved is still unknown (Wilcks et al., 2005).

The outstanding ability of enterococci to cause illnesses is due to the possession of virulence factors such as gelE, esp, cylR1, cylR2, cylLl, cylLs, cylM, cylB, cylA, cylI, hyl and asa1

(Upadhyaya et al., 2009). Virulence factors are yet to be characterised extensively and seem to differ among enterococcal species. So far, it has been demonstrated that the enterococcal surface protein esp promotes the colonisation of host cells while hyl and gelE genes promote the production of toxic substances, which have a destructive effect on the host’s tissues. Cyl genes promote the production of cytolysin, a protein that enables pathogenic enterococci to escape the host immune system by destroying macrophages and neutrophils. Moreover, asa1 mediates the production of aggregation substances (Upadhyaya et al., 2009).

Antimicrobials are routinely used in animal husbandry, however, there are few surveys on the contribution of intensive cattle rearing in the dissemination of multidrug resistant VREs into the different ecological niches. The use of antimicrobials in intensive animal rearing has been identified as one of the main cause of the emergence of multidrug resistant strains (O’Brien,

2002). The ability of enterococci to acquire antibiotic resistance through diverse mechanisms

(plasmids and transposons, chromosomal exchange or mutation) is quite challenging as far as therapeutic options are concerned (Simner et al., 2015). Thus, a constant genotypic monitoring of the different resistant enterococcal isolates is vital for food industry and public health institutions as well as environment protection agencies.

This study is part of a larger project, which assesses the contribution of cattle feedlots in the dissemination and spread of VREs in the environment. The aims of the study were to: screen and characterise VRE isolates from dairy and beef cattle feedlots; and identify characteristics

130 of public health importance to which humans could be exposed (directly or indirectly) such as their antibiotic resistance and their virulence profiles.

4.2 Materials and methods

Ethical clearance was requested obtained from the ethics committee of the North-West

University before collection of samples.

4.2.1 Collection of samples and study area

Samples were collected from six registered commercial feedlots located in the North West

Province, South Africa. The samples were collected depending on the availability of cows in the kraals and permission from owners of the feedlots. Faecal samples from dairy and beef cattle were collected aseptically through rectal palpation, with sterile armed-length gloves, preserved in Cary-Blair medium and transported on ice to the laboratory for processing with aseptically collected samples of water from the drinking troughs and soil samples from the kraals (Table 4.1).

Table 4. 1: Types of samples used in this study

District Sampling Faecal samples Water samples Soil samples area from drinking from Kraals throughs Bojanala Platinum Zwartfontein 147 4 4 District Ngaka Modiri Mafikeng 61 4 4 Molema District Zeerust 46 4 4 Rooigron 52 4 4 Koster 38 4 4 Dr Kenneth Kaunda Potchefstroom 40 4 4 Total 6 384 24 24

131

4.2.2 Isolation of VRE from the samples

Faecal samples were 10-fold serially diluted with buffered peptone water. Inoculation of the diluted faecal slurries was made onto bile-esculin azide agar (Biolab, South Africa) supplemented with 6μg/ml Vancomycin (Sigma-Aldrich, Johannesburg, South Africa). An aliquot of 100 ml from each water sample was filtered through a 0.45 μm (47mm grid) sterile filter membrane (PALL Life Sciences, Mexico) on a vacuum water pump machine (Model,

Sartorius 16824); the membrane filters were placed with sterile forceps onto bile-esculin azide agar (BEA) (Biolab, South Africa) supplemented with Vancomycin (6 µg/ml) to select for

VRE. The soil samples were put in buffered peptone water and submitted to a cell disruptor

(model N° SI-D257, Scientific Industries Inc. USA). The supernatant was 10-fold serially diluted and inoculated onto bile-esculin azide agar (BEA) (Biolab, South Africa) supplemented with Vancomycin (6 µg/ml). After 24-48h incubation at 37°C, brown to black colonies from the plates were isolated and tested for catalase and Gram staining. Gram positive and catalase negative isolates were streaked in order to harvest pure colonies that were kept as stock culture at -80°C into Luria-Bertani broth supplemented with 50% glycerol after 24hrs incubation, for further characterisation.

4.2.3 Genomic Enterococcus DNA isolation and identification

Pure colonies were revived onto nutrient agar, cultured overnight at 37°C in 20ml brain heart infusion broth (BHI, Merck, South Africa) and harvested through centrifugation. Genomic

DNA was extracted with a DNA extraction kit (Zymo Research Genomic DNATM–Tissue

MiniPrep Kit, ZR Corp. Irvine, USA) according to the manufacturer’s instructions. The genomic DNA was quantified using a NanoDrop TM 1000 spectrophotometer (Thermo Fischer

Scientific, USA). 16S rRNA (Table 4.2) was amplified using oligonucleotide primer combinations and cycling conditions as shown in Table 4.2 and a DNA thermal cycler (C1000

Touch™, BIO-RAD, California, USA). All the primers used in this study were sequenced by

132

Inquaba Biotech (Pretoria, South Africa). PCR reactions were performed in 25 μl standard volumes that comprised 12.5μl of 1X Master mix, 0.25 μl of each 1μM primer, 2μl template

DNA (20 – 30 ng/μl) and 10 μl nuclease free water. Sequence data was analysed using Geospiza

Finch TV (version 1.4). All amplified DNA sequences were prurified with a Zymo DNA

Sequencing Clean-up Kit (Zymo Research Corp. Irvine, USA). The amplicons were sequenced by Inquaba Biotec (Pretoria, South Africa) and the raw sequence data transfered on Geospiza

Finch TV (version 1.4) to view the chromatograms. The sequences were identified using

BLAST search on NCBİ webtools (http://www.ncbi.nlm.nih.gov/BLAST). Representative bacterial 16S rRNA sequences were submitted to the Genbank database under accession numbers MK086096- MK086108.

4.2.4 Species-specific PCR assay for the identification of Enterococcus sp.

The identities of the different isolates were determined using previously dercribed multiplex

PCR assays designed to amplify ddl gene specific to Enterococcus faecalis and Enterococcus faecium and species-specific superoxide dismutase (sodA) genes to Enterococcus durans,

Enterococcus gallinarum, Enterococcus hirae, Enterococcus casseliflavus, Enterococcus mundtii and Enterococcus avium (Depardieu et al., 2004; Bauer et al., 1966). Amplifications were performed using a DNA thermal cycler and volumes as described in the previous paragraph. Primers sequences and their cycling conditions are presented in Table 4.2. E. faecalis strain ATCC 29212 was used as the positive control strain while Staphylococcus aureus ATCC 43322 was used as the negative control.

4.2.5 PCR detection of Vancomycin resistance, Tetracycline efflux pump and virulence genes

The presence of Vancomycin resistance determinants (vanA, vanB, vanC) in the enterococcal strains was assessed using a multiplex PCR analysis with specific primers and PCR conditions previously described by Depardieu et al. (2004). The final 20μl volume contained 1μl genomic

133

DNA sample, 12.5μl DreamTaq PCR Master Mix, 0.5μl of each 1μM primer and 6μl nuclease- free water. E. faecium BM4147 (vanA), E. faecalis NCTC 13379 (vanB) and E. gallinarum

BM4174 (vanC) were used as positive control strains while Staphylococcus aureus ATCC

43322 was used as the negative control.

Resistance to Tetracycline was assessed through the amplification of Tetracycline resistance genes, precisely msrA/B, mefA, tetK, tetM and tetL genes as described in previous studies

(Molale and Bezuidenhout, 2016; Wilcks et al., 2005). The final 25μl volumes contained 1μl genomic DNA sample, 12.5μl DreamTaq PCR Master Mix, 0.5μl of each 1μM primer and

10,5μl nuclease-free water.

Virulence determinants of VRE isolates were determined through the amplification of the asa1, cylA, esp, gelE and hyl gene sequences using chromosomal DNA extracted from the isolates

(Molale and Bezuidenhout, 2016). Final volumes of 25μl contained 70ng/μl of genomic DNA,

0.2μM of primers asa1 and gelE each and 0.4μM of primers cylA, esp and hyl each. The sequences of the primers and cycling conditions presented in Table 4.2.

4.2.6 Gel electrophoresis of the amplicons

Amplicons were separated by electrophoresis on a 1.5% (w/v) agarose gel (containing

0.001μg/ml ethidium bromide) using 1 X TAE (40 mM Tris (pH 7.6), 20 mM acetic acid and

1 mM EDTA) at 80V for 15 minutes and later on at 60V for 4 hours. A ChemiDoc Imaging

System (BIO-RAD ChemiDocTM MP Imaging System, Hercules, California, USA) was used to capture the image using Gene Snap (version 6.00.22) software. Each gel contained a 100 bp or 1 kb molecular weight marker (BioLab, New England).

4.2.7 Antimicrobial susceptibility test

VRE isolates were tested against nine antibiotics (Mast Diagnostics, UK) using the Kirby-

Bauer disc diffusion method (1966). This assay was performed on Mueller Hinton agar (Merck,

South Africa) using Tetracycline (TET 30 μg), Ampicillin (AMP 10 μg), Amoxicillin (AMX

134

10 μg), Vancomycin (VAN 30 μg), Chloramphenicol (CHL 30 μg), Penicillin (PEN 10 μg),

Linezolid (LIN 30 μg), Ciprofloxacin (CIP 5μg) and Erythromycin (ERY 15μg).

Staphylococcus aureus ATCC 43322 was used as control strain and the zones of inhibition determined using the Clinical and Laboratory Standards Institute (CLSI) guide (2017). The isolates were grouped as resistant or multidrug resistant based on the occurrence of resistance to one or more antimicrobials. MIC test was also carried out on the VRE isolates using

Vancomycin and Linezolid MIC strips (Liofilchem s.r.l, Via Scozia, Italy) in accordance with the manufacturer’s protocol and the results recorded.

4.2.8 Data analysis

RStudio package (version 3.5) and Statistica 13 (StatSoft, TIBCO software Inc. USA) were used to organise, analyse and compute the data derived from the study. Proportions were used to describe the observations of different characteristics for which the isolates were screened.

135

Table 4.2: Oligonucleotide primers used in this study

Genes Target/ Sequences (5’-3’) Size PCR conditions Reference primer (bp)

16S rRNA gene 16S rRNA F: TGCATTAGCTAGTTGGTG Denaturation 95°C for 4 min, 30 cycles at 95°C 30s, 58°C 60s, 72°C 60s and 72°C 10 min Vankerckhoven

356 et al., 2004 R: TTAAGAAACCGCCTGCGC

Species specific genes E. faecalis F: CACCTGAAGAAACAGGC 475 Denaturation 95°C for 4 min, 30 cycles at 95°C for 30 s, 55°C 60s, 72°C 60s and 72°C for R: ATGGCTACTTCAATTTCACG 7 min. Kariyama et E. faecium F: GAGTAAATCACTGAACGA 1091 al., 2000

R: CGCTGATGGTATCGATTCAT

E. durans F: 295 TTATGTCCCWGTWTTGAAAAATCAA R: TGAATCATATTGGTATGCAGTCCG

E. gallinarum F: GGTATCAAGGAAACCTC 173

R: CTTCCGCCATCATAGCT

E. hirae F: CTTTCTGATATGGATGCTGTC 187

R: TAAATTCTTCCTTAAATGTTG

E. mundtii F: CAGACATGGATGCTATTCCATCT 98 Denaturation 95°C for 4 min, 30 cycles at 95°C for 30 s, 60°C 60s, 72°C 60s and 72°C for 7 min R: GCCATGATTTTCCAGAAGAAT Jackson et al., 2004 E. casseliflavus F: TCCTGAATTAGGTGAAAAAAC 288 Denaturation 95°C for 4 min, 30 cycles at 95°C for 30 s, 55°C 60s, 72°C 60s and 72°C for 7 min R: GCTAGTTTACCGTCTTTAACG

E. avium F: GCTGCGATTGAAAAATATCCG 368 Denaturation 95°C for 4 min, 30 cycles at 95°C for 30 s, 55°C 60s, 72°C 60s and 72°C for 7 min. R: AAGCCAATGATCGGTGTTTTT

136

Table 4.2: Oligonucleotide primers used in this study (continued)

Genes Target/ Sequences (5’-3’) Size PCR conditions Reference primer (bp)

Vancomycin resistance vanA F: GGGAAAACGACAATTGC 732 Denaturation 94 °C 3min, 30 cycles at 94 °C 60 s, 54 °C 60 s, 72 °C 60 s, 72 °C 10min Kariyama et genes al., 2000 R: GTACAATGCGGCCGTTA

vanB F: ACGGAATGGGAAGCCGA 647

R: TGCACCCGATTTCGTTC

vanC1/2 F: ATGGATTGGTAYTKGTAT 815/827

R: TAGCGGGAGTGMCYMGTAA

Tetracycline resistance msrA/B F: GCAAATGGTGTAGGTAAGACAACT 400 Denaturation 95 °C 180 s, 35 cycles at 93 °C 30 s, 55 °C 120 s, 72 °C 90 s Molale and genes Bezuidenhout, R: ATCATGTGATGTAAACAAAAT 2016

mefA F: AGTATCATTAATCACTAGTGC 348

R: TTCTTCTGGTACTAAAAGTGG

tetL F: ATAAATTGTTTCGGGTCGGTAT 1107

R: AACCAGCCAACTAATGACAATGAT

tetK F: TATTTTGGCTTTGTATTCTTTCAT 1159 Denaturation 95 °C 60s, 35 cycles at 50 °C 60 s, 72 °C 30 s, 72 °C at 300 s

R: GCTATACCTGTTCCCTCTGATAA

tetM F: 700 Denaturation 95°C for 60s, followed by 40 cycles of 95°C for 15s, 60 °C for 60s Wilcks et al., GCAGAATATACCATTCACATCGAAGT and 72°C for 60s 2005 R: AAACCAATGGAAGCCCAGAA

137

Table 4.2: Oligonucleotide primers used in this study (continued)

Genes Target/ Sequences (5’-3’) Size PCR conditions Reference primer (bp)

Virulence genes asa1 F: GCACGCTATTACGAACTATGA 375 Denaturation 95 °C 3min, 30 cycles at 95 °C 30s, 56 °C 30s, 72 °C 60s, 72 °C 10min Molale and Bezuidenhout, R: TAAGAAAGAACATCACCACGA 2016

gelE F: TATGACAATGCTTTTTGGGAT 213

R: AGATGCACCCGAAATAATATA

cylA F: ACTCGGGGATTGATAGGC 688

R: GCTGCTAAAGCTGCGCTT

esp F: AGATTTCATCTTTGATTCTTGG 510

R: AATTGATTCTTTAGCATCTGG

hyl F: ACAGAAGAGCTGCAGGAAATG 278

R: GACTGACGTCCAAGTTTCCAA

138

4.3. Results

4.3.1 Species distribution and occurence of Vamcomycin-resitant enterococci in feedlots and feedlots cattle

384 faecal samples, 24 drinking troughs water and 24 soil samples were collected from feedlots and feedlots cattle herds, making a total of 432 samples (Table 4.1). On the basis of biochemical and agar plate assays, 527 presumptive isolates were recovered. Out of this number, 289 isolates were confirmed as Enterococcus sp. after molecular assays (Table 4.3).

Table 4. 3: Distribution of enterococcal species per sampling site

Isolates species Sites Total

Mafikeng Koster Potchefstroom Roigron Zeerust Zwartfontein E. faecalis 4 6 7 4 2 3 26 E. faecium 3 13 4 5 4 1 30 E. durans 27 18 13 10 5 126 199

E. gallinarum 4 4 2 3 3 2 18 E. casseliflavus 0 2 0 2 0 1 5 E. mundtii 0 0 0 3 3 0 6 E. avium 1 0 1 2 1 0 5 E. hirae 0 0 0 0 0 0 0

Total identified isolates 39 43 27 29 18 133 289 Total unidentified 30 23 25 65 36 59 238

Total nber isolates 69 66 52 94 54 192 527

Based on the species-specific PCR assays, presumptive enterococcal isolates were identified as E. faecalis (9%), E. faecium (10%), E. durans (69%), E. gallinarum (6%), E. casseliflavus

(2%), E. mundtii (2%) and E. avium (2%); while no E. hirae was isolated in this survey. 176 confirmed enterococcal isolates possessed Vancomycin resistance genes. Precisely, vanA, vanB and vanC resistance genes were detected in 110, 31 and 38 isolates respectively (Figure

4.1). Out of this number, 12, 6 and 5 isolates were screened from soil while 8, 2 and 1 isolates

139 were screened from drinking troughs water samples respectively. Moreover, more than one

Vancomycin resistance gene was detected in some isolates.

90 84 80 70 60 50 vanA 40 vanB 30

Number of isolates of Number vanC 17 18 20 10 12 7 7 8 10 6 5 5 5 2 1 1 0 0 2 0 0 1 0 E. faecium E. faecalis E. durans E. gallinarum E. E. mundtii E. avium casseliflavus Enterococcal species Figure 4.1: Trend of Vancomycin resistance genes in enterococcal isolates from the feedlots

Moreover, vanA and vanB genes were mostly detected in E. durans isolates and absent in E. mundtii and E. avium isolates, which possessed only vanC resistance gene (Figure 4.1).

Representative amplicons of the VREs are displayed in Figure 4.2.

140

138 (78%) VRE isolates possessed Tetracycline resistance genes. Precisely, 26 (15%), 57

(32%), 111 (63%) and 9 (5%) VRE isolates possessed tetK, tetL, msrA/B and mefA Tetracycline efflux pump genes respectively; while no tetM gene was detected among the VRE isolates

(Figure 4.3).

Figure 4. 2: Multiplex PCR positive isolates. Lane M = Marker 100-1000bp; Lane 1 = Positive

control; Lane 2 = Negative control; Lane 3 = E. faecalis and 16SrRNA; Lane 4 = vanC positive

E. faecium; Lane 5 = vanC positive E. avium; Lane 6 = vanB positive E. durans; Lane 7 =

vanC positive E. mundtii; Lane 8 = vanB positive E. casseliflavus; Lane 9 = vanC positive E.

faecalis; Lane 10 = vanB positive E. gallinarum; Lane 11 = vanA positive E. faecalis

141

120

100

40 Number of VREof Number 20

0 tet M tetL tetK msrA/B mefA Tetracycline resistant genes

Figure 4.3: Distribution of Tetracycline-resistant genes

56 (31%) VREs possessed more than one Tetracycline resistance gene and the most encountered Tetracycline resistance gene pattern encountered was tetL-msrA/B. Figure 5 shows amplicons of Tetracycline resistance genes after gel electrophoresis of VRE isolates.

Figure 4.4: Tetracycline resistant isolates. Lane M = 100 - 1000 bp marker; Lane 1 to 5 = mefA positive VREs; Lane 6 to 9 = msrA/B positive VREs; Lane 10 to 13 = tetL positive

VREs; Lane 14 to 17 = tetK positive VREs

4.3.2 Antibiotic resistance profile of VRE isolates

Only Vancomycin resistant enterococci were subjected to antimicrobial susceptibility assay and mulidrug resistance was highly observed among the isolates tested (Figure 4.5). Almost all

142 the isolates were resitant to Vancomycin (98%) and Linezolid (98%) compared to

Ciprofloxacin, which was effective on all the isolates (0% resistance). High resistance was also observed for Penicillin (94%) and Erythromycin (82%) while low resistance was observed with

Chloremphenicol (13%). 64%, 47% and 40% of the isolates were resistant to Tetracycline,

Amoxicillin and Ampicillin respectively (Figure 4.5). The predominant multidrug resistance patterns observed among the isolates are presented in Table 4.4.

82% 64% 0% TET 30µg AMP 10µg 40% AMX 10µg VAN 30µg 47% 98% CHL 30µg PEN 10µg LIN 30µg CIP 5µg 98% ERY 15µg 94%

13%

Figure 4.5: Proportions of antibiotic resistant VRE isolates

Table 4.4: Predominant multidrug resistance patterns observed among the isolates

Number of isolates Mulidrug resistance pattern Sites (*number of isolates) 10 VANR-PENR-LINR-ERYR Zwartfontein (7), Mafikeng (2), Roigron (1)

21 TETR-AMPR-AMXR-VANR-PENR-LINR-ERYR Zwartfontein (5), Potchefstroom (8), Koster (2), Zeerust (4), Roigron (2) 13 TETR-AMPR-AMXR-VANR-CHLR-PENR-LINR- Zwartfontein(4), Mafikeng (2), Roigron (1), Potchefstroom (2), Koster (1), Zeerust (3) ERYR

18 AMPR-AMXR-VANR-PENR-LINR-ERYR Zwartfontein (9), Zeerust (2), Roigron (4), Koster (3), 17 TETR-AMPR-VANR-PENR-LINR-ERYR Zwartfontein (1), Mafikeng (4), Koster (5), Zeerust (3), Potchefstroom (4), Roigron (1) 14 TETR-VANR-PENR-LINR-ERYR Zwatfontein (2), Mafikeng (6), Koster (6)

143

Key: VAN=vancomycin; TET=tetracyclin; AMP=ampicillin; AMX=amoxicillin; ERY=erythromycin; LIN=linezolid; CHL=chloremphenicol; PEN=penicillin.

Results for the MIC test ranged from 192 to 256 μg/ml for Vancomycin and Linezolid, indicating a high resistance of VRE isolates to these two antimicrobials.

4.3.3 Virulence profiles of VRE isolates

Out of 176 VREs isolated, 86 (49%) VREs were found to possess virulence genes (Table 5).

Some isolates exhibited multiple virulence genes, however, the most encountered virulence pattern was gelE-hyl (30 isolates) and this profile was mostly detected in Vancomycin-resistant

(VR) E. durans isolates. Moreover, virulence genes were detected in 8(9%) VR E. faecalis,

8(9%) VR E. faecium, 57 (67%) VR E. durans, 9 (11%) VR E. gallinarum, 3 VR (3%) E. casseliflavus and 1 (1%) VR E. avium (Table 4.5). However, no virulence gene was detected in Vancomycin-resistant E. mundtii isolates. The only Vancomycin-resistant E. avium isolated in this survey possessed only gelE virulence gene (Table 4.5). Figure 4.6 shows amplicons of virulence genes after gel electrophoresis of virulent VRE isolates. All VREs isolated from trough drinking water and soil samples possessed virulence genes.

Figure 4.6: Enterococcal strains with virulence genes. Lane M = 100 – 1000 bp Marker; Lane

1 to 4 = asa1 positive VREs; Lane 5 to 8 = gelE positive VREs; Lane 9 to 12 = cylA positive

144

VREs; Lane 13 to 16 = esp positive VREs; Lane 17 to 19 = hyl positive VREs

145

Table 4.5: Virulence gene patterns in VRE isolates from the different sampling sites

Species Virulence factors Number of positive isolates Sites (*number of isolates) E. faecalis gelE 4 Mafikeng (1), Potchefstroom (2), Zwartfontein (1) hyl 1 Roigron (1) cylA-hyl 1 Roigron (1) gelE-hyl 2 Zeerust (1), Roigron (1) E. faecium asa1 1 Roigron (1) hyl 1 Potchefstroom (1) gelE 1 Zwartfontein (1) gelE-cylA 1 Koster (1) gelE-hyl 3 Koster (2), Zwartfontein (1) asa1-gelE-esp-hyl 1 Mafikeng (1) E. durans asa1 2 Zwartfontein (2) cylA 1 Koster (1) gelE 8 Mafikeng (2), Potchefstroom (2), Zwartfontein (3), Roigron (1) hyl 2 Zwartfontein (2) asa1-gelE 4 Mafikeng (2), Zwartfontein (1), Roigron (1) gelE-hyl 21 Koster (1), Zeerust (1), Zwartfontein (19) asa1-hyl 5 Mafikeng (1), Zwartfontein (4) cylA-esp 1 Zwartfontein (1) esp-hyl 1 Zwartfontein (1) gelE-cylA 2 Koster (2) asa1-esp-hyl 2 Zwartfontein (2) asa1-gelE-hyl 6 Zwartfontein (6) gelE-esp-hyl 1 Koster (1) asa1-gelE-esp-cylA 1 Mafikeng (1) E. gallinarum hyl 2 Zwartfontein (1), Zeerust (1) asa1-gelE 1 Mafikeng (1) gelE-hyl 4 Koster (1), Roigron (3) asa1-cylA-hyl 1 Zwartfontein (1) gelE-esp-hyl 1 Mafikeng (1) E. casseliflavus asa1 1 Zwartfontein (1) gelE 2 Roigron (2) E. mundtii None 0 ---- E. avium gelE 1 Zeerust 86

146

4.3.4 Data analysis

72 VREs out of the 176 VREs isolated were clustered based on their inhibition zone diameters

(Figure 4.7). The generated dendrogram was analysed and the results are presented in Table 4.6.

Two major clusters were generated (clusters 1 and 2), cluster 1 had two sub-clusters (1A and 1B) while cluster 2 had only one isolate. Sub-cluster 1A was the largest cluster with 69 isolates while sub-cluster 1B had only 2 isolates. The only isolate in cluster 2 was of faecal origin while the isolates in cluster 1 originated from faecal, soil and water samples.

Table 4.6: Cluster distribution of isolates

Sampling site Sample Cluster 1A Cluster 1B Cluster 2 type N = 69 N = 2 N = 1 Faecal 28 (40%) 0 (0%) 0 (0%) Zwartfontein Soil 2 (3%) 0 (0%) 0 (0%) Water 1 (1%) 0 (0%) 0 (0%) Faecal 8 (12%) 1 (50%) 0 (0%) Mafikeng Soil 0 (0%) 0 (0%) 0 (0%) Water 1 (1%) 0 (0%) 0 (0%) Faecal 2 (3%) 0 (0%) 0 (0%) Zeerust Soil 0 (0%) 0 (0%) 0 (0%) water 2 (3%) 0 (0%) 0 (0%) Faecal 8 (12%) 0 (0%) 0 (0%) Roigron Soil 0 (0%) 1 (50%) 0 (0%) Water 2 (3%) 0 (0%) 0 (0%) Faecal 8 (12%) 0 (0%) 1 (100%) Koster Soil 0 (0%) 0 (0%) 0 (0%) Water 1 (1%) 0 (0%) 0 (0%) Faecal 3 (4%) 0 (0%) 0 (0%) Potchefstroom Soil 3 (4%) 0 (0%) 0 (0%) Water 0 (0%) 0 (0%) 0 (0%)

147

Figure 4.7: Dendogram depicting the relationship between 72 multidrug resistant VREs isolated

148 from the feedlots. Bacterial designations are based on sampling site and sample type.

4.4 Discussion

Enterococci colonise the gut of mammals (Morrison et al., 1999). Since they can thrive in any environment, they have been reported to be responsible for quite a number of life-threatening conditions (Sharifi et al., 2013; Arias and Murray, 2009). The ability to cause infections in their hosts is due to the possession of virulence factors and antibiotic resistance genes, which enable them to evade antimicrobial mechanisms of action (Larsen et al., 2010; Fisher and Phillips, 2009).

Genetic antimicrobial resistance attributes are either intrinsic or acquired and can be transmitted either among themselves or to other bacteria in the environment (Fisher and Phillips, 2009). As far as Vancomycin resistance is concerned, VanA, VanB and VanC phenotypes are mediated by vanA, vanB and vanC resistance gene clusters. VanA type of resistance is highly transferable to

Vancomycin and Teicoplanin while VanB phenotypes are susceptible to Teicoplanin. On the contrary, VanC resistance appears to be an intrinsic attribute of E. gallinarum and E. casseliflavus characterised by a low level of resistance to Vancomycin (Courvalin, 2005). VREs data from clinical settings or environmental sources are of utmost importance in epidemiological surveys for public health stakeholders, especially in countries where the prevalence of HIV-AIDS and diseases such as diabetes is high.

In this study, the prevalence of VREs in feedlots and feedlots cattle was reported as well as their virulence and antimicrobial susceptibility profiles. Out of 527 presumptive isolates, 289 (55%) bacteria were identified as enterococci namely; E. faecalis (26), E. faecium (30), E. durans (199),

E. gallinarum (18), E. casseliflavus (5), E. mundtii (6) and E. avium (5). Although studies have been conducted to assess the impact of intensive animal rearing in the spread of VREs in the environment, there are few reports of the contribution of feedlots with regard to the dissemination

149 of VREs. However, Bekele and Ashenafi (Bekele and Ashenafi, 2010) also screened E. faecalis,

E. faecium and E. durans from faecal samples obtained from cattle in Ethiopia. Faeces of animal origin are the primary source of these enterococcal isolates (Li et al., 2014) and this explains our findings. In fact, Tanhi (2016) also screened the same species in addition to E. hirae in cattle dung from farms in the Amathole district of South Africa. Our study differs with the above-mentioned reports in the sense that E. hirae was not detected in our samples while E. casseliflavus, E. gallinarum, E. mundtii and E. avium were screened. E. durans, E. casseliflavus and E. mundtii are environmental enterococci associated with plants and are very common in faecal samples of herbivores due to gut colonisation (Salminen et al., 2004). E. avium are associated with bird droppings (Salminen et al., 2004) and their presence in water samples from drinking troughs might be as a result of contamination by birds that drink from the same troughs. E. gallinarum are predominant in chicken faeces but their presence in faecal samples from cattle and pig has also been demonstrated (Salminen et al., 2004; Pruksakorn et al., 2016). Enterococci were present in soil samples obtained from feedlots due to contamination by cattle faeces (Salminen et al., 2004).

In fact, the soil from these feedlots was used as manure in neighbouring farms. E. durans was the most predominant enterococcal isolate screened in this survey, followed by E. faecium, E. gallinarum and E. faecalis.

The most-encountered Vancomycin resistance gene in this study was vanA (62%), followed by vanC (21%) and vanB (17%). The highest number of VREs was E. durans strains and they mostly possessed vanA resistance gene (84 VR E. durans). The VR E. mundtii and VR E. avium isolated possessed only vanC resistance gene while other Vancomycin resistant enterococci species isolated possessed vanA and vanB resistance genes in addition to vanC gene. Several studies worldwide have established a link between Vancomycin resistance and the usage of Avoparcin (a

150 glycopeptide analogue of Vancomycin) as a growth promoter in animal husbandry (Mannu et al.,

2003; Myllys and Rautala, 1995; Bager et al., 1999; Marshall and Levy, 2011; Aarestrup et al.,

2000; Foka et al., 2018). Although enterococci demonstrate intrinsic resistance to a large number of antibiotics (Penicillins, Cephalosporins, Monobactams...etc) (Iweriebor et al., 2015), the findings of this study is a cause for concern considering the fact that Avoparcin has been banned worldwide since 1997 (Foka et al., 2018). There is, therefore, a need to further investigate the possible relationship between antimicrobials used in these feedlots and the emergence of

Vancomycin resistance in the enterococcal isolates. Neither the owners of the feedlots nor their veterinaries disclosed data and information about the antimicrobials used in the investigated feedlots. Moreover, the unavailability or scarcity of data from wholesale suppliers and the

Department of Agriculture, Forestry and Fisheries in South Africa makes it difficult to establish a link between antimicrobial usage in the feedlots and observations made in this study. VREs were also detected in faecal samples of animal origin in other areas of South Africa (Tanih, 2016;

Iweriebor et al., 2015) as well as in other parts of the world (Bager et al., 1999; Marshall and Levy,

2011; Leclercq et al., 1988; Seo et al., 2005; Li et al., 2014; Pruksakorn et al., 2016; Garcia-

Migura et al., 2005; Peters et al., 2003; Ünal et al., 2017) and these studies are consistent with our findings.

Tetracycline efflux pump genes were also detected in 138 (78%) VRE isolates. msrA/B was the

Tetracycline resistance gene mostly detected among Tetracycline resistant VREs (63%), followed by the tetL gene (32%). tetK and mefA were detected only in 15% and 5% of tetracycline resistant

VREs. Some VREs possessed more than one Tetracycline resistance gene (31%) and the most encountered Tetracycline resistance gene pattern was tetL-msrA/B. Several studies have linked the detection of Tetracycline resistance genes in enterococci to the usage of Tetracyclines in intensive

151 animal rearing as growth promoters or therapeutic regiments (Wilcks et al., 2005). Multidrug resistance in VREs is well documented (Garcia-Migura et al., 2005). 98% of the VRE isolates screened in this study were resistant to Vancomycin and Linezolid, which were the drugs of choice for the treatment of enterococcal infections until the emergence of VREs worldwide. This finding is consistent with other reports worldwide (Mannu et al., 2003; Sharifi et al., 2013; Larsen et al.,

2010; Li et al., 2014; Tanih, 2016; Pruksakorn et al., 2016; Iweriebor et al., 2015; Garcia-Migura et al., 2005; Peters et al., 2003; Ünal et al., 2017) although the proportions recovered varied from one study to another due to the source of the samples and sample size. Moreover, majority of isolates in this study were also resistant to Penicillin and Erythromycin (94% and 82% respectively) while only 13% of the isolates were resistant to Chloramphenicol and no resistance to Ciprofloxacin was recorded. Non-negligible proportions of the isolates were also resistant to

Tetracycline (64%), Ampicillin (47%) and Amoxicillin (40%). Antimicrobial resistance has always been linked to antimicrobial usage (Marshall and Levy, 2011). Although we had no access to data on antimicrobial usage in the investigated feedlots, these multidrug resistant isolates might have emerged because of usage of antimicrobials either for prophylactic (added into animal feed) or therapeutic measures or furthermore, as a result of their use as growth promoters. In fact, analysis of the clusters generated with the inhibition zone diameters proves that the isolates in this study were exposed to the same antibiotics in the different feedlots. Resistance to Vancomycin is attributed to the possession of Vancomycin resistance genes (Leclercq et al., 1988). This explains the findings in the sense that antimicrobial susceptibility testing was carried out only on VRE isolates. Even though we reported a few resistant isolates to Chloramphenicol and no resistance to

Ciprofloxacin, several studies have revealed high enterococcal resistance to Ciprofloxacin and

Chloramphenicol in pig farms (Tanih, 2016; Pruksakorn et al., 2016; Aarestrup et al., 2000;

152

Iweriebor et al., 2015) and in poultry (Ünal et al., 2017). It was associated to the possession of resistance genes that resulted from the therapeutic and prophylactic usage of Advocin and

Chloramphenicol in animals. Furthermore, it was reported that resistance to Tetracycline,

Ampicillin, Amoxicillin, Penicillin and Erythromycin is associated to the possession of resistance genes to these antibiotics, due to the widespread use of Chlortetracycline, Amoxicillin, Penicillin and Erythromycin in intensive animal rearing either for disease control or as feed supplements or growth promoters (Pruksakorn et al., 2016; Moyane et al., 2013). Co-selection of resistance genes located on the same mobile genetic elements does occur as a result of the usage of different antibiotics in animal rearing (Seo et al., 2005; Tansuphasiri et al., 2006; Molale and Bezuidenhout,

2016; Matlou et al., 2019; Nateghian et al., 2016; Ateba and Mohapi, 2013). Moreover, manure and soil or water contaminated with animal excreta are hotspots of isolates carrying mobile genetic resistance elements, that can be transferred horizontally and vertically to animals/humans, commensals and pathogens, which will find their way through previously described mechanisms, into the environment and the food chain (Foka et al., 2018; Ding et al., 2014; Thanner et al., 2016).

Nevertheless, there is a need to further investigate the possession of other antibiotic resistance genes (such as ermB, strA, pbp5 and gyr) through VREs screened in this study in order to further understand their resistance patterns.

Out of the 176 VREs screened in this study, 86 (49%) possessed virulence genes namely; gelE, asa1, hyl, cylA and esp genes. The virulent isolates displayed a variety of virulence patterns (Table

5) but the gelE-hyl virulence pattern mostly occured (30 isolates) and was detected in most VR E. durans isolates. gelE and esp virulence genes were also detected in VRE isolates from previous studies (Tanih, 2016; Iweriebor et al., 2015; Medeiros et al., 2014) but no cylA, asa1 and hyl genes, compared to the findings obtained in this study. However, not all isolates that possess the gelE

153 gene express gelatinase or β-haemolysis activity (Upadhyaya et al., 2009; Lauková et al., 2014), which constitute important attributes in enterococcal pathogenesis. Nevertheless, this does not mean that virulent VREs isolated in this study are not pathogenic even though phenotypic virulence assays should be conducted to determine if all amplified virulence genes are expressed by the isolates. cylA is one of the genes that codes for the production of cytolysin, a protein which enables pathogenic enterococci to escape the host immune system by destroying macrophages and neutrophils (Upadhyaya et al., 2009). It was not detected in the VR E. casseliflavus, VR E. mundtii and VR E. avium isolates screened in this study, but was amplified in VR E. durans (5), VR E. faecalis (1), VR E. faecium (1) and VR E. gallinarum (1) isolates. Other studies have revealed the presence of cylA virulence gene in E. faecium and E. faecalis (Upadhyaya et al., 2009). The detection of virulence genes in these isolates is a cause for concern because of the health implications that could arise from their dissemination into different ecological niches.

4.5 Conclusion

Potentially pathogenic Vancomycin resistant enterococci were detected in samples from the 6 feedlots of the North West Province, South Africa. The results reported in this investigation shed more light on the impact of the extensive use of antimicrobials in intensive animal rearing, and its implications on public health. Antimicrobial resistance and virulence genes are genetic mobile elements that can be transmitted horizontally and vertically to commensals and pathogens of warm-blooded animals. Through well-understood mechanisms, this can lead to the spread of potentially pathogenic resistant strains into the environment and, consequently, into the food chain.

Reports of multidrug resistant clinical and environmental isolates from community patients is quite unsettling because of the challenge that finding an appropriate therapeutic regime in such cases represents, not only for medical practitioners but also for researchers. Life-threatening conditions

154 and diseases such as HIV-AIDS and diabetes motivate the urgent need to address issues on the extensive use of antimicrobials in intensive animal rearing and farming as its health implications cannot be overemphasised.

Limitations of the study

The researchers had no access to data on antimicrobials used in the investigated feedlots; unavailability or scarcity of data from wholesale suppliers and the Department of Agriculture,

Forestry and Fisheries of South Africa.

Conflict of interest

There is no conflict of interest to disclose.

Abbreviations

VREs: Vancomycin-resistant enterococci; VRE: Vancomycin-resistant Enterococcus; esp : enterococcal surface protein; hyl: hyaluronidase; cyl: cytolysin; gelE: gelatinase; HIV: Human

Immunodeficiency Virus; AIDS: Acquired Immunodeficiency Syndrome; PCR: polymerase chain reaction; DNA: deoxyribonucleic acid; rRNA: ribosomal ribonucleic acid.

Contribution of authors

Frank Eric Tatsing F. collected the samples, performed the experiments, analysed and interpreted the data, wrote the manuscript. Collins Njie Ateba supervised the experiments, proofread and approved the manuscript.

Data availability statement

155

Representative bacterial 16S rRNA sequences were submitted and are accessible at the Genbank database under accession numbers MK086096 - MK086108. Moreover, the data used to support the findings of this study are available from the corresponding author upon request.

Acknowledgements

The authors acknowledge the North-West University, Mafikeng Campus, South Africa, for the financial support received through the NWU postgraduate bursary.

REFERENCES

Aarestrup, F.M., Kruse, H., Tast, E., Hammerum, A.M. and Jensen, L.B. (2000). Associations

between the use of antimicrobial agents for growth promotion and the occurrence of

resistance among Enterococcus faeciumfrom broilers and pigs in Denmark, Finland,

and Norway. Microb. Drug Resist. 6 (1), 63 – 70.

Ateba, C.N. and Maribeng, M.D. (2011). Detection of Enterococcus species in groundwater from

some rural communities in the Mmabatho area, South Africa: a risk analysis. Afr. J.

Microbiol. Res. 5 (23), 3930 – 3935.

Ateba, C.N. and Mohapi, M.I. (2013). Isolation of vancomycin resistant enterococci isolated from

leafy vegetables (lettuce) from North West Province. Life Sci. 10 (4), 1163 – 1170.

Arias, C.A. and Murray, B.E. (2009). Enterococcus species, Streptococcus bovis group and

Leuconostoc species. In: Mandell GL, Bennett JE, Dolin R, editors. Mandell, Douglas

and Bennett’s principles and practice of infectious diseases. 7th ed. New York:

Churchill Livingstone, 2643 – 2653.

156

Bager, F., Madsen, M., Christensen, J. and Aarestrup, F.M. (1999). Avoparcin used as a growth

promoter is associated with the occurrence of vancomycin-resistant Enterococcus

faecium on Danish poultry and pig farms. Prev. Vet. Med. 31 (1-2), 95 – 112.

Bauer, A.W., Kirby, W.M.M., Sherris, J.C. and Turck, M. (1966). Antibiotic susceptibility testing

by a standardized single disk method. Am. J. Clin. Pathol. 45 (4), 493 – 496.

Bekele, B. and Ashenafi, M. (2010). Distribution of drug resistance among enterococci and

salmonella from poultry and cattle in Ethiopia. Trop. Anim. Health Prod. 42 (5), 857 –

864.

Courvalin, P. (2005). Genetics of glycopeptide resistance in gram-positive pathogens. Int. J. Med.

Microbiol. 294 (8), 479 – 486.

Depardieu, F., Perichon, B. and Courvalin, P. (2004). Detection of the van alphabet and

identification of enterococci and staphylococci at the species level by multiplex PCR. J.

Clin. Microbiol. 42 (12), 5857 – 5860.

Ding, G.C., Radl, V., Schloter-Hai, B., Jechalke, S., Heuer, H. and Smalla, K. (2014). Dynamics

of soil bacterial communities in response to repeated application of manure containing

sulfadiazine. PLoS One. 9 (3), 92958 – 92968.

Domig, K.J., Mayer, H.K. and Kneifel, W. (2003). Methods used for the isolation, enumeration,

characterisation and identification of Enterococcus spp. Media for isolation and

enumeration, Int. J. Food Microbiol. 88 (2-3), 147 – 164.

Fisher, K. and Phillips, C. (2009). The ecology, epidemiology and virulence of Enterococcus.

Microbiology. 155, 1749 – 1757.

Foka, F.E.T., Kumar, A. and Ateba, C.N. (2018). Emergence of vancomycin-resistant enterococci

in South Africa: Implications for public health. S. Afr. J. Sci. 114 (9-10), 20 – 26.

157

Garcia-Migura, L., Pleydell, E., Barnes, S., Davies, R.H. and Liebana, E. (2005). Characterization

of Vancomycin-Resistant Enterococcus faecium Isolates from Broiler Poultry and Pig

Farms in England and Wales. J. Clin. Microbiol. 43 (7), 3283 – 3289.

Iweriebor, B.C., Obi, L.C. and Okoh, A.I. (2015). Virulence and antimicrobial resistance factors

of Enterococcus spp. isolated from fecal samples from piggery farms in Eastern Cape,

South Africa. BMC Microbiol. 15 (136), 2015.

Jackson, C.R., Fedorka-Cray, P.J. and Barrett, J.B. (2004). Use of a genus and species-specific

multiplex PCR for identification of enterococci. J. Clin. Microbiol. 42 (8), 3558 – 3565.

Kariyama, R., Mitsuhata, R., Chow, J.W., Clewell, D.B. and Kumon, H. (2000). Simple and

reliable multiplex PCR assay for surveillance isolates of vancomycin-resistant

enterococci. J. Clin. Microbiol. 38 (8), 3092 – 3095.

Larsen, J., Schønheyder, H.C., Lester, C.H., Olsen, S.S., Porsbo, L.J. and Garcia-Migura, L.

(2010). Porcine-origin gentamicin-resistant Enterococcus faecalis in humans, Denmark.

Emerg. Infect. Dis. 16 (4), 682 – 710.

Lauková, A., Strompfová, V., Kandričáková, A., Ščerbová, J., Semedo-Lemsaddek, T., Miltko, R.

and Belzecki, G. (2014). Virulence factors genes in enterococci isolated from beavers

(Castor fiber). Folia Microbiol. 60 (2), 151 – 154.

Leclercq, R., Derlot, E., Duval, J. and Courvalin, P. (1988). Plasmid-mediated resistance to

vancomycin and teicoplanin in Enterococcus faecium. N. Engl. J. Med. 319, 157 – 161.

Li, P., Wu, D., Liu, K., Suolang, S., He, T., Liu, X., Wu, C., Wang, Y. and Lin, D. (2014).

Investigation of Antimicrobial Resistance in Escherichia coli and Enterococci Isolated

from Tibetan Pigs. PLoS One. 9 (4), 95623.

158

Mannu, L., Paba, A., Daga, E., Comunian, R., Zanetti, S., Dupre, I. and Sechi, L. (2003)

Comparison of the incidence of virulence determinants and antibiotic resistance between

Enterococcus faecium strains of dairy, animal and clinical origin. Int. J. Food Microbiol.

88 (2-3). 291 – 304.

Marshall, B.M. and Levy, S.B. (2011). Food animals and antimicrobials: impacts on human

health”, Clin. Microbiol. Rev. 24 (4), 718 – 733.

Medeiros, A.W., Pereira, R.I., Oliveira, D.V., Martins, P.D., d’Azevedo, P.A., Van der Sand, S.,

Frazzon, J. and Frazzon, P.G. (2014). Molecular detection of virulence factors among

food and clinical Enterococcus faecalis strains in South Brazil. Braz. J. Microbiol. 45

(1), 327 – 332.

Molale, I.G. and Bezuidenhout, C.C. (2016). Antibiotic resistance, efflux pump genes and

virulence determinants in Enterococcus spp. from surface water systems. Environ. Sci.

Pollut. Res. 23, 21501 – 21510.

Morrison, D., Woodford, N., Barrett, S.P., Sisson, P. and Cookson, B.D. (1999). DNA banding

pattern polymorphism in vancomycin-resistant Enterococcus faecium and criteria for

defining strains. J. Clin. Microbiol. 37(4), 1084 – 1091.

Moyane, J.N., Jideani, A.I.O. and Aiyegoro, O.A. (2013). Antibiotic usage in food producing

animals in South Africa and impact on human: antibiotic resistance. Afr. J. Microbiol.

Res. 7 (24), 2990 – 2997.

Myllys, V. and Rautala, H. (1995). Characterization of clinical mastitis in primiparous heifers. J.

Dairy Sci. 78 (3), 538 – 545.

159

Nateghian, A., Fallah, F., Daghighi, Z., Goudarzi, H., Hashemi, A. and Robinson, J.L. (2016).

Detection of virulence genes in resistant enterococci isolated from paediatric patients at

high risk for nosocomial infections. Diag. Microbiol. Infect. Dis. 85 (2), 260 – 262.

Noble, W.C., Virani, Z. and Cree, R.G. (1992). Co-transfer of vancomycin and other resistance

genes from Enterococcus faecalis NCTC 12201 to Staphylococcus aureus. FEMS

Microbiol. Lett. 72 (2), 195 – 198.

O’Brien, T.F. (2002). Emergence, spread and environmental effect of antimicrobial resistance:

how use of an antimicrobial anywhere can increase resistance to any antimicrobial

anywhere else. Clin. Infect. Dis. 34 (3), 78 – 84.

Peters, J., Mac, K., Wichmann-Schauer, H., Klein, G. and Ellerbroek, L. (2003). Species

distribution and antibiotic resistance patterns of enterococci isolated from food of

animal origin in Germany. Int. J. Food Microbiol. 88 (2-3), 311 – 314.

Pruksakorn, C., Pimarn, C., Boonsoongnern, A. and Narongsak, W. (2016). Detection and

phenotypic characterization of vancomycin-resistant enterococci in pigs in Thailand.

ANRS. 50 (3), 199 – 203.

Salminen, S., Wright, A.V. and Ouwehand, A. (2004). Lactic acid bacteria. Microbiological and

functional aspects. 3rd edition, New York, Mercel Dekker.

Seo, K.S., Lim, J.Y., Yoo, H.S., Bae W.K. and Park, Y.H. (2005). Comparison of vancomycin-

resistant enterococci isolates from human, poultry and pigs in Korea. Vet. Microbiol.

106 (3-4), 225 – 233.

Sharifi, Y., Hasani, A., Ghotaslou, R., Naghili, B., Aghazadeh, M. and Milani, M. (2013).

Virulence and antimicrobial resistance in enterococci isolated from urinary tract

infections. Adv. Pharm. Bull. 3 (1), 197 – 201.

160

Simner, P.J., Adam, H., Baxter, M., McCracken, M., Golding, G. and Karlowsky, J.A. (2015).

Epidemiology of vancomycin-resistant enterococci in Canadian hospitals (CANWARD

study, 2007 to 2013). Antimicrob. Agents Chemother. 59 (7), 4315 – 4317.

Tanih, G.N. (2016). Genotypic and Phenotypic characterization of enterococci from cow dung and

environmental water sources in three selected dairy farms in Amathole District, M.Sc.

thesis, University of Fort Hare.

Tansuphasiri, U., Khaminthakul, D. and Pandii, W. (2006). Antibiotic resistance of enterococci

isolated from frozen foods and environmental water. SE. Asian J. Trop. Med. 37 (1),

160 – 170.

Thanner, S., Drissner, D. and Walsh, F. (2016). Antimicrobial resistance in agriculture. Mbio. 7

(2), 02227 .

Ünal, N., Aşkar, S. and Yıldırım, M. (2017). Antibiotic resistance profile of Enterococcus faecium

and Enterococcus faecalis isolated from broiler cloacal samples. Turk. J. Vet. Anim. Sci.

41 (2), 199 – 203.

Upadhyaya, G.P.M., Ravikumar, K.L. and Umapathy, B.L. (2009). Review of virulence factors of

Enterococcus: An emerging nosocomial pathogen. Indian J. Med. Microbiol. 27(4), 301

– 305.

Vankerckhoven, V., Van Autgaerden, T., Vael, C., Lammens, C., Chapelle, S., Rossi, R., Jabes,

D. and Goossens, H. (2004). Development of a multiplex PCR for the detection of asa1,

gel, cylA, esp, and hyl genes in enterococci and survey for virulence determinants

among European hospital isolates of Enterococcus faecium. J. Clin. Microbiol. 42 (10),

4473 – 4479.

161

Wilcks, A., Andersen, S.R. and Licht, T.R. (2005). Characterization of transferable tetracycline

resistance genes in Enterococcus faecalis isolated from raw food”, FEMS Microbiol.

Lett. 243 (1), 15 – 19.

162

CHAPTER 5

Genomic analysis of Vancomycin-resistant enterococci from

a cattle feedlot: Impact of intensive cattle rearing on the

environment and its microbiomes

Under review at Antibiotics (MPDI)

163

Chapter 5

Complete genomic analysis of Vancomycin-resistant E. durans

strain NWUTAL1 and E. gallinarum strain S52016 from a cattle

feedlot: Impact of intensive cattle rearing on the environment and

its microbiomes

This chapter is under review ("Antibiotics” of MPDI) with contributions from Tatsing Foka F.E.

and Ateba C.N.

Abstract

Practices in intensive animal farming such as the extensive use of antimicrobials has significant impacts on the genetic make-up of bacterial communities (such as those that are commensals of humans and animals) and on a larger scale, on the environment. In this report, whole genome sequencing of two VRE isolates from a cattle feedlot in the North West Province, South Africa, was used to illustrate the effects of extensive antimicrobial usage on intensive animal husbandry, as well as on the environment and the genome of commensals in farmed animals. The genomic

DNA of Vancomycin-resistant E. durans strain NWUTAL1 and E. gallinarum strain S52016 was extracted from a pure culture grown on Bile Esculin Agar supplemented with Vancomycin (6

µg/ml), using a DNA extraction kit (Zymo Research, CA) as indicated in the manufacturer’s protocol. The DNA quality and quantity was determined using a NanoDrop Lite spectrophotometer

(ThermoFischer Scientific, CA). Whole-genome sequencing of the DNA was performed using next-generation sequencing (NGS) technology by Inqaba Biotechnical Industries (Pty) Ltd,

Pretoria, South Africa. The genomes of E. durans strain NWUTAL1 and E. gallinarum strain

164

S52016 consisted of 3,279,618 bp and 2,374,946 bp respectively with G+C contents of 40.76% and 43.13% respectively. Sixty-three RNAs were detected in strain NWUTAL1 compared to thirty-five RNAs in strain S52016. Moreover, NWUTAL1 genome presented 3,082 protein-coding sequences (CDS) while strain S52016 possessed 2,351 CDSs. Most importantly, antibiotic resistance genes that code for resistance against glycopeptides, macrolides, tetracyclines, aminoglycosides, peptides, β-lactams, and quaternary ammonium compounds were detected in the genomes of both strains. Plasmids and virulence factors such as those involved in biofilm formation, colonisation and copper/silver efflux system were also detected in the genome of both strains. The presence of these genetic determinants in the studied strains is a cause for concern as they may contribute to environmental pollution by disseminating and spreading into the environment and its ecological niches. Taking into consideration the multitude of possible transmission routes of antimicrobial resistance genes once they are in the environment, issues of this nature cannot be undermined and are of public health importance.

Keywords: Vancomycin-resistant enterococci, whole genome sequencing, environment, pollution

5.1 Background

The discovery of antibiotics was a significant hallmark in the evolution of mankind as they became important life-saving compounds both for animals and humans (Gonzalez-Zorn and Escudero,

2012). Antimicrobials have impacted significantly on society and the health of humans and animals mainly because life expectancy could be ameliorated as common infections have become curable, thus promoting rapid growth in the population (Gonzalez-Zorn and Escudero, 2012).

Unfortunately, as the therapeutic effects of antibiotics were discovered, their growth-promoting

165 attributes became apparent, resulting in the extensive use of these agents as growth promoters in intensive animal rearing (Acar et al., 2012; Economou and Gousia, 2015). It is believed that:

“subtherapeutic doses of certain antibiotics, used as growth promoters, improve feed conversion, animal growth and diminishes mortality and morbidity rates that arise from clinical and subclinical diseases” (Marshall and Levy, 2011). However, no research has established this fact yet (Marshall and Levy, 2011). Consequently, multidrug resistant isolates have emerged not only because of the abusive use of antibiotics/antimicrobials in communities and clinics, but mostly because of widespread use of antimicrobials in industrial animal farming; eventhough there are studies that highlight that resistant bacteria and resistance mechanisms were present long before antibiotics were produced or used (Acar et al., 2012; Boxall et al., 2002).

A significant consequence of the widespread use of antibiotics in industrial animal farming is the availability of genetic resistance determinants in the environment and its ecological niches (Ding et al., 2014). This also results from the fact that antibiotics are not totally degraded into inactive compounds in the body of treated animals and excreted with feces in manure where they regain their initial molecular structure after some time (Thanner et al., 2016). The manure becomes a hotspot for resistance determinants, which when mixed with soil, genetic material is transfered to other bacteria of the soil (Forsberg et al., 2014; Thanner et al., 2016). Moreover, as a result of agricultural lands runoffs, water bodies become contaminated with resistant strains that exchange genetic material with other commensals, which will find their way into the food chain (Economou and Gousia, 2015).

Enterococci are commensals of the gastrointestinal tract of warm-blooded animals. The possession of some virulence factors can confer to enterococci, the ability to cause illnesses both in animals and immunocompromised individuals. In fact, according to Tatsing and his colleagues (2019), they

166 can cause endocarditis, septicaemia, urinary tract infections, burn wound and deep tissue infections in such patients (Tatsing et al., 2019) while they are responsible for intramammary infections and clinical mastitis in cattle (Aarestrup et al., 2000; Myllys and Rautala, 1995). Vancomycin-resistant enterococci (VREs) emerged decades ago due to the misuse of Avoparcin (a glycopeptide analogue of Vancomycin) as a growth promoter in intensive animal rearing and the abuse of Vancomycin in clinics for the therapeutic management of community-acquired enterococcal infections (Myllys and Rautala, 1995; Bager et al., 1999). Since then, Avoparcin has been banned in intensive animal farming (Myllys and Rautala, 1995). However, the constant detection of VRE worldwide (Arthur et al., 1996; Courvalin, 2006; Depardieu et al., 2004; Tatsing and Ateba, 2019; Sundermann et al.,

2019) is indicative of the fact that factors other than Avoparcin may be the source of the dispersion of these strains into the environment. Resistance to Vancomycin can be either intrinsic or acquired.

Eight types of Vancomycin resistance gene clusters have been characterised so far (vanA, vanB, vanC, vanD, vanE, vanG, vanL, vanM and vanN) (Depardieu et al., 2004).

Although there are several studies on the detection of antibiotic resistant strains such as VREs worldwide (Myllys and Rautala, 1995; Arthur et al., 1996; Courvalin, 2006; Depardieu et al.,

2004; Tatsing and Ateba, 2019), there is a need to investigate the possible effects that practices, such as the missuse of antimicrobials/antibiotics in industrial animal farming facilities, have on the genetic constitution of environmental bacteria and, consequently, on the different ecological niches of the environment. Decades ago, whole genome sequencing (WGS) technologies were introduced in epidemiological studies, generating huge amounts of relevant data. WGS has been used since then to decode the genetic constitution of quite a number of enterococcal species from various sources, putting in the spotlight genetic determinants involved in antimicrobial resistance as well as those involved in pathogenesis processes, which were previously, less studied

167

(Sundermann et al., 2019; Rangel et al., 2019). As a result of this, Enterococcus faecium and

Enterococcus faecalis have become the most studied enterococci, disregarding other supposedly harmless species such as E. durans and E. gallinarum, which have evolved into highly resistant strains with time (Tatsing and Ateba, 2019; Taucer-Kapteijin et al., 2016; Rogers et al., 1992).

Whole genomic data of such strains are still insufficient. E. durans and E. gallinarum are mostly associated with environmental samples and can be screened from faecal samples of herbivores

(Jenney et al., 2000; Rogers et al., 1992).

This research focuses on the impact of cattle feedlots on the spread and dissemination of

Vancomycin resistant enterococci in the environment of the North West Province, South Africa.

The aim of the study was to analyse the whole genomes of two VRE strains, specifically a VR E. durans (strain NWUTAL1) and a VR E. gallinarum (strain S52016) isolated from a feedlot (cattle faeces and soil/manure). Furthermore, the researchers sought to demonstrate the impact of antimicrobial usage in animal farming on the genetic constitution of these strains (by evaluating their genomic diversity as well as their resistome) and the risk that such strains represent for the environment.

5.2 Materials and methods

5.2.1 Ethical clearance

Ethical clearance was requested and obtained from the ethics committee of the North-West

University before undertaking the study. Moreover, authorisation was granted by owners of the feedlots before collection of samples.

168

5.2.2 Sample collection and isolation of presumptive isolates

Samples were collected at the Rooigron cattle feedlot, North-West Province, South Africa. Faecal samples from dairy and beef cattle were aseptically collected with soil samples from the kraals.

The protocoles of the sample collection and isolation of presumptive isolates are detailly described in a previous work (Tatsing et al., 2019).

5.2.3 Genomic DNA extraction and detection of Vancomycin-resistant enterococci (VREs)

The genomic DNA extraction and the detection of vancomycin-resistant enterococci were done according to a previously described protocole from the authors work (Tatsing et al., 2019). The raw sequences generated were assessed using NCBI webtools

(http://www.ncbi.nlm.nih.gov/BLAST) and accession numbers MK086096 - MK086108 were assigned to the identified isolates.

The presence of Vancomycin-resistance genes and the identites of the different isolates were assessed with previously described multiplex PCR assays (Depardieu et al., 2004; Jackson et al.,

2004) and the amplicons were separated by electrophoresis.

5.2.4 Sequencing and library preparation of whole genome

The draft genomes were obtained by sequencing whole genomes using an Illumina paired-end library with an average insert size of 300 bp. 50 ng of genomic DNA samples were used to prepare the library with a Nextera DNA sample preparation kit (Illumina). The samples were fragmented through ultrasonication (Covaris). AMPure XP beads were used to select the resulting DNA fragments according to the size (300 to 800 bp). The fragments were then end-repaired and

Illumina-specific adapter sequences ligated to each fragment. The samples were indexed and a second size selection step performed. The samples were then quantified with a fluorometric method (Life Technologies Inc.), diluted to a standard concentration (4 nM) and then sequenced

169 with an Illumina MiSeq sequencer (Illumina, San Diego, CA, USA) according to the Illumina

MiSeq kit protocol.

5.2.5. Sequence quality checking, trimming and assembly

Sequence data from Illumina platform were extracted and uploaded on Kbase. The quality of the raw sequences reads were assessed with FastQC (v0.11.5) (Wingett and Andrews, 2018). Low quality sequences and adapters were removed with Trimmomatic (v0.36) (Bolger et al., 2014).

The sequences reads were de novo assembled using SPAdes (v3.13.0) (Bankevich et al., 2012).

5.2.6. Genome annotation and comparative analysis

The genomes of our strains of interest were annotated using Prokka (v1.12) (Seemann, 2014),

RAST (v0.11) (Overbeek et al., 2014) and the NCBI prokaryotic genome annotation pipeline

(Tatusova et al., 2015). Algorithms of the Pathosystems Ressource Integration Centre (PATRIC

3.5.41) (Wattam et al., 2017), ResFinder (v3.1.0) (Zankari et al., 2012) and PlasmidFinder (v2.0)

(Carattoli et al., 2014) were used to assess the resistome, plasmids and virulence factors in the draft genomes. The Genome Annotation Service in PATRIC uses k-mer-based AMR genes detection method, which utilises PATRIC’s curated collection of representative AMR gene sequence variants and assigns to each AMR gene, functional annotation, broad mechanism of antibiotic resistance, drug class and, in some cases, specific antibiotic it confers resistance to.

CGView server was used to generate a circular map of the genomes (Grant and Stothard, 2008).

The phylogenetic relationships with other strains of the respective species of interest were also assessed with PATRIC (v3.5.41) (Wattam et al., 2017). Finally, the presence of clustered regularly interspaced short palindromic repeats (CRISPR) and bacteriophages in the draft genomes of interest were assessed with CRISPRFinder (Grissa et al., 2007) and PHASTER (Arndt et al.,

2016).

170

5.2.7 Data analysis

Statistica 13 (StatSoft, TIBCO software Inc., USA) was utilised to organize and interprete the data generated in this study.

5.3 Results

5.3.1 Species identification and enumeration of VR E. durans and VR E. gallinarum

Ninety-four presumptive enterococcal isolates were screened from the samples collected. Out of this number, 29 were identified as members of the genus Enterococcus (see supplementary Table

5.2). Sixty two percent of the isolates were screened from faecal samples while twenty eight percent were screened from soil samples. Ten and three isolates were identified as E. durans and

E. gallinarum respectively with six E. durans and two E. gallinarum detected from faecal samples while four E. durans and one E. gallinarum were screened from soil samples. Five E. durans possessed vanC resistance genes. Out of this number, two were from faecal samples while three were from soil samples. All the VR E. gallinarum isolates detected from this sample site possessed vanC resistance genes with one isolate from soil samples and the other two from faecal samples.

5.3.2 Genomic assembly features of E. durans NWUTAL1 and E. gallinarum S52016

VR E. durans Strain NWUTAL1 was screened from faecal samples obtained from cattle while VR

E. gallinarum strain S52016 was screened from samples obtained from feedlot soil/manure. The genome sequences of strains NWUTAL1 and S52016 were submitted to NCBI GenBank. Data derived from the assembly and the annotation of the genomes studied are summarised in Table

5.1. The genomes have 3,517 versus 2,351 protein coding sequences respectively, 59 versus 30 transfer RNA sequences respectively and 4 versus 5 ribosomal RNA sequences respectively for strains NWUTAL1 and S52016.

171

Table 5.1: Assembly reports of E. durans NWUTAL1 and E. gallinarum S52016 genomes

Features E. durans NWUTAL1 E. gallinarum S52016

Genome size (bp) 3,279,618 2,374,946

DNA G+C content 40.76% 43.13%

Number of contigs 747 18

Contig N50 7,961 288,028

Contig L50 92 4

CDS 3,517 2,351 tRNA 59 30 rRNA 4 5

Partial CDS 0 0

Miscellaneous RNA 0 0

Chromosomes Present Present

Moreover, no miscellaneous RNA sequences were detected in these genomes (Table 5.1).

5.3.3 Genomic annotation of strains NWUTAL1 and S52016

5.3.3.1 Protein features of strains NWUTAL1 and S52016

Annotation generated data that included hypothetical proteins and proteins with functional assignments (Table 5.2). Proteins with functional assignment included proteins with enzyme commission (EC) numbers, those with gene ontology (GO) assignments and those mapped KEGG pathways. Annotation with PATRIC involves two types of protein families, which includes those of the genus-specific protein families (PLfams) and those belonging to the cross-genus protein family (PGfams). The protein features of the studied strains are presented in Table 5.2.

172

Table 5.2: Protein features of E. durans NWUTAL1 and E. gallinarum S52016

Protein features E. durans NWUTAL1 E. gallinarum S52016

Hypothetical proteins 934 507

Proteins with functional assignments 2,583 1,844

Proteins with EC number assignments 833 619

Proteins with GO assignments 684 487

Proteins with pathway assignments 554 429

Proteins with PLfam assignments 3,082 2,168

Proteins with PGfam assignments 3,246 2,262

5.3.3.2 Subsystem analysis of strains NWUTAL1 and S52016 genomes

A subsystem refers to a set of proteins that, altogether, implement a specific biological process or structural complex (Overbeek et al., 2005). PATRIC generated an overview of the subsystems inherent to each of the studied genomes (Figure 5.1). Genes involved in the different cellular processes were summed up and assigned to their respective subsystems.

Figure 5.1: Subsystem analysis of strain NWUTAL1 (left) and strain S52016 (right)

173

VR E. durans NWUTAL1 strain displayed 122 genes belonging to 33 subsystems, which play a role in stress response, defence and virulence mechanisms compared to VR E. gallinarum strain

S52016, which displayed 76 genes belonging to 25 subsystems involved in the same mechanisms.

Moreover, miscellaneous genes and subsystems were not detected in strain S52016 compared to strain NWUTAL1 (Figure 5.1). A circular graphic display of the distribution of the genomes annotations was generated (Figure 5.2).

174

Figure 5.2: Circular graphical display of the distribution of the annotated genomes of strain NWUTAL1 (left) and strain S52016 (right).

This includes, from outer to inner rings, the contigs, CDS on the forward strand, CDS on the reverse strand, RNA genes, CDS with homology to known antimicrobial resistance genes, CDS with homology to know virulence factors, GC content and GC skew. The colours of the CDS on the forward and reverse strand indicate the subsystem that these genes belong to (see legend).

175

5.3.3.3 Genes involved in virulence and antimicrobial resistance

Analysis of the genomes revealed the presence of antimicrobial resistance genes as well as virulence genes. Both strains possessed glycopeptide resistance genes, aminoglycoside resistance genes, β-lactam resistance genes, macrolide resistance genes, Tetracycline resistance genes and peptide antibiotics resistance genes, among others. Antimicrobial resistance genes were identified as antibiotic inactivating enzymes, antibiotic target modifying enzymes, antibiotic target protection proteins, efflux pumps, cell wall altering proteins and regulator proteins (Table 5.3).

176

Table 5.3: Antibiotic resistance genes detected in strains NWUTAL1 and S52016

NWUTAL1 S52016 Resistance genes Antibiotic to which Antibiotic group Function

resistance is

conferred

 vanC1 Vancomycin D-alanine--D-serine ligase

 vanC2/C3 Vancomycin Glycopeptides D-alanine--D-serine ligase

  vanXY-C Vancomycin D-Ala-D-Ala

dipeptidase/carboxypeptidase

  vanC/E/L/N-type Vancomycin Vancomycin (or other glycopeptides)

response regulator VanR

  MacA, MacB Macrolides Macrolides Macrolide-specific efflux protein MacA,

Macrolide export ATP-

binding/permease protein MacB

  RlmA(II) Tylosine 23S rRNA (guanine(748)-N(1))-

methyltransferase

177

 Erm(A) Erythromycin Macrolides, 23S rRNA (adenine(2058)-N(6))-

Streptogramins dimethyltransferase

  Aac(6’)-la - Aminoglycosides Aminoglycoside N(6’)-acetyltransferase

  BlaEC - β-lactams Class C beta-lactamase

 Tet(A) Tetracycline Tetracyclines Tetracycline resistance, MFS efflux

pump

 Tet(L) Tetracycline Tetracyclines Tetracycline resistance, MFS efflux

pump

  S10p Tetracycline Tetracyclines SSU ribosomal protein S10p

 gyrA Ciprofloxacine Quinolones DNA gyrase subunit A

  gyrB Ciprofloxacine Quinolones DNA gyrase subunit B

 msbA Quinolones Efflux pump conferring antibiotic

- resistance

  S12p Streptomycin Aminoglycosides SSU ribosomal protein S12p

  rpoB, rpoC Myxopiremine Peptides DNA-directed RNA polymerase beta'

subunit

178

 MdfA/Cmr Multidrug efflux pump, quaternary Multidrug efflux pump MdfA/Cmr (of

ammonium compounds resistance MFS type), broad spectrum

  LiaF, LiaR, LiaS Daptomycin Peptides Membrane protein LiaF(VraT), specific

inhibitor of LiaRS(VraRS) signaling

pathway,

Cell envelope stress response system

LiaFSR, response regulator LiaR(VraR),

Cell envelope stress response system

LiaFSR, sensor histidine kinase LiaS

 BcrC Bacitracin Polypeptide Undecaprenyl-diphosphatase BcrC (EC

3.6.1.27), conveys bacitracin resistance

 MprF Moenomycin Phosphoglycolipid L-O-lysylphosphatidylglycerol synthase

 PgsA Daptomycin Peptide CDP-diacylglycerol--glycerol-3-

phosphate 3-phosphatidyltransferase

  EF-G Fusidic acid Fusidane Translation elongation factor G

  EF-Tu Elfamycin Translation elongation factor Tu

179

  Ddl, Alr Cycloserines - D-alanine--D-alanine ligase and Alanine

racemase

  kasA Isoniazid, triclosan 3-oxoacyl-[acyl-carrier-protein]

synthase, KASII

  IsotRNA Mupirocin Carboxylic acid Isoleucyl-tRNA synthetase

  inhA, fabl Isoniazid, triclosan Enoyl-[acyl-carrier-protein] reductase

[NADH]

  MurA Fosfomycin Fosfonic UDP-N-acetylglucosamine 1-

antibiotics carboxyvinyltransferase

  folA, Dfr Trimethoprim Dihydrofolate reductase

180

Moreover, comparison of the genome regions of these strains involved in Vancomycin resistance with that of other VREs showed similarity. The virulence genes of importance detected were as follows: pgaA and bopD (biofilm formation); cspE (cold shock protein); purB (colonisation factor); ompA (outer membrane porin); ecbA (cell wall surface anchor protein); and perR (peroxide stress regulator) for strain NWUTAL1; while purB (colonisation factor), ebpC and pgaA (biofilm formation), cspE (a cold shock protein) and ompA as well as ompF (outer membrane porins) were detected in strain S52016. Moreover, a Copper/silver efflux RND transporter, outer membrane protein (cusC) was detected in both strains.

5.3.3 4 Assessment of CRISPR, phages and plasmids

No phages were detected in both strains. However, the plasmid sequences of E. durans NWUTAL1 were aligned with reference sequences and an homology of 99.3% and 99.23% was found for Incl1 and IncFII respectively while rep1, IncFll(pCoo) and IncFIB(AP001918) demonstrated a homology of 96.54%, 95.04% and 93.84% respectively. Comparatively, three plasmid sequences were detected in E. gallinarum S52016 and these included IncFII, Incl1 and rep1. CRISPRFinder predicted three clustered regularly interspaced short palindromic repeats (CRISPR) on nodes 5,

307 and 729 in the genome of strain NWUTAL1. Three CRISPR were also detected on nodes 6,

1029 and 1030 in the genome of strain S52016.

5.3.3.5 Phylogenetic assessment of nucleotide sequences of strains NWUTAL1 and S52016

Based on the alignment of the 16S rRNA sequences, a high similarity was detected between strain

NWUTAL1 and other strains of the same species from different sources (Figure 5.3) compared to strain S52016 and other E. gallinarum strains. Reference genomes from NCBI are used by

PATRIC algorithms to generate a phylogenetic tree. The closest reference and representative genomes to our strains of interest were identified by Mash/MinHash (Ondov et al., 2016). PGfams

181 were selected from these genomes to determine the phylogenetic placement of our genomes of interest. The protein sequences from these families were aligned with MUSCLE (Edgar, 2004), and the nucleotides for each of thse sequences mapped to the protein alignment. The joint set of amino acid and nucleotide alignments were concatenated into a data matrix, and RaxML

(Stamatakis, 2014) used to analyse this matrix with fast bootstrapping (Stamatakis et al., 2008) in order to generate the support values in the phylogenetic tree.

Figure 5.3: Phylogenetic tree determining the relationship between strains NWUTAL1, S52016 and other enterococci of the same species

5.4 Discussion

182

Systematic monitoring of antibiotic usage and prevalence of antibiotic resistance among humans and animals as well as their pattern of spread in the environment, is of utmost importance as far as the management of bacterial infectious diseases is concerned (WHO, 2015). The relatively inexistence of infrastructure and resources in certain low income countries has created gaps in the data generated worldwide, causing inefficient surveillance systems (WHO, 2018). The “One

Health Perspective” was, therefore, designed to close the gap in the antibiotic resistance surveillance data while emphasising on the interconnections between the health and well-being of animals, humans, plants and their environment (OHC, 2019). In this context, this perspective refers to the transmission of antibiotic resistance genes between bacteria and the other compartments.

The present study reveals features that are inherent to the genomes of two enterococcal isolates, namely; Enterococcus durans strain NWUTAL1 isolated from cattle faeces of feedlots and

Enterococcus gallinarum strain S52016 isolated from the soil/manure of the same cattle feedlot.

Data from whole genome sequence was used in the present study to assess their resistome and some virulence factors of importance. An explanation of the multidrug-resistant nature of these isolates may be the ability of enterococci to adapt to their environment by incorporating, in their genomes, genetic determinants such as plasmids that harbour multiple genes, which altogether, code for resistance to either a single drug or multiple drugs (Clewell et al., 2014). Additionally, another explanation of these observations is the increased expression by enterococci of genes that code for multiple-drug efflux pumps, thus conferring on them, the ability to flush out of their cells, a wide range of antimicrobials (Miller et al., 2014). Moreover, antimocrobial resistance in some cases is an inherent feature located in the chromosome, which is transmitted to progenies.

In this study, plasmids (Incl1, IncFII, rep1 and IncFIB) and most importantly, Vancomycin

(glycopeptide) resistance genes as well as genes of resistance to peptides, macrolides,

183 tetracyclines, aminoglycosides, streptogramins, quinolones and β-lactams were detected in the genomes of the studied strains, with many other resistance genes to antibiotics such as Bacitracin,

Fosfomycin, Trimethoprim and Fusidic acid, among others (Table 5.3). Vancomycin resistance can be either intrinsic or acquired. Intrinsic resistance or low-level resistance refers to the ineffectiveness of a drug due to the possession of certain genetic features, which are inherent to a species. This type of resistance is common in E. casseliflavus, E. durans, E. gallinarum and E. flavescens and vanC (vanC1, vanC2/C3) resistance gene confers such type of resistance (Ahmed and Baptiste, 2017). Comparatively, acquired resistance arises due to the uptake of genetic determinants either from the environment or from another bacterium. This type of resistance is common in E. faecalis, E. faecium, E. durans and less often, E. avium and E. raffinosus, vanA, vanB, vanD, vanE, vanG, vanL, vanM and vanN code for this type of resistance (Arthur et al.,

1996; Ahmed and Baptiste, 2017). The Vancomycin resistance genes detected in this study are involved in the intrinsic type of resistance mechanism and the same findings were reported elsewhere (Torres et al., 2018). Broadly, intrinsic glycopeptides resistance in enterococci arises when the peptidoglycan layer synthesis pathway is altered in such a way that D-alanine-D-Alanine

(D-Ala-D-Ala) is replaced by D-Alanine-D-Serine (D-Ala-D-Ser). This is mediated by chromosomal attributes that render glycopeptides inactive on such strains and their offspring.

Although Avoparcin, a growth promoter, which was initially incriminated for the emergence of

VREs, has been banned decades ago, VREs are continuously detected worldwide as is the case in this study. It has been proved that the emergence of VREs is due to the usage of alternative growth promoters and antimicrobials, which continue to co-select Vancomycin resistance due to selective pressure. As a matter of fact, the use of the macrolide tylosin in Danish pig farms was found to co- select for Vancomycin resistance among enterococci (Aarestrup, 2000). Moreover, some studies

184 have revealed that usage of Erythromycin and Tetracyclines in animal rearing settings accounts also for the co-selection of Vancomycin resistance (Aarestrup et al., 2000). An exhaustive list of antibiotics currently used in animal farming settings in South Africa is provided in supplementary

Table 5.3. This list of antimicrobials comforts our findings as far as Vancomycin resistance and the other types of antimicrobial resistance genes detected in this study are concerned (Table 5.3 and Supplementary Table 5.3). However, there is a need to further elucidate the mechanisms through which some of these antimicrobials co-select Vancomycin resistance and this is a limitation of this study.

Administration of antimicrobials to animals, either as therapeutics or as growth promoters, causes drastic changes in the gut microbiota of animals, enhancing the proliferation of drug-resistant strains such as VREs. As demonstrated by a wide range of studies, enterococci, which were initially already resistant to Vancomycin or any other drug may acquire more antimicrobial resistance genetic determinants and additional virulence factors with plasmids upon interaction with other bacteria of the gut, giving rise to multidrug resistant isolates, which may become pathogenic and which will subsequently, be shed with faecal matter (Toomey et al., 2009; Doucet-

Populaire et al., 1991; Rizzotti et al., 2009). This assertion may be an additional explanation of our findings. Most of the virulence factors and the antibiotic resistance genes detected in this study have also previously been screened in other enteric isolates (Ahmed and Baptiste, 2017).

Additionally, the antibiotic susceptibility profiles of strains NWUTAL1 and S52016 were assessed against nine antibiotics (Vancomycin 30µg, Tetracycline 30µg, Erythromycin 15µg, Ampicillin

10µg, Amoxicillin 10µg, Chloramphenicol 30µg, Linezolid 30µg, Ciprofloxacin 5µg and

Penicillin 10µg). The measurement and interpretation of the zones of inhibition revealed they were

185 both intermediate for Ciprofloxacin according to the CLSI guide (2017). Their antibiotic resistance profile was TETR-AMPR-AMXR-VANR-CHLR-PENR-LINR-ERYR.

When soil is mixed with manure in agricultural processes, resistance genes can be transferred either vertically or horizontally to soil microbiota. Through this process, commensals and human pathogens pick up genetic determinants such as resistance genes and virulence factors with plasmids in the already polluted soil and environment (Boxall et al., 2002; Ding et al., 2014;

Forsberg et al., 2014; Thanner and Drissner, 2016; Wei et al., 2019; Zhang et al., 2019). This assertion may additionally justify the observations made in this study.

The effects of usage of antimicrobials in intensive rearing cannot be undermined as it has a significant impact on the environment and, consequently, on the health of human beings. Wastes from such farms may find their way into water bodies used either in irrigation processes or for recreational purposes (Economou and Gousia, 2015). Consequently, these water bodies may be contaminated with antimicrobial resistance genes and whenever water from such sources is used in irrigation processes, antibiotic resistance genes are propagated unto crops, which will later on be eaten by humans and animals, leading to a never ending cycle of transmission of antimicrobial resistance genes to commensals and other potentially pathogenic bacteria, through the food chain and various microbiomes of the environment (Gonzalez-Zorn and Escudero, 2012; Acar et al.,

2012; Wei et al., 2019; Zhang et al., 2019). Moreover, even if waste from such farms was treated before being released into the environment, the problem will not be resolved since antibiotics are not completely deactivated in the process of waste treatment and after a while in the environment, they always revert to their initial active form (Ding et al., 2014).

5.5 Conclusion

186

The well-being of living beings is directly connected to the quality of the environment in which they thrive. Ever since antimicrobials were discovered and introduced in therapeutic regimens and intensive animal farming, the world has spawned into what many scientists call the “post-antibiotic era”, with its huge consequences on the environment and the health of humans and animals. One of such consequences is the emergence of multidrug resistant strains of bacteria and the probable availability of antimicrobial resistance genes into the environment. This report highlights, on a microbiological perspective, the impact of intensive animal rearing on the environment. Two multidrug resistant enterococcal strains (namely; E. durans strain NWUTAL1 and E. gallinarum strain S52016), isolated from a cattle feedlot in the North West Province, South Africa, were assessed through genomics. The detection of antibiotic resistance genes that code for Vancomycin,

Tylosine, Tetracycline, Erythromycin, β-lactam antibiotics, Quinolones, Fusidic acid, Bacitracin and Fosfomycin, among others, in their genomes, highlights the role that intensive farming practices, such as the abusive usage of antimicrobials has on the spread and the dissemination of resistant strains such as VREs in the environment. Intensive livestock rearing has been incriminated as the main source of the spread of antimicrobial resistance genes in ecosystems worldwide. Hence, modern-day farming practices contribute significantly to the pollution of the environment, especially taking into consideration the fact that environment has become a pool where genetic determinants are exchanged horizontally and vertically between organisms of different ecological niches. The implication of environments polluted with resistant strains on human and animal health cannot be overemphasised, thus there urgent need to consider alternatives to antibiotics and adopt lifestyles that are healthier and more environment-friendly.

Sequences data

187

The draft genomes of these strains has been deposited at DDBJ/ENA/GenBank under accession numbers VMRQ00000000 and VRLO00000000. Raw sequence reads have been deposited in the

NCBI Sequence Read Archive (SRA) under the Bioproject accession numbers PRJNA554257 and

PRJNA558653.

List of abbreviations and acronyms

VRE: Vancomycin Resistant Enterococci

CDS: Coding Sequences

RAST: Rapid Annotation using Subsystem Technology

PATRIC: Pathosystems Ressource Integration Centre

CRISPR: Clustered Regularly Interspaced Short Palindromic Repeats

Acknowledgements

This study was supported by the Department of Microbiology, North-West University, South

Africa.

Availability of data and material

The datasets generated during this study are available from the corresponding author and publicly available (Whole Genome Shotgun project has been deposited at DDBJ/ENA/GenBank under accession numbers VMRQ00000000 and VRLO00000000, PRJNA385553 and PRJNA558653.

The versions described in this study are VMRQ01000000 and VRLO01000000 respectively.

Contribution of authors

Frank Eric Tatsing Foka collected the samples, conducted the experiments and wrote the manuscript. Collins Njie Ateba supervised the experiments, read and approved the manuscript.

Conflict of interest

188

The authors have no conflict of interest to disclose.

REFERENCES

Aarestrup, F.M. (2000). Characterization of glycopeptide-resistant Enterococcus faecium (GRE)

from broilers and pigs in Denmark: genetic evidence that persistence of GRE in pig

herds is associated with coselection by resistance to macrolides. J. Clin. Microbiol. 38

(7), 2774 – 2777.

Aarestrup, F. M., Kruse, H., Tast, E., Hammerum, A. M. and Jensen, L. B. (2000). Associations

between the use of antimicrobial agents for growth promotion and the occurrence of

resistance among Enterococcus faecium from broilers and pigs in Denmark, Finland,

and Norway. Microb. Drug Resist. 6 (1), 63 – 70.

Acar, J.F., Moulin, G., Page, S.W. and Pastoret, P.P. (2012). Antimicrobial resistance in animal

and public health: introduction and classification of antimicrobial agents. Rev. Sci.

Tech. 31, 15 – 21.

Ahmed, M.O. and Baptiste, K.E. (2017). Vancomycin-resistant enterococci: a review of

antimicrobial resistant mechanisms and perspectives of human and animal health.

Microb. Drug Resist. 24 (5): 590 – 606.

Arndt, D., Grant, J.R., Marcu, A., Sajed, T., Pon, A., Liang, Y., Wishart, D.S. (2016). PHASTER:

a better, faster version of the PHAST phage search tool. Nucleic Acids Res. 44, W16 –

W21.

Arthur, M., Reynolds, P., Courvalin, P. (1996). Glycopeptide resistance in enterococci. Trends

Microbiol. 4, 401 – 407.

189

Bager, F., Madsen, M., Christensen, J. and Aarestrup, F.M. (1999). Avoparcin used as a growth

promoter is associated with the occurrence of vancomycin-resistant Enterococcus

faecium on Danish poultry and pig farms. Prev. Vet. Med. 31 (1-2), 95 – 112.

Bankevich, A., Nurk, S., Antipov, D., Gurevich, A.A., Dvorkin, M., Kulikov, A.S. et al. (2012).

SPAdes: a new genome assembly algorithm and its applications to single-cell

sequencing. J. Comput. Biol. 19, 455 – 477.

Bolger, A.M., Lohse, M. and Usadel, B. (2014). Trimmomatic: a flexible trimmer for Illumina

sequence data. Bioinformatics. 30, 2114 – 2120.

Boxall, A.B., Blackwell, P., Cavallo, R., Kay, P. and Tolls, J. (2002). The sorption and transport

of a sulphonamide antibiotic in soil systems. Toxicol. Lett. 131, 19 – 28.

Carattoli, A., Zankari, E., García-Fernández, A., Voldby L.M., Lund, O., Villa, L., Aarestrup, F.M.

and Hasman, H. (2014). In silico detection and typing of plasmids using PlasmidFinder

and plasmid multilocus sequence typing. Antimicrob. Agents Chemother. 58, 3895 –

3903.

Clewell, D.B., Weaver, K.E., Dunny, G.M., Coque, T.M., Francia, M.V. and Hayes, F. (2014).

Extrachromosomal and mobile elements in enterococci: transmission, maintenance,

and epidemiology. In Gilmore MS, Clewell DB, Ike Y, Shankar N (ed), Enterococci:

from Commensals to Leading Causes of Drug Resistant Infection. Eye and Ear

Infirmary, Boston, MA, USA.

CLSI. (2017). Performance Standards for Antimicrobial Susceptibility Testing. 27th ed. CLSI

supplement M100. Wayne, PA: Clinical and Laboratory Standards Institute.

Courvalin, P. (2006). Vancomycin resistance in gram-positive cocci. Clin. Infect. Dis. 42 (1), 25

– 34.

190

Depardieu, F., Perichon, B. and Courvalin, P. (2004). Detection of the van alphabet and

identification of enterococci and staphylococci at the species level by multiplex PCR.

J. Clin. Microbiol. 42 (12), 5857 – 5860.

Ding, G.C., Radl, V., Schloter-Hai, B., Jechalke, S., Heuer, H., Smalla, K., et al. (2014). Dynamics

of soil bacterial communities in response to repeated application of manure containing

sulfadiazine. PLoS One. 9 (3), e92958.

Doucet-Populaire, F., Trieu-Cuot, P., Dosbaa, I., Andremont, A. and Courvalin, P. (1991).

Inducible transfer of conjugative transposon Tn1545 from Enterococcus faecalis to

Listeria monocytogenes in the digestive tracts of gnotobiotic mice. Antimicrob. Agents

Chemother. 35 (1), 185 – 187.

Economou, V. and Gousia, P. (2015). Agriculture and food animals as a source of antimicrobial-

resistant bacteria. Infect. Drug Resist. 8, 49 – 61.

Edgar, R.C. (2004). MUSCLE: multiple sequence alignment with high accuracy and high

throughput. Nucleic Acids Res. 32, 1792 – 1797.

Forsberg, K.J., Patel, S., Gibson, M.K., Lauber, C.L., Knight, R., Fierer, N., et al. (2014). Bacterial

phylogeny structures soil resistomes across habitats. Nature. 509, 612 – 616.

Gonzalez-Zorn, B. and Escudero, J.A. (2012). Ecology of antimicrobial resistance: humans,

animals, food and environment. Int. microbial. 15, 101 – 109.

Grant, J.R. and Stothard, P. (2008). The CGView server: a comparative genomics tool for circular

genomes. Nucleic Acids Res. 36, W181 – W184.

Grissa, I., Vergnaud, G. and Pourcel, C. (2007). CRISPRFinder: a web tool to identify clustered

regularly interspaced short palindromic repeats. Nucleic Acids Res. 35, W52 – W57.

191

Jackson, C.R., Fedorka-Cray, P.J. and Barrett, J.B. (2004). Use of a genus and species-specific

multiplex PCR for identification of enterococci. J. Clin. Microbiol. 42 (8), 3558 –

3565.

Jenney, A., Franklin, L., Liolos and Spelman, D. (2000). Enterococcus durans vanB. J.

Antimicrob. Chemother. 46, 513 – 519.

Kariyama, R., Mitsuhata, R., Chow, W., Clewell, B. and Kumon, H. (2000). Simple and reliable

PCR assay for surveillance isolates of vancomycin-resistant enterococci. J. Clin.

Microbiol. 38 (8), 3092 – 3095.

Marshall, B.M. and Levy, S.B. (2011). Food animals and antimicrobials: impacts on human health.

Clin. Microbiol. Rev. 24 (4), 718 – 733.

Miller, W.R., Munita, J.M. and Arias, C.A. (2014). Mechanisms of antibiotic resistance in

enterococci. Expert Rev. Anti-infect. Ther. 12 (10), 1221 – 1236.

Myllys, V. and Rautala, H. (1995). Characterization of clinical mastitis in primiparous heifers. J.

Dairy Sci. 78 (3), 538 – 545.

OHC (One Health Commission), 2019. What is one health?

https://www.onehealthcommission.org/en/why_one_health/what_is_one_health.

Accessed online on the 11th June 2019.

Ondov, B.D.T., Reangen, T.J., Melsted, P., Mallonee, A.B., Bergman, N.H., Koren, S. and

Phillippy, A.M. (2016). Mash: fast genome and metagenome distance estimation using

MinHash. Genome biol. 17, 132.

Overbeek, R., Begley, T., Butler, R.M., Choudhuri, J.V., Chuang, H-Y., Cohoon, M de Crécy-

Lagard, V., Diaz, N., Disz, T. and Edwards, R. (2005). The subsystems approach to

192

genome annotation and its use in the project to annotate 1000 genomes. Nucleic Acids

Res. 33, 5691 – 5702.

Overbeek, R., Olson, R., Pusch, G.D., Olsen, G.J., Davis, J.J., Disz, T., Edwards, R.A. et al. (2014).

The SEED and the Rapid Annotation of microbial genomes using Subsystems

Technology (RAST), Nucleic Acids Res. 42 (1), D206 – D214.

Rangel Freitas, A. A., Rodrigues Souza, S. S., Faria, A. R., Planet, P. J., Carreira, M. V. L. and

Teixeira, M. L., 2019. Draft Genome Sequence of Multidrug-Resistant Enterococcus

faecium Strain E1298, with a Sequence Type 1274 Profile, Recovered from the Cloacal

Microbiome of a Tropical Screech Owl (Megascops choliba) in Rio de Janeiro, Brazil.

Microbiol. Resour. Announc. 8(16): e00168.

Rizzotti, L., La Gioia, F., Dellaglio, F. and Torriani, S. (2009). Molecular diversity and

transferability of the tetracycline resistance gene tet(M), carried on Tn916-1545 family

transposons, in enterococci from a total food chain. Antimicrob. Agents Chemother. 96

(1), 43 – 52.

Rogers, D.G., Zeman, D.H. and Erikson, E.D. (1992). Diarrhea associated with Enterococcus

durans in calves. J. Vet. Diagn. Invest. 4, 471 – 472.

Seemann, T. (2014). Prokka: rapid prokaryotic genome annotation. Bioinformatics. 30 (14), 2068

– 2069.

Stamatakis, A. (2014). RAxML version 8: a tool for phylogenetic analysis and post-analysis of

large phylogenies. Bioinformatics. 30, 1312 – 1313.

Stamatakis, A., Hoover, P. and Rougemont, J. (2008). A rapid bootstrap algorithm for the RAxML

web servers. Syst. biol. 57, 758 – 771.

193

Sundermann, A. J., Babiker, A., Marsh, J. W., Shutt, K. A., Mustapha, M. M., Pasculle, A. W., et

al. (2019). Outbreak of Vancomycin-resistant Enterococcus faecium in Interventional

Radiology: Detection Through Whole Genome Sequencing-Based Surveillance. Clin.

Infect. Dis. 10, 1058 – 4838.

Tatsing Foka, F. E. and Ateba, C.N. (2019). Detection of virulence genes in multidrug resistant

enterococci isolated from feedlot dairy and beef cattle: implications for human health

and food safety. Biomed. Res. Int. Article ID 5921840.

Tatusova, T., DiCuccio, M., Badretdin, A., Chetvernin, V., Nawrocki, E.P., Zaslavsky, L.,

Lomsadze, A., Pruitt, K.D., Borodovsky, M. and Ostell, J. (2015). NCBI prokaryotic

genome annotation pipeline. Nucleic Acids Res. 43, D599 – D605.

Taucer-Kapteijin, M., Hoogenboezem, W., Heiliegers, L., Danny de Bolster, H. and Medema, G.

(2016). Screening municipal wastewater effluent and surface water used for drinking

water production for the presence of ampicillin and vancomycin resistant enterococci.

Int. J. Hyg. Environ. Health. 16, 1 – 7.

Thanner, S., Drissner, D. and Walsh, F. (2016). Antimicrobial resistance in agriculture. MBio. 7

(2), e02227 – 15.

Toomey, N., Monaghan, A., Fanning, S. and Bolton, D.J. (2009). Assessment of antimicrobial

resistance transfer between lactic acid bacteria and potential foodborne pathogens

using in vitro methods and mating in a food matrix. Foodborne Pathog. Dis. 6 (8), 925

– 933.

Torres, C., Alonso, C.A., Ruiz-Ripa, L, León-Sampedro, R., Del Campo, R. and Coque, M.T.

(2018). Antimicrobial resistance in Enterococcus sp. of animal origin. Microbiol.

Spectrum. 6 (4), ARBA 0032 – 2018.

194

Wingett, S.W. and Andrews, S. (2018). FastQ Screen: A tool for multi-genome mapping and

quality control. F1000 Res. 7, 1338.

Wattam, A.R., Davis, J.J., Assaf, R., Boisvert, S., Brettin, T., Bun, C., Conrad, N., Dietrich, E.M.

et al. (2017). Improvements to PATRIC, the all-bacterial bioinformatics database and

analysis resource center. Nucleic Acids Res. 45, D535 – D542.

Wei, R., He, T., Zhang, S., Zhu, L., Shang, B., Li, Z. and Wang, R. (2019). Occurrence of

seventeen veterinary antibiotics and resistant bacteria in manure-fertilized vegetable

farm soil in four provinces of China. Chemosphere. 215 (2019), 234 – 240.

WHO (World Health Organization), 2015. Global Action Plan on Antimicrobial Resistance 2015.

WHO, Geneva, Switzerland.

http://www.who.int/antimicrobialresistance/publications/global-action-plan/en.

Accessed online on the 11th June 2019.

WHO (World Health Organization), 2018. WHO Report on Surveillance of Antibiotic

Consumption: 2016–2018 Early Implementation. WHO, Geneva, Switzerland.

https://www.who.int/medicines/areas/rational_use/oms-amr-amcreport-2016-

2018/en. Accessed online on the 11th June 2019.

Zankari, E., Hasman, H., Cosentino, S., Vestergaard, M., Rasmussen, S., Lund, O., Aarestrup,

F.M. and Larsen, M.V. (2012). Identification of acquired antimicrobial resistance

genes. J. Antimicrob. Chemother. 67, 2640 – 2644.

Zhang, Y-J., Hu, H-W., Chen, Q-L., Singh, B. K., Yan, H., Chen, D. and He, J-Z. (2019). Transfer

of antibiotic resistance from manure-amended soils to vegetable microbiomes.

Environ. Int. 130 (2019), 104912.

195

Supplementary Table 5.1: Oligonucleotide primers and PCR conditions used in this study

Genes Target/ primer Sequences (5’-3’) Size Volumes and PCR conditions Reference

(bp)

16S rRNA gene 16S rRNA F: TGCATTAGCTAGTTGGTG Total 25 μl standard volumes comprised 12.5 μl of 1X Master mix, 0.25 μl of each 1μM primer, [35]

2μl template DNA (20 – 30 ng/μl) and 10 μl nuclease free water. R: TTAAGAAACCGCCTGCGC 356

Denaturation 95°C for 4 min, 30 cycles at 95°C 30s, 58°C 60s, 72°C 60s and 72°C 10 min

Species specific genes E. faecalis F: CACCTGAAGAAACAGGC

475 Denaturation 95°C for 4 min, 30 cycles at 95°C for 30 s, 55°C 60s, 72°C 60s and 72°C for 7 min. R: ATGGCTACTTCAATTTCACG

E. faecium F: GAGTAAATCACTGAACGA 1091 [21]

R: CGCTGATGGTATCGATTCAT

E. durans F: TTATGTCCCWGTWTTGAAAAATCAA 295

R: TGAATCATATTGGTATGCAGTCCG

E. gallinarum F: GGTATCAAGGAAACCTC 173

R: CTTCCGCCATCATAGCT

E. hirae F: CTTTCTGATATGGATGCTGTC 187

R: TAAATTCTTCCTTAAATGTTG

E. mundtii F: CAGACATGGATGCTATTCCATCT 98 Denaturation 95°C for 4 min, 30 cycles at 95°C for 30 s, 60°C 60s, 72°C 60s and 72°C for 7 min

R: GCCATGATTTTCCAGAAGAAT

E. casseliflavus F: TCCTGAATTAGGTGAAAAAAC 288 Denaturation 95°C for 4 min, 30 cycles at 95°C for 30 s, 55°C 60s, 72°C 60s and 72°C for 7 min

R: GCTAGTTTACCGTCTTTAACG

E. avium F: GCTGCGATTGAAAAATATCCG 368 Denaturation 95°C for 4 min, 30 cycles at 95°C for 30 s, 55°C 60s, 72°C 60s and 72°C for 7 min.

196

R: AAGCCAATGATCGGTGTTTTT [21]

Supplementary Table 5.1: Oligonucleotide primers and PCR conditions used in this study (continued)

Genes Target/ Sequences (5’-3’) Size Volumes and PCR conditions Reference

primer (bp)

Vancomycin resistance vanA F: GGGAAAACGACAATTGC 732 The final 20μl volume contained 1μl genomic DNA sample, 12.5μl DreamTaq PCR Master Mix, [14]

genes 0.5μl of each 1μM primer and 6μl nuclease-free water.

R: GTACAATGCGGCCGTTA

Denaturation 94 °C 3min, 30 cycles at 94 °C 60 s, 54 °C 60 s, 72 °C 60 s, 72 °C 10min

vanB F: ACGGAATGGGAAGCCGA 647

R: TGCACCCGATTTCGTTC

vanC1/2 F: ATGGATTGGTAYTKGTAT 815/827

R: TAGCGGGAGTGMCYMGTAA

R: AAACCAATGGAAGCCCAGAA

197

Supplementary Table 5.2: Distribution of enterococcal isolates in Rooigrond

Isolated species Sample type Total

Faecal samples Soil samples

vanA vanB vanC No van gene vanA vanB vanC No van gene

E. faecalis 0 1 0 3 0 0 0 0 4 (14%)

E. faecium 1 0 0 4 0 0 0 0 5 (17%)

E. durans 0 0 2 4 0 0 3 1 10 (34%)

E. casseliflavus 0 0 1 0 0 0 1 0 2 (7%)

E. gallinarum 0 0 2 0 0 0 1 0 3 (10%)

E. hirae 0 0 0 0 0 0 0 0 0 (0%)

E. avium 0 0 0 0 0 0 0 2 2 (7%)

E. mundtii 0 0 0 1 0 0 0 2 3 (10%)

Total identified isolates 18 (62%) 11 (38%) 29 (100%)

Total unidentified isolates 45 20 65

Presumptive isolates 63 31 94

198

Supplementary Table 5.3: Antibiotics currently used in animal farming in South Africa

Antibiotic Treatment objective Food animal

Lincomycin Feed efficiency, growth promoter and disease control Swine, poultry

Tylosin Feed efficiency and growth promoter Poultry, cattle

Penicillin Feed efficiency, growth promoter and disease control Swine, poultry

Virginiamycin Feed efficiency, growth promoter and disease control Swine, poultry, cattle

Tetracyclin Feed efficiency, growth promoter and disease control Swine, poultry, cattle

Chlortetracycline Feed efficiency, growth promoter Swine, poultry, cattle

Oxytetracycline Feed efficiency, growth promoter Cattle

Erythromycin Disease control Swine, poultry, cattle,

sheep

Bacitracin Feed efficiency, growth promoter Swine, poultry, cattle

Lasalocid Feed efficiency, growth promoter Cattle

Monensin Feed efficiency, growth promoter Cattle

Fluoroquinolones Disease control Cattle, poultry

199

CHAPTER 6

General discussion, concluding remarks and future perspectives

200

Chapter 6

6.1 General discussion

After the discovery of antibiotics and their microbicidal properties, they became widely used for therapeutic purposes. In fact, the introduction of antimicrobials in human and veterinary medicine was one of the most significant achievements ever made in modern era. The usage of antimicrobial agents has immensely changed our way of living for the past 90 years; besides the fact that disease conditions that were lethal then, can now be treated; surgical interventions cannot be successful without the prophylactic usage of antimicrobials (Aarestrup, 2015). The discovery and ever-improving designing of new antimicrobial agents have comforted this. Subsequently, the growth-promoting properties of antimicrobials were discovered, shortly after the establishment of their therapeutic effects; and with time, analoguous compounds of antimicrobials used in human medicine, have been widely used in intensive animal rearing (Butaye et al., 2003; Marshall and Levy, 2011).

Since then, growth promoters have become keystones in the production of industrial food for animal consumption. This was motivated by the belief that growth promoters enhance feed uptake, ameliorate animal growth and reduce mortality and morbidity rates that could arise from clinical and subclinical disease conditions; eventhough the mechanisms through which this is achieved are still poorly investigated (Feighner and Dashkevicz, 1987; Aarestrup, 2000 and Mellon et al., 2001). However, animal welfare, increased food production, reduced colonisation by zoonotic bacteria, availability of cheaper food and, most importantly, direct impact on farmers’ economy and industry lobbying are some of the driver-factors that influenced the decision to use antimicrobials as growth promoters in intensive animal rearing (Graham et al., 2007; Aarestrup, 2015).

Unfortunately, while the benefits of the usage of antibiotics as growth promoters were praised, strong evidence of the contrary emerged. Several studies revealed the connection between the use of growth promoters and the detection of antibiotic resistant strains in farm animals and, subsequently, in the environment (Klare et al., 1995; Aaerestrup et al., 2000; Jackson et al., 2005; Ding et al., 2014; Petersen

201 et al., 2002; Taucer-Kapteijin et al., 2016). This resulted in the banning of many growth promoters from intensive animal rearing such as Avoparcin, an analogous compound of Vancomycin. Nevertheless, some growth promoters, such as Tylosine, that hav been banned in other parts of the world, are still used nowadays in South Africa, alongside other antibiotics that are used for prophylactic and therapeutic purposes in animal husbandry (Moyane et al., 2013).

It has been demonstrated that VREs emerged due to the misuse of Avoparcin as a growth promoter in animal food production, and as a result of the abuse of Vancomycin in the treatment of community- acquired infections. Consequently, Avoparcin was banned in animal husbandry decades ago and

Vancomycin dismissed as the therapeutic option for the treatment of enterococcal infections. However,

VREs are constantly detected worldwide and specifically in South Africa (Roberts et al., 2016; Choi and

Choi, 2017; Iweriebor et al., 2015a; Iweriebor et al., 2015b; Ateba et al., 2013, Tatsing and Ateba, 2019;

Matlou et al., 2019).

There is little information about the patterns of antibiotic usage in animal farming in South Africa.

Moreover, despite the numerous programmes and policies adopted in order to reduce or tackle issues of antimicrobial resistance in South Africa, much needs to be done in order to appropriately address this issue. An adequate investigation on the causative factors of the prevalence and distribution of potentially pathogenic VREs in the different ecological niches could be a a good starting point for the development of efficient strategies to assess and eradicate issues of antimicrobial resistance or more specifically, issues of Vancomycin resistance. Thus, it is hypothesised in this study that the usage of other growth promoters and antibiotics (for prophylactic or therapeutic purposes) in cattle rearing continues to select

VREs in the environment.

Four studies were conducted to confirm this hypothesis. The aim of the first study was perform a holistic assessment of the regulations and current management of antibiotic stewardship in South Africa and its loopholes. The purpose of the other studies was to characterise enterococcal isolates from soil, drinking troughs and faecal samples from cattle obtained from some selected commercial farms in the North-

West Province, South Africa, using biochemical, genetic and molecular methods as well as bioinformatics tools. Henceforth, genes encoding for Vancomycin resistance, Tetracycline efflux pumps 202 and virulence factors were investigated. Finally, next generation sequencing (NGS) was performed on selected VREs in order to investigate the presence of mobile genetic elements that could harbour resistance genes to other antibiotics as well as other virulence factors and metabolites of interest that could not be detected with PCR assays.

6.1.1 Antibiotic stewardship and current regulation of antimicrobials in South Africa

An investigation was carried out to assess the loopholes and discrepancies in South Africa’s regulation system of antimicrobials (Chapters 2 and 3). Its aim was not only to give a glimpse on the different antibiotics and growth promoters currently used in veterinarian medicine and intensive cattle rearing in

South Africa, but also to demonstrate the impact of current regulations on the availability and usage of such antimicrobials in the veterinarian sector and industrial animal farming.

South Africa and other countries such as India, Kenya, Nepal, Mozambique, Tanzania, Uganda and

Vietnam came together in 2009 to form the Global Resistance Partnership (GARP), a project of the

Centre for Disease Dynamics, Economics and Policy (CDDEP) funded by the Bill & Melinda Gates foundation. This project entered its third phase in 2016 with countries such as Namibia, Nigeria,

Pakistan, Bangladesh, Laos, Seychelles and Zimbabwe joining in. The purpose of this partnership was to establish local policy analysis and development capacity in low and middle-income countries in order to tackle antibiotic resistance issues. Additionally, the South African National Veterinary Surveillance and Monitoring Programme for Resistance to Antimicrobial Drugs (SANVAD) was brought to the forefront, with the South African Antibiotic Stewardship Programme (SAASP). Reports made by these bodies are still to be converted into operational policies and action strategies. However, South Africa is the most dynamic African country when it comes to antimicrobial resistance monitoring. In this regard, the Global Action Plan on antimicrobial resistance was launched in partnership with the World Health

Organisation. It puts emphasis on the optimisation and reinforcement of knowledge through surveillance and research on antimicrobial usage in human beings and animals. However, the paucity of consumption data worldwide and in South Africa specifically, makes this task a cumbersome one. Reports of the current assessement of antibiotic use and resistance, made by interested parties in South Africa and the

203

GARP, through the CDDEP project, outlined many obstacles in the antimicrobial stewardship programmes. The main setback was the unavailability of data from the intercontinental marketing services, creating a bias in the actual assessment of antimicrobial consumption patterns in South Africa.

As far as humans are concerned, the prescription of antimicrobials in the public sector is channelled by

Standard Treatment Guidelines (STGs) (which are accessible electronically) and depends on the obtainability of the medicine on the Essential Medicines Lists (EML) (Perumal-Pillay and Suleman,

2017). In the private sector, prescription is unrestricted as prescribers can select whatever medicine they deem appropriate (Chunnilall et al., 2015) depending, sometimes, on the finances of the patient.

Prescriptions are often made by health practitionners registered with the Health Professions Council of

South Africa. However, provisions are made through the Nursing Act 33 of 2005 under Section 56(6) and Act Nº53 of 1974, which allows nurses and pharmacists to prescribe and dispense treatments.

With regard to the veterinary sector, the National Department of Health (NDOH) and the Department of

Agriculture, Forestry and Fisheries regulate the use of antibiotics. The later promulgated the Stock

Remedies Act 36 of 1947 in order to eradicate external and internal parasites infesting livestock in South

Africa at the time. With time, a certain number of antimicrobials were added to allow farmers in remote areas to access vital livestock medicines over the counter and these included growth promoters

(Department of Agriculture, Forestry and Fisheries, 2016). The Medicines and Related Substances Act

101 of 1965 was later promulgated by the NDOH to ease the registration of only prescribed medicines.

This Act was amended in 1979 such that all substances, including antibiotics to be used in veterinary medicine, are regulated by the Act. Moreover, the South African Veterinary Council (SAVC) also has an influence on the regulation of veterinary medicines in South Africa, and this is done through the rules of the Veterinary and Para-veterinary Professions Act 19 of 1982.

However, there are discrepancies in the dual registration process of medicines through the Stock

Remedies Act 36 of 1947 and the Medicines and Related Substances Control Act 101 of 1965, and this has raised concerns about the exacerbation of antimicrobial resistance. The manufacturers supply stock remedies to veterinary wholesalers, distributors, farmers’ cooperatives and feed mix companies.

Consequently, stock remedies are freely available and there is no record of their usage. Moreover, the 204

South African situation is not in accordance with the 1998 World Health Organisation best practice guidelines. Firstly, the dual system of regulating veterinary products only partially addresses clear, transparent manufacturing requirements (whereas antibiotics listed under Act 101 of 1965 must be authorised with a Good Manufacturing Practice licence, stock remedies under Act 36 of 1947 are not).

Secondly, most authorised veterinary antibiotics are over the counter stock remedies and often administered by farmers while the World Health Organisation recommends that only trained and licensed professionals decide when and how to use antibiotics (Henton et al., 2011).

Furthermore, there is scarcity of data indicating the volume of consumption of antimicrobials in intensive cattle rearing in South Africa. Most of the antimicrobials used in livestock rearing in South Africa are administered for therapeutic, prophylactic and growth promoting purposes (Eaton, 2008). A study revealed that Tylosin (which was banned from the European Union since 1997), Virginiamycin,

Tetracycline and Erythromycin are commonly used in cattle rearing for their growth promoting attributes and for prophylaxis in South Africa (Moyane et al., 2013). Moreover, the owners of the farms investigated in this study revealed that besides the above-mentioned antimicrobials, Penicillin,

Sulfametacine and Streptomycine were used for prophylactic and therapeutic purposes on their herds.

This study has revealed the flaws in South Africa’s regulations and laws on availability and usage of medicine. Most importantly, the study has revealed that although global actions are being instructed, there is still a need to revise existing regulations on usage of antimicrobials and transform concrete measures into operational policies in order to limit abusive usage of antibiotics. Moreover, the use of banned growth promoters and antibiotics in intensive cattle rearing probably enhances the emergence of resistant strains such as VREs. In fact, it was demonstrated that Tylosine co-select Vancomycin resistance in enterococci (Aarestrup, 2000) because the genes encoding the two resistances are harboured by the same plasmid. Although the above-mentioned reasons might be an explanation for the detection of VREs in the feedlots cattle investigated, further genetic investigations were carried out on the VRE isolates in order to assert our hypothesis.

205

6.1.2 Screening of Vancomycin-resistance attributes in enterococci isolated from cattle feedlots in the North West Province, South Africa

Several studies have reported the prevalence and incidence of Vancomycin-resistant enterococci worldwide and in South Africa specifically. These were either screened from environmental samples or food products and clinical samples (Simner et al., 2015; Seo et al., 2005; Mannu et al., 2003; Matlou et al., 2019; Molale and Bezuidenhout, 2016; Iweriebor et al., 2015a; Iweriebor et al., 2015b, Ateba et al.,

2013; Ateba and Mohapi, 2013). Although most surveys carried out in Europe tend to outline a clear epidemiological pattern of VREs with time, much still needs to be done in South Africa. However, we described in Chapter 4, the detection of Vancomycin resistance determinants in enterococcal strains from different types of samples collected in some selected cattle feedlots in the North-West Province (faecal samples of cattle, soil/litter and drinking troughs water). In this study, 432 samples were collected (384 faecal samples, 24 drinking through water and 24 soil samples) from feedlots and feedlots cattle herds.

In the same order, 527 presumptive isolates were recovered. Out of this number, 289 (55%) isolates were confirmed after biochemical and genotypic assays as Enterococcus sp. The confirmed enterococci were identified as E. faecalis (n=26), E. faecium (n=30), E. durans (n=199), E. gallinarum (n=18), E. casseliflavus (n=5), E. mundtii (n=6) and E. avium (n=5). Isolates identified as E. faecalis, E. faecium,

E. durans and E. hirae have also been screened from faecal samples of cattle in Ethiopia and in another province of South Africa (Bekele and Ashenafi, 2010; Tanhi, 2016). Moreover, Beukers et al. (2017) and Jackson et al. (2011) also screened E. casseliflavus and E. gallinarum from faecal samples of cattle.

The E. mundtii isolates of this study were screened from samples of soil/liter and this is in accordance with the findings obtained by Graves et al. (2009) Furthermore, E. avium isolates were screened from samples of drinking troughs water.

Members of the genus Enterococcus are ubiquitous bacteria as they can be found in all the ecological niches, however, the gastro-intestinal tract is their main habitat. All cows from which faecal samples were collected were healthy and showed no clinical sign of illness. All the isolates screened in this study were associated to animal faeces, which happen to be their primary source (Salminen et al., 2004).

However, E. durans, E. casseliflavus and E. mundtii are “environmental enterococci”, which are very 206 common in plants and grass. Hence, they are very common in faecal samples of herbivores as they colonise their gut when herbivores graze on contaminated grass (Salminen et al., 2004) and this might explain the high prevalence of E. durans strains in this study (69% of the confirmed isolates). E. avium are found in bird droppings (Salminen et al., 2004), hence their presence in drinking troughs water might have arisen as a result of contamination by birds that occasionnaly drank from these sources in the investigated feedlots. Furthermore, eventhough E. gallinarum are associated with chicken faeces, there are reports of their detection in cattle and pig faeces (Pruksakorn et al., 2016). The detection of enterococcal isolates in soil/litter samples is also resulting from the contamination of the soil with cattle dung.

Vancomycin resistant genes were screened in the confirmed enterococcal isolates. Sixty-one percent

(n=176) of the 289 confirmed enterococcal isolates harboured Vancomycin resistance genes.

Specifically, we identified vanA, vanB and vanC resistance genes in 110, 31 and 38 isolates respectively.

Twelve, six and five isolates from soil/liter had vanA, B and C genes while eight, two and one isolates from water samples possessed these genes. In this study, the most-detected Vancomycin resistance gene was vanA (62%), trailed by vanC (21%) and vanB (17%). VR E. durans strains were the largest number of isolates and mostly harboured vanA resistance gene (84 VR E. durans). The strains of VR E. mundtii and VR E. avium screened, harboured only vanC resistance gene.

As mentioned earlier in this study, the connection between Vancomycin resistance and the misuse of

Avoparcin (a glycopeptide analogue of Vancomycin), as a growth promoter in industrial food animal production, was established (Aarestrup et al., 2000). However, the fact that it has been banned and is no more used in intensive cattle rearing, points out a disturbing truth: the continuous detection of

Vancomycin resistance in isolates from the different microbiota and more specifically from feedlots cattle may be due to the usage of other antimicrobials in industrial animal farming (Mannu et al., 2003;

Garcia-Migura et al., 2005; Seo et al., 2005; Marshall and Levy, 2011). Other studies have linked it to the pollution of the environment and water bodies with clinical wastes effluents (Iweriebor et al., 2015a;

Iweriebor et al., 2015b; Isogai et al., 2013; Moges et al., 2014). Although clinical wastes undergo treatment before discharge into the environment, antibiotics are not totally degraded in waste water 207 management processes. Hence, they revert to their initial state once released in the environment.

Moreover, such wastes are a potential hotspot for antimicrobial resistance genes because they carry along genetic determinants that can be taken up by commensal bacteria in the environment, conferring them new genetic attributes that they did not possess initially (Isogai et al., 2013, Tao et al., 2014).

Furthermore, antibiotics are not fully transformed into inactive compounds in the body of treated animals. They often revert to their initial state after they are excreted with dung in the manure (Boxall et al., 2002). Manure is used as fertilizer in the farms and will contaminate the soil and crops that might be harvested and probably given as feed to animals. Runoffs and seepages from the farms will contaminate surface and ground water bodies over time. This constitutes a continuous and endless loop, unless alternatives to antibiotics are taken into consideration. As mentioned earlier in this thesis, studies have linked the usage of Tylosin in intensive animal rearing to the emergence of VREs. This is because

Tylosin co-select for Vancomycin resistance among enterococci (Aarestrup, 2000). Further investigations were done in order to find out if, besides Tylosin, which is actually used in the investigated farms, the other antibiotics used do not also contribute to the emergence of these VREs.

6.1.3 Antimicrobial susceptibility testing and detection of Tetracycline resistance genes in VREs

PCR assays were used to screen for Tetracycline efflux pump genes among the VREs and antimicrobial susceptibility testing, specifically disc diffusion and MIC methods were further performed on the VREs isolated in this study (Chapter 4). 78% (n=138) of VREs harboured Tetracycline efflux pump genes.

Exactly, 15% (n=26), 32% (n=57), 63% (n=111) and 5% (n=9) of VREs harboured tetK, tetL, msrA/B and mefA Tetracycline efflux pump genes correspondingly.

Multidrug resistance was greatly detected among the tested isolates. Almost all the VREs were resistant to Vancomycin (98%) and Linezolid (98%) while no isolate was resistant to Ciprofloxacin (0% resistance). We also detected high resistance to Penicillin (94%) and Erythromycin (82%) while low resistance was observed with Chloremphenicol (13%). 64%, 47% and 40% of the isolates showed resistance to Tetracycline, Amoxicillin and Ampicillin correspondingly. TETR-AMPR-AMXR-VANR-

PENR-LINR-ERYR was the most encountered multidrug resistance pattern as reported in Chapter 4,

208 followed by AMPR-AMXR-VANR-PENR-LINR-ERYR and TETR-AMPR-VANR-PENR-LINR-ERYR.

Since Vancomycin and Linezolid were considered in the past as drugs of choice in the treatment of enterococcal infections, MIC tests were performed on strips coated with different concentrations of these two antimicrobials. The values ranged from 192 to 296 μg/ml for the two compounds.

A link between the detection of Tetracycline resistance genes in enterococcal isolates and the usage of

Tetracyclines in industrial animal farming, either as growth promoters or for therapeutic purposes, has been established previously (Wilcks et al., 2005); this justifies our findings. Furthermore, multidrug resistance in VREs is well documented. Antibiotic resistance is related to the usage of antimicrobials

(Marshall and Levy, 2011). In fact, the clusters analysis of the zones of inhibition diameters of our isolates (Chapter 4) somehow reveals a common exposure history to the antibiotics used in the investigated feedlots. Van genes confer resistance to Vancomycin and this is consistent with our results

(Iweriebor et al., 2015b, Matlou et al., 2019).

Eventhough we encountered few VREs, that were resistant to chloramphenicol and many VREs that were susceptible to ciprofloxacin in this study, several reports have highlighted enterococcal resistance to Ciprofloxacin and Chloramphenicol in animal farms (Aarestrup et al., 2000; Iweriebor et al., 2015b;

Tanih, 2016; Pruksakorn et al., 2016; Ünal et al., 2017). The therapeutic/prophylactic usage of Advocin and Chloramphenicol in the farms was indicated as the source of antimicrobial resistance detection in these studies. Furthermore, resistance to Tetracycline, Ampicillin, Amoxicillin, Penicillin and

Erythromycin is linked to the expression of resistance genes to these antibiotics, due to the widespread use of Chlortetracycline, Amoxicillin, Penicillin and Erythromycin in industrial animal farming, either for disease control or as feed supplements or growth promoters (Moyane et al., 2013;

Pruksakorn et al., 2016). Moreover, enterococci have an intrinsic resistance to cephalosporins and are naturally resistant to Penicillins because of the expression of low-affinity Penicillin binding proteins.

Furthermore, manure and soil/liter or water contaminated with animals’ excreta constitute hotspots of bacteria that carry mobile genetic resistance elements. These can be transferred horizontally and vertically to animals/humans commensals and pathogens, which in turn, will find their way through previously defined mechanisms, into the different ecological niches and the food chain (Tatsing et al., 209

2018; Ding et al., 2014; Thanner et al., 2016). Nevertheless, further investigation of the possession of other antimicrobial resistance genes (for instance ermB, strA, RlmA(II) and gyr resistance genes) was performed on the VREs screened in this study in order to comfirm our hypothesis.

6.1.4 Virulence profiles of the VRE isolates

Virulence factors are fundamental in the process of infection by a specific pathogen or bacterium. They confer the ability to cause illness in a particular host. The prevalence of debilitating diseases such as

HIV/Aids and diabetes is quite high in South Africa (Tatsing et al., 2018). In this context, an outbreak of potentially pathogenic VREs would be disastrous. Hence, constant monitoring of potentially resistant pathogens cannot be overemphasised. With respect to this, we deemed it important to assess the virulence profiles of the isolated VREs in this study. Moreover, phenotypic assays were used to determine if some of the virulence genes detected were expressed.

The possession of five clinically-relevant virulence genes was assessed. 49% (n=86) of the VREs isolated harboured these virulence genes (gelE, asa1, hyl, cylA and esp genes). Some isolates had more than one virulence gene but the most-encountered virulence profile was gelE-hyl (30 VREs) and was detected mainly in VR E. durans isolates. Moreover, 14% (n=12) virulent VREs produced gelatinase

(gelatine liquefaction) while 27% (n=23) and 7% (n=6) virulent VREs produced hyaluronidase and cytolysin (β-haemolysis on blood agar) respectively. The virulence genes reported in this study have been previously screened in enterococci elsewhere (Iweriebor et al., 2015b; Medeiros et al., 2014).

Eventhough not all the virulence genes reported in this study were expressed, their detection remains a cause for concern due to the health implications that could arise from their dissemination into the environment.

6.1.5 Whole genome sequencing of E. durans strain NWUTAL1 and E. gallinarum strain S52016

Two VREs that did not possess virulence attributes and the Tetracycline resistance genes tested for through PCR assays in this study, were processed for NGS (Chapter 5). These isolates were named as

VR E. durans strain NWUTAL1 and VR E. gallinarum strain S52016 isolated from faecal samples of cattle and soil/litter respectively. Both genome projects have been deposited at NCBI

210

DDBJ/ENA/GenBank under the accession numbers VMRQ00000000 and Bioproject with accession number PRJNA554257 for E. durans strain NWUTAL1 and VRLO00000000 and Bioproject with accession number PRJNA558653 for E. gallinarum strain S52016 respectively.

E. durans strain NWUTAL1 genome comprised a nucleotide sequence of 3,279,618 bp, 747 contigs, 58 tRNA, 4rRNA and 3,166 protein-coding genes while E. gallinarum strain S52016 genome presented a

2,374,946 bp nucleotide sequence, 18 contigs, 30 tRNA, 5 rRNA and 2,351 protein-coding genes. The antimicrobial resistance genes that were detected in strain NWUTAL1 genome included vanC2/C3 and vanXY-C (associated with Vancomycin resistance); tetA and S10p (associated with Tetracycline resistance); macA and macB (associated with Macrolides resistance), RlmA(II) (associated with Tylosine resistance); mdfA/Cmr (a multidrug efflux pump gene associated with quaternary ammonium compounds resistance); gyrA and gyrB (associated with Quinolones resistance); aac(6’)-la (associated with Aminoglycosides resistance) and blaEC (associated with resistance to β-lactams). Resistance genes that confer resistance to Streptomycin, Myxopiremine, Daptomycin, Bacitracin, Fusidic acid,

Fosfomycin, Trimethoprim, Isoniazid, Triclosan and Mupirocin were also detected in this strain (Chapter

6). Moreover, strain NWUTAL1 genome contained five plasmids as follows: IncFII; IncFll(pCoo);

Incl1; IncFIB(AP001918); and rep1. Virulence factors were also detected in strain NWUTAL1 genome among which pgaA and bopD (involved in biofilm formation), cspE (a cold shock protein), purB

(involved in colonisation processes), ompA (an outer membrane porin), perR (a peroxide stress regulator), ecbA (which codes for a cell wall surface anchor protein involved in adherence) and cusC (a

Copper/silver efflux RND transporter, outer membrane protein).

Comparatively, antimicrobial resistance genes screened in the genome of E. gallinarum strain S52016 included vanC1 and vanXY-C (involved in Vancomycin resistance), tetL and S10p (associated with

Tetracycline resistance), macA and macB (associated with Macrolides resistance), RlmA(II) (associated with Tylosine resistance), gyrB and msbA (associated with resistance to Quinolones), aac(6’)-la

(associated with Aminoglycosides resistance), blaEC (associated with resistance to β-lactams) and erm(A) (involved in Erythromycin resistance). Additionally, resistance genes that confer resistance to

Streptomycin, Myxopiremine, Daptomycin, Fusidic acid, Fosfomycin, Trimethoprim, Isoniazid, 211

Triclosan and Mupirocin were also detected in this strain (Chapter 6). Bacitracin resistance genes were not detected in this strain. Moreover, strain S52016 genome contained three plasmids as follows: IncFII;

Incl1; and rep1. The most important virulence factors screened in strain S52016 genome include ebpC and pgaA (involved in biofilm formation), cspE (a cold shock protein), purB (involved in colonisation processes), ompA and ompF (outer membrane porins) and cusC (a Copper/silver efflux RND transporter, outer membrane protein).

Multidrug resistance was detected in these two strains. This is explained by the fact that enterococci adapt to a specific environmental setting by incorporating genetic attributes (plasmids) that will make them resistant to one or more antimicrobials (Clewell et al., 2014). As mentioned earlier in this study,

Vancomycin resistance can either be intrinsic or acquired. Intrinsic resistance or low-level resistance refers to the inefficacy of a drug due to the possession of certain genes (vanC1, vanC2/C3 genes) that are inherent to a species. It is common in E. casseliflavus, E. durans, E. gallinarum and E. flavescens

(Ahmed and Baptiste, 2017) as reported elsewhere (Torres et al., 2018). Due to the fact that Avoparcin

(a growth promoter, which was initially found to be responsible for the emergence of VREs) was banned decades ago, the continuous detection of VREs worldwide, as is the case in this study, is due to the usage of alternative growth promoters, which continue to co-select Vancomycin resistance due to selective pressure. In fact, it was reported that the usage of the macrolide tylosin in Danish pig farms co-selected

Vancomycin resistance among enterococci (Aarestrup, 2000). Moreover, some reports have proved that the use of Erythromycin and Tetracyclines in intensive animal husbandry settings is also responsible for the co-selection of Vancomycin resistance (Aarestrup et al., 2000, Torres et al., 2018). Antimicrobials currently used in intensive animal husbandry in South Africa are listed in Chapter 2. This list comfirms our results as far as Vancomycin resistance and the other types of antimicrobial resistance genes detected in this study are concerned.

Administration of antimicrobials to animals either for therapeutic/prophylactic purposes or for growth promoting reasons, leads to significant disturbances in the gut microbial flora of animals, enhancing the proliferation of multidrug-resistant strains such as VREs. As revealed in previous investigations, enterococci (including those that might be resistant to a particular drug already) can acquire antibiotic 212 resistant genes and virulence factors upon interaction with other bacteria of the gut or of the environment

(soil/manure and water), leading to the rise of potentially pathogenic multidrug-resistant strains, which can be shed with faecal matter (Toomey et al., 2009; Doucet-Populaire et al., 1991 and Rizzotti et al.,

2009). This assertion comes in handy to explain our findings as far as E. durans NWUTAL1 and E. gallinarum strain S52016 are concerned.

In summary, the resistance to Vancomycin observed in all the VREs screened in this study is due to the extensive usage of other antimicrobials in the feedlots, which continue to co-select Vancomycin resistance due to selective pressure. Eventhough all the virulence genes screened genetically in the isolates were not expressed phenotypically, the detection of potentially pathogenic VREs in samples from the investigated feedlots remains a cause for concern.

6.2 Concluding remarks

The effects of antimicrobial usage in intensive animal husbandry cannot be undermined as its impact on the environment and, consequently, on the health of humans and animals, is commensurable. Waste products from feedlots may leak into water bodies used either for irrigation processes or for recreational purposes (Economou and Gousia, 2015). This may lead to the contamination of such water bodies with antibiotic-resistance genes, which will find their way into the food chain, through previously investigated mechanisms (Tatsing et al., 2018). The ultimate consequence of such a situation is a continuous cycle of transmission of antibiotic-resistance genes to commensals and other potentially pathogenic bacteria of the various environmental microbiota (Gonzalez and Escudero, 2012; Wei et al., 2019 and Zhang et al., 2019). In the long run, this leads to a narrowing of therapeutic options for community-aquiered infections, with disastrous perspectives for patients with an impaired immune system such as AIDS and diabetic patients.

With regard to the implications of extensive antimicrobial usage in animal farming on the well-being of living beings, there is an urgent need to foster resources in the development and implementation of alternatives to antibiotics. In this regard, the usage of probiotics, prebiotics and synbiotics should be promoted since they ameliorate the gut microbial flora thus, reducing the occurrence of diseases that

213 could require antimicrobial therapy, not to ignore the fact that a healthier gut microbiota boosts the immune system. Additionally, bacteriophages and phage cocktails represent a potential alternative to antibiotics as far as the treatment of bacterial infections is concerned. They can be used for prophylactic purposes because of their selectivity and their specificity towards particular bacteria. Tremendous research is currently underway in Eastern Europe on this subject and the outcomes are very promising.

In the South African context, a revision of the rules and regulations that address management issues with regard to antimicrobials is necessary in conjunction with initiatives that promote the aforementioned alternatives. However, the adoption of healthy lifestyles and environment-friendly attitudes should be at the forefront of any initiative.

6.3 Future perspectives

Tremendous efforts are currently being made worldwide to gather antimicrobial resistance data in order to come up with effective tools that could be used for surveillance systems. A limitation in this study was the inability to perform the whole genome sequencing of all virulent Vancomycin-resistant isolates screened from all the sampling points considered for this study. Thus, future investigations should consider this aspect since the genomic data generated in such enterprise will provide not only a glimse on potential drug targets for the development of new antibiotics, but will also assist in epidemiological assessments of the dissemination of antimicrobial resistance. Moreover, future studies should consider a comparative analysis of the genomes of such strains with that of resistant isolates from clinical environments.

REFERENCES

Aarestrup, F.M. (2000). Characterization of glycopeptide-resistant Enterococcus faecium (GRE) from

broilers and pigs in Denmark: genetic evidence that persistence of GRE in pig herds is

associated with coselection by resistance to macrolides. J. Clin. Microbiol. 38 (7), 2774 –

2777.

214

Aarestrup, F.M. (2015). The livestock reservoir for antimicrobial resistance: a personal view on changing

patterns of risks, effects of interventions and the way forward. Phil. Trans. R. Soc. B370.

Aarestrup, F.M., Kruse, H., Tast, E., Hammerum, A.M. and Jensen, L.B. (2000). Associations between

the use of antimicrobial agents for growth promotion and the occurrence of resistance among

Enterococcus faecium from broilers and pigs in Denmark, Finland, and Norway. Microb. Drug

Resist. 6, 63 – 70.

Ahmed, M.O. and Baptiste, K.E. (2017). Vancomycin-resistant enterococci: a review of antimicrobial

resistant mechanisms and perspectives of human and animal health. Microb Drug Resist. 10

(2), 21 – 22.

Ateba, C.N., Lekoma, K.P. and Kawadza, D.T. (2013). Detection of vanA and vanB genes in

vancomycin-resistant enterococci (VRE) from groundwater using multiplex PCR analysis. J.

Water Health. 11 (4), 684 – 691.

Ateba, C.N. and Mohapi, M.I. (2013). Isolation of vancomycin resistant enterococci isolated from leafy

vegetables (lettuce) from North West Province. Life Sci. 10 (4), 1163 – 1170.

Bekele, B. and Ashenafi, M. (2010). Distribution of drug resistance among enterococci and salmonella

from poultry and cattle in Ethiopia. Trop. Anim. Health Prod. 42 (5), 857 – 864.

Beukers, A.G., Zaheer, R., Goji, N., et al. (2017). Comparative genomics of Enterococcus sp. isolated

from bovine feces. BMC Microbiol. 17 (1), 52.

Boxall, A.B., Blackwell, P., Cavallo, R., Kay, P., Tolls, J. (2002). The sorption and transport of a

sulphonamide antibiotic in soil systems. Toxicol. Lett. 131, 19 – 28.

Butaye, P., Devriese, L.A. and Haesebrouck, F. (2003). Antimicrobial growth promoters used in animal

feed: Effects of less well-known antibiotics on gram-positive bacteria. Clin. Microbiol. Rev.

16 (2), 175 – 188.

Choi, M. and Choi, S. (2017). Analysis of Antimicrobial Resistance Pattern and Distribution of Multi-

drug Efflux Pump Genes and Virulence Genes in Enterococcus faecalis Isolated from Retail

Meat in Seoul. J. Food Hyg. Saf. 32 (2), 135 – 140.

215

Chunnilall, D., Peer, A., Naidoo, A. and Essack, S. (2015). An evaluation of antibiotic prescribing

patterns in adult intensive care units in a private hospital in KwaZulu-Natal. S. Afr. J. Infect.

Dis. 30 (1), 17 – 22.

Clewell DB, Weaver KE, Dunny GM, Coque TM, Francia MV, Hayes F. (2014). Extrachromosomal

and mobile elements in enterococci: transmission, maintenance, and epidemiology. In

Gilmore MS, Clewell DB, Ike Y, Shankar N (ed), Enterococci: from Commensals to Leading

Causes of Drug Resistant Infection. Eye and Ear Infirmary, Boston, MA, USA.

Department of Agriculture, Forestry and Fisheries (DAFF). South African Veterinary Strategy document

(2016–2026). March 2016.

http://www.nda.agric.za/docs/media/Vet%20strategy%20final%20signed.pdf. [Accessed

February 15, 2017].

Ding, G.C., Radl, V., Schloter-Hai, B., Jechalke, S., Heuer, H., Smalla, K., et al. (2014). Dynamics of

soil bacterial communities in response to repeated application of manure containing

sulfadiazine. PLoS One. 9(3), e92958.

Doucet-Populaire, F., Trieu-Cuot, P., Dosbaa, I., Andremont, A. and Courvalin, P. (1991). Inducible

transfer of conjugative transposon Tn1545 from Enterococcus faecalis to Listeria

monocytogenes in the digestive tracts of gnotobiotic mice. Antimicrob. Agents Chemother. 35

(1), 185 – 187.

Ergani-Ozcan, A., Naas, T., Baysan, B.O., Ogunc, D., Inan, D., et al. (2008). Nosocomial outbreak of

vancomycin-resistant Enterococcus faeciumin a paediatric unit at a Turkish university

hospital. J. Antimicrob. Chemother. 61 (5), 1033 – 1039.

Feighner, S.D. and Dashkevicz, M.P. (1987). Subtherapeutic levels of antibiotics in poultry feeds and

their effects on weight gain, feed efficiency, and bacterial cholyltaurine hydrolase activity.

Appl. Environ. Microbiol. 53 (2), 331 – 336.

Garcia-Migura, L., Pleydell, E., Barnes, S., Davies, R.H. and Liebana, E. (2005). Characterization of

Vancomycin-Resistant Enterococcus faecium Isolates from Broiler Poultry and Pig Farms in

England and Wales. J. Clin. Microbiol. 43 (7), 3283 – 3289. 216

Graham, J.P., Boland, J.J. and Silbergeld, E. (2007). Growth promoting antibiotics in food animal

production: an economic analysis. Public Health Rep.122, 79 – 87.

Graves, A., Weaver, R.W. and Entry, J. (2009). Characterization of enterococci populations in livestock

manure using BIOLOG. Microbiol. Res. 164 (3), 260 – 266.

Gonzalez-Zorn, B. and Escudero, J.A. (2012). Ecology of antimicrobial resistance: humans, animals,

food and environment. Int. microbial. 15, 101 – 109.

Henton, M.M., Eagar, H.A., Swan, G.E. and Vuuren Van M., 2011. Part VI GARP: Antibiotic

management and resistance in livestock production. S. Afr. Med. J. 101 (8), 583 – 586.

Isogai, N., Urushibara, N., Kawaguchiya, M., Ghosh, S., Suzaki, K., Watanabe, N., et al. (2013).

Characterization of Enterococcus faeciumwith macrolide resistance and reduced susceptibility

to quinupristin/dalfopristin in a Japanese hospital: Detection of extensive diversity in erm(B)-

regulator regions. Microb. Drug. Resist. 19, 298 – 307.

Iweriebor, B.C., Gaqavu, S., Obi, C.L., Nwodo, U.U. and Okoh A.I. (2015a). Antibiotic susceptibilities

of enterococcus species isolated from hospital and domestic wastewater effluents in Alice,

Eastern Cape Province of South Africa. Int. J. Environ. Res. Pub. Health. 12: 4231 – 4236.

Iweriebor, B.C., Obi, L.C. and A. I. Okoh, A.I. (2015b). Virulence and antimicrobial resistance factors

of Enterococcus spp. isolated from fecal samples from piggery farms in Eastern Cape, South

Africa. BMC Microbiol. 15 (136).

Jackson, C.R., Fedorka-Cray, P.J., Barrett, J.B. and Ladely, S.R. (2005). High-level aminoglycoside

resistant enterococci isolated from swine. Epidemiol. Infect. 133, 367 – 371.

Jackson, C. R., Lombard, J. E., Dargatz, D. A. and Fedorka-Cray, P.J. (2011). Prevalence, species

distribution and antimicrobial resistance of enterococci isolated from US dairy cattle.

Lett. Appl. Microbiol. 52, 41 – 48.

Klare, I., Heier, H., Claus, H., Bohme, G., Marin, S., Seltmann, G., Hakenbeck, R., Antanassova, V. and

Witte, W. (1995). Enterococcus faecium strains with vanA-mediated high-level glycopeptide

resistance isolated from animal foodstuffs and fecal samples of humans in the community.

Microb. Drug Resist. 1, 265 – 272. 217

Mannu, L., Paba, A., Daga, E., Comunian, R., Zanetti, S., Dupre, I. and Sechi, L. (2003). Comparison

of the incidence of virulence determinants and antibiotic resistance between Enterococcus

faecium strains of dairy, animal and clinical origin. Int. J. Food Microbiol. 88 (2-3), 291

– 304.

Marshall, B.M. and Levy, S.B. (2011). Food animals and antimicrobials: Impacts on human health. Clin.

Microbiol. Rev. 24(4), 718 – 733.

Matlou, P.D., Bissong, A.M.E., Tchatchouang, K.C.D., Adem, M.R., Tatsing Foka, F.E., Kumar, A. and

Ateba, C.N. (2019). Virulence profiles of vancomycin-resistant enterococci isolated from

surface and ground water utilized by humans in the North West Province, South Africa: a

public health perspective. Environ. Sci. Pollut. Res. 26 (15), 15105 – 15114.

Medeiros, A.W, Pereira, R.I., Oliveira, D.V., Martins, P.D., d’Azevedo, P.A., et al. (2014). Molecular

detection of virulence factors among food and clinical Enterococcus faecalis strains in South

Brazil. Bra. J. Microbiol. 45 (1), 327 – 332.

Mellon, M., Benbrook, C. and Benbrook K.L. (2001). Hogging It! Estimates of antimicrobial abuse in

livestock. Cambridge: Union of Concerned Scientists Publications.

http://www.ucsusa.org/assets/documents/food_and_agriculture/hog_chaps.pdf Accessed

24/April/2017.

Moges, F., Endris, M., Belyhun, Y., Worku, W. (2014). Isolation and characterization of multiple drug

resistance bacterial pathogens from waste water in hospital and non-hospital environments,

northwest Ethiopia. BMC Res. Notes. 7, 1 – 6.

Molale, I.G. and Bezuidenhout, C.C. (2016). Antibiotic resistance, efflux pump genes and virulence

determinants in Enterococcus sp. from surface water systems. Env. Sci. Pollut. Res. 23, 21501

– 21510.

Moyane, J.N., Jideani, A.I.O., Aiyegoro, O.A. (2013). Antibiotic usage in food producing animals in

South Africa and impact on human: antibiotic resistance. Afr. J. Microb. Res. 7 (24), 2990 –

2997.

218

Perumal-Pillay, V. and Suleman, F. (2017). Selection of essential medicines for South Africa: an analysis

of in-depth interviews with national essential medicines list committee members. BMC Health

Serv. Res. 17, 17.

Petersen, A., Andersen, J.S., Kaewmack, T., Somsiri, T. and Dalsgaard, A. (2002). Impact of integrated

fish farming on antimicrobial resistance in a pond environment. Appl. Environ. Microbiol. 68

(12), 6036 – 6042.

Pruksakorn, C., Pimarn, C., Boonsoongnern, A. and Narongsak, W. (2016). Detection and phenotypic

characterization of vancomycin-resistant enterococci in pigs in Thailand. Agric. Nat. Resour.

50 (3), 199 – 203.

Republic of South Africa. Nursing Act, 2005 (Act No. 33 of 2005, as amended).

http://www.gov.za/documents/nursing-act. [Accessed February 15, 2017].

Republic of South Africa. Pharmacy Act, 1974 (Act No. 53 of 1974, as amended).

http://www.gov.za/documents/pharmacy-act-16-oct-1974-0000. [Accessed February 15,

2017].

Republic of South Africa. Medicines and related substances act 1965 (ActNº 101 of 1965, as

amended).http://www.hpcsa.co.za/Uploads/editor/UserFiles/downloads/legislations/acts/med

icines_and_related_sub_act_101_of_1965.pdf. [Accessed February 15, 2017].

Rizzotti L, La Gioia F, Dellaglio F, Torriani S. (2009). Molecular diversity and transferability of the

tetracycline resistance gene tet(M), carried on Tn916-1545 family transposons, in enterococci

from a total food chain. Antimicrob. Agents Chemother. 96 (1), 43 – 52.

Roberts, M.C., Marzluff, J.M., Delap, J.H. and Turner, R. (2016). Vancomycin resistant Enterococcus

sp. from crows and their environment in metropolitan Washington State, United States of

America: is there a correlation between VRE positive crows and the environment? Vet.

Microbiol. 194, 48 – 54.

Salminen, S., Wright, A.V. and Ouwehand, A. (2004). Lactic acid bacteria. Microbiological and

functional aspects. Third edition, New York: Mercel Dekker.

219

Seo, K.S., Lim, J.Y., Yoo, H.S., Bae, W.K. and Park, Y.H. (2005). Comparison of vancomycin-resistant

enterococci isolates from human, poultry and pigs in Korea. Vet. Microbiol. 106 (3-4), 225 –

233.

Simner, P.J., Adam, H., Baxter, M., McCracken, M., Golding, G. and Karlowsky, J.A. (2015).

Epidemiology of vancomycin-resistant enterococci in Canadian hospitals (CANWARD study,

2007 to 2013)”, Antimicrob. Agents Chemother. 59 (7), 4315 – 4317.

Tanih, G.N. (2016). Genotypic and Phenotypic characterization of enterococci from cow dung and

environmental water sources in three selected dairy farms in Amathole District. M.Sc. thesis,

University of Fort Hare.

Tao, C.W., Bing-Mu, H., Wen-Tsai, J., Tsui-Kang, H., Po-Min, K., Chun-Po, H. et al. (2014). Evaluation

of five antibiotic resistance genes in wastewater treatment systems of swine farms by real-

time PCR. Sci. Total Environ. 496, 116 – 121.

Tatsing Foka, F. E. and Ateba, C.N. (2019): Detection of Virulence Genes in Multidrug Resistant

Enterococci Isolated from Feedlots Dairy and Beef Cattle: Implications for Human Health and

Food Safety. BioMed Res. Int. 2019 (5921840).

Tatsing Foka, F.E., Kumar, A. and Ateba, C.N. (2018). Emergence of vancomycin-resistant enterococci

in South Africa: Implications for public health. S. Afr. J. Sci. 114 (9-10), 20 – 26.

Taucer-Kapteijin, M., Hoogenboezem, W., Heiliegers, L., Danny de Bolster, H. and Medema, G. (2016).

Screening municipal wastewater effluent and surface water used for drinking water production

for the presence of ampicillin and vancomycin resistant enterococci. Int. J. Hyg. Environ.

Health. 16, 1 – 7.

Thanner, S., Drissner, D. and Walsh, F. (2016). Antimicrobial resistance in agriculture. Mbio. 7 (2),

02227 – 15.

Toomey, N., Monaghan, A., Fanning, S. and Bolton, D.J. (2009). Assessment of antimicrobial resistance

transfer between lactic acid bacteria and potential foodborne pathogens using in vitro methods

and mating in a food matrix. Foodborne Pathog. Dis. 6 (8), 925 – 933.

220

Torres, C., Alonso, C.A., Ruiz-Ripa, L, León-Sampedro, R., Del Campo, R. and Coque, M.T. (2018).

Antimicrobial resistance in Enterococcus sp. of animal origin. Microbiol. Spectrum. 6 (4),

ARBA 0032 – 2018.

Ünal, N., Aşkar, S. and Yıldırım, M. (2017). Antibiotic resistance profile of Enterococcus faecium

and Enterococcus faecalis isolated from broiler cloacal samples. Turk. J. Vet. Anim. Sci.

41 (2), 199 – 203.

Wei, R., He, T., Zhang, S., Zhu, L., Shang, B., Li, Z. and Wang, R. (2019). Occurrence of seventeen

veterinary antibiotics and resistant bacteria in manure-fertilized vegetable farm soil in four

provinces of China. Chemosphere. 215 (2019), 234 – 240.

Wilcks, A., Andersen, S.R. and Licht, T.R. (2005). Characterization of transferable tetracycline

resistance genes in Enterococcus faecalis isolated from raw food”, FEMS Microbiol. Lett. 243

(1), 15 – 19.

Zhang, Y-J., Hu, H-W., Chen, Q-L., Singh, B. K., Yan, H., Chen, D. and He, J-Z. (2019). Transfer of

antibiotic resistance from manure-amended soils to vegetable microbiomes. Environ. Int. 130

(2019), 104912.

221

LIST APPENDICES

Appendix 1: Map of the different sampling points

222

Appendix 2: Details of materials, chemicals enzymes, reagents and culture media used in this study

2.1 Culture media

2.1.1 Bile Esculin Agar g/L

Peptone 14.0

Bile salts 15.0

Ferric citrate 0.5

Esculin 1.0

Agar 15.0

Forty-five point five grams (45.5g) of the above components were dissolved in 1L of distilled water. The media was sterilised by autoclaving at 121oC for 15 minutes. Vancomycin

(16µg/ml) antibiotic was added to the media after autoclaving for supplementing. The media was then distributed into 90 mm petri dishes. Bile Esculin Agar (Sigma-Aldrich, South Africa) was used as a selective medium for VRE isolates.

2.1.2 Nutrient Broth g/L

Meat extracts 1.0

Yeast extract 2.0

Peptone 5.0

Sodium Chloride 8.0

Sixteen grams (16 g) of the above components were dissolved in 1L of distilled water. The media was distributed into McCartney bottles and autoclaved at 121oC for 15 minutes. Nutrient broth (Biolab, Merck Diagnostic, South Africa) was used as pre-enrichment medium for overnight cultures during DNA extraction.

223

2.1.3 Blood Agar g/L

Proteose peptone 15.0

Liver digest 1.5

Yeast extract 5.0

Sodium Chloride 5.0

Agar 12.0

Thirty-seven point five (37.5 g) of the above components were dissolved in 1L of distilled water. The media was autoclaved at 121oC for 15 minutes. The media was then supplemented with 5% bovine blood. Blood agar (TMast, DM100D; South Africa) was used as a differential medium for evaluating Cytolysin production.

2.1.4 Mueller-Hinton Agar g/L

Meat Infusion 5.0

Casein Hydrolysate 17.5

Soluble Starch 1.5

Agar 14.0

Thirty-eight grams (38 g) of the above components were dissolved in 1L of distilled water. The medium was distributed into McCartney bottles and autoclaved at 121oC for 15 minutes. The media was poured into plates and used to determine the antimicrobial susceptibility profiles of the isolates.

2.2 General chemicals

2.2.1 Buffers (50 X TAE)

Thermo Scientific 50X TAE Electrophoresis Buffer (40mM Tris, 20mM Acetic Acid and 1mM

EDTA) stock solution was supplied by Thermo Scientific, Johannesburg, South Africa. A 1X

224

TAE buffer working solution was prepared and used for resolving either DNA or amplified

PCR products by agarose gel electrophoresis.

2.2.2 Ethanol (70%) Alcohol

Absolute ethanol (99% v/v) was supplied by Merck, Diagnostics, South Africa. A 70% (v/v) working solution was prepared by aliquoting 750 ml of absolute ethanol into 1L Duran bottle and the volume adjusted to 1L by adding 300 ml of distilled water. The solution was stored at room temperature and used for sterilizing the working area.

2.2.3 Sodium Hypochlorite

A 10% (v/v) sodium hypochlorite (working solution) was prepared by aliquoting 10ml of sodium hypochlorite (stock solution) into 1L Duran bottle and the volume adjusted to 1L by adding 900ml of distilled water. The solution was stored at room temperature and used for disinfecting the working area.

2.3 DNA loading dye (6x)

0.25% (w/v) bromophenol blue

0.25% (w/v) xylene cyanol FF

30% (w/v) glycerol

A working solution was prepared by mixing all the above agents into 50 ml Duran bottle. The solution was filter sterilized using 0.45 μm filter and stored at room temperature. The solution was used for agarose gel electrophoresis of extracted DNA or amplified PRC products.

2.4 Ethidium bromide

225

A stock solution of 10mg/ml was prepared in 5 ml Duran bottle by dissolving the powder in distilled water and the solution was protected by wrapping the bottle with a masking tape and stored at 4oC. A final concentration of 0.1 μl was used for visualising DNA and PCR products in electrophoresis gel.

2.5 Enzymes and chemicals for DNA isolation

2.5.1 Lysozyme (10 mg/mL)

2.5.2 CTAB (Sigma H-6269) isolation buffer

2.5.3 2% (w/v) hexadecyltrimethylammonium bromide, 1.4 M, NaCl, 0.1% (v/v) of β- mercaptoethanol

2.5.4 Chloroform: isoamyl alcohol at ratios of 96:4.

2.5.5 0.1 volume of 3 M sodium acetate (NaOAc) and 0.7 volumes of iso-propanol

2.5.6 Cold 70% (v/v) ethanol

2.5.7 TE buffer

2.6 PCR Master Mix (2X Dreamtaq Green)

Thermo Scientific 2X DreamTaq Green Master Mix (0.4 mM dATP, 0.4 mM dCTP, 0.4 mM dGTP and 0.4 mM dTTP, 4mM MgCl2 and loading buffer) was used for PCR amplification of target genes. This was supplied by Inqaba Biotechnical Industries (Pty) Ltd, Sunnyside;

Pretoria, South Africa. The Master Mix was stored at -20oC.

2.7 Oligonucleotide primers

Primer sets used in this present study to amplify various genes encoding several determinants were synthesised and supplied by Inqaba Biotechnical Industries (Pty) Ltd, Sunnyside;

Pretoria, South Africa. The primer sets (Forward and Reverse) were stored in separate tubes at

226

-4 oC for future use. The working solution was prepared by aliquoting the required volume of forward and reverse primer set from the stock solution into a 1.5 μl sterile eppendorf tube.

2.8 DNA ladder or DNA marker

The standard DNA markers, O’GeneRuler 1 Kilo base pairs and GeneRuler 100 base pairs ranging from 250-10000 bp to 100-1000 bp fragments were supplied by Thermo Scientific

Company and used to determine the relative sizes of all amplicons immediately during agarose gel electrophoresis.

227

228

Appendix 3: Raw results

3.1: Results of biochemical tests of VREs

Isolates Catalase Motility H2S Lancefield Esculin Lactose D-glucose Haemolysin Hyalurinodase Gelatinase

production group D hydrolysis production

Positive 0 0 0 176 176 176 176 8 36 16

Negative 176 176 176 0 0 0 0 2 18 48

Undefined 0 0 0 0 0 0 0 166 122 112

Total 176 176 176 176 176 176 176 176 176 176

3.2: Results of antibiotic susceptibility testing

Status Antibiotics tested

TET AMP AMX VAN CHL PEN LIN CIP ERY

R 94 59 68 143 19 137 143 0 119

I 12 0 0 0 11 0 0 4 12

S 40 87 78 3 116 9 3 142 15

Total 146 146 146 146 146 146 146 146 146

229

230