Disclaimer: The manuscript and its contents are confidential, intended for journal review purposes only, and not to be further disclosed.

URL: https://circres-submit.aha-journals.org

Manuscript Number: CIRCRES/2018/313854DR1

Title: ATF6 regulates cardiac hypertrophy by transcriptional induction of the mTORC1 activator, Rheb

Authors: Christopher Glembotski Erik Blackwood Christoph Hofmann Michelle Santo Domingo Alina Bilal Winston Stauffer Donna Thuerauf Fred Kolkhorst Oliver Müller Tobias Jakobi Christoph Dieterich Hugo Katus Shirin Doroudgar Anup Sarakki Adrian Arrieta

For Circulation Research Peer Review. Do not distribute. Destroy after use.

Circulation Research Online Submission: https://circres-submit.aha-journals.org Circulation Research Homepage: http://circres.ahajournals.org Circulation Research Editorial Office 3355 Keswick Rd, Main Bldg 103 Baltimore, MD 21211 [email protected] Telephone: 410-327-5005

1 2 CIRCRES/2018/313233D-A 3 4 ATF6 regulates cardiac hypertrophy by transcriptional induction of the mTORC1 5 activator, Rheb 6 7 Erik A. Blackwood, B.S. 1, Christoph Hofmann1,2,3, Michelle Santo Domingo, B.S. 8 1, Alina S. Bilal, B.A. 1, Anup Sarakki, B.S. 1, Winston Stauffer, B.S.1, Adrian 9 Arrieta, M.S.1, Donna J. Thuerauf, M.S.1, Fred W. Kolkhorst, Ph.D.1, 10 Oliver J. Müller2,3,4, M.D., Tobias Jakobi3,5, Ph.D., 11 Christoph Dieterich3,5, Ph.D., Hugo A. Katus, M.D. 2,3, Shirin Doroudgar, Ph.D.2,3 12 and Christopher C. Glembotski, Ph.D. 1* 13 14 15 1San Diego State University Heart Institute and the Department of Biology, San 16 Diego State University, San Diego, CA 92182 17 2Department of Cardiology, Angiology, and Pneumology, University Hospital 18 Heidelberg, Innere Medizin III, Im Neuenheimer Feld 669, 19 69120 Heidelberg, Germany. 20 3DZHK (German Centre for Cardiovascular Research), Partner Site 21 Heidelberg/Mannheim, 69120 Heidelberg, Germany. 22 4 Department of Internal Medicine III, 23 University of Kiel, Arnold-Heller-Str.3, Kiel, Germany 24 5Section of Bioinformatics and Systems Cardiology, Department of Internal 25 Medicine III, Klaus Tschira Institute for Integrative Computational Cardiology, 26 University Hospital Heidelberg, Heidelberg, Germany 27 28 29 Short Title: ATF6 regulates cardiac growth 30 *Corresponding Author: Christopher C. Glembotski, the SDSU Heart Institute and 31 Department of Biology, San Diego State University, 5500 Campanile Drive, San Diego, 32 CA 92182, USA. Tel.: (619) 594-2959; FAX: (619) 594-5676; E-mail: 33 [email protected] 34 35 36 For Circulation Research Peer Review. Do not distribute. Destroy after use.

1

1 ABSTRACT:

2 Rationale: ER stress dysregulates ER proteostasis, which activates the transcription 3 factor, ATF6, an inducer of genes that enhance protein folding and restore proteostasis. 4 Due to increased protein synthesis, it is possible that protein folding and, thus, ER 5 proteostasis are challenged during cardiac myocyte growth. However, it is not known 6 whether ATF6 is activated, and if so, what its function is during hypertrophic growth of 7 cardiac myocytes. 8 Objective: To examine the activity and function of ATF6 during cardiac hypertrophy. 9 Methods and Results: We found that ATF6 was activated and ATF6-target genes were 10 induced in mice subjected to an acute model of trans-aortic constriction (TAC), or to 11 free-wheel exercise, which promote adaptive cardiac myocyte hypertrophy with 12 preserved cardiac function. Cardiac myocyte-specific deletion of Atf6 (ATF6 cKO) 13 blunted TAC- and exercise-induced cardiac myocyte hypertrophy and impaired cardiac 14 function, demonstrating a role for ATF6 in compensatory myocyte growth. Transcript 15 profiling and chromatin immunoprecipitation identified RHEB as an ATF6-target gene in 16 the heart. RHEB is an activator of mTORC1, a major inducer of protein synthesis and 17 subsequent cell growth. Both TAC and exercise upregulated RHEB, activated mTORC1, 18 and induced cardiac hypertrophy in WT mouse hearts, but not in ATF6 cKO hearts. 19 Mechanistically, knockdown of ATF6 in neonatal rat ventricular myocytes blocked 20 phenylephrine (PE)-, and insulin-like growth factor 1 (IGF1)-mediated Rheb induction, 21 mTORC1 activation, and myocyte growth, all of which were restored by ectopic RHEB 22 expression. Moreover, AAV9-RHEB restored cardiac growth to ATF6 cKO mice 23 subjected to TAC. Finally, ATF6 induced RHEB in response to growth factors, but not in 24 response to other activators of ATF6 that do not induce growth, indicating that ATF6 25 target gene induction is stress-specific. 26 Conclusions: Compensatory cardiac hypertrophy activates ATF6, which induces Rheb 27 and activates mTORC1. Thus, ATF6 is a previously unrecognized link between growth 28 stimuli and mTORC1-mediated cardiac growth. 29 30 Key Words: 31 Myocytes, cardiac protein folding, proteostasis, cardiac hypertrophy, ATF6, Rheb, 32 mTORC1 33

For Circulation Research Peer Review. Do not distribute. Destroy after use.

2

1 Non-standard Abbreviations and Acronyms 2 3 AAV adeno-associated virus 4 AdV adenovirus 5 ANOVA analysis of variance 6 ATF6 activating transcription factor 6 alpha 7 ATF6 cKO ATF6 alpha conditional knockout 8 Cat Catalase 9 ER endoplasmic reticulum 10 Grp78 78 kilodalton glucose-regulated protein, Hapa5 11 HR heart rate 12 HW heart weight 13 ICF immunocytofluorescence 14 LV left ventricle 15 LVEDV left ventricular end diastolic volume 16 LVESV left ventricular end systolic volume 17 LVIDD left ventricular inner diameter in diastole 18 LVIDS left ventricular inner diameter in systole 19 PWTD left ventricular posterior wall thickness in diastole 20 PWTS left ventricular posterior wall thickness in systole 21 Rheb Ras homologue enriched in brain 22 SR sarcoplasmic reticulum 23 TAC transverse aortic constriction 24 TL tibia length 25 TM tunicamycin 26 UPR unfolded protein response 27 28

For Circulation Research Peer Review. Do not distribute. Destroy after use.

3

1 INTRODUCTION: 2 3 Protein homeostasis, or proteostasis involves the coordination of protein synthesis 4 and folding to ensure proteome integrity and vital cell function1. In cardiac myocytes the 5 endoplasmic reticulum (ER) is a major site of synthesis of proteins that are critical for 6 proper function of the heart, including many calcium-handling proteins, receptors, and 7 secreted proteins, such as hormones, stem cell homing factors, and growth factors2, 3. 8 Therefore, ER proteostasis maintains the integrity of the cardiac myocyte proteome and, 9 thus, cardiac contractility. Increased protein synthesis in growing cardiac myocytes must 10 be balanced by increased protein-folding to avoid the accumulation of toxic misfolded 11 proteins; thus growth poses a potential challenge to cardiac myocyte proteostasis4. 12 However, the molecular mechanisms underlying the maintenance of ER proteostasis 13 during cardiac myocyte growth are not well understood. 14 ER proteostasis is controlled in all mammalian cells by several ER-transmembrane 15 sensors of protein misfolding, including the adaptive transcription factor, ATF65. When 16 protein synthesis surpasses the capacity of the protein-folding machinery, increases in 17 misfolded proteins cause the translocation of the ER-transmembrane, 670-amino acid, 18 90 kD form of ATF6, to the Golgi, where it is clipped, liberating an N-terminal fragment 19 that serves as a transcription factor. This 50 kD active form of ATF6 regulates a gene 20 program that is responsible for the expression of numerous proteins that enhance ER 21 protein folding, which adaptively restores the balance between protein synthesis and 22 folding6, 7. Thus, nodal proteostasis regulators, such as ATF6, that sense and maintain 23 this balance could play important roles in optimizing cardiac myocyte growth; however, 24 neither the activation nor the function of ATF6 in the setting of hypertrophic cardiac 25 growth has been examined. Accordingly, here we studied the effects of Atf6 deletion in 26 mouse hearts and in cultured cardiac myocytes during physiologically-relevant 27 maneuvers known to promote compensatory cardiac hypertrophy in either a concentric 28 (pressure overload)8 or eccentric (exercise)9 manner, positing that the absence of ATF6 29 would imbalance proteostasis, which would be maladaptive. 30 Both growth maneuvers activated ATF6, and Atf6 deletion was maladaptive, as 31 evidenced by impaired cardiac function. However, surprisingly, cardiac myocyte growth 32 was also impaired upon Atf6 deletion. This was unexpected, since Atf6 is not known to 33 be required for cardiac myocyte growth. Further mechanistic studies showed that ATF6 34 is activated as a result of the increased demands placed on the ER protein folding 35 machinery during growth-related increases in protein synthesis. Moreover we found that 36 Atf6 serves a previously unrecognized role as a molecular link between growth stimuli 37 and activation of mammalian/mechanistic target of rapamycin complex 1 (mTORC1), a 38 major promoter of protein synthesis and consequent growth of cardiac myocytes10-15. 39 Two conditionsFor Circulation need to be met forResearch mTORC1 to be Peer activated; Review. 1) in resp onseDo tonot a growth 40 stimulus, mTORC1 needs to translocate to organelles, such as lysosomes16, where it 41 encounters the small GTPase distribute. activator of Destroy mTORC1, Rheb after17, and use. 2) Rheb must be 42 active and present in sufficient quantities18. In terms of Rheb activation, it is known that 43 growth stimuli lead to the phosphorylation and, thus, inhibition of the Rheb GTPase- 44 activating protein (GAP), TSC1/TSC219, which increases the GTP-loading state and, 45 thus, the activity of Rheb. However, the molecular mechanisms underlying the Rheb 46 gene expression are less well understood. Here, we showed, for the first time, that ATF6 47 is an inducer of Rheb, and in this way, ATF6 coordinates protein synthesis and protein 48 folding, ensuring the adaptive maintenance of proteostasis in growing cardiac myocytes. 49 Thus, ATF6 is a newly identified and essential member of mTORC1 growth signaling in 50 cardiac myocytes in the heart.

4

1 Methods: 2 Further details on the Methods can be found in the Online Supplement. 3 Laboratory Animals: The research reported in this paper has been reviewed and 4 approved by the SDSU Institutional Animal Care and Use Committee and it conforms to 5 the Guide for the Care and Use of Laboratory Animals published by the National 6 Research Council. 7 ATF6 Floxed Mice: Atf6�fl/fl mice used in this study were generated by Dr. Gokhan S. 8 Hotamisligil20. All of the mice used in this study were 10 week-old males. 9 Statistics: Unless otherwise stated, values shown are mean ± SEM and statistical 10 treatments are either a t-test or a one-way ANOVA followed by Newman-Keuls post hoc 11 analysis. 12

For Circulation Research Peer Review. Do not distribute. Destroy after use.

5

1 RESULTS: 2 • ATF6 is required for cardiac myocyte hypertrophy in response to pressure overload 3 To examine the role of Atf6 in cardiac myocytes on heart growth, we generated an 4 Atf6 conditional knockout mouse (ATF6 cKO) by injecting Atf6fl/fl mice with a recombinant 5 AAV9 that encodes Cre under the control of the cardiac troponin T promoter (Fig. 1A). 6 Compared to Atf6fl/fl injected with AAV9-Con, injection with AAV9-CRE effectively 7 reduced Atf6 mRNA from cardiac myocytes isolated from Atf6fl/fl mice, but not non- 8 cardiac myocytes, or liver (Fig. 1B). Atf6fl/fl mice injected with AAV9-Con (Con) or AAV9- 9 CRE (ATF6 cKO), were subjected to TAC and examined 7d later, when hypertrophic 10 growth is maximal21 and structural remodeling is compensatory22, 23. TAC activated ATF6 11 in Con mouse hearts, as evidenced by increased levels of the active, 50 kD form of 12 ATF6 (Fig. 1C). This was unexpected, since ATF6 is not known to be activated in 13 cardiac myocytes by any growth stimulus. Coordinate with ATF6 activation, TAC 14 increased expression of numerous canonical ATF6 target genes (Fig. 1C-D; Online Fig. 15 IA). As expected, ATF6 was undetectable in ATF6 cKO mouse hearts (Fig. 1C-D). TAC 16 increased Con mouse heart weights, but, surprisingly, this growth effect was significantly 17 blunted in ATF6 cKO mouse hearts (Fig. 1E). TAC increased Nppa and Nppb 18 expression to similar extents in both Con and ATF6 cKO mice, while the induction of 19 Myh7 and Col1a1 was slightly greater in the ATF6 cKO mice (Fig. 1F). This, coupled 20 with the decrease in Atp2a2 i.e. SERCA2a in ATF6 cKO mice, suggests a blunted 21 compensatory response in the absence of ATF6. In Con mouse hearts, cardiac function, 22 including fractional shortening was preserved, while chamber dimensions were 23 unchanged after TAC (Fig. 1G; Online Table I) and cardiac myocyte size was increased 24 (Fig. 1H), consistent with the compensatory nature of cardiac hypertrophy in mice at this 25 time after pressure overload24. However, in contrast to Con, in ATF6 cKO mice 26 subjected to TAC myocyte size was decreased compared to Con (Fig. 1H) and fractional 27 shortening was impaired (Fig. 1G) with increased chamber dimensions, such as LVEDV 28 and LVESV, despite high frequency Doppler measurements between right and left 29 carotid arteries demonstrating consistent and identical pressure overload in TAC- 30 operated Con and ATF6 cKO mice (Online Table I). Along with increased plasma levels 31 of cTnI (Online Fig. IB), these results are consistent with the initial stages of chamber 32 dilation, as well as myocardial damage and decompensation in the ATF6 cKO mice. 33 Thus, ATF6 is activated by pressure overload and is required for hypertrophy. 34 35 • ATF6 is required for cardiac myocyte hypertrophy in response to exercise 36 To assess the breadth of the impact of ATF6 on heart growth, we examined the 37 effects of cardiac myocyte-specific ATF6 deletion in mice subjected to free-wheel 38 exerciseFor25, 26 Circulation(Fig. 2A). Similar toResearch TAC, exercise Peersurprisingly Review. activated ATF6Do notand 39 induced ATF6 target genes distribute. in Con, but not Destroy in ATF6 cKO after mice (Fig. use. 2B-C). As expected, 40 compared to Con sedentary mice, Con mice subjected to exercise exhibited increased 41 heart weights and LV wall thickness, as well as myocyte size (Fig. 2D, 2F; Online Table 42 II). While Nppa and Nppb were mildly increased, Atp2a2 was robustly increased by 43 exercise in Con mouse hearts, and there was no change in Myh7 or Col1a1 (Fig. 2E); 44 this gene profile is typical of adaptive cardiac hypertrophy in exercising mice24, 27. In 45 contrast to Con, in ATF6 cKO mice subjected to exercise there was no change in heart 46 weights or LV wall thickness (Fig. 2D; Online Table II), reduced increases in myocyte 47 size (Fig. 2F), and reduced induction of ATF6 target genes (Fig. 2C). Compared to 48 exercised Con mice, exercised ATF6 cKO mice showed no increase in Nppa, and

6

1 neither Con nor ATF6 cKO mice showed significant changes in Nppb or Myh7. 2 Importantly, while Con mice exhibited decreased Col1a1 and increased Atp2a2 after 3 exercise, which are beneficial genetic changes typical of this regime, the ATF6 cKO 4 mice failed to adapt and had increased Col1a1 and no change in Atp2a2 (Fig. 2E). 5 Thus, ATF6 is activated by exercise and is required for compensatory hypertrophy in this 6 exercise model. 7 8 • Rheb is an ATF6-inducible gene in the heart 9 Since there are no known Atf6-inducible genes that are required for cardiac myocyte 10 growth, we turned to transcript profiling for clues to the identities of such genes. RNA 11 sequencing of the hearts of our previously published transgenic mice that express 12 activated ATF628 (Online Table III) revealed that ATF6 induced 51 genes in the gene 13 ontology category, small GTPase mediated signal transduction; this category includes 14 the ras-related small GTPase, Ras homologue enriched in brain (RHEB) (Fig. 3A; 15 Online Fig. IIA). Rheb is required for activation of mTORC1, however, only in the 16 presence of a growth stimulus. Accordingly, we focused on Rheb as a candidate gene 17 through which ATF6 might contribute to cardiac hypertrophy, pursuing the hypothesis 18 that increased Rheb gene expression and subsequent mTORC1 activation under growth 19 conditions are Atf6-dependent. The upregulation of RHEB by ATF6 in mouse hearts 20 observed by RNA sequencing was confirmed by qRT-PCR (Online Fig. IIB). Consistent 21 with ATF6 as a possible transcriptional inducer of Rheb was our finding that the Rheb 22 promoter has two potential ATF6 binding sites, which we call ER stress response 23 elements (ERSEs)-1 and -2 (Fig. 3B). Chromatin immunoprecipitation (ChIP) showed 24 that ATF6 binds to both sites in the RHEB gene in neonatal rat ventricular myocytes 25 (NRVM) (Fig. 3C). The progressive decline in RHEB promoter activity in plasmids that 26 encode 5’-truncation deletions of the rat RHEB promoter driving luciferase demonstrated 27 the importance of these putative ERSEs in ATF6-mediated RHEB promoter activation 28 (Online Fig. IIC). To mechanistically investigate the functional involvement of these 29 ERSEs further, we mutated either or both ERSE (Fig. 3D). Mutating either ERSE 30 decreased ATF6 RHEB promoter activation by ATF6, however, the promoter-proximal 31 site, i.e. ERSE-1 appeared to have the largest effect (Fig. 3E). To determine whether 32 ATF6 is sufficient to induce Rheb in the heart, in vivo, mice were injected with a 33 recombinant AAV9 that encodes activated ATF6, i.e. ATF6(1-373). qRT-PCR and 34 immunoblotting demonstrated that activated ATF6 increased RHEB mRNA and protein 35 in the heart (Online Fig. IID-F). These results are the first demonstration in any cell type 36 that ATF6 induces RHEB, implicating ATF6 as a critical link between growth stimuli and 37 mTORC1 activation. 38 39 • RHEBFor induction Circulation during pressure Research-overload and Peer exercise Review. requires ATF6 Do not distribute. Destroy after use. 40 We found that RHEB was strongly induced in Con mice after either TAC or exercise, 41 but not in ATF6 cKO mouse hearts (Fig. 3F-K). Thus, ATF6 is necessary for the 42 upregulation of RHEB in these models of cardiac hypertrophy, in vivo. Since RHEB is 43 required for mTORC1 activation in response to a growth stimulus, we assessed 44 mTORC1 pathway activation. As expected, pressure-overload and exercise both 45 activated mTORC1, as shown by increased phosphorylation of mTORC1 (Ser2448), p70 46 ribosomal S6 kinase (S6K; Thr389), and eukaryotic translation initiation factor 4E- 47 binding protein 1 (4E-BP1; Thr37/46); however, mTORC1 activation was blunted in 48 ATF6 cKO mouse hearts (Fig. 3G, J), consistent with the key role for ATF6 in mTORC1 49 activation by growth stimuli. To examine whether ATF6 might affect other signaling

7

1 pathways leading to mTORC1 activation, we assessed the phosphorylation of Akt on 2 Ser308 and the phosphorylation of TSC2, both of which lie upstream of Rheb in the 3 mTORC1 signaling pathway. We found that pressure overload increased 4 phosphorylation of Akt (Thr308) and TSC2 (Thr1462), as expected; however, in contrast 5 to Rheb expression, neither of these phosphorylation events were affected by ATF6 6 deletion (Online Fig. IIIA). Thus, the deficit in mTORC1 activation in ATF6 cKO mice 7 must reside downstream of Akt and TSC2, i.e. Rheb. We also examined whether ATF6 8 deletion affected other well known canonical hypertrophy signaling pathways, but found 9 that neither phosphorylation of Akt on Ser473, Erk phosphorylation (Online Fig. IIIA) or 10 calcineurin activation (Online Fig. IIIB) were affected by ATF6 deletion. These results 11 pinpoint the growth deficit in the ATF6 cKO mouse hearts to the inability to upregulate 12 Rheb. 13 14 • RHEB is required for PE- and IGF1-induced cardiac myocyte growth 15 To explore the mechanistic relationship between ATF6 and RHEB we used RHEB 16 and ATF6 loss-of-function approaches in NRVM treated with the α1-adrenergenic 17 receptor agonist, phenylephrine (PE) or insulin-like growth factor 1 (IGF1), which 18 recapitulate much of the intracellular signaling during pressure-overload or exercise- 19 induced hypertrophy, respecitvely29. Knocking down either ATF6 or RHEB abrogated the 20 effects of PE or IGF1 on cardiac myocyte hypertrophy, fetal gene induction, ATF6 target 21 gene induction and mTORC1 signaling (Fig. 4A-E; Online Fig. IVA, IVC; Fig. 5A-E; 22 Online Fig. IVB), but had no effect on mTORC2 signaling, as assessed by 23 phosphorylation of Akt on Ser-473 (Online Fig. IVD-E). To further substantiate the 24 results with Rheb siRNA, we used a different Rheb loss-of-function approach involving 25 the Rheb inhibitor, Lonafarnib30. Lonafarnib mimicked the effects of Rheb siRNA on PE- 26 and IGF1-mediated ATF6 activation, mTORC1 signaling, ATF6 gene induction and 27 growth in NRVM (Online Fig. V). 28 To complement ATF6 loss-of-function approach, we used a gain-of-function 29 approach, examining the effects of ectopic expression of ATF6 and RHEB. In the 30 absence of a growth stimulus, ectopic expression of ATF6 did not increase myocyte 31 growth, as expected, due to the absence of mTORC1 activation under these conditions 32 (Online Fig. VIA Con). Either PE or IGF1 increased myocyte growth, which was 33 completely blocked by the mTORC1 inhibitor, rapamycin, as expected (Online Fig. VIA, 34 PE and IGF1, red vs blue). Ectopic ATF6 augmented the growth-promoting effects of 35 PE and IGF1, which were also completely blocked by rapamycin (Online Fig. VIA, PE 36 and IGF1, black and green). Moreover, ectopic ATF6 slightly augmented PE- and 37 IGF1-stimulated NRVM growth, however, it was not able to restore growth in cells 38 treated with either RHEB siRNA or Lonafarnib (Online Fig. VIB-C). As expected, ectopic 39 expressionFor of Circulation RHEB had no effect Research in the absence Peer of a growth Review. stimulus; Dohowever, not upon a 40 growth stimulus , the loss distribute. of growth and mTORC1 Destroy activation after seen use. with ATF6 siRNA were 41 completely restored by ectopically expressed RHEB (Fig. 4F-H; Fig. 5F-H). 42 • Mechanistic Relationship between Growth Signaling and the UPR 43 The unfolded protein response (UPR), which in addition to ATF6, is mediated by 44 PERK and IRE15, is activated by the misfolding of proteins induced by a variety of 45 chemical and pathophysiological treatments, most of these do not promote growth. In 46 fact, the UPR is not widely considered to be growth-promoting. Accordingly, since we 47 found here that ATF6 can be activated during growth, we assessed how growth affected 48 the other arms of the UPR. We found that PE and IGF1 activated all three arms of the

8

1 UPR in a rapamycin-sensitive manner (Online Fig. VIIA), indicating that mTORC1 2 activation is required for UPR activation during growth. We then individually knocked 3 down ATF6, PERK and IRE1, and found that only ATF6 knockdown blunted growth 4 (Online Fig. VIIB-C). To ensure that the effects of ATF6 on growth are dependent on 5 the transcriptional effects of ATF6, we showed that NRVM infected with AdV-ATF6(1- 6 373) [active] exhibited increased growth in response to PE, especially when endogenous 7 ATF6 was knocked down, however AdV-ATF6(94-373) [trancriptionally inactive] did not 8 (Online Fig. VIID). 9 Next, we examined the effect on mTORC1 signaling of other UPR stimulators that do 10 not affect growth, such as tunicamycin (TM), which increases ER protein misfolding by 11 inhibiting protein glycosylation in the ER. In contrast to PE, activation of ATF6 by TM 12 was not dependent on RHEB (Fig. 6A-B). Additionally, while RHEB knockdown blocked 13 PE- and IGF1-mediated induction of ATF6 target genes, (Fig. 4E, 5E), it had no effect 14 on TM-mediated induction of ATF6 target genes (Fig. 6C). Thus, there are 15 RHEB/growth-dependent and RHEB/growth-independent pathways that lead to ATF6 16 activation and induction of ATF6 target genes. 17 • Stimulus-dependent Differential Induction of ATF6 Target Genes 18 We dived deeper into the mechanism of RHEB/growth-dependent and RHEB/growth- 19 independent pathways of ATF6 activation. We previously showed that ATF6 induces 20 some proteins targeted to the ER, where they enhance protein folding (e.g. 21 HSPA5/GRP78), and others located outside the ER, where they serve other functions. 22 One example of the latter is our finding that I/R activates ATF6-dependent induction of 23 catalase (CAT), which resides in peroxisomes and neutralizes damaging ROS. Here, we 24 provide an additional example of an ATF6-inducible gene, RHEB, that encodes a protein 25 that resides outside the ER. Because of the differences in the locations and functions of 26 Hspa5, Cat, and Rheb, we posited that they might be differentially induced by treatments 27 that cause ER protein misfolding (TM), or oxidative stress (I/R) but do not induce growth, 28 or to a treatment that induces growth (PE). While, for the most part, the mRNA levels for 29 all three genes were increased by all the treatments, the quantitative nature of induction 30 differed depending on the treatments, such that TM, sI/R, and PE had the greatest 31 effects on induction of Hspa5, Cat, and Rheb, respectively (Fig. 6D). Notably, CAT 32 induction was highly selective, showing an approximate 6-fold induction by sI/R, and 33 much less induction by either TM or PE (Fig. 6D, Cat). Remarkably, RHEB induction 34 was also highly selective, showing the least induction by TM or sI/R, while being induced 35 by over 5-fold by PE (Fig. 6D, Rheb). Importantly, all of these effects depended on 36 ATF6 (Fig. 6E). 37 38 ToFor dissect Circulation this stimulus-dependent Research differential Peer gene induction Review. further, Do we notshowed 39 that promoter/luciferase reporter constructs for Hspa5, Cat, and Rheb (Fig. 6F) were 40 also differentially induced distribute. by TM, sI/R and Destroy PE, mimicking after mRNA use. induction (Fig. 6G). 41 Importantly, as with the mRNA, all of these effects depended upon ATF6 (Fig. 6H). 42 43 These stimulus-specific effects of ATF6 on Hspa5, Cat, and Rheb could be due to 44 the stimulus-dependent binding of ATF6 to the ERSEs in these genes. To test this, we 45 developed a new method for measuring ATF6 binding to the HSPA5, CAT, and RHEB 46 promoters in cells treated with TM, sI/R or PE. To this end we generated a recombinant 47 AdV FLAG full-length p90 ATF6, i.e. ATF6(1-670), which remains in the ER in the 48 absence of ER stress, and, therefore, can not bind to ERSEs. NRVM expressing FLAG- 49 ATF6(1-670) were treated with TM, sI/R or PE, each of which induce the formation of the

9

1 FLAG-tagged N-terminal, active p50 form of ATF6, so it can bind to ERSEs. ChIP 2 demonstrated that the binding of ATF6 to these genes differed, depending on the 3 stimulus, mimicking the mRNA induction and promoter activation (Fig. 6I). These effects 4 were not seen with AdV encoding only FLAG, verifying ATF6-specificity (Fig. 6J). This 5 shows, for the first time in any cell type, that ATF6 can be activated by a broad spectrum 6 of conditions that affect proteostasis in a variety of ways, yet the relative induction of 7 ATF6 targets differs in a condition-dependent manner. 8 9 • Ectopic Expression of RHEB Restores Cardiac Growth to ATF6 cKO Mouse Hearts 10 Next, we assessed the effects of ectopic expression of RHEB in the heart, in vivo 11 using a new recombinant AAV9-RHEB (Fig. 7A). In ATF6 cKO mice, AAV9-RHEB 12 effectively restored the loss of mTORC1 signaling, hypertrophic growth and cardiac 13 function, as well as the hypertrophic and ATF6 gene programs in response to TAC (Fig. 14 7B-F; Online Table IV). Thus, it is by increasing RHEB that ATF6 influences mTORC1 15 signaling and subsequent cardiac myocyte growth, fetal gene expression and ATF6- 16 target gene expression. 17 18 • ATF6 Activation in Response to Growth Requires mTORC1 Activation, Protein 19 Synthesis and Protein Misfolding 20 To this point, mTORC1 and ATF6 activation were shown to be dependent on each 21 other under the growth conditions examined. To account for this interdependence, we 22 posited a temporal sequence of events, wherein the initial event is mTORC1 activation, 23 which depends on basal levels of Rheb (Fig. 8A, Step 1). This initial mTORC1 activation 24 precedes, but drives initial increases in protein synthesis that place demands on the 25 protein-folding machinery (Fig. 8A, Step 2), which activates ATF6. Then, ATF6 serves 26 canonical- and non-canonical roles (Fig. 8A, Steps 3, 4), the latter of which includes 27 RHEB induction (Fig. 8A, Step 5), which is necessary to sustain mTORC1 activation 28 (Fig. 8A, Step 6) and the continued increases in protein synthesis that required for 29 growth and cardiac myocyte hypertrophy (Fig. 8A, Step 7). To examine this hypothesis, 30 a TAC time course was carried out. At 3h of TAC, a time when mTORC1 is activated, 31 but protein synthesis has not yet increased, mTORC1 signaling was activated, but ATF6 32 was not activated and RHEB was not induced (Fig. 8B, 3h). However, at both 2 and 7d 33 of TAC, when protein synthesis is increased, mTORC1 signaling and ATF6 were 34 activated, and RHEB was induced (Fig. 8B, 2d and 7d). As expected, heart weights 35 increased as a function of TAC time from 3h to 7d (Fig. 8C; Online Table V). Thus, 36 mTORC1 activation occurred soon after TAC and preceded ATF6 activation. Further 37 supporting our hypothesis that initially, mTORC1 activation precedes ATF6 activation 38 were resultsFor Circulationof a 3h TAC experiment Research in ATF6 cKO Peer mice, where,Review. in contrast Do to not longer 39 times of TAC (i.e. 7d - Fig.distribute. 3G), the deletion Destroy of ATF6 did after not affect use. mTORC1 activation 40 (Fig. 8D). As expected, heart weights did not change under these conditions (Fig. 8E; 41 Online Table VI). 42 43 Consistent with these results, when examining the effect of PE and IGF1 at the 44 earliest time points , just prior to when protein synthesis is greatest in NRVM, knocking 45 down ATF6 did not affect mTORC1 activation (Online Fig. VIIIA), but again, ATF6 46 activation was rapamycin-dependent (Online Fig. VIIIB). Moreover, inhibiting protein 47 synthesis with cycloheximide had no effect on mTORC1 activation at these short times 48 of PE or IGF1 treatment, but impaired ATF6 activation and RHEB induction, indicating 49 that protein synthesis is required for ATF6 activation and subsequent RHEB induction

10

1 (Online Fig. VIIIC). Finally, in NRVM treated with the chemical chaperone, 4PBA, PE 2 and IGF1 activated mTORC1 however, ATF6 was not activated and RHEB was not 3 induced (Online Fig. VIIID), indicating the increase in protein folding demand driven by 4 increases in protein synthesis are responsible for activating ATF6. 5 6

For Circulation Research Peer Review. Do not distribute. Destroy after use.

11

1 DISCUSSION: 2 • ATF6 is Required for Growth of the Heart 3 While previous studies reported increased expression of a few ER stress genes in 4 mouse models of pressure overload, implicating ER protein misfolding31-34, prior to our 5 study here, neither the activation nor the roles for ATF6 in cardiac myocytes during 6 cardiac growth had been examined. Here, we showed, for the first time that ATF6, a 7 major mediator of the UPR, is activated by diverse growth stimuli and that ATF6 is 8 required for growth of the heart in response to these stimuli. We determined that the 9 mechanism of this effect involves ATF6-mediated induction of RHEB (Fig. 8A). It was 10 surprising to find that ATF6 is required for heart growth, considering the UPR is not 11 widely known to to be involved in growth processes. However, this non-canonical role for 12 ATF6 complements its canonical role as a sensor of misfolded proteins in the ER and, 13 as such, a sensor of increases in protein folding demand, which occur during growth. 14 Thus, ATF6 maintains proteostasis and proteome integrity when the heart is stimulated 15 to grow in a compensatory manner. 16 17 We also found that, depending on the stimulus, ATF6 target genes are differentially 18 expressed due to the unique effects that the stresses have on ATF6 binding to, and 19 thus, transcriptional activation of ATF6 target genes. Such differential ATF6 target gene 20 induction by treatments that all activate ATF6 suggests that there are yet-to-be- 21 described regulatory layers that fine-tune the ATF6 gene program to best adapt to the 22 conditions. Some possible mechanisms that could contribute to this differential 23 expression are beginning to emerge, as it has been shown that ATF6 can interact with 24 other transcription factors, such as Nrf1, PGC1α and β, and ERRγ,35-37 which changes 25 the transcriptional programming in ways that fine-tune ATF6 target gene induction. 26 27 • Rheb in the Heart 28 Rheb was originally documented as an mTORC1 activator in the brain38, this role has 29 been demonstrated in numerous other tissues and organs17, 39, 40. Global deletion of 30 Rheb is embryonic lethal, in part due to cardiac defects41, demonstrating the importance 31 of Rheb-mediated mTORC1 activation in heart growth and development. The growth- 32 promoting effect of Rheb gain-of-function was demonstrated in adult rat ventricular 33 myocytes transfected with adenovirus encoding Rheb42. However, overexpression of 34 Rheb in transgenic mice increased infarct size, in part because Rheb inappropriately 35 decreased autophagy, which is adaptive in this disease setting43. Pharmacological 36 inhibition of Rheb in mice subjected to TAC for three weeks was cardioprotective14. 37 TheseFor findings Circulation differ from our study Research, perhaps because Peer different Review. times after Do TAC not were 38 studied, or different approaches distribute. to decreasing Destroy Rheb. It afteris also possible use. that Rheb 39 induction and mTORC1 activation have different roles in a severe afterload-induced 40 hypertrophy model, such that acute activation works in a compensatory manner, but 41 chronic activation drives decompensation. The αMHC-CRE-dependent conditional 42 deletion of Rheb from mouse cardiac myocytes resulted in atrophic hearts, heart failure, 43 and death within 1-2 weeks after birth, a timeframe that aligns with the time of αMHC 44 expression after birth12, 44. Although there have been no studies prior to ours 45 mechanistically connecting Atf6 with Rheb induction, one study in tumor cells45, and 46 another in the setting of Huntington’s disease46, have implicated such a connection and, 47 therefore, support the findings reported here.

12

1 • Feedback Regulation of ATF6-mediated Growth 2 Our study describes a mechanism whereby ATF6 matches protein synthesis with 3 folding in times of increased growth; since this constitutes a positive feedback 4 mechanism, we reason that there must also be mechanisms that interrupt this feedback, 5 thereby limiting the rate of growth driven by the ATF6-Rheb-mTORC1 axis. One such 6 mechanism might involve Rheb itself, which has been shown to activate PERK47. 7 Mechanisms such as this underscore the complexities of proteostasis, raising questions 8 about how Rheb switches from protein synthesis activator to inhibitor. 9 • Conclusions 10 The results of our study firmly place ATF6 in a critical position as a determinant of 11 cardiac growth (Fig. 8A). Moreover, since ATF6 is ubiquitously expressed, our findings 12 underscore the widespread importance of the ATF6-Rheb-mTORC1-growth signaling 13 axis described here in non-cardiac cells and tissues in addition to the heart.

For Circulation Research Peer Review. Do not distribute. Destroy after use.

13

1 ACKNOWLEDGMENTS 2 We thank Dr. Gokhan S. Hotamisligil (Harvard T.H. Chan School of Public Health, 3 Boston, MA) for the ATF6�fl/fl mice. 4 SOURCES OF FUNDING 5 EAB American Heart Association (17PRE33670796), the Rees-Stealy Research 6 Foundation and SDSU Heart Institute, the Inamori Foundation, and the ARCS 7 Foundation, Inc., San Diego Chapter. 8 CH Boehringer Ingelheim Fonds Travel Grant, the DZHK Mobilitätsprogramm and the 9 Deutsche Herzstiftung 10 OJM the DZHK and by the BMBF (German Ministry of Education and Research) 11 SD was supported by an Excellence Grant from the German Centre for Cardiovascular 12 Research (DZHK) and Department of Cardiology, Angiology, and Pneumology, 13 University Hospital Heidelberg. 14 CCG by (NIH) grants R01 HL75573, R01 HL104535, and P01 HL085577. 15 16 DISCLOSURES 17 NONE 18 19 20

For Circulation Research Peer Review. Do not distribute. Destroy after use.

14

1 Figure Legends: 2 3 Figure 1. Effect of cardiac myocyte-specific ATF6 gene deletion in hearts of 4 mice subjected to TAC. 5 6 A, Protocol for AAV9 administration to ATF6fl/fl mice and TAC. B, ATF6 mRNA 7 levels determined by qRT-PCR on isolated cardiac myocytes (CM), non-cardiac 8 myocytes (NCM), and liver extracts from ATF6fl/fl mice injected with AAV9-Con 9 (Con) or AAV9-CRE (i.e. ATF6 cKO). C, Immunoblot of LV extracts from Con or 10 ATF6 cKO mice. D, mRNA for ATF6 target genes determined by qRT-PCR. E, 11 Heart weight/tibia lengths (HW/TL). F, mRNA levels for fetal genes determined 12 by qRT-PCR. Nppa , natriuretic peptide A); Nppb, natriuretic peptide B); Myh7, β- 13 myosin heavy chain; Col1a1, Collagen 1A1; Atp2a2, Serca2a. G, Fractional 14 shortening (%), determined by echocardiography, see Online Table I. H, 15 Confocal immunocytofluorescence microscopy (ICF) analysis of mouse heart 16 sections for laminin (green). Data are mean ± SEM. *P≤0.05, **P≤0.01, #P≤0.001 17 different from Con Sham, or from the value shown by the bar. 18 19 Figure 2. Effect of cardiac myocyte-specific ATF6 gene deletion in hearts of 20 mice subjected to free wheel exercise. 21 22 A, Protocol for AAV9 administration to ATF6fl/fl mice and free wheel exercise. B, 23 Immunoblot of LV extracts from Con or ATF6 cKO mice. C, mRNA levels for 24 ATF6 target genes determined by qRT-PCR. D, Heart weights/tibia lengths 25 (HW/TL). E, mRNA levels for fetal genes determined by qRT-PCR. F, ICF 26 analysis of mouse heart sections for laminin (green). Data are mean ± SEM. 27 *P≤0.05, **P≤0.01, #P≤0.001. Echocardiography details are in Online Table II. 28 29 Figure 3. Regulation of Rheb Expression by ATF6. 30 31 A, Heat map of transcript profiling showing z-score-transformed RPKM values 32 (Reads Per Kilobase per Million mapped reads) with hierarchical clustering of 33 transcripts of control and ATF6 transgenic mouse hearts. Differentially expressed 34 genes with p values and FDR ≤0.05 and a subset of genes annotated with term 35 GO:0007264 are shown. All the genes increased or decreased by ATF6 are in 36 Online Table III. B, Locations of consensus ATF6-binding motifs, i.e. ER stress 37 responseFor elements Circulation 1 and 2 (ERSE-1 Research and 2) andPeer their Review. sequences Doin the not RHEB 38 gene 5’-flanking region. distribute. Nucleotide differences Destroy from after canonical use. ERSE elements 39 are bold. C, Neonatal rat ventricular myocytes (NRVM) were infected with AdV 40 encoding control or FLAG-ATF6(1-373) [active form], and then ATF6 binding to 41 endogenous ERSE-1 or ERSE-2, as well as to the endogenous PDIA6 ERSE, 42 used here as a positive control, and the negative control targets heme 43 oxygenase 1 (ho-1) and gapdh were examined by chromatin immunoprecipitation 44 (ChIP). D, Locations of ERSE-1 and 2 in the RHEB 5’-flanking region, their 45 sequences (lower case), and the mutations that were made (bold and upper 46 case). E, NRVM were transfected with rat-rheb(-1067/+123)-Luc WT, M2, M1 or

15

1 M1/M2 then infected with AdV FLAG-ATF6(1-373),. Then, 48h later, luciferase 2 activity was measured in extracts. F-H, mRNA for RHEB determined by qRT- 3 PCR (F) and Rheb protein and mTOR pathway components measured by 4 immunoblots (G) and quantified by densitometry (H) from Con or ATF6 cKO 5 mouse heart extracts after 7 days of Sham or TAC. I-K, mRNA for RHEB 6 determined by qRT-PCR (I) and Rheb protein and mTOR pathway components 7 immunoblots (J) and quantified by densitometry (K) from Con or ATF6 cKO 8 mouse heart extracts after 4 weeks of sedentary or free wheel exercise (Run). 9 Data are mean ± SEM. *P≤0.05, **P≤0.01, #P≤0.001. 10 11 Figure 4. Effects of ATF6- and RHEB knockdown and ectopic Rheb 12 expression on phenylephrine-induced hypertrophy in cultured cardiac 13 myocytes. 14 15 A-E, NRVM were transfected with a nontargeted siRNA (siCon) or with siRNAs 16 targeted to either rat ATF6 (siAtf6) or RHEB (siRheb), and then treated ± 17 phenylephrine (PE; 50µM) for 48 hours. A, Cell surface area was determined by 18 photomicroscopy and morphometry. B, ICF of NRVM for α-actinin (blue) and 19 TOPRO-3 (red). Bar = 50µm. C, qRT-PCR examination of Nppa and Nppb. 20 Values are expressed as fold-of-control cardiac myocytes in the absence of PE. 21 D, Immunoblot of NRVM. E, mRNA for ATF6 target genes determined by qRT- 22 PCR. Values are expressed as fold-of-control myocytes in the absence of PE. F- 23 H, NRVM were transfected with a control plasmid or a plasmid encoding Flag- 24 Rheb and either siCon or siAtf6, followed by treatment ± PE for 48 hours. Cell 25 surface area (F) was determined by morphometry after ICF (G). NRVM were 26 stained for FLAG (green; isolated channel displayed in inset), α-actinin (blue), 27 and TOPRO-3 (red). Bar = 50µm. Only FLAG-positive cells were used for cell 28 surface area analysis. H, Immunoblot of NRVM. Data are mean ± SEM. *P≤0.05, 29 **P≤0.01, #P≤0.001. 30 31 Figure 5. Effects of ATF6- and RHEB knockdown and ectopic Rheb 32 expression on insulin like growth factor 1-induced hypertrophy in cultured 33 cardiac myocytes. 34 35 A-E, NRVM were transfected with siCon, siAtf6 or siRheb, then treated ± IGF1 36 (100ng/ml) for 48 hours. A, Cell surface area was determined by was determined 37 by morphometryFor Circulation after ICF . B, Research ICF of NRVM Peerfor α-actinin Review. (blue) and Do TOPRO- not 3 38 (red). Bar = 50 µ m. C, distribute. qRT-PCR for Nppa Destroy and Nppb after. Values use. are fold-of-control 39 myocytes in the absence of IGF1. D, Immunoblot of NRVM. E, mRNA levels of 40 ATF6 target genes determined by qRT-PCR. Values are fold-of-control myocytes 41 in the absence of IGF1. F-H, NRVM were transfected with a control plasmid or a 42 plasmid encoding Flag-Rheb and then either siCon or siAtf6, followed by 43 treatment ± IGF1 for 48 hours. Cell surface area (F) was determined by 44 morphometry after ICF (G). NRVM were stained for FLAG (green; isolated 45 channel displayed in inset), α-actinin (blue) and TOPRO-3 (red). Bar = 50µm.

16

1 Only FLAG-positive cells were used for cell surface area analysis. H, Immunoblot 2 of NRVM. Data are mean ± SEM. *P≤0.05, **P≤0.01, #P≤0.001. 3 4 Figure 6. Examination of Rheb Requirement for Growth-dependent but not 5 Growth-independent Activation of the ATF6. 6 7 A-B, NRVM were transfected with siCon, siAtf6 or siRheb then treated ± 8 tunicamycin (TM; 10µg/mL) (A) or PE (50µM) (B) for 24 hours, then analyzed for 9 ATF6 activation by immunoblotting. C, mRNA levels for ATF6 target genes 10 determined by qRT-PCR. Values are fold-of-control, i.e. not treated with TM. D, 11 E, NRVM were transfected with siCon (D) or siAtf6 (E), then treated ± TM 12 (10µg/mL), or PE (50µM) for 24 hours, or subjected to simulated 13 ischemia/reperfusion (sI/R; 8 hours of sI, followed by 24 hours of reperfusion) 14 and mRNA for ATF6 target genes determined by qRT-PCR. F, Diagram of 15 constructs that encode luciferase driven by the grp78, catalase, and rheb 5’- 16 flanking region. G, H, NRVM were transfected with human-grp78(-284/+221)-Luc 17 WT, rat-catalase(-1161/+131)-Luc WT, or rat-rheb(-1067/+123)-Luc WT and then 18 transfected with siCon (G) or siAtf6 (H), then treated ± TM (10µg/mL), or PE 19 (50µM) for 24 hours, or subjected to sI/R and luciferase activity measured in 20 extracts. I, J, NRVM infected with AdV FLAG-ATF6(1-670) (I) or control (J), and 21 then ATF6 binding to the endogenous grp78, catalase, or rheb genes, as well as 22 to the negative control gene, gapdh, examined by ChIP under the same 23 experimental conditions described above. Data are mean ± SEM. *P≤0.05, 24 **P≤0.01, #P≤0.001. 25 26 Figure 7. Effect of cardiac myocyte-specific ectopic Rheb expression in 27 ATF6 gene deleted mouse hearts subjected to TAC. 28 29 A, Experimental protocol for AAV9 administration to ATF6fl/fl mice and TAC. B, 30 Heart weights/tibia lengths (HW/TL). C, Fractional shortening (%), as determined 31 by echocardiography, see Online Table IV. D, mRNA for fetal genes determined 32 by qRT-PCR. E, mRNA for ATF6 target genes determined by qRT-PCR. F, 33 Immunoblots of LV extracts. Data are mean ± SEM. *P≤0.05, **P≤0.01, 34 #P≤0.001. 35 36 37 FigureFor 8. Mechanism Circulation whereby Research ATF6 acts asPeer a nodal Review. regulator Do of both not 38 protein sy nthesis and distribute. protein folding Destroy during cardiac after hypertrophy. use. 39 40 A, Shown are the temporal sequence of steps involved in mediating the initial 41 (Steps 1-4) and sustained (Steps 5-7) aspects of growth and the interdependent 42 roles of mTORC1 and ATF6. B, C, Immunoblot of LV extracts (B) and heart 43 weights/tibia lengths (HW/TL) (C) from WT mice subjected to TAC for 3 hours, 2 44 days, or 7 days. Echocardiography details in Online Table V. D, E, Immunoblot of 45 LV extracts (D) and heart weights/tibia lengths (HW/TL) (E) from Con or ATF6

17

1 cKO mice subjected to 3 hours of TAC. Echocardiography details in Online Table 2 VI. Data are mean ± SEM. *P≤0.05, #P≤0.001. 3 4

For Circulation Research Peer Review. Do not distribute. Destroy after use.

18

1 References: 2 3 1. Balch WE, Morimoto RI, Dillin A and Kelly JW. Adapting proteostasis for disease 4 intervention. Science. 2008;319:916-9. 5 2. Glembotski CC. Roles for the sarco-/endoplasmic reticulum in cardiac myocyte 6 contraction, protein synthesis, and protein quality control. Physiology (Bethesda). 7 2012;27:343-50. 8 3. Gidalevitz T, Stevens F and Argon Y. Orchestration of secretory protein folding 9 by ER chaperones. Biochim Biophys Acta. 2013;1833:2410-24. 10 4. Glembotski CC. Roles for ATF6 and the sarco/endoplasmic reticulum protein 11 quality control system in the heart. Journal of Molecular and Cellular Cardiology. 12 2014;71:11-15. 13 5. Arrieta A, Blackwood EA and Glembotski CC. ER Protein Quality Control and the 14 Unfolded Protein Response in the Heart. Curr Top Microbiol Immunol. 2017. 15 6. Zhu C, Johansen FE and Prywes R. Interaction of ATF6 and serum response 16 factor. Mol Cell Biol. 1997;17:4957-66. 17 7. Haze K, Yoshida H, Yanagi H, Yura T and Mori K. Mammalian transcription 18 factor ATF6 is synthesized as a transmembrane protein and activated by proteolysis in 19 response to endoplasmic reticulum stress. Mol Biol Cell. 1999;10:3787-99. 20 8. Luckey SW, Walker LA, Smyth T, Mansoori J, Messmer-Kratzsch A, Rosenzweig 21 A, Olson EN and Leinwand LA. The role of Akt/GSK-3beta signaling in familial 22 hypertrophic cardiomyopathy. J Mol Cell Cardiol. 2009;46:739-47. 23 9. Bernardo BC and McMullen JR. Molecular Aspects of Exercise-induced Cardiac 24 Remodeling. Cardiol Clin. 2016;34:515-530. 25 10. Zhang D, Contu R, Latronico MV, Zhang J, Rizzi R, Catalucci D, Miyamoto S, 26 Huang K, Ceci M, Gu Y, Dalton ND, Peterson KL, Guan KL, Brown JH, Chen J, 27 Sonenberg N and Condorelli G. MTORC1 regulates cardiac function and myocyte 28 survival through 4E-BP1 inhibition in mice. J Clin Invest. 2010;120:2805-16. 29 11. Shende P, Plaisance I, Morandi C, Pellieux C, Berthonneche C, Zorzato F, 30 Krishnan J, Lerch R, Hall MN, Ruegg MA, Pedrazzini T and Brink M. Cardiac raptor 31 ablation impairs adaptive hypertrophy, alters metabolic gene expression, and causes 32 heart failure in mice. Circulation. 2011;123:1073-82. 33 12. Tamai T, Yamaguchi O, Hikoso S, Takeda T, Taneike M, Oka T, Oyabu J, 34 Murakawa T, Nakayama H, Uno Y, Horie K, Nishida K, Sonenberg N, Shah AM, Takeda 35 J, Komuro I and Otsu K. Rheb (Ras homologue enriched in brain)-dependent 36 mammalian target of rapamycin complex 1 (mTORC1) activation becomes indispensable 37 for cardiac hypertrophic growth after early postnatal period. J Biol Chem. 38 2013;288:10176-87. 39 13. Volkers M, Toko H, Doroudgar S, Din S, Quijada P, Joyo AY, Ornelas L, Joyo E, 40 ThueraufFor DJ, Circulation Konstandin MH, GudeResearch N, Glembotski Peer CC andReview. Sussman DoMA. Pathologicalnot 41 hypertrophy amelioration by PRAS40-mediated inhibition of mTORC1. Proc Natl Acad 42 Sci U S A . 2013;110:12661 distribute.-6. Destroy after use. 43 14. Wu X, Cao Y, Nie J, Liu H, Lu S, Hu X, Zhu J, Zhao X, Chen J, Chen X, Yang Z 44 and Li X. Genetic and pharmacological inhibition of Rheb1-mTORC1 signaling exerts 45 cardioprotection against adverse cardiac remodeling in mice. Am J Pathol. 46 2013;182:2005-14. 47 15. Sciarretta S, Forte M, Frati G and Sadoshima J. New Insights Into the Role of 48 mTOR Signaling in the Cardiovascular System. Circ Res. 2018;122:489-505. 49 16. Sancak Y, Peterson TR, Shaul YD, Lindquist RA, Thoreen CC, Bar-Peled L and 50 Sabatini DM. The Rag GTPases bind raptor and mediate amino acid signaling to 51 mTORC1. Science. 2008;320:1496-501.

19

1 17. Duran RV and Hall MN. Regulation of TOR by small GTPases. EMBO Rep. 2 2012;13:121-8. 3 18. Betz C and Hall MN. Where is mTOR and what is it doing there? J Cell Biol. 4 2013;203:563-74. 5 19. Tee AR, Manning BD, Roux PP, Cantley LC and Blenis J. Tuberous sclerosis 6 complex gene products, Tuberin and Hamartin, control mTOR signaling by acting as a 7 GTPase-activating protein complex toward Rheb. Curr Biol. 2003;13:1259-68. 8 20. Engin F, Yermalovich A, Nguyen T, Hummasti S, Fu W, Eizirik DL, Mathis D and 9 Hotamisligil GS. Restoration of the unfolded protein response in pancreatic beta cells 10 protects mice against type 1 diabetes. Sci Transl Med. 2013;5:211ra156. 11 21. Wang Y, Zhang Y, Ding G, May HI, Xu J, Gillette TG, Wang H and Wang ZV. 12 Temporal dynamics of cardiac hypertrophic growth in response to pressure overload. 13 Am J Physiol Heart Circ Physiol. 2017;313:H1119-H1129. 14 22. Nakamura A, Rokosh DG, Paccanaro M, Yee RR, Simpson PC, Grossman W 15 and Foster E. LV systolic performance improves with development of hypertrophy after 16 transverse aortic constriction in mice. Am J Physiol Heart Circ Physiol. 2001;281:H1104- 17 12. 18 23. Takaoka H, Esposito G, Mao L, Suga H and Rockman HA. Heart size- 19 independent analysis of myocardial function in murine pressure overload hypertrophy. 20 Am J Physiol Heart Circ Physiol. 2002;282:H2190-7. 21 24. Harvey PA and Leinwand LA. The cell biology of disease: cellular mechanisms of 22 cardiomyopathy. J Cell Biol. 2011;194:355-65. 23 25. Allen DL, Harrison BC, Maass A, Bell ML, Byrnes WC and Leinwand LA. Cardiac 24 and skeletal muscle adaptations to voluntary wheel running in the mouse. J Appl Physiol 25 (1985). 2001;90:1900-8. 26 26. Chung E, Heimiller J and Leinwand LA. Distinct cardiac transcriptional profiles 27 defining pregnancy and exercise. PLoS One. 2012;7:e42297. 28 27. Bernardo BC, Weeks KL, Pretorius L and McMullen JR. Molecular distinction 29 between physiological and pathological cardiac hypertrophy: experimental findings and 30 therapeutic strategies. Pharmacol Ther. 2010;128:191-227. 31 28. Martindale JJ, Fernandez R, Thuerauf D, Whittaker R, Gude N, Sussman MA 32 and Glembotski CC. Endoplasmic reticulum stress gene induction and protection from 33 ischemia/reperfusion injury in the hearts of transgenic mice with a tamoxifen-regulated 34 form of ATF6. Circ Res. 2006;98:1186-93. 35 29. Simpson P. Stimulation of hypertrophy of cultured neonatal rat heart cells 36 through an alpha 1-adrenergic receptor and induction of beating through an alpha 1- and 37 beta 1-adrenergic receptor interaction. Evidence for independent regulation of growth 38 and beating. Circ Res. 1985;56:884-94. 39 30. Basso AD, Mirza A, Liu G, Long BJ, Bishop WR and Kirschmeier P. The farnesyl 40 transferaseFor inhibitorCirculation (FTI) SCH66336 Research (lonafarnib) Peer inhibits Review. Rheb farnesylation Do not and mTOR 41 signaling. Role in FTI enhancement of taxane and tamoxifen anti-tumor activity. J Biol 42 Chem. 2005;280:31101 distribute.-8. Destroy after use. 43 31. Okada K, Minamino T, Tsukamoto Y, Liao Y, Tsukamoto O, Takashima S, Hirata 44 A, Fujita M, Nagamachi Y, Nakatani T, Yutani C, Ozawa K, Ogawa S, Tomoike H, Hori 45 M and Kitakaze M. Prolonged endoplasmic reticulum stress in hypertrophic and failing 46 heart after aortic constriction: possible contribution of endoplasmic reticulum stress to 47 cardiac myocyte apoptosis. Circulation. 2004;110:705-12. 48 32. Sari FR, Widyantoro B, Thandavarayan RA, Harima M, Lakshmanan AP, Zhang 49 S, Muslin AJ, Suzuki K, Kodama M and Watanabe K. Attenuation of CHOP-mediated 50 myocardial apoptosis in pressure-overloaded dominant negative p38alpha mitogen- 51 activated protein kinase mice. Cell Physiol Biochem. 2011;27:487-96.

20

1 33. Park CS, Cha H, Kwon EJ, Sreenivasaiah PK and Kim DH. The chemical 2 chaperone 4-phenylbutyric acid attenuates pressure-overload cardiac hypertrophy by 3 alleviating endoplasmic reticulum stress. Biochem Biophys Res Commun. 4 2012;421:578-84. 5 34. Liu X, Kwak D, Lu Z, Xu X, Fassett J, Wang H, Wei Y, Cavener DR, Hu X, Hall J, 6 Bache RJ and Chen Y. Endoplasmic reticulum stress sensor protein kinase R-like 7 endoplasmic reticulum kinase (PERK) protects against pressure overload-induced heart 8 failure and lung remodeling. Hypertension. 2014;64:738-44. 9 35. Vekich JA, Belmont PJ, Thuerauf DJ and Glembotski CC. Protein disulfide 10 isomerase-associated 6 is an ATF6-inducible ER stress response protein that protects 11 cardiac myocytes from ischemia/reperfusion-mediated cell death. J Mol Cell Cardiol. 12 2012;53:259-67. 13 36. Wu J, Ruas JL, Estall JL, Rasbach KA, Choi JH, Ye L, Bostrom P, Tyra HM, 14 Crawford RW, Campbell KP, Rutkowski DT, Kaufman RJ and Spiegelman BM. The 15 unfolded protein response mediates adaptation to exercise in skeletal muscle through a 16 PGC-1alpha/ATF6alpha complex. Cell Metab. 2011;13:160-9. 17 37. Misra J, Kim DK, Choi W, Koo SH, Lee CH, Back SH, Kaufman RJ and Choi HS. 18 Transcriptional cross talk between orphan nuclear receptor ERRgamma and 19 transmembrane transcription factor ATF6alpha coordinates endoplasmic reticulum 20 stress response. Nucleic Acids Res. 2013;41:6960-74. 21 38. Yamagata K, Sanders LK, Kaufmann WE, Yee W, Barnes CA, Nathans D and 22 Worley PF. rheb, a growth factor- and synaptic activity-regulated gene, encodes a novel 23 Ras-related protein. J Biol Chem. 1994;269:16333-9. 24 39. Potheraveedu VN, Schopel M, Stoll R and Heumann R. Rheb in neuronal 25 degeneration, regeneration, and connectivity. Biol Chem. 2017;398:589-606. 26 40. Heard JJ, Fong V, Bathaie SZ and Tamanoi F. Recent progress in the study of 27 the Rheb family GTPases. Cell Signal. 2014;26:1950-7. 28 41. Goorden SM, Hoogeveen-Westerveld M, Cheng C, van Woerden GM, Mozaffari 29 M, Post L, Duckers HJ, Nellist M and Elgersma Y. Rheb is essential for murine 30 development. Mol Cell Biol. 2011;31:1672-8. 31 42. Wang Y, Huang BP, Luciani DS, Wang X, Johnson JD and Proud CG. Rheb 32 activates protein synthesis and growth in adult rat ventricular cardiomyocytes. J Mol Cell 33 Cardiol. 2008;45:812-20. 34 43. Sciarretta S, Zhai P, Shao D, Maejima Y, Robbins J, Volpe M, Condorelli G and 35 Sadoshima J. Rheb is a critical regulator of autophagy during myocardial ischemia: 36 pathophysiological implications in obesity and metabolic syndrome. Circulation. 37 2012;125:1134-46. 38 44. Cao Y, Tao L, Shen S, Xiao J, Wu H, Li B, Wu X, Luo W, Xiao Q, Hu X, Liu H, 39 Nie J, Lu S, Yuan B, Han Z, Xiao B, Yang Z and Li X. Cardiac ablation of Rheb1 induces 40 impairedFor heart Circulation growth, endoplasmic Research reticulum-associated Peer Review. apoptosis and Do heart not failure in 41 infant mice. Int J Mol Sci. 2013;14:24380-98. 42 45. Schewe DM and distribute. Aguirre-Ghiso JA. Destroy ATF6alpha after-Rheb-mTOR use. signaling promotes 43 survival of dormant tumor cells in vivo. Proc Natl Acad Sci U S A. 2008;105:10519-24. 44 46. Fernandez-Fernandez MR, Ferrer I and Lucas JJ. Impaired ATF6alpha 45 processing, decreased Rheb and neuronal cell cycle re-entry in Huntington's disease. 46 Neurobiol Dis. 2011;41:23-32. 47 47. Tyagi R, Shahani N, Gorgen L, Ferretti M, Pryor W, Chen PY, Swarnkar S, 48 Worley PF, Karbstein K, Snyder SH and Subramaniam S. Rheb Inhibits Protein 49 Synthesis by Activating the PERK-eIF2alpha Signaling Cascade. Cell Rep. 2015. 50

21 A B AAV9-Con AAV9-CRE

1.0

0.8 AAV9-Con 14d Sham (n=5) 7d Analysis AAV9-CRE TAC (n=5) 0.6 (fold-of-con) 0.4 ATF6fl/fl # β- actin 0.2

Atf6/ 0.0 CM NCM Liver C D Con Sham Con TAC ATF6 cKO Sham ATF6 cKO TAC

Sham TAC 10 # # # Con ATF6 cKO Con ATF6 cKO # 8 # 1 2 3 4 5 6 7 8 9 10 11 12 # # 100- # ATF6 P90 6 (fold-of-con) 50- ATF6 P50 * 4 75- GRP78 * β- actin 43- β-Actin 2

Target/ 0 Hspa5 Syvn1 Manf Hsp90b1 Pdia6 E F G Con Con Sham Con TAC Con ATF6 cKO ATF6 cKO Sham ATF6 cKO TAC ATF6 cKO * 12 * # 40 ** 80 10 60 * * * * # # ** # # # 30 8 40 20 *

(fold-of-con) * 6 20 2.5 ** 2.0 4 * β- actin 1.5 10 Fract Short (%) HW/TL (mg/mm) HW/TL 2 1.0 0.5 *

0 Target/ 0.0 0 SHAM TAC Nppa Myh7 Atp2a2 SHAM TAC For Circulation NppbResearchCol1a1 Peer Review. Do H not distribute. Destroy after use. Sham TAC Con ATF6 cKO Con ATF6 cKO Laminin

50 µm

Figure 1 A

Sedentary (n=5) AAV9-Con 14d 4w Free Wheel Analysis AAV9-CRE Exercise (n=5)

ATF6fl/fl

B C

Con Sed Con Run ATF6 cKO Sed ATF6 cKO Run

Sedentary Run 8 * Con ATF6 cKO Con ATF6 cKO # 6 * 1 2 3 4 5 6 7 8 9 10 11 12 # 100- ATF6 P90 (fold-of-con) 50- ATF6 P50 4 * * * * * * 75- GRP78 * β- actin 43- β-Actin 2

Target/ 0 Hspa5 Syvn1 Manf Hsp90b1 Pdia6

D E Con Con Sed Con Run ATF6 cKO ATF6 cKO Sed ATF6 cKO Run

12 4 # # # # 10 ** 3 ** 8 ** * 6 (fold-of-con) 2

4

β- actin 1 HW/TL (mg/mm) HW/TL 2

0 Target/ 0 Sed Run Nppa Myh7 Atp2a2 Nppb Col1a1 F Sedentary Run ForCon CirculationATF6 cKOResearch PeerCon Review.ATF6 Do cKO Laminin not distribute. Destroy after use.

50 µm

Figure 2 A All Genes GO: 0007264: B Changed small GTPase mediated -754 -735 -628 -609 -1000 signal transduction -1 Rheb ERSE-2 ERSE-1 CCACAGTTCCTCAGCCACG CCCGTCAGCTAGGGCCACG

Rheb C C AdV-Con 6 AdV-ATF6 #

4 # **

1.5 %-of-input 2 1 FLAG-ATF6 ChIP FLAG-ATF6 0.5 0 0 −0.5 Rheb Pdia6 Gapdh −1 ERSE-2 ERSE −1.5 Rheb Ho-1 ERSE-1 Con ATF6 Con 1 Con 2 Con 3 ATF6 1 ATF6 2 ATF6 3 ATF6 4 ATF6 * AdV-Con D E 4 # AdV-ATF6 ERSE-2 ERSE-1 -754 -735 -628 -609 3 -1067 +123 ** Rat-Rheb Luc 2 CCACAGTTCCTCAGCCACG

CCACAGTTCCTCAGAACAT (fold-of-con) 1 Mutant 2

CCCGTCAGCTAGGGCCACG Rel Luminescence CCCGTCAGCTAGGGAACAT 0 Mutant 1 WT M2 M1 M1/M2 Sham TAC F Con G H Con Con ATF6 cKO Con ATF6 cKO ATF6 cKO ATF6 cKO 12 1 2 3 4 5 6 7 8 9 10 11 12 6 # 20- # # RHEB # 10 250- p-mTOR 8 4 250- mTOR (fold-of-con) (fold-of-con) 6 75- p-S6K S6K 4 75- 2 β-Actin β- actin 20- p-4EBP 2 For Circulation20- Research Peer Review.4EBP Do Rheb/ 0 43- β-Actin RHEB / 0 SHAM TAC not distribute. Destroy after use. SHAM TAC Sedentary Run I Con J K Con ATF6 cKO Con ATF6 cKO Con ATF6 cKO ATF6 cKO 1 2 3 4 5 6 7 8 9 10 11 12 5 * 20- RHEB 10 ** ** 4 250- p-mTOR 8 ** 250- mTOR 3 6

75- p-S6K (fold-of-con) (fold-of-con) 2 75- S6K 4 20- p-4EBP β-Actin β- actin 1 20- 4EBP 2 43- Rheb/ β-Actin

0 RHEB / 0 Sed Run Sed Run Figure 3 A siCon siRheb B C siCon siRheb siAtf6 siAtf6 siCon siAtf6 siRheb Gene Induction by PE # 1250 # 2 # 6 1000 Con * 750 4

500 ** 2 250 PE Cell Surface Area (µm ) Cell Surface

0 (fold-of-con) Target/Gapdh 0 Con PE 50 µm Nppa Nppb D siCon siAtf6 siRheb E Con PECon PE Con PE siCon siAtf6 siRheb 1 2 3 4 5 6 7 8 9 10 11 12 Gene Induction by PE 100- ATF6 P90 6 # 50- ATF6 P50 # 5 75- GRP78 # 20- RHEB 4 p-mTOR 250- 3 * * mTOR 250- 2 75- p-S6K 75- S6K 1 20- p-4EBP (fold-of-con) Target/Gapdh 0 Hspa5 Syvn1 Manf 20- 4EBP Hsp90b1 Pdia6 37- GAPDH F G siCon+Con siAtf6+Con siCon siAtf6 siCon+Flag-Rheb siAtf6+Flag-Rheb Con Flag-Rheb Con Flag-Rheb * 1200 #

2 FLAG FLAG FLAG FLAG # 1000 # Con 800

600

400 FLAG FLAG FLAG FLAG

200 PE

Cell Surface Area (µm ) Cell Surface 0 50 µm ConFor Circulation PE Research Peer Review. Do H notsiCon+Con distribute. DestroysiAtf6+Con after use. siCon+Flag-Rheb siAtf6+Flag-Rheb Con PECon PE Con PE Con PE 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 100- ATF6 P90 50- ATF6 P50 75- GRP78 25- FLAG-RHEB 20- RHEB 250- p-mTOR 250- mTOR 75- p-S6K 75- S6K 20- p-4EBP 20- 4EBP 37- GAPDH Figure 4 A siCon siRheb B C siCon siRheb siAtf6 siAtf6 siCon siAtf6 siRheb Gene Induction by IGF1 1200 * 2 ** 1000 6 Con 800 * 4 600 *

400 2 200 IGF1 Cell Surface Area (µm ) Cell Surface

0 50 µm (fold-of-con) Target/Gapdh 0 Con IGF1 Nppa Nppb D siCon siAtf6 siRheb E Con IGF1Con IGF1 Con IGF1 siCon siAtf6 siRheb 1 2 3 4 5 6 7 8 9 10 11 12 Gene Induction by IGF1 100- ATF6 P90 10 ** 50- ATF6 P50 8 75- GRP78 20- RHEB 6 * 250- p-mTOR * * 4 * 250- mTOR 75- p-S6K 2 75- S6K

20- p-4EBP (fold-of-con) Target/Gapdh 0 Hspa5 Syvn1 Manf 20- 4EBP Hsp90b1 Pdia6 37- GAPDH F G siCon+Con siAtf6+Con siCon siAtf6 siCon+Flag-Rheb siAtf6+Flag-Rheb Con Flag-Rheb Con Flag-Rheb 1200

2 FLAG FLAG FLAG FLAG # 1000 # Con 800 #

600 * 400 FLAG FLAG FLAG FLAG

200 IGF1 Cell Surface Area (µm ) Cell Surface 0 50 µm ForCon Circulation IGF1 Research Peer Review. Do H siCon+Connot distribute. siAtf6+ConDestroy after use. siCon+Flag-Rheb siAtf6+Flag-Rheb Con IGF1Con IGF1 Con IGF1 Con IGF1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 100- ATF6 P90 50- ATF6 P50 75- GRP78 25- FLAG-RHEB 20- RHEB 250- p-mTOR 250- mTOR 75- p-S6K 75- S6K 20- p-4EBP 20- 4EBP 37- GAPDH Figure 5 A siCon siAtf6 siRheb C Con TM Con TM Con TM siCon siAtf6 siRheb 1 2 3 4 5 6 7 8 9 10 11 12 Gene Induction by TM 100- ATF6 P90 20 # 50- ATF6 P50 # ** 37- GAPDH 15 # # # #

B (fold-of-con) # siCon siAtf6 siRheb 10 ** # ** Con PE Con PE Con PE * * 1 2 3 4 5 6 7 8 9 10 11 12 5 * * ** 100- ATF6 P90

50- ATF6 P50 Target/Gapdh 0 Hspa5 Syvn1 Manf 37- GAPDH Hsp90b1 Pdia6

D Gene Induction E Gene Induction + siAtf6 TM PE TM PE sI/R sI/R ** 12 # 12 10 10 ** 8 # ** 8 (fold-of-con) # (fold-of-con) 6 6 * * 4 4 * * 2 * 2

0 0 Target/Gapdh Target/Gapdh Target/Gapdh Target/Gapdh Hspa5 Cat Rheb Hspa5 Cat Rheb

F G Luciferase Induction H Luciferase Induction + siAtf6 TM PE TM PE sI/R sI/R -284 +221 * # Hspa5 Luc 6 6 * -1161 +131 ** Catalase Luc 4 * 4 * ** -1067 +123 * * * Rheb Luc 2 2 (fold-of-con) (fold-of-con) Rel Luminescence For Circulation Research Peer Review.Rel Luminescence Do 0 0 not distribute.Hspa5 Destroy Cat Rheb after use.Hspa5 Cat Rheb

I TM PE J TM PE sI/R 10 10 sI/R * 8 ** 8 * 6 ** 6 * * * * 4 4 * %-of-input %-of-input (fold-of-con) 2 (fold-of-con) 2 FLAG-ATF6 ChIP FLAG-ATF6 FLAG-Con ChIP

0 0 Hspa5 Cat Rheb Gapdh Hspa5 Cat Rheb Gapdh Figure 6 A AAV9-Con (Con) 14d Sham (n=5) 7d AAV9-Rheb (Con+Rheb) TAC (n=7-8) AAV9-Con

14d Analysis

AAV9-CRE AAV9-Con (ATF6 cKO) 14d Sham (n=5) 7d ATF6fl/fl AAV9-Rheb (ATF6 cKO+Rheb) TAC (n=7-8)

B C Con ATF6 cKO Con ATF6 cKO Con+Rheb ATF6 cKO+Rheb Con+Rheb ATF6 cKO+Rheb ** 12.5 # # 40 # 10.0 * 30 * * 7.5 20 # 5.0 10 Fract Short (%) HW/TL (mg/mm) HW/TL 2.5

0.0 0 SHAM TAC SHAM TAC

D E Con ATF6 cKO Con ATF6 cKO Con+Rheb ATF6 cKO+Rheb Con+Rheb ATF6 cKO+Rheb

50 10 * 40 ** # 8 * # # 30 * # * * 6 * (fold-of-sham) 20 (fold-of-sham) # # * 4 ** 10 * ** β- actin β- actin * 2 # 2 * * * 1 * * * 0 * 0 Target/ Nppa Myh7 Atp2a2 Target/ Hspa5 Syvn1 Manf Nppb Col1a1 Hsp90b1 Pdia6

For Circulation Research Peer Review. Do F Con ATF6 cKO not distribute.Con+Rheb DestroyATF6 after cKO+Rheb use. Sham TAC Sham TAC Sham TAC Sham TAC 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 100- ATF6 P90 50- ATF6 P50 75- GRP78 25- FLAG-RHEB 20- RHEB 250- p-mTOR 250- mTOR 75- p-S6K 75- S6K 20- p-4EBP 20- 4EBP 43- β-Actin Figure 7 A ATF6 3 canonical mTOR Grp78 maintain 2 protein 7 proteostasis growth mTORC1 protein 1 activation folding during stimulus 6 synthesis demand compensatory Rheb growth 5 Rheb ATF6 non-canonical 4

B WT TAC Timecourse C Sham 2D TAC TAC 3Hr TAC 7D TAC (time) Sham 3 Hr 2 Day 7 Day * 1 2 3 4 5 6 7 8 9 10 11 12 10 # 100- ATF6 P90 8 * 50- ATF6 P50 75- p-S6K 6 75- S6K 4 20- p-4EBP 20-

4EBP (mg/mm) HW/TL 2 20- RHEB 0 43- β-Actin

D 3Hr TAC E Sham TAC Con ATF6 cKO Con ATF6 cKO Con ATF6 cKO 1 2 3 4 5 6 7 8 9 10 11 12 8 100- ATF6 P90 50- ATF6 P50 6 75- p-S6K 75- S6K 4 20- p-4EBP 20- 2

4EBP (mg/mm) HW/TL 20- RHEB 0 43- β-Actin SHAM TAC

For Circulation Research Peer Review. Do not distribute. Destroy after use.

Figure 8 Supplemental Material

Detailed Methods

Laboratory animals

The research reported in this article has been reviewed and approved by the San Diego State University Institutional Animal Care and Use Committee (IACUC), and conforms to the Guide for the Care and Use of Laboratory Animals published by the National Research Council. ATF6-floxed (ATF6fl/fl) mice were a generous gift from Dr. Gokhan S. Hotamisligil. Briefly, ATF6-floxed mice were generated with a targeting construct flanking exons 8 and 9 of ATF6 with LoxP sequences on a C57B/6J background, as previously described1.

Animal numbers

A total of 184 mice were used for this study. ATF6fl/fl C57BL/6J mice injected with AAV9-Con (Con) (n=81) and their ATF6fl/fl littermates injected with AAV9-Cre (ATF6 cKO) (n=80); for certain experimental paradigms Con and ATF6 cKO mice were subsequently injected with either AAV9-Con (n=37), AAV9-Rheb (n=13) or AAV9-ATF6 (n=24); ATF6 TG C57BL/6J mice (n=4) and their non-transgenic littermates (n=3). Male wild-type C57BL/6J mice were purchased from Jackson Laboratories for the TAC time course experiment (n=16). All animals were fed ad libitum for all experimental purposes and kept on a traditional 12-hour light/dark cycle. All animal sacrifice and tissue harvest was consistently performed between the hours of 12pm-3pm when we have observed animals to be in a fasted and sedentary state.

Cultured cardiac myocytes (NRVM) and experimental design

Neonatal rat ventricular myocytes (NRVMs) were isolated via enzymatic digestion, purified by Percoll density gradient centrifugation, and maintained in Dulbecco's modified Eagle's medium (DMEM)/F12 supplemented with 10% fetal bovine serum (FBS) and antibiotics (100 units/ml penicillin and 100 µg/ml streptomycin) on plastic culture plates that had been pre-treated with 5 µg/ml fibronectin, as previously described2. For all NRVM experiments, plating density was maintained at 2.5 x 105 cells/well on 12-well plates. Sixteen hours after plating, NRVM were subjected to respective treatments. For stimulated in vitro hypertrophy in NRVM, an initial period of serum starvation was implemented by replacing all culture media with 0.5 ml of glucose-free DMEM for 48 hours. NRVM culture media was then replaced with DMEM/F12 supplemented with BSA (1 mg/ml) containing either control, phenylephrine (50 µM) or IGF1 (100ng/ml) for an additional 48 hours. Experiments in which Lonafarnib (2 µM; Cayman Chemical, Cas#193275-84-2), rapamycin (20nM; Sigma-Aldrich), cyclohexamide

1 (100 µg/ml; Sigma-Aldrich, Cat#C1988) or 4-phenylbutyrate (100 µM; Sigma- Aldrich, Cat#SML0309) were administered was performed as previously described 3-6, treatment was performed after serum starvation in conjunction with respective phenylephrine or IGF1 administration. Images were obtained with an IX70 fluorescence microscope (Olympus, Melville, NY). For in vitro chemical UPR activation, sixteen hours after plating NRVM and AMVM were treated with tunicamycin (10 µg/ml) for 24 hours in DMEM/F12 supplemented with bovine serum albumin (BSA) (1 mg/ml) for NRVM. For in vitro ischemia/reperfusion (I/R), ischemia was simulated by replacing all culture media with 0.5 ml of glucose-free DMEM containing 2% dialyzed FBS, then incubated at 0.1% O2 in a hypoxia chamber with an oxygen controller (ProOx P110 oxygen controller, Biospherix, Parish, NY) for 8 hours or 3 hours for NRVM or AMVM, respectively, as previously described2. Reperfusion was simulated by replacing culture media with DMEM/F12 supplemented with BSA (1 mg/ml) for NRVM or maintaining media for AMVM and incubating at 21% O2 for an additional 24 hours.

Immunoblotting

NRVM were lysed and subjected to immunoblot analysis, as previously described2. In brief, cultures were lysed with VC lysis buffer made from 20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 0.1% SDS, 1% Triton X-100, protease inhibitor cocktail (Roche Diagnostics, Indianapolis, IN) and phosphatase inhibitor cocktail (Roche Diagnostics). Mouse heart tissues were homogenized in modified RIPA buffer with 2% SDS. Lysates were clarified by centrifugation at 15,000xg for 15 min at 4°C, and the protein concentration was determined using DC protein assay (Bio-Rad, Hercules, CA). Samples comprising 15 µg of protein were mixed with Laemmli sample buffer, boiled, then subjected to SDS-PAGE followed by transfer onto PVDF membranes for immunoblotting. Full-length Atf6 (p90) was detected with an antibody from SAB Signalway Antibody (1:1000, cat# 32008, College Park, MD), while active Atf6 (p50) was detected with an antibody from Proteintech (1:1000, cat# 24169-1-AP, Rosemont, IL). Other antibodies used include: anti-KDEL antibody (1:8,000, cat# ADI-SPA-827 , Enzo Life Sciences, Farmingdale, NY), which was used to detect GRP78, anti-IRE1 (1:500, cat# sc- 390960, Santa Cruz), anti-XBP1s (1:1000, cat# 619502, BioLegend, San Diego, CA), anti-phospho-PERK (1:1000, cat# 3179, Cell Signaling), anti-PERK (1:1000, cat# 3192, Cell Signaling), anti-Gapdh (1:25000, cat# G109a, Fitzgerald Industries International Inc.), anti-β-actin (1:1000, cat# sc-47778, Santa Cruz), and anti-FLAG (1:3,000, cat#F1804, Sigma-Aldrich, St. Louis, MO). The following antibodies were purchased from Cell Signaling (Danvers, MA): anti-RHEB (1:1,000, cat#13879s), anti-Phospho-mTOR (Ser2448, 1:1,000, cat#2971s), anti- mTOR (1:1,1000, cat#2972s), anti-Phospho-AKT (Ser473, 1:1,000, cat#9271s), anti-Phospho-ATK (Thr308, 1:1000, cat#13038s), anti-AKT (1:1,000, cat#9272s), anti-Phospho-S6K (1:1,000, cat#9205s), anti-S6K (1:1,000, cat#9202s), anti- Phospho-4EBP (1:1,000, cat#2855s), anti-4EBP (1:1,000, cat#9452s), anti- Phospho-TSC2 (Thr1462, 1:1000, 3617s), anti-TSC2 (1:1000, 3990s), anti-

2 Phospho-ERK1/2 (Thr202/Tyr204, 1:1000, 9101s), and anti-ERK1/2 (1:1000, 9102s).

Adenovirus

Recombinant adenoviruses (AdV) encoding 3XFLAG-tagged constitutively active ATF6, ATF6α(1-373), 3XFLAG-tagged transcriptionally dead ATF6, ATF6α(94-373), and 3XFLAG-tagged full-length inactive ATF6, ATF6α(1-670) were generated using AdEasy system essentially as previously described7. Transduction of NRVM was performed by incubating cultures for 5 hours with the appropriate AdV at a multiplicity of infection of one.

Plasmid transfection

Transfection of plasmids into NRVM was achieved using electroporation as previously described8. Briefly, 1 million NRVM were suspended in 300 µl DMEM/F12 supplemented with BSA (1 mg/ml) and mixed with 10 µg of CMV- Flag-Rheb (AddGene plasmid #19996), or a Rheb promoter-luciferase construct of choice (see below), or an empty vector control plasmid. Subsequently, each mixture was then electroporated in a Bio-Rad gene pulser at 500 V, 25 microfarads, 100 Ω in a 0.2 cm gap cuvette. Transfected NRVM viability is approximately 50% and were then plated into four-chamber Lab Tek chamber slides at 0.75x105 NRVM per 2 cm2 chamber.

Rheb promoter-luciferase constructs

The promoter region of the rat RHEB gene spanning nucleotides -1067 to +123 was amplified by PCR using ggatcgacgcgtcagtacgcctgttgcagaaa as the forward primer, which introduced an MluI site (underlined) just 5’ of rat RHEB - 1067, and ggatcgctcgagcttggtagcCTgGTCAGC as the reverse primer, which introduced an Xho1 site (underlined) just 3’ of rat RHEB +123. Upper case nucleotides match those in the rat RHEB gene. The amplified product was then cloned into pGL2p to generate rat-RHEB(-1067/+123)-Luc. Truncated versions of rat-RHEB luciferase were cloned into pGL2p using a similar strategy and the same reverse primer coupled with the following forward primers: ggaacgacgcgtTCACCACCCACACTAAGC (-723), and ggaacgacgcgtGAACAGTGTCTCTCCTTGGC (-390) to generate rat-RHEB(- 723/+123)-Luc and rat-RHEB(-390/+123)-Luc, respectively. Upper case nucleotides of these primers correspond to rat RHEB gene sequences. Informatics analyses identified putative ER stress response elements in the rat RHEB gene at nucleotide positions -754 to -736 and -628 to -610 in the rat RHEB gene, which we called ERSE-2 and ERSE-1, respectively. These elements in rat- RHEB(-1067/+123)-Luc were mutated by site-directed mutagenesis in ways

3 predicted to ablate ATF6 binding using RHEB-ERSE-2 mut sense primer, CCCACAGTTCCTCAGaacatAATAAAGCTTAGTCAC and RHEB-ERSE-2 mut antisense primer, GTGACTAAGCTTTATTatgttCTGAGGAACTGTGGG RHEB-ERSE-1 mut sense primer, GCCCGTCAGCTAGGGaacatCGCCTCACGCC, and RHEB-ERSE-1 mut antisense primer, GGCGTGAGGCGatgttCCCTAGCTGACGGGC. PCR-based mutagenesis was performed using the QuikChange XL Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA). Lower case letters represent mutated nucleotides; upper case letters represent nucleotides that are identical to those in the rat RHEB gene. Plasmids were transfected into NRVM and luciferase activity was determined as previously described2.

Luciferase reporter assay Luciferase reporter assays were performed as previously described2. Briefly, suspended NRVMs were co-transfected by electroporation with Rheb promoter- luciferase constructs described above, human-Hspa5(-284/+221), or rat- Catalase(-1161/+131) promoter-luciferase constructs previously described2, 9 along with pCH110 plasmids encoding SV40-beta-galactosidase and pGL2B, as described previously10. NRVMs were plated overnight and then infected with different forms of AdV-ATF6 or subjected to respective experimental paradigms. NRVMs were lysed after 48 h, and the activities of luciferase and beta- galactosidase were measured using an Optocompt II luminometer (MGM Instruments, Hamden, CT).

Small interfering RNA (siRNA) transfection

Transfection of siRNA into NRVM was achieved using HiPerfect Transfection Reagent (Qiagen, Valencia, CA) following the vendor’s protocol as previously described2. Briefly, NRVM culture medium was replaced with DMEM/F12 supplemented with 0.5% FBS without antibiotics, 120 nM siRNA, and 1.25 µl HiPerfect / 1 µl siRNA, then incubated for 16 hours, after which the culture medium was replaced with DMEM/F12 supplemented with BSA (1 mg/ml) for an additional 48 hours. The following targeting siRNAs were used: rat ATF6 (assay ID# RSS315363, Stealth siRNA, Thermo Fisher), rat RHEB (assay ID# RSS352522, Stealth siRNA, Thermo Fisher), rat PERK (assay ID# s132055, Silencer Select siRNA, Thermo Fisher), and rat IRE1 (assay ID# RSS363210, Stealth siRNA, Thermo Fisher). A non-targeting sequence (cat# 12935300, Thermo Fisher) was used as a control siRNA.

Immunocytofluorescence (ICF) and immunohistochemistry

4 NRVM were plated on fibronectin and laminin-coated glass chamber slides, respectively as previously described2. Briefly, cells were fixed with 4% paraformaldehyde, followed by permeabilization with 0.5% Triton-X. Adult mouse hearts were paraffin-embedded after fixation in neutral buffered 10% formalin via abdominal aorta retroperfusion as previously described3. Primary antibodies used were anti-α-actinin (1:200, cat# A7811, Sigma-Aldrich), anti-tropomyosin (1:200, cat# T9283, Sigma-Aldrich), anti-RHEB (1:50, cat#13879s, Cell Signaling), and anti-laminin (1:30, cat# L9393, Sigma-Aldrich). Slides were incubated with appropriate fluorophore-conjugated secondary antibodies (1:100, Jackson ImmunoResearch Laboratories, West Grove, PA) followed by nuclei counter stain Topro-3 (1:1000, Thermo Fisher). Images were obtained using laser scanning confocal microscopy on an LSM 710 confocal laser scanning microscope (Carl Zeiss, Oberkochen, Germany).

Quantitative real-time PCR (qRT-PCR)

Total RNA was isolated from NRVM or mouse hearts as previously described3 using Quick-RNA MiniPrep kit (Zymo Research, Irvine, CA) or RNeasy Mini kit (Qiagen), respectively. cDNA synthesis was performed using SuperScript III First-Strand Synthesis System (Thermo Fisher). qRT-PCR was performed using Maxima SYBR Green/ROX qPCR Master Mix in a StepOnePlus RT-PCR System (Thermo Fisher). All qPCR probes were obtained from Integrated DNA Technologies, as previously described2, 6. Rheb-specific qPCR primers are listed below:

Gene (rat) Forward Primer Reverse Primer Rheb - 1 CAGCAGGGCAGGATGAATA GCTTGCCGTGGATAACTTTAAT Rheb - 2 AAGATGCCTCAGTCCAAGTC GATCAGCTTGGTGAATGTGTTT

Gene (mouse) Rheb - 1 CCATGGCAAGTTGTTGGATATG TCTTCATAGCTGATCACCCTTTC Rheb - 2 ACGTCTGACTCTGTCCAAATG TGCCAACAGGAGGCAATAA

Adeno-Associated virus serotype 9 (AAV9)

The plasmid encoding the human cardiac troponin T promoter driving Cre- recombinase was provided as a gift from Dr. Oliver Muller9. AAV9 preparation was carried out as previously described2. Non-anesthetized 8-week old ATF6fl/fl mice were injected with 100 µL of AAV9-control or AAV9-cTnT-Cre containing 1x1011 viral particles via the lateral tail vein using a 27-guage syringe and housed for 2 weeks before either sacrifice or experimental initiation. To generate AAV9- FLAG-Rheb, a plasmid encoding FLAG-Rheb was obtained from Addgene (Addgene 19996). The region of this construct containing FLAG-Rheb was excised with EcoR1 and Xho1, then, after addition of an EcoR1/Nhe1 linker, it

5 was ligated into the Nhe1 and Xho1 sites of the AAV shuttle vector, pTRUF- CMVenhMLC800. AAV9 were then prepared and administered as previously described in accordance with the respective experimental paradigms2.

Chromatin immunoprecipitation (ChIP)

ChIP assays were performed essentially as previously described2, 11. Briefly, AdV-Con, AdV-FLAG-ATF6(1-373), or AdV-FLAG-ATF6(1-670) infected NRVM were treated with fixing buffer (50 mM HEPES-KOH, pH 7.5, 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, and 1% formaldehyde) for 10 min, quenched with 125 mM glycine, and scraped into ice-cold PBS. Cells were centrifuged, resuspended in lysis buffer (50 mM HEPES, pH 7.9, 140 mM NaCl, 1 mM EDTA, 10% glycerol, 0.5% NP-40, 0.25% Triton X-100, and protease inhibitor cocktail), and incubated on ice for 10 min. After centrifugation at 1,800 x g for 10 min, the pellets were washed with buffer containing 10 mM Tris, pH 8.1, 200 mM NaCl, 1 mM EDTA, and 0.5 mM EGTA, resuspended in shearing buffer (0.1% SDS, 1 mM EDTA, and 10 mM Tris, pH 8.1), and then transferred to microTUBEs (Covaris, Woburn, MA). Chromatin was sheared by sonication for 15 min using an M220 focused ultrasonicator (Covaris). Triton X-100 and NaCl were added to the final concentration of 1% Triton and 150 mM NaCl followed by centrifugation at 16,000 x g for 10 min. Immunoprecipitation was performed by incubated 140 µl of sheared chromatin with 5 µg of anti-FLAG antibody (cat# F1804, Sigma-Aldrich) and 260 µl of immunoprecipitation buffer (0.1% SDS, 1 mM EDTA, 10 mM Tris, pH 8.1, 1% Triton X-100, and 150 mM NaCl) at 4°C overnight. Protein A/G magnetic beads (5 µl, BcMag, Bioclone, San Diego, CA) were added to the mixtures and incubated at 4°C for 1.5 h. Magnetic beads were sequentially washed with low salt wash buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM HEPES-KOH, pH7.9, and 150 mM NaCl), high salt wash buffer with 500 mM NaCl, LiCl wash buffer (100 mM Tris-HCl, pH 7.5, 0.5 M LiCl, 1% NP-40, and 1% deoxycholate acid), and TE buffer (10 mM Tris-HCl, pH 8.0 and 0.1 mM EDTA). Immune complexes were eluted by incubating beads with proteinase K digestion buffer (20 mM HEPES, pH 7.9, 1 mM EDTA, 0.5% SDS, and 0.4 mg/ml proteinase K) at 50°C for 15 min. Formaldehyde crosslinking was reversed by incubating with 0.3 M NaCl and 0.3 mg/ml RNase A at 65°C overnight. Samples were further incubated with 550 µg/ml proteinase K at 50°C for 1h. DNA was purified using NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Bethlehem, PA) and eluted by 30 µl of water. Two µl of DNA was used for qRT- PCR analysis with primers targeting rat Rheb ERSE-1 (5’- CTGCACAGATTCCATTCTTCCC-3’ and 5’-TGTCTATACTTTAAATT-3’), rat Rheb ERSE-2 (5’-TGACAGCCAACCTACAGCC-3’ and 5’- GAAGCGCGGTCATTGGTG-3’), rat Hspa5 (5’-GGTGGCATGAACCAACCAG-3’ and 5’-GCTTATATATCCTCCCCGC-3’), rat Cat (5’- CTACCCACCAATTAGTACCAAATAA-3’ and 5’- AGAAGGGACAGGATTGGAAG-3’), rat Pdia6 ERSE (5’- CACATGAGCGAAATCCACAGA-3’ and 5’-ACTAGTCGAGCCATGCTGAT-3’),

6 rat HO-1 (5’-GGGCTACTCCCGTCTTCCTG-3’ and 5’- CCTTTCCAGAACCCTCTACTCTACTC-3’), or rat Gapdh (5’- ATGCGGTTTCTAGGTTCACG-3’ and 5’-ATGTTTTCTGGGGTGCAAAG-3’). Pdia6 served as a positive control for a known ATF6 target gene in cardiac myocytes while HO-1 and Gapdh served as negative controls. ChIP signals obtained from the qRT-PCR were normalized to the input DNA.

3H-Leucine incorporation and trichloroacetic acid precipitation of protein

NRVM 3H-Leucine incorporation was performed as previously described6. Briefly, NRVM were plated at a density of 2.5 x 105 cells/well on 12-well plastic culture plates. After 48 hours of serum starvation in DMEM/F-12, NRVM culture media was replaced with DMEM/F12 supplemented with BSA (1 mg/ml) containing either control, phenylephrine (50 µM), IGF1 (100ng/ml), or Lonafarnib (2 µM) for an additional 48 hours. To this media was added 1 µCi of 3H-Leucine (PerkinElmer NET460A001MC L-[3,4,5-3H(N)]-Leucine, 100 to 150 Ci/mmol). After 48 hours, the media was removed, cultures were washed 3 times with 1 ml DMEM/F-12 and cells were subsequently scraped from culture dishes with 0.5 ml of 25% trichloroacetic acid and transferred to 1.5 ml microcentrifuge tubes. Protein precipitation was induced using 50 µl of a 10mg/ml solution of BSA and samples were allowed to freeze overnight. Upon thawing, precipitates were collected by centrifugation at 4˚C at ~20,000xg for 20 minutes. Supernatants were removed by manual aspiration and precipitated protein dissolved in 200 µl of base buffer (1% Triton X-100, 1M NaOH) at 37˚C for two hours. Radioactivity in solubilized material was quantified by scintillation counting in glass scintillation vials using 180 µl of solubilized protein into 10 ml of Ecoscint scintillation fluid. Each vial was counted for a minimum of 2 minutes with at least six separate myocyte cultures per treatment.

Cultured cardiac myocyte area

NRVM (minimum of n=3 cultures per treatment) were visualized by phase- contrast microscopy and images were obtained with an IX70 fluorescence microscope (Olympus, Melville, NY) as previously described6. Cell surface area was determined using NIH Image J software from a minimum of 100 cells per image using three separate fields from each cell culture.

Transverse aortic constriction

Transverse aortic constriction (TAC) was performed as previously described6. Briefly, adult male mice were anesthetized using a 2% isofluorane/O2 mixture and intubated. Mice were treated with buprenorphine (0.1 mg/kg IP) and a partial trans-sternal thoracotomy performed using aseptic technique. An approximately

7 1.5 cm vertical left parasternal skin incision was made, underlying pectoralis muscle retracted, and the chest cavity entered through the fourth intercostal space. Using hooked retractors, adjacent ribs were retracted to expose the heart and aortic arch. The aorta was isolated from annexed tissue, and the artery partially ligated between the innominate and left common carotid arteries with 6-0 silk. The calibrated constriction of the aorta was performed by placing a dull 27- gauge needle to the side of the artery, the ligature tied firmly to both the needle and the artery, and, subsequently, the needle was removed leaving a calibrated stenosis of the aorta. Sham operated mice were exposed to the same procedure, except that the aorta was not constricted. The thoracic cavity was closed and the animals were allowed to recover. Animals were injected once with buprenorphine (0.1 mg/kg IP) about 12 h after recovery in order to reduce any post-operative discomfort. In case any animals displayed signs of pain or distress after this period, additional doses of buprenorphine were administered as needed. Immediately prior to sacrifice, animals were anesthetized and constriction levels were quantified by measuring alterations in Doppler velocities of the innominate and left carotid arteries 7 days post-TAC, as previously described12. Mean carotid peak blood flow velocities were determined using a 20 MHz Doppler probe (Indus Instruments, Houston, TX) and ratios of innominate (RC) to left carotid (LC) were determined to evaluate consistency across animals in both SHAM and TAC groups. Just prior to sacrifice, post-TAC, animals were anesthetized and 0.5 mL of arterial blood were obtained via inferior vena cava puncture. Blood was placed in heparin- and EDTA-coated vacutainer (BD Vacutainer) and centrifuged at 3000 rpm for 10 minutes and plasma samples were analyzed for cardiac troponin I with a Mouse cTnI High-Sensitivity ELISA kit (Life Diagnostics, Inc.). A calcineurin phosphatase activity assay was performed using a calcineurin tissue extract assay kit (cat#BML-AK816-0001, Enzo Life Sciences) according to the manufacturer’s protocol. Briefly, free phosphate was removed from LV tissue extracts by passing through a desalting column and calcineurin phosphatase activity was measured spectrophotometrically by detecting free phosphate released from the synthetic RII phosphopeptide.

Free-wheel exercise protocol

Free-wheel exercise protocol was performed as previously described13. Briefly, adult male mice were housed individually in cages containing rodent exercise wheels of a 5.356 in diameter (Model InnoWheel, BioServe) and provided with food and water ad libitum. The wheels were equipped with a digital magnetic counter to record revelations of the wheel during bouts of exercise. Sedentary mice were maximally house and provided with food and water ad libitum in cages not equipped with exercise wheels.

8 Transthoracic echocardiography

Transthoracic echocardiography was performed using an ultrasound imaging system (Vevo 2100 System, Fujifilm VisualSonics, Toronto, Ontario, Canada) as described2.

Transcript profiling and bioinformatics

ATF6 TG and non-transgenic littermates were treated with tamoxifen (10 mg/kg IP) daily for 5 days as previously described14. Total RNA was isolated from mouse left ventricular extracts and RNA sequencing was carried out on Illumina Nextseq at CellNetworks Deep Sequencing Core Facility at Heidelberg University. Sequencing adapter residues and low quality bases were removed from raw sequencing reads prior to all other analysis steps using Flexbar version 3.0.315. Subsequently, reads mapping to known ribosomal RNA species were excluded from further analyses using Bowtie2 version 2.3.0 with a custom rRNA-index and only keeping non- aligning reads16.⁠ Principal read mapping against the mouse reference genome (mm10, ENSEMBL build 85) was performed with the STAR aligner, version 2.5.3a17.⁠ The read-to-transcript assignment was carried out using the R package Rsubread version 1.24.218 ⁠⁠ and the ENSMBL gene annotation mm10/build85. The resulting count table was further processed with the edgeR R package19 to construct the list of differentially expressed genes. The final heatmap was generated using the pheatmap R package version 1.0.1020.⁠

Statistics

For studies involving induction of myocardial hypertrophy, either through surgical TAC or isoproterenol infusion, cohort sizes were based on a predictive power analysis to achieve 5% error and 80% power. Cell culture experiments were performed with at least three cultures for each treatment. Two-group comparisons were performed using Student’s two-tailed t-test, and all multiple group comparisons were performed using a one-way ANOVA with a Newman- Keuls post-hoc analysis. Data are represented as mean with all error bars indicating ± SEM. *P<0.05, **P<0.01, #P<0.001.

9 REFERENCES:

1. Engin F, Yermalovich A, Nguyen T, Hummasti S, Fu W, Eizirik DL, Mathis D and Hotamisligil GS. Restoration of the unfolded protein response in pancreatic beta cells protects mice against type 1 diabetes. Sci Transl Med. 2013;5:211ra156. 2. Jin JK, Blackwood EA, Azizi K, Thuerauf DJ, Fahem AG, Hofmann C, Kaufman RJ, Doroudgar S and Glembotski CC. ATF6 Decreases Myocardial Ischemia/Reperfusion Damage and Links ER Stress and Oxidative Stress Signaling Pathways in the Heart. Circ Res. 2017;120:862-875. 3. Niessner H, Beck D, Sinnberg T, Lasithiotakis K, Maczey E, Gogel J, Venturelli S, Berger A, Mauthe M, Toulany M, Flaherty K, Schaller M, Schadendorf D, Proikas- Cezanne T, Schittek B, Garbe C, Kulms D and Meier F. The farnesyl transferase inhibitor lonafarnib inhibits mTOR signaling and enforces sorafenib-induced apoptosis in melanoma cells. J Invest Dermatol. 2011;131:468-79. 4. Volkers M, Toko H, Doroudgar S, Din S, Quijada P, Joyo AY, Ornelas L, Joyo E, Thuerauf DJ, Konstandin MH, Gude N, Glembotski CC and Sussman MA. Pathological hypertrophy amelioration by PRAS40-mediated inhibition of mTORC1. Proc Natl Acad Sci U S A. 2013;110:12661-6. 5. Park CS, Cha H, Kwon EJ, Sreenivasaiah PK and Kim DH. The chemical chaperone 4-phenylbutyric acid attenuates pressure-overload cardiac hypertrophy by alleviating endoplasmic reticulum stress. Biochem Biophys Res Commun. 2012;421:578-84. 6. Doroudgar S, Volkers M, Thuerauf DJ, Khan M, Mohsin S, Respress JL, Wang W, Gude N, Muller OJ, Wehrens XH, Sussman MA and Glembotski CC. Hrd1 and ER- Associated Protein Degradation, ERAD, are Critical Elements of the Adaptive ER Stress Response in Cardiac Myocytes. Circ Res. 2015;117:536-46. 7. Thuerauf DJ, Hoover H, Meller J, Hernandez J, Su L, Andrews C, Dillmann WH, McDonough PM and Glembotski CC. Sarco/endoplasmic reticulum calcium ATPase-2 expression is regulated by ATF6 during the endoplasmic reticulum stress response: intracellular signaling of calcium stress in a cardiac myocyte model system. J Biol Chem. 2001;276:48309-17. 8. Zechner D, Craig R, Hanford DS, McDonough PM, Sabbadini RA and Glembotski CC. MKK6 activates myocardial cell NF-kappa B and inhibits apoptosis in a p38 mitogen- activated protein kinase-dependent manner. Journal of Biological Chemistry. 1998;273:8232-8239. 9. Doroudgar S, Thuerauf DJ, Marcinko MC, Belmont PJ and Glembotski CC. Ischemia activates the ATF6 branch of the endoplasmic reticulum stress response. J Biol Chem. 2009;284:29735-45. 10. Thuerauf DJ, Hoover H, Meller J, Hernandez J, Su L, Andrews C, Dillmann WH, McDonough PM and Glembotski CC. Sarco/endoplasmic reticulum calcium ATPase-2 expression is regulated by ATF6 during the endoplasmic reticulum stress response - Intracellular signaling of calcium stress in a cardiac myocyte model system. Journal of Biological Chemistry. 2001;276:48309-48317.

10 11. Vekich JA, Belmont PJ, Thuerauf DJ and Glembotski CC. Protein disulfide isomerase-associated 6 is an ATF6-inducible ER stress response protein that protects cardiac myocytes from ischemia/reperfusion-mediated cell death. J Mol Cell Cardiol. 2012;53:259-67. 12. Reynolds JO, Quick AP, Wang Q, Beavers DL, Philippen LE, Showell J, Barreto- Torres G, Thuerauf DJ, Doroudgar S, Glembotski CC and Wehrens XH. Junctophilin-2 gene therapy rescues heart failure by normalizing RyR2-mediated Ca2+ release. Int J Cardiol. 2016;225:371-380. 13. Volkers M, Toko H, Doroudgar S, Din S, Quijada P, Joyo AY, Ornelas L, Joyo E, Thuerauf DJ, Konstandin MH, Gude N, Glembotski CC and Sussman MA. Pathological hypertrophy amelioration by PRAS40-mediated inhibition of mTORC1. Proc Natl Acad Sci U S A. 110:12661-6. 14. Martindale JJ, Fernandez R, Thuerauf D, Whittaker R, Gude N, Sussman MA and Glembotski CC. Endoplasmic reticulum stress gene induction and protection from ischemia/reperfusion injury in the hearts of transgenic mice with a tamoxifen-regulated form of ATF6. Circ Res. 2006;98:1186-93. 15. Roehr JT, Dieterich C and Reinert K. Flexbar 3.0 - SIMD and multicore parallelization. Bioinformatics. 2017;33:2941-2942. 16. Langmead B and Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nat Methods. 2012;9:357-9. 17. Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, Batut P, Chaisson M and Gingeras TR. STAR: ultrafast universal RNA-seq aligner. Bioinformatics. 2013;29:15- 21. 18. Liao Y, Smyth GK and Shi W. The Subread aligner: fast, accurate and scalable read mapping by seed-and-vote. Nucleic Acids Res. 2013;41:e108. 19. Robinson MD, McCarthy DJ and Smyth GK. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics. 2010;26:139-40. 20. Kolde R. Pheatmap: pretty heatmaps. R Packag. version 61. 2012.

11 A Con Sham Con TAC ATF6 cKO Sham ATF6 cKO TAC

6 **

4 **

2

0 β -actin (fold-of-con) Target/ Rcan1 Calr Cat

B Con ATF6 cKO 20

10 # Plasma cTnI (ng/ml) nd 0 SHAM TAC

Online Figure I. Effect of cardiac myocyte-specific ATF6 gene deletion in mice subjected to TAC: A, mRNA for ATF6 target genes was determined by qRT-PCR. B, Troponin I (cTnI) levels were measured in plasma samples collected from Con or ATF6 cKO mice. Data are represented as mean + s.e.m. **P<0.01, #P<0.001. Online Figure I A GO:0007264: small GTPase mediated signal transduction

Rhoq Arf2 Rheb Tiam2 Rap1a Pak4 Rap2b Arhgap44 Rala Mapkap1 Nckap1 Rhod Farp1 Pak3 Ctnnal1 Arhgap12 Rhoa Arhgap35 Arhgdia Jun Rnd1 Ralgps1 Map2k1 Arhgef10l Spata13 Hras Rap2a Gpr35 Kras Kpnb1 Rnd3 Shoc2 Git1 Kank1 Pdpn Erbb2 Rhoc Stmn1 Aif1 Sdcbp Rras2 Dok2 Ralb Hmox1 Net1 Cdc42 Itga3 Col3a1 Ect2 Arhgap1 Bcl6

B NTG C ATF6 TG # 6 ERSE-2 ERSE-1 Fold Induction # -754 -735 -628 -609 By AdV- ATF6 5 -1067 +123 # Rat-Rheb Luc 3.78 ± 0.17 4 -723 +123 (fold-of-con) 3 # Luc 5.53 ± 0.37 2

β- actin -390 +123 1 Luc 2.21 ± 0.26 *

Rheb/ 0 Veh TMX

D E AAV9-Con F AAV9-Con AAV9-ATF6 AAV9 AAV9-ATF6 Con ATF6 10 3 ** 1 2 3 4 5 6 * 8 50- Flag-ATF6 GRP78 2 6 75- (fold-of-con)

(fold-of-con) 20- RHEB 4 43- β-Actin 1 β-Actin β- actin 2 Rheb/

0 RHEB / 0

Online Figure II. ATF6-dependent induction of Rheb in mouse hearts: A, Table of a subset of induced genes represented by respective gene symbols in ATF6 TG mice with p values and FDR <0.05 annotated with ensemble biological process term GO:0007264. B, mRNA for Rheb was determined by qRT-PCR using LV extracts from ATF6-transgenic (ATF6 TG) and non-transgenic littermates after 5 days of tamoxifen administration (10mg/kg), which activates ATF6 in this mouse line. C, Diagram of constructs encoding different truncated forms of the rat rheb 5’-flanking sequence driving luciferase, as shown (left), i.e. rat-rheb(-1067/+123)-Luc, rat-rheb(-723/+123)-Luc, and rat-rheb(-390/+123)-Luc were transfected into NRVM which were then infected with AdV encoding ATF6(1-373) [active form], or with a control AdV. Luciferase enzyme activity in AdV-ATF6-infected cells was normalized to luciferase enzyme activity in AdV-Con-infected cells to determine the fold-induction by ATF6 (right). D, mRNA for Rheb was determined by qRT-PCR from LV extracts from mice treated 4 weeks with AAV9-Con or AAV9-ATF6. E, F, Immunoblot (E) and densitometry quantification (F) of RHEB protein expression AAV9-Con or AAV9-ATF6 mouse heart extracts. Data are represented as mean + s.e.m. *P<0.05, **P<0.01, #P<0.001. Online Figure II A Sham TAC Con ATF6 cKO Con ATF6 cKO 1 2 3 4 5 6 7 8 9 10 11 12 200- p-TSC2 (Thr1462) 200- TSC2 60- p-AKT (Thr308) 60- p-AKT (Ser473) 60- AKT 50- p-ERK1/2 (Thr202/Tyr204) 50- ERK1/2

B Con ATF6 cKO 3 # # 2

1 (fold-of-con) Calcineurin Activity

free-phosphate released 0 SHAM TAC

Online Figure III. Effects of ATF6 deletion on regulators of the mTORC1 pathway in hearts of mice subjected to TAC: A, Immunoblot of TSC2, AKT, and ERK1/2 protein phosphorylation and expression in LV extracts from Con or ATF6 cKO mice after 7 days of Sham or TAC. B, Calcineurin activity as measured by free-phosphate release in LV extracts from Con or ATF6 cKO mice after 7 days of Sham or TAC. Data are represented as mean + s.e.m. #P<0.001. Online Figure III A siCon siRheb B siCon siRheb siAtf6 siAtf6 6000 # 6000 * # ** 5000 5000

4000 4000

3000 3000

2000 2000 H-Leucine Incorp H-Leucine Incorp

3 1000 3 1000 (Disintegrations/min) (Disintegrations/min) 0 0 Con PE Con IGF1

C siCon siRheb siAtf6 Gene Induction by PE ** 10 #

8 * ** 6 * * * 4 * * 2

0 Target/Gapdh (fold-of-con) Target/Gapdh Rcan1 Calr Cat

D siCon siAtf6 siRheb Con PECon PE Con PE 1 2 3 4 5 6 7 8 9 10 11 12 60- pAKT (Ser473) 60- AKT

E siCon siAtf6 siRheb Con IGF1Con IGF1 Con IGF1 1 2 3 4 5 6 7 8 9 10 11 12 60- pAKT (Ser473) 60- AKT

Online Figure IV. Effect of ATF6 and RHEB knockdown on the mTORC1 pathway at cardiac myocyte hypertrophy: A-E, NRVM were transfected with a nontargeted siRNA (siCon) or siRNAs targeted to rat ATF6 (siAtf6) or RHEB (siRheb), and then treated with or without phenylephrine (PE; 50µM) or IGF1 (100ng/ml) for 48 hours. A, B, Incorporation of 3H-leucine into TCA-precipitable protein in NRVM extracts was measured by scintillation counting. E, mRNA for ATF6 target genes was determined by qRT-PCR in coordination with target genes presented in Figure 4E.D, E, Immunoblot of NRVM. Phosphorylation of AKT on Ser473 is indicative of mTORC2 activity. Data are represented as mean + s.e.m. *P<0.05, **P<0.01, #P<0.001. Online Figure IV A Vehicle B Vehicle Lonafarnib Lonafarnib 6000 *

5000 * Con

4000

3000

2000 PE H-Leucine Incorp

3 1000 (Disintegrations/min) 0 50 µm Con PE

C Vehicle Lonafarnib Con PE Con PE 1 2 3 4 5 6 7 8 9 10 11 12 100- ATF6 P90 50- ATF6 P50 75- GRP78 20- RHEB 250- p-mTOR 250- mTOR 75- p-S6K 75- S6K 20- p-4EBP 20- 4EBP 37- GAPDH

D Vehicle E Vehicle Lonafarnib Lonafarnib 5000 * **

4000 Con

3000 *

2000 H-Leucine Incorp 1000 IGF1 3 (Disintegrations/min) 0 50 µm Con IGF1

Online Figure V. Rheb-inhibitor, Lonafarnib, inhibition of cardiac myocyte hypertrophy: A-C, NRVM were treated with or without PE (50µM) for 48 hours in the 3 presence or absence of the Rheb inhibitor, Lonafarnib (2µM). A, Incorporation of H-leucine into TCA-precipitable protein in NRVM extracts was measured by scintillation counting. B, ICF of NRVM stained for α-actinin (blue) and TOPRO-3 (red). Bar = 50µm. C, Immunoblot of NRVM. D-E, NRVM were treated with or without IGF1 (100ng/ml) for 48 hours in the presence or absence of the Rheb inhibitor, Lonafarnib (2µM). D, Incorporation of 3 H-leucine into TCA-precipitable protein in NRVM extracts was measured by scintillation counting. E, ICF of NRVM stained for α-actinin (blue) and TOPRO-3 (red). Bar = 50µm. Data are represented as mean s.e.m. *P<0.05, **P<0.01. + Online Figure V A AdV-Con + Con AdV-ATF6 + Con AdV-Con + Rap AdV-ATF6 + Rap * # * 1400 #

2 # # # 1200 # # 1000 # 800 600 400 200

Cell Surface Area (µm ) Cell Surface 0 Con PE IGF1 B siCon Lonarfinib C siCon Lonafarnib siRheb siRheb # ** # 1200 # 2 2 1200 * 1000 * 1000 # # 800 800 * * * * 600 600 * * 400 400 200 200

Cell Surface Area (µm ) Cell Surface 0 Area (µm ) Cell Surface 0 Con + + + + + + Con + + + + + + PE + + + + + + IGF1 + + + + + + AdV-Con + + + + + + AdV-Con + + + + + + AdV-ATF6 + + + + + + AdV-ATF6 + + + + + +

Online Figure VI. Effect of ATF6 overexpression on cardiac myocyte hypertrophy: A, NRVM were infected with AdV encoding control or FLAG-ATF6(1-373) [active form] and then treated with or without phenylephrine (PE; 50µM) or IGF1 (100ng/ml), with or without rapamycin (20nM) for 48 hours, as shown. Cell surface area was determined by photomicroscopy and morphometry, then expressed as mean + s.e.m after analyzing at least 100 cells per treatment per experiment. B-C, NRVM were transfected with a non-targeted siRNA (siCon) or siRNA targeted to rat RHEB (siRheb), and then infected with AdV encoding control or FLAG-ATF6(1-373) [active form]. NRVM were then treated with or without phenylephrine (PE; 50µM) (B) or IGF1 (100ng/ml) (C) with or without Lonafarnib (2µM) for 48 hours, as shown. Data are represented as mean + s.e.m. *P<0.05, **P<0.01, #P<0.001. Online Figure VI A Con Rapamycin Con PE IGF1 Con PE IGF1 1 2 3 4 5 6 7 8 9 10 11 12 100- ATF6 P90 50- ATF6 P50 150- pPERK 150- PERK 50- XBP1s 150- IRE1 75- p-S6K 75- S6K 20- p-4EBP 20- 4EBP 20- RHEB 37- GAPDH

B C siCon siPerk siCon siPerk siAtf6 siIre1 siAtf6 siIre1

1.2

2 # 1200 1.0 1000 # # 0.8 800

(fold-of-con) 0.6 ** 600 ** 0.4 400 β- actin # 0.2 200

0.0 Area (µm ) Cell Surface 0 Target/ Atf6 Eif2ak3 Ern1 Con PE

D AdV-Con AdV-94-373 AdV-1-373

1000 * 2 # 800 # # * # 600 * * 400

200

Cell Surface Area (µm ) Cell Surface 0 PE - - + + siAtf6 - -+ +

Online Figure VII Online Figure VII. mTORC1-dependent activation of the UPR during cardiac myocyte hypertrophy: A, Immunoblot of NRVM after treatment with or without phenylephrine (PE; 50µM) or IGF1 (100ng/ml), with or without rapamycin (20nM) for 48 hours, as shown. B, C, NRVM were transfected with siCon or siRNAs targeted to rat ATF6 (siAtf6), PERK (siPerk), or IRE1 (siIre1) and then treated with or without phenylephrine (PE; 50µM) for 48 hours. Atf6, Perk (Eif2ak3) and Ire1 (Ern1) mRNA levels were determined by qRT-PCR (B), and cell surface area was determined by photomicroscopy and morphometry (C). D, NRVM were transfected with a nontargeted siRNA (siCon) or siRNA targeted to rat ATF6 (siAtf6) and were then infected with AdV encoding control, FLAG-ATF6(1-373) [active] or FLAG-ATF6(94-373) [inactive due to deletion of transcriptional activation domain], then treated with or without phenylephrine (PE; 50µM) for 48 hours. Cell surface area was determined by photomicroscopy and morphometry, then expressed as mean + s.e.m after analyzing at least 100 cells per treatment per experiment. Data are represented as mean + s.e.m. *P<0.05, **P<0.05, #P<0.001.

Online Figure VII A siCon siAtf6 Con PE IGF1 Con PE IGF1 1 2 3 4 5 6 7 8 9 10 11 12 100- ATF6 P90 50- ATF6 P50 75- p-S6K 75- S6K 20- p-4EBP 20- 4EBP 20- RHEB 37- GAPDH

B Con Rapamycin Con PE IGF1 Con PE IGF1 1 2 3 4 5 6 7 8 9 10 11 12 100- ATF6 P90 50- ATF6 P50 75- p-S6K 75- S6K 20- p-4EBP 20- 4EBP 20- RHEB 37- GAPDH

C Con CHX Con PE IGF1 Con PE IGF1 1 2 3 4 5 6 7 8 9 10 11 12 100- ATF6 P90 50- ATF6 P50 75- p-S6K 75- S6K 20- p-4EBP 20- 4EBP 20- RHEB 37- GAPDH

D Con 4-PBA Con PE IGF1 Con PE IGF1 1 2 3 4 5 6 7 8 9 10 11 12 100- ATF6 P90 50- ATF6 P50 75- p-S6K 75- S6K 20- p-4EBP 20- 4EBP 20- RHEB 37- GAPDH

Online Figure VIII Online Figure VIII. Protein synthesis-dependent activation of the UPR during cardiac myocyte hypertrophy: A, Immunoblot of NRVM transfected with a nontargeted siRNA (siCon) or with siRNA targeted to rat ATF6 (siAtf6) and then treated with or without phenylephrine (PE; 50µM) or IGF1 (100ng/ml) for 6 hours. B, Immunoblot of NRVM after treatment with or without phenylephrine (PE; 50µM) or IGF1 (100ng/ml), with or without rapamycin (20nM) for 6 hours, as shown. C, Immunoblot of NRVM after co-treatment with or without cyclohexamide (CHX; 100µg/ml) and either phenylephrine (PE; 50µM) or IGF1 (100ng/ml) for 6 hours. D, Immunoblot of NRVM after pretreatment with 4-phenylbutyrate (4-PBA; 100µM) for 24 hours and subsequent co-treatment with or without 4-PBA (100µM) and either phenylephrine (PE; 50µM) or IGF1 (100ng/ml) for an additional 6 hours.

Online Figure VIII Table I: 7-day TAC echocardiographic parameters for Con and ATF6 cKO mice

Con ATF6 cKO Con ATF6 cKO Sham Sham TAC TAC (n = 5) (n = 5) (n = 5) (n = 6) FS (%) 30.40±1.91 26.71±2.31 28.28±1.89 16.12±1.411,2 EF (%) 58.60±2.72 52.64±3.72 55.46±2.86 34.30±2.741,2 LVEDV (l) 53.75±5.29 62.55±4.99 51.26±2.23 68.32±5.212 LVESV (l) 22.47±3.07 30.08±3.98 22.83±1.80 45.35±4.732 LVIDD (mm) 3.56±0.15 3.80±0.13 3.51±0.06 3.95±0.132 LVIDS (mm) 2.48±0.14 2.80±0.16 2.52±0.08 3.32±0.151,2 PWTD (mm) 0.86±0.13 0.89±0.15 1.51±0.111 1.01±0.102 PWTS (mm) 1.17±0.10 1.04±0.12 1.76±0.101 1.07±0.112 AWTD (mm) 0.88±0.07 0.76±0.05 1.40±0.081 0.97±0.071,2 AWTS (mm) 1.08±0.04 1.02±0.08 1.72±0.031 1.10±0.072 HR (bpm) 519±13.27 540±2.63 524±3.71 523±13.47 DPLR (RC/LC) 0.91±0.05 1.11±0.08 4.56±0.251 4.85±0.341 HW (mg) 118.98±5.41 120.62±3.35 183.36±6.141 154.08±3.091,2 BW (g) 21.57±0.78 23.85±0.80 25.78±0.641 24.43±0.59 TL (mm) 16.40±.0.24 17.40±0.24 17.40±0.24 17.00±0.00 HW/BW (mg/g) 5.53±0.27 5.06±0.08 7.12±0.201 6.32±0.161,2 HW/TL (mg/mm) 7.26±0.33 6.93±0.11 10.53±0.251 9.06±0.181,2

FS = fractional shortening EF = ejection fraction LVEDV = left ventricular end diastolic volume LVESV = left ventricular end systolic volume LVIDD = left ventricular inner diameter in diastole LVIDS = left ventricular inner diameter in systole PWTD = left ventricular posterior wall thickness in diastole PWTS = left ventricular posterior wall thickness in systole AWTD = left ventricular anterior wall thickness in diastole AWTS = left ventricular anterior wall thickness in systole HR = heart rate in beats per minute DPLR = Doppler ratio of right carotid blood flow velocity to left carotid blood flow velocity HW = heart weight BW = body weight TL = tibia length HW/BW = heart weight/body weight HW/TL = heart weight/tibia length

Statistical analyses used a one-way ANOVA with a Newman-Keuls post-hoc analysis.

1 = p 0.05 different from respective Sham 2 = p 0.05 different from Con TAC ൑

൑ Online Table I Table II: 4-week Free Wheel echocardiographic parameters for Con and ATF6 cKO mice

Con ATF6 cKO Con ATF6 cKO Sedentary Sedentary Run Run (n = 5) (n = 5) (n = 5) (n = 5) FS (%) 29.19±1.46 24.22±1.64 29.24±1.74 23.03±1.752 EF (%) 56.42±2.33 48.55±2.70 57.06±2.74 46.53±3.002 LVEDV (l) 79.56±16.48 72.38±6.33 50.38±7.60 71.78±5.852 LVESV (l) 35.29±7.76 37.64±4.35 22.29±3.93 38.54±4.112 LVIDD (mm) 4.13±0.40 4.04±0.15 3.44±0.24 4.03±0.142 LVIDS (mm) 2.93±0.30 3.07±0.16 2.45±0.21 3.10±0.142 PWTD (mm) 0.75±0.14 0.89±0.14 1.77±0.111 0.79±0.032 PWTS (mm) 1.08±0.08 1.21±0.15 2.06±0.081 1.08±0.042 AWTD (mm) 0.81±0.06 0.84±0.07 1.22±0.081 0.96±0.092 AWTS (mm) 1.11±0.03 1.14±0.05 1.48±0.071 1.09±0.072 HR (bpm) 491±9.28 500±9.36 506±9.11 556±8.701,2 DIST (km/wk) n/a n/a 8.11±1.79 8.65±0.87 HW (mg) 132.02±4.51 128.32±7.28 171.16±5.241 137.02±1.402 BW (g) 27.23±0.51 25.14±0.90 24.80±0.661 24.43±0.43 TL (mm) 17.00±0.00 17.20±0.20 17.20±0.20 17.60±0.24 HW/BW (mg/g) 4.85±0.14 5.09±0.16 6.90±0.131 5.61±0.091,2 HW/TL (mg/mm) 7.77±0.27 7.46±0.42 9.96±0.351 7.79±0.112

FS = fractional shortening EF = ejection fraction LVEDV = left ventricular end diastolic volume LVESV = left ventricular end systolic volume LVIDD = left ventricular inner diameter in diastole LVIDS = left ventricular inner diameter in systole PWTD = left ventricular posterior wall thickness in diastole PWTS = left ventricular posterior wall thickness in systole AWTD = left ventricular anterior wall thickness in diastole AWTS = left ventricular anterior wall thickness in systole HR = heart rate in beats per minute DIST = average distance ran per week HW = heart weight BW = body weight TL = tibia length HW/BW = heart weight/body weight HW/TL = heart weight/tibia length

Statistical analyses used a one-way ANOVA with a Newman-Keuls post-hoc analysis. 1 = p 0.05 different from respective Sedentary 2 = p 0.05 different from Con Run ൑ ൑ Online Table II Online Table III - Genes Changed by ATF6 in the Heart p < 0.05 Gene No.Gene Symbol ENSEMBL ID log2FC 1 Derl3 ENSMUSG00000009092 11.81357136 2 Bmp10 ENSMUSG00000030046 10.08553123 3 Serpinb1c ENSMUSG00000079049 9.474748328 4 Esr1 ENSMUSG00000019768 9.008620439 5 Saa3 ENSMUSG00000040026 8.404639259 6 Rec8 ENSMUSG00000002324 7.080680613 7 Gm8424 ENSMUSG00000081194 6.43393998 8 Sdf2l1 ENSMUSG00000022769 6.422401383 9 Vmn2r3 ENSMUSG00000091572 6.388726375 10 Gm1627 ENSMUSG00000100987 6.167009426 11 Slc7a11 ENSMUSG00000027737 6.022939919 12 Epyc ENSMUSG00000019936 5.970480515 13 Far1 ENSMUSG00000030759 5.898776763 14 Myl7 ENSMUSG00000020469 5.765310795 15 Ube2c ENSMUSG00000001403 5.703447206 16 Arntl ENSMUSG00000055116 5.68993575 17 Pdia4 ENSMUSG00000025823 5.653529589 18 Mthfd2 ENSMUSG00000005667 5.640699455 19 Slc6a2 ENSMUSG00000055368 5.588147698 20 Slc7a3 ENSMUSG00000031297 5.585746991 21 Pak3 ENSMUSG00000031284 5.576617158 22 Chil3 ENSMUSG00000040809 5.544097671 23 Mybphl ENSMUSG00000068745 5.418282086 24 Pycr1 ENSMUSG00000025140 5.415421318 25 Mefv ENSMUSG00000022534 5.273792403 26 Psat1 ENSMUSG00000024640 5.200998995 27 Serpina3f ENSMUSG00000066363 5.179387737 28 Baalc ENSMUSG00000022296 5.165927848 29 Myl4 ENSMUSG00000061086 5.142184528 30 Sln ENSMUSG00000042045 5.062686483 31 Ptx3 ENSMUSG00000027832 5.060941359 32 Prkcz ENSMUSG00000029053 5.04750561 33 Gm33474 ENSMUSG00000106554 4.984196961 34 Acox2 ENSMUSG00000021751 4.824390864 35 Phgdh ENSMUSG00000053398 4.816582392 36 Ptprt ENSMUSG00000053141 4.730415496 37 Manf ENSMUSG00000032575 4.726713953 38 Asns ENSMUSG00000029752 4.620079425 39 Gm11382 ENSMUSG00000074973 4.614035415 40 Polr3k ENSMUSG00000038628 4.549235916 41 Tnni1 ENSMUSG00000026418 4.526836544 42 Cxcl5 ENSMUSG00000029371 4.443899107 43 Tubb3 ENSMUSG00000062380 4.421978788 44 Tk1 ENSMUSG00000025574 4.417099686 45 Mlana ENSMUSG00000024806 4.402834241 46 Ccl2 ENSMUSG00000035385 4.389626965 47 Selp ENSMUSG00000026580 4.375541912 48 P4hb ENSMUSG00000025130 4.375151476 49 Gabrg3 ENSMUSG00000055026 4.295137994 50 Mcoln2 ENSMUSG00000011008 4.238921524 51 Timp1 ENSMUSG00000001131 4.214956842 52 7530428D23Rik ENSMUSG00000103441 4.200585247 53 Mmp12 ENSMUSG00000049723 4.177679228 54 Sphkap ENSMUSG00000026163 4.144898204 55 Bmp3 ENSMUSG00000029335 4.139366775 56 Il1rn ENSMUSG00000026981 4.091671943 57 Hsp90b1 ENSMUSG00000020048 4.073873276 58 Clec4e ENSMUSG00000030142 4.040821306 59 Prkcz2 ENSMUSG00000108314 4.038600449 60 Dok5 ENSMUSG00000027560 3.978150578 61 E2f1 ENSMUSG00000027490 3.975272909 62 Hp ENSMUSG00000031722 3.959608332 63 Hyou1 ENSMUSG00000032115 3.944982062 64 Fgf12 ENSMUSG00000022523 3.939196334 65 Sycp2 ENSMUSG00000060445 3.935533061 66 Gdf15 ENSMUSG00000038508 3.934450583 67 Rbm15b ENSMUSG00000074102 3.931228987 68 Spp1 ENSMUSG00000029304 3.740713979 69 Ccl7 ENSMUSG00000035373 3.738093438 70 Tmem163 ENSMUSG00000026347 3.731074518 71 Gm7967 ENSMUSG00000100009 3.730896653 72 Adamts4 ENSMUSG00000006403 3.718658173 73 Xrcc3 ENSMUSG00000021287 3.706565382 74 Cxcr6 ENSMUSG00000048521 3.700892285 75 Plac8 ENSMUSG00000029322 3.680345573 76 Creld2 ENSMUSG00000023272 3.666193145 77 Tnc ENSMUSG00000028364 3.591714397 78 Rxfp1 ENSMUSG00000034009 3.535189978 79 Tnfsf18 ENSMUSG00000066755 3.524499913 80 Ereg ENSMUSG00000029377 3.416991129 81 Gm7901 ENSMUSG00000101431 3.414907051 82 Cxcl10 ENSMUSG00000034855 3.389971448 83 Card14 ENSMUSG00000013483 3.357137465 84 Aldh18a1 ENSMUSG00000025007 3.34458723 85 Dnajb11 ENSMUSG00000004460 3.343407519 86 Gm15344 ENSMUSG00000084899 3.294729535 87 Slc2a6 ENSMUSG00000036067 3.284007038 88 Ccr2 ENSMUSG00000049103 3.277942748 89 Cyp2e1 ENSMUSG00000025479 3.272304905 90 Lrp8 ENSMUSG00000028613 3.2721959 91 Socs3 ENSMUSG00000053113 3.254763524 92 Hspa5 ENSMUSG00000026864 3.226595312 93 Tspyl2 ENSMUSG00000041096 3.182915422 94 Nxpe5 ENSMUSG00000047592 3.170840319 95 Slc27a3 ENSMUSG00000027932 3.160858267 96 Ch25h ENSMUSG00000050370 3.156766066 97 Lman1l ENSMUSG00000056271 3.086917291 98 Hn1l ENSMUSG00000024165 3.058111074 99 D030028A08Rik ENSMUSG00000078700 3.024411342 100 Trib3 ENSMUSG00000032715 3.01669847 101 Oip5 ENSMUSG00000072980 3.007680092 102 Calr ENSMUSG00000003814 3.002423682 103 Ptrh1 ENSMUSG00000053746 2.996601041 104 Sel1l ENSMUSG00000020964 2.984189709 105 Pgp ENSMUSG00000043445 2.977330198 106 Fhl1 ENSMUSG00000023092 2.962677997 107 Hspa1a ENSMUSG00000091971 2.946993662 108 Akr1b3 ENSMUSG00000001642 2.926261072 109 Aldh1a2 ENSMUSG00000013584 2.923052074 110 Gm37006 ENSMUSG00000103885 2.917999382 111 Slfn4 ENSMUSG00000000204 2.911860183 112 Gm10097 ENSMUSG00000096553 2.910195446 113 F10 ENSMUSG00000031444 2.898660594 114 Gm12138 ENSMUSG00000082087 2.871691575 115 Cdkn2b ENSMUSG00000073802 2.859130135 116 4732465J04Rik ENSMUSG00000101517 2.838500759 117 Mt2 ENSMUSG00000031762 2.836149018 118 Serpina3n ENSMUSG00000021091 2.821965398 119 Cilp2 ENSMUSG00000044006 2.806837587 120 Elk1 ENSMUSG00000009406 2.803602336 121 Ints3 ENSMUSG00000027933 2.794929571 122 Gm6644 ENSMUSG00000100309 2.788194109 123 2610028H24Rik ENSMUSG00000009114 2.776943846 124 Lmntd1 ENSMUSG00000054966 2.766244614 125 B230217C12Rik ENSMUSG00000050538 2.760138761 126 Sele ENSMUSG00000026582 2.753570014 127 Ebp ENSMUSG00000031168 2.744096448 128 Alkbh2 ENSMUSG00000044339 2.704625956 129 Gm6736 ENSMUSG00000071414 2.697352753 130 Fgr ENSMUSG00000028874 2.688598098 131 Eda2r ENSMUSG00000034457 2.682140385 132 Serpina3g ENSMUSG00000041481 2.656149339 133 Itgax ENSMUSG00000030789 2.646619905 134 Hspa1b ENSMUSG00000090877 2.614593952 135 Stbd1 ENSMUSG00000047963 2.612770661 136 Slc7a5 ENSMUSG00000040010 2.611412306 137 Fanca ENSMUSG00000032815 2.600943825 138 Gpr141 ENSMUSG00000053101 2.599376007 139 Myc ENSMUSG00000022346 2.593094825 140 Gm9768 ENSMUSG00000108391 2.589201067 141 Serpina9 ENSMUSG00000058260 2.569835526 142 H2-Ke6 ENSMUSG00000073422 2.539940112 143 B430219N15Rik ENSMUSG00000085211 2.535694452 144 Lgals3 ENSMUSG00000050335 2.519191675 145 Pilra ENSMUSG00000046245 2.516259782 146 Dolpp1 ENSMUSG00000026856 2.514853363 147 Gm43660 ENSMUSG00000107352 2.505444971 148 Gm3571 ENSMUSG00000090610 2.49879397 149 Pdia6 ENSMUSG00000020571 2.490430091 150 Ppp1r3d ENSMUSG00000049999 2.480900989 151 Shisa6 ENSMUSG00000053930 2.47963875 152 Tnfrsf12a ENSMUSG00000023905 2.479420744 153 Fos ENSMUSG00000021250 2.471681076 154 C920009B18Rik ENSMUSG00000097352 2.461909181 155 Cpne5 ENSMUSG00000024008 2.456456201 156 Gm4841 ENSMUSG00000068606 2.452944216 157 Tfec ENSMUSG00000029553 2.45290359 158 Cenpw ENSMUSG00000075266 2.449517084 159 Tlr1 ENSMUSG00000044827 2.449281283 160 Gm24305 ENSMUSG00000095590 2.445442278 161 Gtse1 ENSMUSG00000022385 2.431922128 162 Gm29040 ENSMUSG00000099576 2.428158893 163 Rab26os ENSMUSG00000093565 2.423793102 164 Arf2 ENSMUSG00000062421 2.42044934 165 Dnajc3 ENSMUSG00000022136 2.41721018 166 Cdk2ap2 ENSMUSG00000024856 2.41009384 167 1200007C13Rik ENSMUSG00000087684 2.390563475 168 Clec4d ENSMUSG00000030144 2.384137488 169 Cdkn1a ENSMUSG00000023067 2.375206669 170 Hmox1 ENSMUSG00000005413 2.374030372 171 Ddias ENSMUSG00000030641 2.3659262 172 Csf2rb2 ENSMUSG00000071714 2.362173452 173 2210407C18Rik ENSMUSG00000037145 2.360698164 174 Dkk3 ENSMUSG00000030772 2.36049145 175 Gm26606 ENSMUSG00000097337 2.358506742 176 Lrrc71 ENSMUSG00000023084 2.338508612 177 Xbp1 ENSMUSG00000020484 2.336362417 178 Ncam1 ENSMUSG00000039542 2.332206947 179 Cxcl1 ENSMUSG00000029380 2.332199941 180 Gprin3 ENSMUSG00000045441 2.317360823 181 Sept5 ENSMUSG00000072214 2.313294592 182 Syvn1 ENSMUSG00000024807 2.306530263 183 Egr2 ENSMUSG00000037868 2.304716168 184 Thbs1 ENSMUSG00000040152 2.295796614 185 Kcnc3 ENSMUSG00000062785 2.290653415 186 Kifc1 ENSMUSG00000079553 2.287334021 187 Gale ENSMUSG00000028671 2.284048043 188 Nans ENSMUSG00000028334 2.275578636 189 Nusap1 ENSMUSG00000027306 2.255037554 190 Rcan1 ENSMUSG00000022951 2.212202653 191 Slfn1 ENSMUSG00000078763 2.212112935 192 Gm17709 ENSMUSG00000091952 2.209253708 193 Avil ENSMUSG00000025432 2.201618781 194 Mvd ENSMUSG00000006517 2.199845318 195 Unc5c ENSMUSG00000059921 2.196062762 196 Sesn2 ENSMUSG00000028893 2.195520396 197 Cdca3 ENSMUSG00000023505 2.191457262 198 Napsa ENSMUSG00000002204 2.188994743 199 Chka ENSMUSG00000024843 2.186135159 200 Zfp850 ENSMUSG00000096916 2.184406999 201 2200002D01Rik ENSMUSG00000030587 2.182975708 202 Tbcb ENSMUSG00000006095 2.182783885 203 Cenpk ENSMUSG00000021714 2.180064742 204 Ormdl2 ENSMUSG00000025353 2.177591587 205 Clec4n ENSMUSG00000023349 2.172999515 206 2810474O19Rik ENSMUSG00000032712 2.169593649 207 Ms4a4c ENSMUSG00000024675 2.169515604 208 Nde1 ENSMUSG00000022678 2.146751019 209 Serpina3i ENSMUSG00000079014 2.138122645 210 Asf1b ENSMUSG00000005470 2.137415133 211 Ears2 ENSMUSG00000030871 2.137228298 212 Gpr35 ENSMUSG00000026271 2.134014304 213 Junb ENSMUSG00000052837 2.133716588 214 Spc25 ENSMUSG00000005233 2.129056067 215 Dmxl1 ENSMUSG00000037416 2.127947217 216 Msr1 ENSMUSG00000025044 2.126320408 217 Wfs1 ENSMUSG00000039474 2.121447861 218 Uck2 ENSMUSG00000026558 2.113344049 219 Zfp324 ENSMUSG00000004500 2.097824653 220 Adam8 ENSMUSG00000025473 2.09172395 221 Ccl12 ENSMUSG00000035352 2.08771107 222 Kctd8 ENSMUSG00000037653 2.078933632 223 Ntng2 ENSMUSG00000035513 2.064808181 224 Sfrp5 ENSMUSG00000018822 2.061985858 225 Pdia3 ENSMUSG00000027248 2.058758685 226 Sh2d5 ENSMUSG00000045349 2.053762515 227 Adamts15 ENSMUSG00000033453 2.051962365 228 Slamf8 ENSMUSG00000053318 2.041095586 229 Lad1 ENSMUSG00000041782 2.039938823 230 Nlrp3 ENSMUSG00000032691 2.034710962 231 Gm10130 ENSMUSG00000095315 2.026437197 232 Eif1a ENSMUSG00000057561 2.022963037 233 Samsn1 ENSMUSG00000022876 2.017177449 234 Ankrd42 ENSMUSG00000041343 2.015608579 235 Morf4l2 ENSMUSG00000031422 2.003946107 236 Slc6a9 ENSMUSG00000028542 2.002328136 237 Xlr3b ENSMUSG00000073125 2.002130317 238 Piga ENSMUSG00000031381 2.001658825 239 Nfil3 ENSMUSG00000056749 1.997276455 240 1500015O10Rik ENSMUSG00000026051 1.981376136 241 Aldh1l2 ENSMUSG00000020256 1.980183895 242 Tpx2 ENSMUSG00000027469 1.979014627 243 Slc20a1 ENSMUSG00000027397 1.978291357 244 Blvrb ENSMUSG00000040466 1.971647348 245 Hist1h2ab ENSMUSG00000061615 1.970698593 246 Bex1 ENSMUSG00000050071 1.963875025 247 Tnf ENSMUSG00000024401 1.963341889 248 Lrrc10b ENSMUSG00000090291 1.960004863 249 D16Ertd472e ENSMUSG00000022864 1.942668191 250 2900092N22Rik ENSMUSG00000104034 1.935048799 251 Pnpo ENSMUSG00000018659 1.933798517 252 Adam12 ENSMUSG00000054555 1.920686384 253 Btg2 ENSMUSG00000020423 1.919087802 254 Chad ENSMUSG00000039084 1.916603137 255 Idi1 ENSMUSG00000058258 1.911564895 256 M6pr-ps ENSMUSG00000080832 1.907252581 257 Rtn4 ENSMUSG00000020458 1.890110721 258 Stx11 ENSMUSG00000039232 1.877917576 259 Vcp-rs ENSMUSG00000083327 1.866506145 260 2700038G22Rik ENSMUSG00000097180 1.857497369 261 Rnd1 ENSMUSG00000054855 1.856688099 262 Serpinh1 ENSMUSG00000070436 1.856610681 263 Vcp ENSMUSG00000028452 1.854155205 264 Tubb4b-ps2 ENSMUSG00000099997 1.853558273 265 AW011738 ENSMUSG00000078349 1.840325275 266 Pin1 ENSMUSG00000032171 1.829870336 267 Pcdh11x ENSMUSG00000034755 1.829636281 268 Mettl27 ENSMUSG00000040557 1.827642833 269 ENSMUSG00000064168 1.824874552 270 Adamts8 ENSMUSG00000031994 1.822492136 271 Nfkbid ENSMUSG00000036931 1.821751403 272 Nhp2 ENSMUSG00000001056 1.821565655 273 Icam4 ENSMUSG00000001014 1.816106568 274 Ginm1 ENSMUSG00000040006 1.811234451 275 Cd44 ENSMUSG00000005087 1.806952418 276 Tenm4 ENSMUSG00000048078 1.806469533 277 Ccnf ENSMUSG00000072082 1.79495856 278 Gm28187 ENSMUSG00000099375 1.790163645 279 AI506816 ENSMUSG00000105987 1.786008502 280 Tnfaip2 ENSMUSG00000021281 1.780321378 281 Gas2l3 ENSMUSG00000074802 1.776794858 282 Hsf2bp ENSMUSG00000002076 1.776085215 283 Fasn ENSMUSG00000025153 1.772576521 284 Rhoq ENSMUSG00000024143 1.77164729 285 Zfp469 ENSMUSG00000043903 1.764803209 286 Rrp12 ENSMUSG00000035049 1.764797566 287 B3gnt5 ENSMUSG00000022686 1.763194956 288 Sqle ENSMUSG00000022351 1.74614843 289 Gm44193 ENSMUSG00000107559 1.744119957 290 2700078F05Rik ENSMUSG00000103722 1.74092107 291 Atf3 ENSMUSG00000026628 1.736691794 292 Dusp5 ENSMUSG00000034765 1.735880351 293 Armc7 ENSMUSG00000057219 1.7290977 294 Myrfl ENSMUSG00000034057 1.72736617 295 BC022687 ENSMUSG00000037594 1.724962995 296 Uchl1 ENSMUSG00000029223 1.723117731 297 Mybl1 ENSMUSG00000025912 1.712405563 298 Snhg15 ENSMUSG00000085156 1.708595817 299 Trmt61a ENSMUSG00000060950 1.700813943 300 Engase ENSMUSG00000033857 1.700119749 301 Gm14857 ENSMUSG00000081289 1.695715714 302 Slc2a8 ENSMUSG00000026791 1.69467734 303 Hagh ENSMUSG00000024158 1.694606394 304 Txnrd1 ENSMUSG00000020250 1.692519589 305 Cfp ENSMUSG00000001128 1.688643231 306 Vwc2 ENSMUSG00000050830 1.68668911 307 Fam167a ENSMUSG00000035095 1.686618007 308 Itgam ENSMUSG00000030786 1.682160168 309 Ddit3 ENSMUSG00000025408 1.681542641 310 Map3k3 ENSMUSG00000020700 1.675749333 311 Pvt1 ENSMUSG00000097039 1.675264628 312 Bcl3 ENSMUSG00000053175 1.673181926 313 Cenpi ENSMUSG00000031262 1.673171107 314 Slc1a4 ENSMUSG00000020142 1.672319322 315 Loxl4 ENSMUSG00000025185 1.66021152 316 Birc5 ENSMUSG00000017716 1.655877869 317 Emb ENSMUSG00000021728 1.650733426 318 Sbno2 ENSMUSG00000035673 1.650593127 319 Ubald2 ENSMUSG00000050628 1.650501705 320 Chac1 ENSMUSG00000027313 1.646133269 321 Fst ENSMUSG00000021765 1.646130913 322 Klra2 ENSMUSG00000030187 1.645709693 323 Uggt1 ENSMUSG00000037470 1.644961843 324 Mmp3 ENSMUSG00000043613 1.642238674 325 Gm9260 ENSMUSG00000106239 1.638809044 326 Csf2rb ENSMUSG00000071713 1.638798976 327 Arid4a ENSMUSG00000048118 1.637927577 328 Mpv17l2 ENSMUSG00000035559 1.637687304 329 Egr1 ENSMUSG00000038418 1.633002072 330 Pgk1 ENSMUSG00000062070 1.629109112 331 Trp63 ENSMUSG00000022510 1.62107416 332 Tnni2 ENSMUSG00000031097 1.618747065 333 Cyb5r1 ENSMUSG00000026456 1.609318021 334 Slc17a7 ENSMUSG00000070570 1.604700213 335 Gm42725 ENSMUSG00000105601 1.603763447 336 Igf2bp2 ENSMUSG00000033581 1.600812966 337 Thop1 ENSMUSG00000004929 1.600765487 338 Suco ENSMUSG00000040297 1.598969712 339 Sertad3 ENSMUSG00000055200 1.598348345 340 Ect2 ENSMUSG00000027699 1.595965295 341 Cd200r1 ENSMUSG00000022667 1.595525098 342 Cdca2 ENSMUSG00000048922 1.595195402 343 Shroom3 ENSMUSG00000029381 1.581363529 344 Cat ENSMUSG00000027187 1.581206905 345 Isyna1 ENSMUSG00000019139 1.580324046 346 Gclm ENSMUSG00000028124 1.578931649 347 Tuba1c ENSMUSG00000043091 1.578448169 348 Ccr1 ENSMUSG00000025804 1.577197402 349 Ckap2 ENSMUSG00000037725 1.570621326 350 E2f8 ENSMUSG00000046179 1.566293037 351 Top2a ENSMUSG00000020914 1.564537824 352 Gars ENSMUSG00000029777 1.563576397 353 Pgbd5 ENSMUSG00000050751 1.560744026 354 Gm37018 ENSMUSG00000102950 1.559964399 355 Mxd1 ENSMUSG00000001156 1.559822684 356 2310030G06Rik ENSMUSG00000032062 1.558835095 357 Gm12092 ENSMUSG00000084850 1.557193143 358 Os9 ENSMUSG00000040462 1.556819869 359 Calu ENSMUSG00000029767 1.552245573 360 Sptlc2 ENSMUSG00000021036 1.547928702 361 Hmgcs1 ENSMUSG00000093930 1.541408389 362 Plek ENSMUSG00000020120 1.53988097 363 Pemt ENSMUSG00000000301 1.539235376 364 Spdl1 ENSMUSG00000069910 1.535588415 365 Appl1 ENSMUSG00000040760 1.534526106 366 Ankrd1 ENSMUSG00000024803 1.532520407 367 Agtrap ENSMUSG00000029007 1.530067499 368 Odc1 ENSMUSG00000011179 1.529290011 369 Ccl11 ENSMUSG00000020676 1.5290234 370 Gm5526 ENSMUSG00000084817 1.528484975 371 Zfp593 ENSMUSG00000028840 1.525871795 372 Ppib ENSMUSG00000032383 1.525753398 373 Gm37258 ENSMUSG00000102760 1.522556443 374 Neto2 ENSMUSG00000036902 1.516386822 375 Kpnb1 ENSMUSG00000001440 1.516098943 376 Hist1h3g ENSMUSG00000099517 1.515072055 377 Cks2 ENSMUSG00000062248 1.50652198 378 Gm37795 ENSMUSG00000102813 1.506341996 379 Pclaf ENSMUSG00000040204 1.505488381 380 Cdk1 ENSMUSG00000019942 1.502538423 381 B230217O12Rik ENSMUSG00000097785 1.502532816 382 Cep55 ENSMUSG00000024989 1.502132531 383 Gm13481 ENSMUSG00000086353 1.498347419 384 Clec3a ENSMUSG00000008874 1.49783155 385 Itga7 ENSMUSG00000025348 1.49235615 386 Cdc6 ENSMUSG00000017499 1.487626593 387 Pirt ENSMUSG00000048070 1.487265198 388 Vcan ENSMUSG00000021614 1.484980991 389 Flnc ENSMUSG00000068699 1.48355526 390 Angptl6 ENSMUSG00000038742 1.483255396 391 Tbccd1 ENSMUSG00000004462 1.480213903 392 Lilrb4a ENSMUSG00000062593 1.478050587 393 Gm14636 ENSMUSG00000073274 1.477286849 394 Hist2h2ab ENSMUSG00000063689 1.474500867 395 Gm43499 ENSMUSG00000106739 1.473440243 396 Slc9a7 ENSMUSG00000037341 1.47208978 397 Pmm1 ENSMUSG00000022474 1.469739665 398 Lcp1 ENSMUSG00000021998 1.465687722 399 Togaram2 ENSMUSG00000045761 1.462654704 400 Kcnma1 ENSMUSG00000063142 1.453088907 401 Tubb4b ENSMUSG00000036752 1.451557295 402 Gm10698 ENSMUSG00000079884 1.45061928 403 AI839979 ENSMUSG00000107355 1.449119566 404 Ccne1 ENSMUSG00000002068 1.447445984 405 Add3 ENSMUSG00000025026 1.447244999 406 Piwil2 ENSMUSG00000033644 1.44722344 407 Hist1h1a ENSMUSG00000049539 1.446221052 408 Ptpn7 ENSMUSG00000031506 1.445728984 409 Gm42514 ENSMUSG00000105553 1.442490661 410 Ctps ENSMUSG00000028633 1.438371947 411 Coro1a ENSMUSG00000030707 1.437823862 412 Rasef ENSMUSG00000043003 1.437469131 413 Mgl2 ENSMUSG00000040950 1.436187652 414 Mettl1 ENSMUSG00000006732 1.436107039 415 Icam1 ENSMUSG00000037405 1.435857964 416 Tnfaip6 ENSMUSG00000053475 1.435627103 417 Acta2 ENSMUSG00000035783 1.435284206 418 Atf4 ENSMUSG00000042406 1.433688739 419 Copz1 ENSMUSG00000060992 1.430038805 420 Gm5621 ENSMUSG00000057626 1.429304345 421 Cd52 ENSMUSG00000000682 1.428954184 422 1110038B12Rik ENSMUSG00000092203 1.428291662 423 Spryd3 ENSMUSG00000036966 1.427522411 424 Slc1a2 ENSMUSG00000005089 1.426300546 425 Tubb2a ENSMUSG00000058672 1.421754195 426 Pold4 ENSMUSG00000024854 1.420881931 427 Wisp1 ENSMUSG00000005124 1.417477785 428 Dpep2 ENSMUSG00000053687 1.41535261 429 Ms4a6d ENSMUSG00000024679 1.411589263 430 Dtl ENSMUSG00000037474 1.409796483 431 Siah2 ENSMUSG00000036432 1.408822208 432 Stox2 ENSMUSG00000038143 1.407948117 433 Gadd45g ENSMUSG00000021453 1.407408956 434 Gm12989 ENSMUSG00000083678 1.404923716 435 Mcm10 ENSMUSG00000026669 1.403036914 436 Shank1 ENSMUSG00000038738 1.401781001 437 Casq1 ENSMUSG00000007122 1.400434602 438 Ddx39 ENSMUSG00000005481 1.39988641 439 Kif4 ENSMUSG00000034311 1.399067027 440 Ssr3 ENSMUSG00000027828 1.398708309 441 Hist1h3b ENSMUSG00000069267 1.394372841 442 Tfcp2l1 ENSMUSG00000026380 1.393161629 443 Taf13 ENSMUSG00000048100 1.392998942 444 Gm7993 ENSMUSG00000107092 1.388597857 445 Gm45531 ENSMUSG00000110353 1.387891961 446 Gm1966 ENSMUSG00000073902 1.387819539 447 Chek1 ENSMUSG00000032113 1.38723691 448 Sptbn4 ENSMUSG00000011751 1.386241892 449 Rp2 ENSMUSG00000060090 1.385912245 450 Atf5 ENSMUSG00000038539 1.385340179 451 Dcaf11 ENSMUSG00000022214 1.381885962 452 Fam46b ENSMUSG00000046694 1.378167116 453 Ckap4 ENSMUSG00000046841 1.377983134 454 Ccnb2 ENSMUSG00000032218 1.375884366 455 Slc39a14 ENSMUSG00000022094 1.373201831 456 Gcat ENSMUSG00000006378 1.372933003 457 Parvg ENSMUSG00000022439 1.372192156 458 Dlg2 ENSMUSG00000052572 1.371734306 459 Fzd5 ENSMUSG00000045005 1.371696261 460 Fam26e ENSMUSG00000049872 1.367206577 461 Il33 ENSMUSG00000024810 1.363591102 462 Col8a2 ENSMUSG00000056174 1.363224893 463 Knl1 ENSMUSG00000027326 1.362172771 464 Tubb4b-ps1 ENSMUSG00000095159 1.361518755 465 Gmppb ENSMUSG00000070284 1.360384561 466 Edem1 ENSMUSG00000030104 1.359504073 467 Xpo1 ENSMUSG00000020290 1.358919462 468 Mmp9 ENSMUSG00000017737 1.354393221 469 B4galt5 ENSMUSG00000017929 1.346974419 470 Prg4 ENSMUSG00000006014 1.342563561 471 Snhg5 ENSMUSG00000097195 1.338052351 472 Gm12250 ENSMUSG00000082292 1.336648238 473 Nr6a1 ENSMUSG00000063972 1.335957529 474 Brca1 ENSMUSG00000017146 1.335918773 475 Rufy4 ENSMUSG00000061815 1.335781939 476 Wdr46 ENSMUSG00000024312 1.335465454 477 Pask ENSMUSG00000026274 1.335125088 478 Pgk1-rs7 ENSMUSG00000066632 1.333537124 479 Ccl9 ENSMUSG00000019122 1.331399831 480 Gm6158 ENSMUSG00000090381 1.330544091 481 Uhrf1 ENSMUSG00000001228 1.324781216 482 Ush1c ENSMUSG00000030838 1.319572423 483 Aldh1a3 ENSMUSG00000015134 1.318057841 484 Cdca8 ENSMUSG00000028873 1.317159825 485 Ncf4 ENSMUSG00000071715 1.313516064 486 Fbxo36 ENSMUSG00000073633 1.312734301 487 Col12a1 ENSMUSG00000032332 1.311033634 488 Shisa3 ENSMUSG00000050010 1.311018626 489 Tbrg1 ENSMUSG00000011114 1.311000765 490 Ccr5 ENSMUSG00000079227 1.310358961 491 Gm15328 ENSMUSG00000086095 1.308210775 492 Derl2 ENSMUSG00000018442 1.307259566 493 Pde4b ENSMUSG00000028525 1.306643448 494 Nr2c2ap ENSMUSG00000071078 1.304422618 495 Kif9 ENSMUSG00000032489 1.302670479 496 Herpud1 ENSMUSG00000031770 1.302564699 497 Slc41a3 ENSMUSG00000030089 1.30110197 498 Kcnq1ot1 ENSMUSG00000101609 1.300853761 499 Ppa1 ENSMUSG00000020089 1.299245627 500 Pdk3 ENSMUSG00000035232 1.298552717 501 Arid5a ENSMUSG00000037447 1.297558156 502 F730043M19Rik ENSMUSG00000052125 1.29514611 503 Atp8b4 ENSMUSG00000060131 1.294764027 504 Eef1e1 ENSMUSG00000001707 1.293534944 505 Dcbld2 ENSMUSG00000035107 1.290393328 506 Spn ENSMUSG00000051457 1.290033875 507 B4galnt1 ENSMUSG00000006731 1.28891425 508 Msrb1 ENSMUSG00000075705 1.281903924 509 Zfp697 ENSMUSG00000050064 1.279477024 510 Lrrc49 ENSMUSG00000047766 1.276088543 511 Rfx7 ENSMUSG00000037674 1.274375178 512 Rras2 ENSMUSG00000055723 1.273857494 513 B930095G15Rik ENSMUSG00000085133 1.273024667 514 6430548M08Rik ENSMUSG00000031824 1.2728817 515 Hs3st3b1 ENSMUSG00000070407 1.272752395 516 Pak4 ENSMUSG00000030602 1.271858364 517 Rpl3-ps1 ENSMUSG00000084349 1.269581012 518 Dcun1d4 ENSMUSG00000051674 1.269561257 519 Tmem189 ENSMUSG00000090213 1.268538681 520 Hcn1 ENSMUSG00000021730 1.268156092 521 Tmem50b ENSMUSG00000022964 1.267450664 522 Lpin3 ENSMUSG00000027412 1.267349798 523 Wbp1 ENSMUSG00000030035 1.266661045 524 Pim1 ENSMUSG00000024014 1.265560591 525 Ncapg ENSMUSG00000015880 1.2654372 526 Hectd2os ENSMUSG00000087579 1.264197733 527 Nipsnap3b ENSMUSG00000015247 1.263768222 528 G530011O06Rik ENSMUSG00000072844 1.263713637 529 Esd ENSMUSG00000021996 1.261243754 530 Otub2 ENSMUSG00000021203 1.259221277 531 Tctn2 ENSMUSG00000029386 1.258207556 532 Mum1l1 ENSMUSG00000042515 1.257306282 533 Npl ENSMUSG00000042684 1.251704294 534 Slc10a3 ENSMUSG00000032806 1.251594014 535 Nme1 ENSMUSG00000037601 1.248493132 536 Cass4 ENSMUSG00000074570 1.247895241 537 Mfsd12 ENSMUSG00000034854 1.247329755 538 Nppb ENSMUSG00000029019 1.247247828 539 Mesd ENSMUSG00000038503 1.245358334 540 Eif2ak3 ENSMUSG00000031668 1.244652688 541 Gm7367 ENSMUSG00000047370 1.237312066 542 Kcnj5 ENSMUSG00000032034 1.236827526 543 Tfg ENSMUSG00000022757 1.23233869 544 6430710C18Rik ENSMUSG00000085427 1.231385968 545 Phlda3 ENSMUSG00000041801 1.231236934 546 Rgs7bp ENSMUSG00000021719 1.228422741 547 Ostc ENSMUSG00000041084 1.226963586 548 Adat3 ENSMUSG00000035370 1.224450689 549 Mafk ENSMUSG00000018143 1.224360772 550 Ccna2 ENSMUSG00000027715 1.22429789 551 Stat3 ENSMUSG00000004040 1.220096548 552 Fam122b ENSMUSG00000036022 1.214434032 553 Usp18 ENSMUSG00000030107 1.213368784 554 Esyt1 ENSMUSG00000025366 1.210954025 555 Alcam ENSMUSG00000022636 1.210629983 556 Mki67 ENSMUSG00000031004 1.206938756 557 Psma5 ENSMUSG00000068749 1.206060018 558 Cars ENSMUSG00000010755 1.205057184 559 Spag5 ENSMUSG00000002055 1.205018018 560 Ptgs2 ENSMUSG00000032487 1.203540576 561 Akip1 ENSMUSG00000031023 1.202559927 562 Myh7 ENSMUSG00000053093 1.20046659 563 Trim16 ENSMUSG00000047821 1.200163728 564 Hsp90aa1 ENSMUSG00000021270 1.198763826 565 Zbp1 ENSMUSG00000027514 1.198082831 566 Tfrc ENSMUSG00000022797 1.197497585 567 Tmem173 ENSMUSG00000024349 1.196917013 568 Rrp9 ENSMUSG00000041506 1.196173589 569 Ccl8 ENSMUSG00000009185 1.195247161 570 Aspm ENSMUSG00000033952 1.194041169 571 Gm38359 ENSMUSG00000103317 1.193897614 572 Dok2 ENSMUSG00000022102 1.193717167 573 Tyk2 ENSMUSG00000032175 1.190501275 574 Esco2 ENSMUSG00000022034 1.185134026 575 Rpl3 ENSMUSG00000060036 1.183677711 576 Rpl10 ENSMUSG00000008682 1.183173662 577 Cenpn ENSMUSG00000031756 1.182370776 578 Casp4 ENSMUSG00000033538 1.181148662 579 Gm7332 ENSMUSG00000080875 1.175857669 580 Zbtb3 ENSMUSG00000071661 1.175706805 581 D10Wsu102e ENSMUSG00000020255 1.175461387 582 Fam72a ENSMUSG00000055184 1.174842741 583 Gipc1 ENSMUSG00000019433 1.173894119 584 Hspa1l ENSMUSG00000007033 1.172493484 585 Stt3b ENSMUSG00000032437 1.170914991 586 Itgb2 ENSMUSG00000000290 1.169997355 587 Arrdc3 ENSMUSG00000074794 1.169678464 588 Nudcd1 ENSMUSG00000038736 1.168817163 589 Pik3r3 ENSMUSG00000028698 1.167333543 590 Ppan ENSMUSG00000004100 1.166826929 591 Clec11a ENSMUSG00000004473 1.164850642 592 Nr4a2 ENSMUSG00000026826 1.163633754 593 Trmt10a ENSMUSG00000004127 1.162878389 594 Plxnb2 ENSMUSG00000036606 1.161690849 595 Gja5 ENSMUSG00000057123 1.160544506 596 Hist1h2af ENSMUSG00000061991 1.159729615 597 Slc16a6 ENSMUSG00000041920 1.157421983 598 Mdn1 ENSMUSG00000058006 1.157364083 599 Capg ENSMUSG00000056737 1.156060338 600 Anln ENSMUSG00000036777 1.156054529 601 Sash3 ENSMUSG00000031101 1.153727702 602 Dbf4 ENSMUSG00000002297 1.15302495 603 Ttf2 ENSMUSG00000033222 1.152826279 604 Gm8394 ENSMUSG00000050490 1.152190004 605 Hck ENSMUSG00000003283 1.149489868 606 Cage1 ENSMUSG00000044566 1.146471431 607 Knstrn ENSMUSG00000027331 1.146277923 608 Fzd2 ENSMUSG00000050288 1.145634205 609 Mx1 ENSMUSG00000000386 1.14494589 610 Dstn ENSMUSG00000015932 1.142341577 611 Tlr2 ENSMUSG00000027995 1.141801924 612 Usp1 ENSMUSG00000028560 1.140379401 613 Prkcsh ENSMUSG00000003402 1.140233021 614 Ptpre ENSMUSG00000041836 1.138809485 615 Dph5 ENSMUSG00000033554 1.13657609 616 Srpx ENSMUSG00000090084 1.134293016 617 Olfm1 ENSMUSG00000026833 1.133848828 618 Heatr1 ENSMUSG00000050244 1.133491875 619 Azin1 ENSMUSG00000037458 1.132883442 620 Rpsa-ps9 ENSMUSG00000082895 1.132775108 621 Ppp1r15a ENSMUSG00000040435 1.131558837 622 Snhg1 ENSMUSG00000108414 1.130862556 623 Grk3 ENSMUSG00000042249 1.130640537 624 Aurka ENSMUSG00000027496 1.129311021 625 Ift43 ENSMUSG00000007867 1.127582151 626 Ing1 ENSMUSG00000045969 1.125978778 627 Zfp566 ENSMUSG00000078768 1.125891655 628 Fgl2 ENSMUSG00000039899 1.123987257 629 Pdpn ENSMUSG00000028583 1.122759466 630 Asb16 ENSMUSG00000034768 1.122276057 631 Aqp4 ENSMUSG00000024411 1.122151756 632 Aars ENSMUSG00000031960 1.120957875 633 Dusp23 ENSMUSG00000026544 1.11810292 634 Paip2b ENSMUSG00000045896 1.115897527 635 Gstcd ENSMUSG00000028018 1.115730709 636 Coq8b ENSMUSG00000003762 1.115288686 637 Rap2b ENSMUSG00000036894 1.114326427 638 Cntn2 ENSMUSG00000053024 1.112534684 639 Zmynd19 ENSMUSG00000026974 1.111641171 640 Tmbim1 ENSMUSG00000006301 1.111517063 641 Grk5 ENSMUSG00000003228 1.110747505 642 Tmed2 ENSMUSG00000029390 1.109476899 643 Smyd5 ENSMUSG00000033706 1.102683445 644 Ibtk ENSMUSG00000035941 1.101475027 645 C330027C09Rik ENSMUSG00000033031 1.099547502 646 Abca12 ENSMUSG00000050296 1.095786221 647 Vars ENSMUSG00000007029 1.093832221 648 Sars ENSMUSG00000068739 1.093735011 649 Map2k3os ENSMUSG00000042549 1.091347636 650 Gm6210 ENSMUSG00000107951 1.089886298 651 Lmbrd2 ENSMUSG00000039704 1.087412152 652 Stip1 ENSMUSG00000024966 1.086537039 653 Ubfd1 ENSMUSG00000030870 1.085322293 654 Tubb6 ENSMUSG00000001473 1.085001017 655 Ung ENSMUSG00000029591 1.08455813 656 Socs1 ENSMUSG00000038037 1.083140057 657 Shq1 ENSMUSG00000035378 1.082574401 658 Tiam2 ENSMUSG00000023800 1.082496268 659 Hist1h2ac ENSMUSG00000069270 1.082203199 660 Nol12 ENSMUSG00000033099 1.082003866 661 Dpy19l1 ENSMUSG00000043067 1.079606873 662 Arrdc4 ENSMUSG00000042659 1.079340688 663 Plk4 ENSMUSG00000025758 1.078923652 664 Avpi1 ENSMUSG00000018821 1.078296992 665 Wdr44 ENSMUSG00000036769 1.077086586 666 Runx1 ENSMUSG00000022952 1.076810666 667 Tmem45a ENSMUSG00000022754 1.076558315 668 Opn3 ENSMUSG00000026525 1.073604491 669 Ppox ENSMUSG00000062729 1.073267217 670 Bbc3 ENSMUSG00000002083 1.072287344 671 Iars ENSMUSG00000037851 1.071964574 672 Gsk3b ENSMUSG00000022812 1.070813224 673 Clcf1 ENSMUSG00000040663 1.064614037 674 Tesk2 ENSMUSG00000033985 1.063742128 675 Cenpt ENSMUSG00000036672 1.06146737 676 Ttc41 ENSMUSG00000044937 1.061089629 677 Cdc7 ENSMUSG00000029283 1.059243045 678 Gpatch4 ENSMUSG00000028069 1.05907009 679 Gm12346 ENSMUSG00000083899 1.058665929 680 Has2 ENSMUSG00000022367 1.057616501 681 Pold2 ENSMUSG00000020471 1.056373421 682 Pim2 ENSMUSG00000031155 1.054490917 683 Slc26a2 ENSMUSG00000034320 1.05224895 684 Phkg2 ENSMUSG00000030815 1.052031009 685 Vbp1 ENSMUSG00000031197 1.051255794 686 Bcat1 ENSMUSG00000030268 1.050279226 687 Tmem184c ENSMUSG00000031617 1.049938119 688 Gm5812 ENSMUSG00000051639 1.048363636 689 Cers6 ENSMUSG00000027035 1.047851043 690 Il17ra ENSMUSG00000002897 1.047462251 691 Derl1 ENSMUSG00000022365 1.047444175 692 Wif1 ENSMUSG00000020218 1.047119083 693 Cks1b ENSMUSG00000028044 1.046554899 694 Ccdc134 ENSMUSG00000068114 1.045129946 695 Farp1 ENSMUSG00000025555 1.04389361 696 Tars ENSMUSG00000022241 1.043266521 697 Rpn2 ENSMUSG00000027642 1.039931574 698 Nop16 ENSMUSG00000025869 1.03963659 699 Msmo1 ENSMUSG00000031604 1.038855593 700 Cdv3-ps ENSMUSG00000090389 1.037316451 701 Yif1a ENSMUSG00000024875 1.037258808 702 Zfp568 ENSMUSG00000074221 1.036068891 703 Col7a1 ENSMUSG00000025650 1.034000942 704 Oasl1 ENSMUSG00000041827 1.033131634 705 Mcfd2 ENSMUSG00000024150 1.025906718 706 Slc7a7 ENSMUSG00000000958 1.025602479 707 Rab6a ENSMUSG00000030704 1.024779016 708 Erp29 ENSMUSG00000029616 1.02083526 709 1810055G02Rik ENSMUSG00000035372 1.01858213 710 Lrrc59 ENSMUSG00000020869 1.018185595 711 Heatr5a ENSMUSG00000035181 1.018091303 712 Marcksl1 ENSMUSG00000047945 1.017402547 713 Mvp ENSMUSG00000030681 1.017384365 714 Per1 ENSMUSG00000020893 1.017223008 715 Aif1 ENSMUSG00000024397 1.016551272 716 Gnl3 ENSMUSG00000042354 1.01648494 717 Hells ENSMUSG00000025001 1.016223913 718 Mcm5 ENSMUSG00000005410 1.0143332 719 N4bp2os ENSMUSG00000106978 1.013382364 720 Krt80 ENSMUSG00000037185 1.012635222 721 Hist1h2bb ENSMUSG00000075031 1.01137536 722 Psmd11 ENSMUSG00000017428 1.011018617 723 Nsdhl ENSMUSG00000031349 1.010787814 724 Fam174b ENSMUSG00000078670 1.010025926 725 Gm7895 ENSMUSG00000100347 1.009476227 726 Gm25360 ENSMUSG00000094655 1.009366206 727 St6galnac4 ENSMUSG00000079442 1.009190701 728 Steap2 ENSMUSG00000015653 1.008242338 729 M6pr ENSMUSG00000007458 1.007816687 730 Spi1 ENSMUSG00000002111 1.005558321 731 Srm ENSMUSG00000006442 1.005149292 732 Gm6563 ENSMUSG00000051255 1.004539333 733 Cmtr2 ENSMUSG00000046441 1.004455668 734 Isoc2a ENSMUSG00000086784 1.002035749 735 Mob3c ENSMUSG00000028709 1.001988325 736 Atad5 ENSMUSG00000017550 1.000331972 737 Kcnn3 ENSMUSG00000000794 0.99982441 738 Dnajb9 ENSMUSG00000014905 0.999482146 739 B230216N24Rik ENSMUSG00000089706 0.999150399 740 Olfml2b ENSMUSG00000038463 0.998856338 741 Col11a2 ENSMUSG00000024330 0.99846639 742 Bambi ENSMUSG00000024232 0.998400037 743 Cotl1 ENSMUSG00000031827 0.997762408 744 Snap23 ENSMUSG00000027287 0.99717774 745 Mak16 ENSMUSG00000031578 0.996282623 746 Rnf5 ENSMUSG00000015478 0.995026243 747 Snhg4 ENSMUSG00000097769 0.994877612 748 Dusp8 ENSMUSG00000037887 0.992982688 749 Shisa4 ENSMUSG00000041889 0.991855458 750 Gsg1l ENSMUSG00000046182 0.991643791 751 Canx ENSMUSG00000020368 0.99103089 752 Gm8203 ENSMUSG00000101878 0.989511615 753 Armc6 ENSMUSG00000002343 0.989498202 754 Slx4ip ENSMUSG00000027281 0.98930013 755 Gm13456 ENSMUSG00000082536 0.988812863 756 Ints2 ENSMUSG00000018068 0.987187817 757 Golt1b ENSMUSG00000030245 0.985137192 758 Hspb1 ENSMUSG00000004951 0.984501964 759 Rpf2 ENSMUSG00000038510 0.984054313 760 Scml4 ENSMUSG00000044770 0.983279986 761 Ppp1r14b ENSMUSG00000056612 0.982912048 762 Nme6 ENSMUSG00000032478 0.982882597 763 Ccl6 ENSMUSG00000018927 0.982589258 764 Lhfpl2 ENSMUSG00000045312 0.980846806 765 Rnf181 ENSMUSG00000055850 0.980432741 766 Mb21d1 ENSMUSG00000032344 0.980115292 767 Cad ENSMUSG00000013629 0.979420976 768 Got1 ENSMUSG00000025190 0.979355287 769 Lmcd1 ENSMUSG00000057604 0.978649847 770 Lamc2 ENSMUSG00000026479 0.97554956 771 Cyld ENSMUSG00000036712 0.974943338 772 Nktr ENSMUSG00000032525 0.971355026 773 Gm4540 ENSMUSG00000092072 0.971285941 774 Cnpy3 ENSMUSG00000023973 0.971164845 775 Glipr2 ENSMUSG00000028480 0.970473478 776 Fam98c ENSMUSG00000030590 0.97018368 777 Bcl6 ENSMUSG00000022508 0.969489625 778 Stat2 ENSMUSG00000040033 0.96069757 779 Gm14048 ENSMUSG00000080989 0.959293156 780 Zdhhc24 ENSMUSG00000006463 0.958629392 781 Ifi211 ENSMUSG00000026536 0.957641599 782 Gm12655 ENSMUSG00000087128 0.95733895 783 Map1b ENSMUSG00000052727 0.95634716 784 Il6st ENSMUSG00000021756 0.95314068 785 Pck2 ENSMUSG00000040618 0.953104793 786 Ubtd1 ENSMUSG00000025171 0.952484985 787 Gm13127 ENSMUSG00000070610 0.952072131 788 Il4ra ENSMUSG00000030748 0.950384327 789 Suv39h2 ENSMUSG00000026646 0.950314164 790 Hgf ENSMUSG00000028864 0.949086932 791 Hmgcr ENSMUSG00000021670 0.948321994 792 Stk19 ENSMUSG00000061207 0.94671894 793 Enah ENSMUSG00000022995 0.945605411 794 Cenpl ENSMUSG00000026708 0.945413278 795 Mllt3 ENSMUSG00000028496 0.944147681 796 Gm38253 ENSMUSG00000102780 0.943228673 797 Dram1 ENSMUSG00000020057 0.942235891 798 Fkbp2 ENSMUSG00000056629 0.939827021 799 Gm28229 ENSMUSG00000101335 0.939355326 800 Lair1 ENSMUSG00000055541 0.938493164 801 Mapkapk2 ENSMUSG00000016528 0.936458386 802 Pcgf6 ENSMUSG00000025050 0.935665477 803 Zfp367 ENSMUSG00000044934 0.934484588 804 Tm2d2 ENSMUSG00000031556 0.933364167 805 Sec11a ENSMUSG00000025724 0.930747552 806 Kif5b ENSMUSG00000006740 0.930384309 807 Clvs1 ENSMUSG00000041216 0.929682573 808 5430416N02Rik ENSMUSG00000097772 0.927749382 809 Gpx4 ENSMUSG00000075706 0.926359853 810 Mroh1 ENSMUSG00000022558 0.926118233 811 Klf6 ENSMUSG00000000078 0.92183922 812 Cenpc1 ENSMUSG00000029253 0.921501563 813 Nfkb2 ENSMUSG00000025225 0.920852777 814 Rnf19b ENSMUSG00000028793 0.920537936 815 Osmr ENSMUSG00000022146 0.918933908 816 Pus7 ENSMUSG00000057541 0.917310055 817 Sarnp ENSMUSG00000078427 0.916958299 818 Mt1 ENSMUSG00000031765 0.916867703 819 Enho ENSMUSG00000028445 0.91608576 820 Grn ENSMUSG00000034708 0.915517395 821 Rasl11b ENSMUSG00000049907 0.913181622 822 Fkbp11 ENSMUSG00000003355 0.913036698 823 Plau ENSMUSG00000021822 0.912940093 824 Lipa ENSMUSG00000024781 0.910771572 825 Gm5560 ENSMUSG00000067161 0.91077063 826 Zfp948 ENSMUSG00000067931 0.909510608 827 Sac3d1 ENSMUSG00000024790 0.909267499 828 Jpt1 ENSMUSG00000020737 0.909190468 829 Apex1 ENSMUSG00000035960 0.908491689 830 Trmt6 ENSMUSG00000037376 0.907990576 831 Rheb ENSMUSG00000028945 0.907606311 832 Fam198b ENSMUSG00000027955 0.907554858 833 Bax ENSMUSG00000003873 0.907449126 834 Rpn1 ENSMUSG00000030062 0.906935746 835 Gm11478 ENSMUSG00000083992 0.905994986 836 Zdhhc9 ENSMUSG00000036985 0.905808959 837 Slc38a4 ENSMUSG00000022464 0.904812847 838 Gm26672 ENSMUSG00000097330 0.902397251 839 Rcl1 ENSMUSG00000024785 0.901908816 840 Tpp2 ENSMUSG00000041763 0.901477192 841 Snhg6 ENSMUSG00000098234 0.899789841 842 Lgi2 ENSMUSG00000039252 0.897646502 843 Zfp462 ENSMUSG00000060206 0.896480563 844 Lrif1 ENSMUSG00000056260 0.895298737 845 Kif11 ENSMUSG00000012443 0.892626767 846 Thsd4 ENSMUSG00000032289 0.892486283 847 Rragd ENSMUSG00000028278 0.889950586 848 Ccdc86 ENSMUSG00000024732 0.889519185 849 Usp53 ENSMUSG00000039701 0.889057897 850 Mob3a ENSMUSG00000003348 0.888369885 851 Zfas1 ENSMUSG00000074578 0.887650048 852 Nop58 ENSMUSG00000026020 0.887388208 853 Gm6223 ENSMUSG00000096647 0.887365225 854 Gfod1 ENSMUSG00000051335 0.887152785 855 Tmem97 ENSMUSG00000037278 0.886737284 856 Jun ENSMUSG00000052684 0.886098371 857 Ncs1 ENSMUSG00000062661 0.885836675 858 Csf2ra ENSMUSG00000059326 0.884172744 859 Ltv1 ENSMUSG00000019814 0.884018053 860 Sh3pxd2b ENSMUSG00000040711 0.880479476 861 Tob1 ENSMUSG00000037573 0.880452628 862 Man1a ENSMUSG00000003746 0.880287851 863 Dusp10 ENSMUSG00000039384 0.879694355 864 Gm45457 ENSMUSG00000110411 0.878622714 865 Tprn ENSMUSG00000048707 0.876324704 866 March3 ENSMUSG00000032656 0.876120534 867 Hist1h1c ENSMUSG00000036181 0.872327463 868 Rpl36a-ps3 ENSMUSG00000071141 0.871135433 869 Trabd ENSMUSG00000015363 0.870610656 870 Gm12295 ENSMUSG00000085162 0.870583756 871 Cstf3 ENSMUSG00000027176 0.870545915 872 Prkaca ENSMUSG00000005469 0.870147833 873 BC031181 ENSMUSG00000036299 0.870006603 874 Yrdc ENSMUSG00000028889 0.869735199 875 Mtmr4 ENSMUSG00000018401 0.866029558 876 Hsd17b12 ENSMUSG00000027195 0.86408055 877 Snrnp25 ENSMUSG00000040767 0.86236488 878 Slc35b1 ENSMUSG00000020873 0.862043131 879 Uxs1 ENSMUSG00000057363 0.861861965 880 Rhoc ENSMUSG00000002233 0.861369588 881 Atp8b2 ENSMUSG00000060671 0.859678124 882 Relb ENSMUSG00000002983 0.859378177 883 Arhgap19 ENSMUSG00000025154 0.859244571 884 Klhl21 ENSMUSG00000073700 0.858928128 885 Ier5 ENSMUSG00000056708 0.858885901 886 Slc35e4 ENSMUSG00000048807 0.858665598 887 Ifi205 ENSMUSG00000054203 0.856980021 888 Igtp ENSMUSG00000078853 0.855072616 889 Fam96b ENSMUSG00000031879 0.854406453 890 Arpc3 ENSMUSG00000029465 0.854351924 891 Clock ENSMUSG00000029238 0.853340465 892 Grwd1 ENSMUSG00000053801 0.852420254 893 Tuba1a ENSMUSG00000072235 0.851395906 894 Mtbp ENSMUSG00000022369 0.847799005 895 Baz1a ENSMUSG00000035021 0.847175088 896 Tlr4 ENSMUSG00000039005 0.846219844 897 Hsp25-ps1 ENSMUSG00000078915 0.845951106 898 Gm45220 ENSMUSG00000109279 0.844793295 899 Abca4 ENSMUSG00000028125 0.84421429 900 Lrrc3b ENSMUSG00000045201 0.844018318 901 Hnrnpa3 ENSMUSG00000059005 0.842870906 902 Tsr1 ENSMUSG00000038335 0.842141274 903 Rhod ENSMUSG00000041845 0.840435869 904 Creld1 ENSMUSG00000030284 0.840289076 905 Dda1 ENSMUSG00000074247 0.839225255 906 Vwa5a ENSMUSG00000023186 0.838955985 907 Abi3bp ENSMUSG00000035258 0.838946299 908 Prmt3 ENSMUSG00000030505 0.838927104 909 Zfp322a ENSMUSG00000046351 0.836133767 910 Fam46a ENSMUSG00000032265 0.836070746 911 Stmn1 ENSMUSG00000028832 0.835738151 912 Mis12 ENSMUSG00000040599 0.835615698 913 Oat ENSMUSG00000030934 0.834136647 914 Med19 ENSMUSG00000027080 0.833175877 915 Pla2g4a ENSMUSG00000056220 0.83298215 916 Dzip3 ENSMUSG00000064061 0.83208629 917 Gda ENSMUSG00000058624 0.831307598 918 Tcea1-ps1 ENSMUSG00000067869 0.830474395 919 Rbmx2 ENSMUSG00000031107 0.830185857 920 Gas5 ENSMUSG00000053332 0.830002317 921 Tlnrd1 ENSMUSG00000070462 0.829861228 922 Ipo5 ENSMUSG00000030662 0.8274388 923 Golim4 ENSMUSG00000034109 0.826919132 924 Zbtb40 ENSMUSG00000060862 0.825764322 925 Gcsh ENSMUSG00000034424 0.825080405 926 Nubp1 ENSMUSG00000022503 0.823716909 927 Adgrd1 ENSMUSG00000044017 0.823705721 928 Eif4a-ps4 ENSMUSG00000101188 0.822285582 929 Tgfbr1 ENSMUSG00000007613 0.819006418 930 Sec23a ENSMUSG00000020986 0.818675812 931 Katnb1 ENSMUSG00000031787 0.815531235 932 Ascc3 ENSMUSG00000038774 0.815042677 933 Creb3l2 ENSMUSG00000038648 0.81439726 934 Amer1 ENSMUSG00000050332 0.812900011 935 Gtf2f2 ENSMUSG00000067995 0.812866099 936 Psmd14 ENSMUSG00000026914 0.811361474 937 Tcea1 ENSMUSG00000033813 0.810968429 938 Fads3 ENSMUSG00000024664 0.809540069 939 Spata13 ENSMUSG00000021990 0.808825986 940 Fcgr2b ENSMUSG00000026656 0.808137326 941 Gm12258 ENSMUSG00000072915 0.80795738 942 Fxyd5 ENSMUSG00000009687 0.807277415 943 Tyrobp ENSMUSG00000030579 0.807110129 944 Selenoi ENSMUSG00000075703 0.805764874 945 Tnfrsf11a ENSMUSG00000026321 0.805378296 946 Surf4 ENSMUSG00000014867 0.805330078 947 Ahnak2 ENSMUSG00000072812 0.80520946 948 Xpot ENSMUSG00000034667 0.805192336 949 Rpl13a ENSMUSG00000074129 0.804787789 950 Ankrd49 ENSMUSG00000031931 0.804318284 951 Lmnb2 ENSMUSG00000062075 0.804229027 952 Tmem183a ENSMUSG00000042305 0.80371481 953 Ifi204 ENSMUSG00000073489 0.803687915 954 Mydgf ENSMUSG00000019579 0.803441204 955 Pja2 ENSMUSG00000024083 0.802786062 956 Erbb2 ENSMUSG00000062312 0.802684133 957 Nckap1l ENSMUSG00000022488 0.801160539 958 Eef1a1 ENSMUSG00000037742 0.79904953 959 Popdc3 ENSMUSG00000019848 0.797193966 960 Rps19bp1 ENSMUSG00000051518 0.796956637 961 Galns ENSMUSG00000015027 0.79645697 962 Actr3 ENSMUSG00000026341 0.795827554 963 Gpx3 ENSMUSG00000018339 0.795421727 964 Pinx1 ENSMUSG00000021958 0.794583212 965 Emd ENSMUSG00000001964 0.794213198 966 Dap ENSMUSG00000039168 0.793663404 967 Fryl ENSMUSG00000070733 0.793585949 968 Gm12844 ENSMUSG00000084260 0.792949051 969 Cenpx ENSMUSG00000025144 0.792844995 970 Alg8 ENSMUSG00000035704 0.792373737 971 Nars ENSMUSG00000024587 0.79112078 972 Klf7 ENSMUSG00000025959 0.790947492 973 Ddx31 ENSMUSG00000026806 0.790395442 974 Mogs ENSMUSG00000030036 0.788864385 975 Med10 ENSMUSG00000021598 0.788246323 976 Ifrd1 ENSMUSG00000001627 0.7880196 977 Rrp15 ENSMUSG00000001305 0.786998678 978 Extl1 ENSMUSG00000028838 0.786757054 979 Prr13 ENSMUSG00000023048 0.786660343 980 Gpn2 ENSMUSG00000028848 0.786223513 981 Mvk ENSMUSG00000041939 0.785041015 982 Casp3 ENSMUSG00000031628 0.783183801 983 Ddx50 ENSMUSG00000020076 0.783123916 984 Usp39 ENSMUSG00000056305 0.782950199 985 Wdr4 ENSMUSG00000024037 0.782833194 986 Gpn1 ENSMUSG00000064037 0.782525316 987 Ppm1b ENSMUSG00000061130 0.781952441 988 Snd1 ENSMUSG00000001424 0.781466948 989 Ikbkg ENSMUSG00000004221 0.781330934 990 Dynll1 ENSMUSG00000009013 0.780116711 991 Arpc4 ENSMUSG00000079426 0.779585176 992 Ccdc115 ENSMUSG00000042111 0.779252872 993 Eif4a1 ENSMUSG00000059796 0.778100092 994 Ftsj3 ENSMUSG00000020706 0.777306748 995 Fbxw9 ENSMUSG00000008167 0.777211512 996 Leo1 ENSMUSG00000042487 0.776732527 997 Rhoa ENSMUSG00000007815 0.776493294 998 Gm12112 ENSMUSG00000081254 0.77566347 999 Bahcc1 ENSMUSG00000039741 0.775052378 1000 Pum3 ENSMUSG00000041360 0.774948414 1001 Gm45221 ENSMUSG00000109005 0.774602671 1002 Lyz2 ENSMUSG00000069516 0.774524955 1003 1600002K03Rik ENSMUSG00000035595 0.774418722 1004 Fkbp7 ENSMUSG00000002732 0.773717985 1005 Fn1 ENSMUSG00000026193 0.773362062 1006 Sap30l ENSMUSG00000020519 0.773262893 1007 Tes ENSMUSG00000029552 0.772626119 1008 Slc39a6 ENSMUSG00000024270 0.771398846 1009 Zc2hc1a ENSMUSG00000043542 0.771017675 1010 Thyn1 ENSMUSG00000035443 0.770797183 1011 Ddah1 ENSMUSG00000028194 0.769961103 1012 Ccng1 ENSMUSG00000020326 0.769197013 1013 Sgms2 ENSMUSG00000050931 0.768717188 1014 Taf7 ENSMUSG00000051316 0.768132124 1015 Adprhl1 ENSMUSG00000031448 0.767639577 1016 Wdpcp ENSMUSG00000020319 0.766627398 1017 Utp18 ENSMUSG00000054079 0.765916084 1018 Aen ENSMUSG00000030609 0.765640168 1019 Fosl2 ENSMUSG00000029135 0.76503642 1020 Eprs ENSMUSG00000026615 0.76403217 1021 Spcs3 ENSMUSG00000054408 0.763733035 1022 Zfp202 ENSMUSG00000025602 0.763239857 1023 Ddx21 ENSMUSG00000020075 0.761090656 1024 Ifit3b ENSMUSG00000062488 0.760911452 1025 Itga3 ENSMUSG00000001507 0.760586711 1026 Sec61b ENSMUSG00000053317 0.760554414 1027 Acot9 ENSMUSG00000025287 0.760485931 1028 Rap2a ENSMUSG00000051615 0.760193646 1029 Plxna1 ENSMUSG00000030084 0.760040367 1030 Col3a1 ENSMUSG00000026043 0.759873146 1031 Litaf ENSMUSG00000022500 0.757875884 1032 Ugdh ENSMUSG00000029201 0.75650923 1033 Slc25a5 ENSMUSG00000016319 0.755661677 1034 Taf4b ENSMUSG00000054321 0.755349399 1035 Atp6v1h ENSMUSG00000033793 0.755164921 1036 Pprc1 ENSMUSG00000055491 0.754992697 1037 Ero1lb ENSMUSG00000057069 0.754878836 1038 Atp13a3 ENSMUSG00000022533 0.754297559 1039 Scara3 ENSMUSG00000034463 0.753649119 1040 Rab20 ENSMUSG00000031504 0.753365513 1041 Pfkp ENSMUSG00000021196 0.750610364 1042 Fam185a ENSMUSG00000047221 0.750106396 1043 Snhg12 ENSMUSG00000086290 0.749717222 1044 Cib1 ENSMUSG00000030538 0.74771931 1045 Bola2 ENSMUSG00000047721 0.746320287 1046 Selenos ENSMUSG00000075701 0.745582972 1047 Cbx6 ENSMUSG00000089715 0.745101247 1048 Wars ENSMUSG00000021266 0.743841568 1049 Cacna1h ENSMUSG00000024112 0.742510804 1050 Arhgef10l ENSMUSG00000040964 0.741971201 1051 Zwint ENSMUSG00000019923 0.740927247 1052 Ywhaz ENSMUSG00000022285 0.739821073 1053 Hsph1 ENSMUSG00000029657 0.739234336 1054 Lars ENSMUSG00000024493 0.738810973 1055 Amn1 ENSMUSG00000068250 0.73819553 1056 Dapk3 ENSMUSG00000034974 0.735756947 1057 Rars ENSMUSG00000018848 0.735425061 1058 Sap130 ENSMUSG00000024260 0.735274982 1059 Clptm1l ENSMUSG00000021610 0.735101427 1060 Fbl ENSMUSG00000046865 0.732474301 1061 Itpk1 ENSMUSG00000057963 0.732267051 1062 Sema3a ENSMUSG00000028883 0.732207001 1063 Mon1b ENSMUSG00000078908 0.732016876 1064 Shoc2 ENSMUSG00000024976 0.731088633 1065 Hist1h3e ENSMUSG00000069273 0.731064742 1066 Fem1b ENSMUSG00000032244 0.731036087 1067 Urb2 ENSMUSG00000031976 0.730985248 1068 Actn1 ENSMUSG00000015143 0.729523694 1069 Tmem167 ENSMUSG00000012422 0.728202541 1070 Utp20 ENSMUSG00000004356 0.727887583 1071 Acsl3 ENSMUSG00000032883 0.726157803 1072 Hipk2 ENSMUSG00000061436 0.726075305 1073 Hfe ENSMUSG00000006611 0.725174423 1074 Wdr75 ENSMUSG00000025995 0.725124244 1075 2310022B05Rik ENSMUSG00000031983 0.724824673 1076 Smg1 ENSMUSG00000030655 0.724789024 1077 Rps26 ENSMUSG00000025362 0.723623341 1078 Pfn1 ENSMUSG00000018293 0.723399628 1079 Nup88 ENSMUSG00000040667 0.721541853 1080 Spata24 ENSMUSG00000024352 0.72114141 1081 P2ry2 ENSMUSG00000032860 0.720427675 1082 Cav3 ENSMUSG00000062694 0.719875911 1083 Cfl1 ENSMUSG00000056201 0.719785535 1084 Herc4 ENSMUSG00000020064 0.719381863 1085 Selenof ENSMUSG00000037072 0.719245944 1086 Cxcl16 ENSMUSG00000018920 0.717932582 1087 Gm10110 ENSMUSG00000062093 0.716952245 1088 Cyb5r3 ENSMUSG00000018042 0.716716913 1089 Slc3a2 ENSMUSG00000010095 0.716602287 1090 Noc3l ENSMUSG00000024999 0.716426765 1091 Ddx54 ENSMUSG00000029599 0.715670612 1092 Mcrs1 ENSMUSG00000037570 0.714953137 1093 Igf1r ENSMUSG00000005533 0.714498197 1094 Prkcd ENSMUSG00000021948 0.7128372 1095 Fam49b ENSMUSG00000022378 0.712197402 1096 Nop2 ENSMUSG00000038279 0.710666914 1097 Ttc9c ENSMUSG00000071660 0.707842691 1098 Zfp954 ENSMUSG00000062116 0.707420379 1099 Zfpm1 ENSMUSG00000049577 0.706576066 1100 Pgs1 ENSMUSG00000017715 0.706202908 1101 Tspyl5 ENSMUSG00000038984 0.705293119 1102 Mpp7 ENSMUSG00000057440 0.704277435 1103 Tnfrsf1a ENSMUSG00000030341 0.704189614 1104 Otulin ENSMUSG00000046034 0.704115093 1105 Kank1 ENSMUSG00000032702 0.702975445 1106 Rpsa ENSMUSG00000032518 0.702748438 1107 Rcc2 ENSMUSG00000040945 0.702261881 1108 Srxn1 ENSMUSG00000032802 0.701460756 1109 Slc2a1 ENSMUSG00000028645 0.700955335 1110 Cct3 ENSMUSG00000001416 0.69967866 1111 Mad2l1 ENSMUSG00000029910 0.69840823 1112 Asna1 ENSMUSG00000052456 0.698282921 1113 Ckb ENSMUSG00000001270 0.698075616 1114 Nifk ENSMUSG00000026377 0.697968583 1115 Lmo4 ENSMUSG00000028266 0.697798413 1116 Rrp7a ENSMUSG00000018040 0.69721061 1117 Rps15a ENSMUSG00000008683 0.695995515 1118 Nsd2 ENSMUSG00000057406 0.695643756 1119 Nup43 ENSMUSG00000040034 0.695320906 1120 G2e3 ENSMUSG00000035293 0.694936906 1121 Ifi27 ENSMUSG00000064215 0.694884649 1122 Gas7 ENSMUSG00000033066 0.694061823 1123 Sertad1 ENSMUSG00000008384 0.692249697 1124 Vcam1 ENSMUSG00000027962 0.691728936 1125 Ralb ENSMUSG00000004451 0.69153584 1126 Igsf10 ENSMUSG00000036334 0.691271506 1127 Gm10073 ENSMUSG00000060019 0.68938212 1128 Stam ENSMUSG00000026718 0.689018094 1129 Maged1 ENSMUSG00000025151 0.68891575 1130 Plpp1 ENSMUSG00000021759 0.688901161 1131 Gan ENSMUSG00000052557 0.686545609 1132 Synpo2l ENSMUSG00000039376 0.686398231 1133 Htt ENSMUSG00000029104 0.686383182 1134 Gem ENSMUSG00000028214 0.686188335 1135 Pvr ENSMUSG00000040511 0.685411045 1136 Lins1 ENSMUSG00000053091 0.683541269 1137 Cyb561 ENSMUSG00000019590 0.683530223 1138 Heatr5b ENSMUSG00000039414 0.683422176 1139 Pabpc4 ENSMUSG00000011257 0.682692924 1140 Fam111a ENSMUSG00000024691 0.682321473 1141 Nudt4 ENSMUSG00000020029 0.681346251 1142 Ercc8 ENSMUSG00000021694 0.681173255 1143 Tspan31 ENSMUSG00000006736 0.680937093 1144 Sema3c ENSMUSG00000028780 0.680773986 1145 Slc25a28 ENSMUSG00000040414 0.680093591 1146 Zbtb7b ENSMUSG00000028042 0.679923023 1147 9130011E15Rik ENSMUSG00000039901 0.678730954 1148 Anxa6 ENSMUSG00000018340 0.677924858 1149 Csnk1g1 ENSMUSG00000032384 0.67790772 1150 Aste1 ENSMUSG00000032567 0.677790507 1151 Mx2 ENSMUSG00000023341 0.677562512 1152 Ago2 ENSMUSG00000036698 0.677518908 1153 Gm8355 ENSMUSG00000093798 0.676679781 1154 Polr2h ENSMUSG00000021018 0.67613414 1155 B4galt1 ENSMUSG00000028413 0.676056464 1156 Col27a1 ENSMUSG00000045672 0.67596004 1157 Dysf ENSMUSG00000033788 0.675477748 1158 Ebna1bp2 ENSMUSG00000028729 0.675301472 1159 Snrpa ENSMUSG00000061479 0.675264485 1160 Sacm1l ENSMUSG00000025240 0.674974673 1161 Sept11 ENSMUSG00000058013 0.674586578 1162 Nip7 ENSMUSG00000031917 0.67427054 1163 Zfp35 ENSMUSG00000063281 0.673101415 1164 Rpsa-ps10 ENSMUSG00000047676 0.67298466 1165 Rbm19 ENSMUSG00000029594 0.671834375 1166 Papss1 ENSMUSG00000028032 0.670756067 1167 Gm15710 ENSMUSG00000084111 0.669958309 1168 Atp10a ENSMUSG00000025324 0.66964081 1169 Eif2s2 ENSMUSG00000074656 0.669289656 1170 Rhobtb3 ENSMUSG00000021589 0.669280554 1171 Ifit1 ENSMUSG00000034459 0.669162863 1172 Rps27l ENSMUSG00000036781 0.668752047 1173 Mex3c ENSMUSG00000037253 0.668191088 1174 Rangap1 ENSMUSG00000022391 0.667900592 1175 Tmtc3 ENSMUSG00000036676 0.667784074 1176 Sptssa ENSMUSG00000044408 0.666057059 1177 Rpl36al ENSMUSG00000049751 0.665684482 1178 Utp14a ENSMUSG00000063785 0.663737961 1179 Slc35b4 ENSMUSG00000018999 0.663657564 1180 Nt5e ENSMUSG00000032420 0.662443118 1181 Alg14 ENSMUSG00000039887 0.662411485 1182 Bak1 ENSMUSG00000057789 0.66107869 1183 Sulf2 ENSMUSG00000006800 0.660960059 1184 Plekho2 ENSMUSG00000050721 0.660295218 1185 Clic4 ENSMUSG00000037242 0.660096493 1186 Gmds ENSMUSG00000038372 0.659058531 1187 Dennd4a ENSMUSG00000053641 0.658649715 1188 D1Ertd622e ENSMUSG00000044768 0.657605772 1189 Nuak1 ENSMUSG00000020032 0.657568401 1190 Gm9892 ENSMUSG00000052825 0.657255832 1191 Gys1 ENSMUSG00000003865 0.655983247 1192 Dnaaf5 ENSMUSG00000025857 0.654063659 1193 Rps19-ps6 ENSMUSG00000096942 0.654044111 1194 Aimp2 ENSMUSG00000029610 0.652181821 1195 Ranbp1 ENSMUSG00000005732 0.651469332 1196 Akirin1 ENSMUSG00000023075 0.651233528 1197 Magt1 ENSMUSG00000031232 0.651042114 1198 Tmem8b ENSMUSG00000078716 0.650505945 1199 Cnot1 ENSMUSG00000036550 0.649904527 1200 Lrrfip1 ENSMUSG00000026305 0.648583949 1201 Dlgap4 ENSMUSG00000061689 0.647999278 1202 Cttn ENSMUSG00000031078 0.647377419 1203 Csrp1 ENSMUSG00000026421 0.646229032 1204 ENSMUSG00000109908 0.646091023 1205 Calm1 ENSMUSG00000001175 0.645126522 1206 Btg1 ENSMUSG00000036478 0.645011658 1207 Thumpd3 ENSMUSG00000030264 0.643791002 1208 Eif6 ENSMUSG00000027613 0.643730306 1209 Alg12 ENSMUSG00000035845 0.64288158 1210 Prelid1 ENSMUSG00000021486 0.642585588 1211 Sft2d1 ENSMUSG00000073468 0.642332084 1212 Gtf2f1 ENSMUSG00000002658 0.641609494 1213 Arhgdia ENSMUSG00000025132 0.641402122 1214 Lpp ENSMUSG00000033306 0.641290026 1215 Herc2 ENSMUSG00000030451 0.641123786 1216 Ssr4 ENSMUSG00000002014 0.64044671 1217 Sec11c ENSMUSG00000024516 0.639828566 1218 Osbpl9 ENSMUSG00000028559 0.639498317 1219 Net1 ENSMUSG00000021215 0.637143851 1220 Smc2 ENSMUSG00000028312 0.634767001 1221 Gm4202 ENSMUSG00000091421 0.634523293 1222 Cyp51 ENSMUSG00000001467 0.63435002 1223 Col6a3 ENSMUSG00000048126 0.633595473 1224 Pign ENSMUSG00000056536 0.63355999 1225 Tuba1b ENSMUSG00000023004 0.63198989 1226 Uso1 ENSMUSG00000029407 0.63104944 1227 Epn3 ENSMUSG00000010080 0.630938757 1228 Ppp2r1b ENSMUSG00000032058 0.630364598 1229 Tmem43 ENSMUSG00000030095 0.630081801 1230 Nup98 ENSMUSG00000063550 0.629392191 1231 Lrrc28 ENSMUSG00000030556 0.629353958 1232 Cptp ENSMUSG00000029073 0.629064149 1233 Map2k1 ENSMUSG00000004936 0.628573741 1234 Atp6ap2 ENSMUSG00000031007 0.628390821 1235 Cbwd1 ENSMUSG00000024878 0.6280778 1236 Sdad1 ENSMUSG00000029415 0.627165797 1237 Col1a1 ENSMUSG00000001506 0.626620549 1238 Exosc2 ENSMUSG00000039356 0.625799426 1239 Alkbh6 ENSMUSG00000042831 0.624868934 1240 Mtm1 ENSMUSG00000031337 0.624794263 1241 Tma16 ENSMUSG00000025591 0.624759039 1242 Git1 ENSMUSG00000011877 0.623695541 1243 Chchd6 ENSMUSG00000030086 0.62330958 1244 Ptpn2 ENSMUSG00000024539 0.621793951 1245 Noc4l ENSMUSG00000033294 0.621598922 1246 Rnd3 ENSMUSG00000017144 0.619969972 1247 Rps26-ps1 ENSMUSG00000059775 0.619435377 1248 Hinfp ENSMUSG00000032119 0.618940271 1249 Rnf4 ENSMUSG00000029110 0.618481098 1250 Gadd45a ENSMUSG00000036390 0.617931993 1251 Cdc42se2 ENSMUSG00000052298 0.61765282 1252 Tusc2 ENSMUSG00000010054 0.614390119 1253 Nup205 ENSMUSG00000038759 0.61390988 1254 Hras ENSMUSG00000025499 0.613823609 1255 H2afz ENSMUSG00000037894 0.613687268 1256 Crls1 ENSMUSG00000027357 0.613582286 1257 1810022K09Rik ENSMUSG00000078784 0.61310472 1258 Prdm4 ENSMUSG00000035529 0.612345211 1259 Utp23 ENSMUSG00000022313 0.612224386 1260 Abca7 ENSMUSG00000035722 0.610961443 1261 Slc43a2 ENSMUSG00000038178 0.609567402 1262 Arhgap1 ENSMUSG00000027247 0.609348442 1263 1110065P20Rik ENSMUSG00000078570 0.608295661 1264 Mlec ENSMUSG00000048578 0.607575492 1265 Ctgf ENSMUSG00000019997 0.607389662 1266 Tubb5 ENSMUSG00000001525 0.60692508 1267 Fstl1 ENSMUSG00000022816 0.606903738 1268 Cript ENSMUSG00000024146 0.606393596 1269 Cdkn2d ENSMUSG00000096472 0.606364933 1270 Slc38a1 ENSMUSG00000023169 0.606175017 1271 Snrnp40 ENSMUSG00000074088 0.606046247 1272 Rpl37rt ENSMUSG00000072692 0.605870647 1273 Ticam1 ENSMUSG00000047123 0.605515294 1274 Mknk1 ENSMUSG00000028708 0.605372644 1275 Zpr1 ENSMUSG00000032078 0.605301172 1276 Ptov1 ENSMUSG00000038502 0.605065096 1277 Borcs6 ENSMUSG00000045176 0.603991584 1278 Pwp2 ENSMUSG00000032834 0.603470513 1279 Cd302 ENSMUSG00000060703 0.602227963 1280 Col4a5 ENSMUSG00000031274 0.601840054 1281 Dcun1d3 ENSMUSG00000048787 0.601495354 1282 Tmem41b ENSMUSG00000047554 0.601304134 1283 Ak6 ENSMUSG00000078941 0.600480642 1284 Abhd17c ENSMUSG00000038459 0.6004754 1285 Adam9 ENSMUSG00000031555 0.598811296 1286 Tspan9 ENSMUSG00000030352 0.597732982 1287 Tmbim6 ENSMUSG00000023010 0.597709731 1288 Evi5l ENSMUSG00000011832 0.597197721 1289 Mcm6 ENSMUSG00000026355 0.596849969 1290 Hspa8 ENSMUSG00000015656 0.596785008 1291 Myo9a ENSMUSG00000039585 0.595772587 1292 Cdv3 ENSMUSG00000032803 0.594391759 1293 Rps5 ENSMUSG00000012848 0.59352121 1294 Gpr108 ENSMUSG00000005823 0.592814952 1295 Wsb1 ENSMUSG00000017677 0.592735969 1296 Rps19 ENSMUSG00000040952 0.592580642 1297 Hmg20b ENSMUSG00000020232 0.5917954 1298 Flna ENSMUSG00000031328 0.590876496 1299 Ccdc25 ENSMUSG00000022035 0.588484211 1300 Maea ENSMUSG00000079562 0.588459912 1301 Ap3m1 ENSMUSG00000021824 0.588426438 1302 Leprot ENSMUSG00000035212 0.587584642 1303 Rpl14 ENSMUSG00000025794 0.587384075 1304 Pbdc1 ENSMUSG00000031226 0.587199446 1305 Itm2c ENSMUSG00000026223 0.586300683 1306 Klf2 ENSMUSG00000055148 0.586213082 1307 Yars ENSMUSG00000028811 0.585805997 1308 Ctnnal1 ENSMUSG00000038816 0.585104715 1309 Anxa2 ENSMUSG00000032231 0.584881521 1310 Tomm70a ENSMUSG00000022752 0.584741477 1311 Sdsl ENSMUSG00000029596 0.584574705 1312 9930021J03Rik ENSMUSG00000046138 0.58445531 1313 Tssc1 ENSMUSG00000036613 0.583745402 1314 Pde12 ENSMUSG00000043702 0.582926616 1315 Sbf1 ENSMUSG00000036529 0.582653681 1316 Fam174a ENSMUSG00000051185 0.582472213 1317 Taldo1 ENSMUSG00000025503 0.582320022 1318 D930016D06Rik ENSMUSG00000097392 0.581637646 1319 Dcaf13 ENSMUSG00000022300 0.581585018 1320 Exoc1 ENSMUSG00000036435 0.581250128 1321 Ltbr ENSMUSG00000030339 0.581166184 1322 Ppp2r5a ENSMUSG00000026626 0.581147697 1323 Ttc37 ENSMUSG00000033991 0.580241398 1324 Ipo4 ENSMUSG00000002319 0.580236941 1325 Bag2 ENSMUSG00000042215 0.579701437 1326 Dse ENSMUSG00000039497 0.579658773 1327 Rhbdd1 ENSMUSG00000026142 0.578566976 1328 Fam208b ENSMUSG00000033799 0.578445914 1329 Rpl12 ENSMUSG00000038900 0.575352258 1330 Tmem208 ENSMUSG00000014856 0.575008895 1331 Cyb5b ENSMUSG00000031924 0.574780909 1332 Trove2 ENSMUSG00000018199 0.573184709 1333 Ddx10 ENSMUSG00000053289 0.573045385 1334 Fat1 ENSMUSG00000070047 0.572118107 1335 Fbn1 ENSMUSG00000027204 0.571995332 1336 B3gat3 ENSMUSG00000071649 0.571481092 1337 Nlk ENSMUSG00000017376 0.57134959 1338 Dnajc2 ENSMUSG00000029014 0.571336165 1339 Gm37084 ENSMUSG00000102856 0.5710928 1340 Pspc1 ENSMUSG00000021938 0.57058026 1341 Btaf1 ENSMUSG00000040565 0.569496277 1342 Loxl1 ENSMUSG00000032334 0.568574626 1343 Hand2 ENSMUSG00000038193 0.568356416 1344 Cfap36 ENSMUSG00000020462 0.567957448 1345 Emp2 ENSMUSG00000022505 0.567116638 1346 Tmem160 ENSMUSG00000019158 0.566839725 1347 Rala ENSMUSG00000008859 0.566565194 1348 Gba ENSMUSG00000028048 0.566345276 1349 Sec23b ENSMUSG00000027429 0.565988723 1350 Bud31 ENSMUSG00000038722 0.56464418 1351 Pno1 ENSMUSG00000020116 0.563941008 1352 Gm15459 ENSMUSG00000100801 0.562548494 1353 Rpe ENSMUSG00000026005 0.56228236 1354 Pdlim1 ENSMUSG00000055044 0.562234977 1355 Arih1 ENSMUSG00000025234 0.561272177 1356 Sf3b6 ENSMUSG00000037361 0.561260446 1357 L2hgdh ENSMUSG00000020988 0.561232297 1358 Rps27a ENSMUSG00000020460 0.561222534 1359 Mpp6 ENSMUSG00000038388 0.560892157 1360 Prmt2 ENSMUSG00000020230 0.560223307 1361 Rack1 ENSMUSG00000020372 0.560178981 1362 Rab5a ENSMUSG00000017831 0.55994017 1363 Slc11a2 ENSMUSG00000023030 0.559739773 1364 Blvra ENSMUSG00000001999 0.559022061 1365 Lnpk ENSMUSG00000009207 0.558561254 1366 Sumf1 ENSMUSG00000030101 0.558050627 1367 Dusp27 ENSMUSG00000026564 0.557232968 1368 Zfp330 ENSMUSG00000031711 0.556388189 1369 Tasp1 ENSMUSG00000039033 0.555967599 1370 Asap2 ENSMUSG00000052632 0.555036211 1371 Ptpn1 ENSMUSG00000027540 0.554938869 1372 Zbtb6 ENSMUSG00000066798 0.554409184 1373 Hnrnpf ENSMUSG00000042079 0.553946945 1374 Ppip5k1 ENSMUSG00000033526 0.553921651 1375 Arhgap12 ENSMUSG00000041225 0.553714279 1376 Ddost ENSMUSG00000028757 0.552975811 1377 Fcf1 ENSMUSG00000021243 0.551800679 1378 Gm10275 ENSMUSG00000069682 0.551041155 1379 Rnft1 ENSMUSG00000020521 0.549530386 1380 Gm15500 ENSMUSG00000086583 0.549512492 1381 Cct2 ENSMUSG00000034024 0.549296809 1382 Esyt2 ENSMUSG00000021171 0.549186355 1383 Anapc10 ENSMUSG00000036977 0.548612062 1384 Gfpt1 ENSMUSG00000029992 0.548423544 1385 Ufm1 ENSMUSG00000027746 0.547345291 1386 Rps12 ENSMUSG00000061983 0.547126738 1387 Wbscr22 ENSMUSG00000005378 0.546905029 1388 Plekho1 ENSMUSG00000015745 0.546833989 1389 Jund ENSMUSG00000071076 0.546304886 1390 Tcerg1 ENSMUSG00000024498 0.546265948 1391 Tesk1 ENSMUSG00000028458 0.545899804 1392 Eif2s1 ENSMUSG00000021116 0.545643719 1393 Mtr ENSMUSG00000021311 0.544752927 1394 Fam192a ENSMUSG00000031774 0.544488305 1395 Cacul1 ENSMUSG00000033417 0.54428689 1396 Ran ENSMUSG00000029430 0.542801135 1397 Commd4 ENSMUSG00000032299 0.542503083 1398 Pcdhgc3 ENSMUSG00000102918 0.541874673 1399 Gsr ENSMUSG00000031584 0.541721894 1400 Ascc2 ENSMUSG00000020412 0.540838018 1401 Edem3 ENSMUSG00000043019 0.540722206 1402 Scamp2 ENSMUSG00000040188 0.540442832 1403 Gyg ENSMUSG00000019528 0.539156464 1404 Tatdn1 ENSMUSG00000050891 0.538008144 1405 Tgm2 ENSMUSG00000037820 0.537466052 1406 Snrpf ENSMUSG00000020018 0.536775913 1407 Uba5 ENSMUSG00000032557 0.536745484 1408 Gnptab ENSMUSG00000035311 0.536514154 1409 Smpx ENSMUSG00000041476 0.536432807 1410 Zc3h7a ENSMUSG00000037965 0.536316795 1411 Gm26917 ENSMUSG00000097971 0.53567106 1412 Gls ENSMUSG00000026103 0.535524031 1413 Sdcbp ENSMUSG00000028249 0.534253874 1414 Arhgap20 ENSMUSG00000053199 0.534000412 1415 Anxa7 ENSMUSG00000021814 0.532414861 1416 Gm6136 ENSMUSG00000084106 0.532066705 1417 Maged2 ENSMUSG00000025268 0.531469614 1418 Rpl13 ENSMUSG00000000740 0.531304063 1419 Txndc17 ENSMUSG00000020803 0.530715324 1420 Polr1b ENSMUSG00000027395 0.530455322 1421 Pgrmc2 ENSMUSG00000049940 0.528930034 1422 Sec61a1 ENSMUSG00000030082 0.528825325 1423 Selenok ENSMUSG00000042682 0.528515985 1424 Mettl2 ENSMUSG00000020691 0.52787577 1425 Nedd4l ENSMUSG00000024589 0.527241157 1426 Hspa14 ENSMUSG00000109865 0.526804674 1427 Rpl4 ENSMUSG00000032399 0.526427875 1428 Timm17b ENSMUSG00000031158 0.526378283 1429 Ogfrl1 ENSMUSG00000026158 0.525974161 1430 Twf2 ENSMUSG00000023277 0.524151338 1431 Qars ENSMUSG00000032604 0.52410875 1432 Zcchc7 ENSMUSG00000035649 0.523261157 1433 Sec24a ENSMUSG00000036391 0.523249415 1434 Gm9794 ENSMUSG00000107176 0.522853865 1435 Vapa ENSMUSG00000024091 0.521932574 1436 Cct5 ENSMUSG00000022234 0.521632792 1437 Ythdc2 ENSMUSG00000034653 0.521246085 1438 Rps18 ENSMUSG00000008668 0.521134919 1439 Gtf3c6 ENSMUSG00000019837 0.520981546 1440 Imp4 ENSMUSG00000026127 0.520974461 1441 Atp6v0a2 ENSMUSG00000038023 0.520967279 1442 Eef1d ENSMUSG00000055762 0.520926659 1443 Pabpc1 ENSMUSG00000022283 0.520114387 1444 Usp9x ENSMUSG00000031010 0.520076771 1445 Mtmr9 ENSMUSG00000035078 0.519041252 1446 Uap1 ENSMUSG00000026670 0.518762823 1447 Lmna ENSMUSG00000028063 0.518272094 1448 Msn ENSMUSG00000031207 0.51705165 1449 Rpl37 ENSMUSG00000041841 0.516447015 1450 Arpc1b ENSMUSG00000029622 0.515515079 1451 Elof1 ENSMUSG00000013822 0.515378858 1452 Khsrp ENSMUSG00000007670 0.515315131 1453 Uba6 ENSMUSG00000035898 0.515108656 1454 Dpysl3 ENSMUSG00000024501 0.51427296 1455 Ergic1 ENSMUSG00000001576 0.513845711 1456 Mib1 ENSMUSG00000024294 0.513508284 1457 Snx6 ENSMUSG00000005656 0.513002019 1458 Ddx27 ENSMUSG00000017999 0.512623582 1459 Rspry1 ENSMUSG00000050079 0.512027889 1460 Scfd1 ENSMUSG00000020952 0.511947739 1461 Bysl ENSMUSG00000023988 0.510829898 1462 Pnp ENSMUSG00000021871 0.510733136 1463 Adamts2 ENSMUSG00000036545 0.510538921 1464 Ralgps1 ENSMUSG00000038831 0.510487815 1465 Exosc9 ENSMUSG00000027714 0.509835303 1466 Abce1 ENSMUSG00000058355 0.509233442 1467 Dyrk2 ENSMUSG00000028630 0.508790477 1468 Dis3 ENSMUSG00000033166 0.508518208 1469 Rplp1 ENSMUSG00000007892 0.508212368 1470 Ccdc6 ENSMUSG00000048701 0.507225369 1471 Hspa13 ENSMUSG00000032932 0.507138892 1472 Wdr43 ENSMUSG00000041057 0.506417679 1473 Epb41 ENSMUSG00000028906 0.505875092 1474 Mtpn ENSMUSG00000029840 0.505665596 1475 Atr ENSMUSG00000032409 0.505648778 1476 Nupl1 ENSMUSG00000063895 0.505096689 1477 Traf7 ENSMUSG00000052752 0.504886147 1478 Ptges3-ps ENSMUSG00000040078 0.504635487 1479 Rps20 ENSMUSG00000028234 0.504393132 1480 Eif5a ENSMUSG00000078812 0.502601419 1481 Tbce ENSMUSG00000039233 0.502541866 1482 Psme2 ENSMUSG00000079197 0.502236661 1483 Plaa ENSMUSG00000028577 0.501379027 1484 Mtdh ENSMUSG00000022255 0.501300669 1485 Rpl15 ENSMUSG00000012405 0.50108021 1486 Rps23 ENSMUSG00000049517 0.50065545 1487 Larp1 ENSMUSG00000037331 0.500420423 1488 Eif2a ENSMUSG00000027810 0.500170125 1489 1110008F13Rik ENSMUSG00000027637 0.499021313 1490 Ap2b1 ENSMUSG00000035152 0.498820397 1491 Pes1 ENSMUSG00000020430 0.498363938 1492 Pigm ENSMUSG00000050229 0.498275869 1493 Nmt1 ENSMUSG00000020936 0.498171532 1494 Set ENSMUSG00000054766 0.498097334 1495 Ttc13 ENSMUSG00000037300 0.498063021 1496 Utp11 ENSMUSG00000028907 0.497994406 1497 Naa25 ENSMUSG00000042719 0.497062382 1498 Twf1 ENSMUSG00000022451 0.496746642 1499 Nacc1 ENSMUSG00000001910 0.496606494 1500 Ngdn ENSMUSG00000022204 0.496259281 1501 Exoc2 ENSMUSG00000021357 0.495969666 1502 Rps8 ENSMUSG00000047675 0.495867146 1503 Sept10 ENSMUSG00000019917 0.495383284 1504 Dhx29 ENSMUSG00000042426 0.494292892 1505 Nelfe ENSMUSG00000024369 0.494029333 1506 Snx4 ENSMUSG00000022808 0.492311794 1507 Dnajb2 ENSMUSG00000026203 0.491360664 1508 Rrp36 ENSMUSG00000023971 0.490777527 1509 Vcpip1 ENSMUSG00000045210 0.489566213 1510 Btf3 ENSMUSG00000021660 0.488985218 1511 Snap29 ENSMUSG00000022765 0.488839177 1512 Gdap2 ENSMUSG00000027865 0.486409295 1513 Col5a2 ENSMUSG00000026042 0.48619249 1514 Tnpo1 ENSMUSG00000009470 0.485193635 1515 Mtmr12 ENSMUSG00000039458 0.484172984 1516 Kdelr2 ENSMUSG00000079111 0.484165692 1517 Zfp809 ENSMUSG00000057982 0.483616479 1518 Wnk1 ENSMUSG00000045962 0.482921099 1519 Cdc42 ENSMUSG00000006699 0.48291774 1520 Rpain ENSMUSG00000018449 0.482469071 1521 Ifnar1 ENSMUSG00000022967 0.481257099 1522 Capza1 ENSMUSG00000070372 0.48085383 1523 Pex2 ENSMUSG00000040374 0.480696842 1524 Usp22 ENSMUSG00000042506 0.480619961 1525 Ap1s1 ENSMUSG00000004849 0.480458595 1526 Ank3 ENSMUSG00000069601 0.480387379 1527 BC017643 ENSMUSG00000039294 0.480156834 1528 Nrd1 ENSMUSG00000053510 0.479951824 1529 Atp6v1a ENSMUSG00000052459 0.479716457 1530 Cpeb2 ENSMUSG00000039782 0.479321725 1531 Rpl27a ENSMUSG00000046364 0.478058747 1532 Rplp0 ENSMUSG00000067274 0.477678845 1533 Tmem57 ENSMUSG00000028826 0.477620117 1534 Aspscr1 ENSMUSG00000025142 0.476714939 1535 Rpl35a ENSMUSG00000060636 0.476592185 1536 Eif3c ENSMUSG00000030738 0.476556054 1537 Fer ENSMUSG00000000127 0.475780649 1538 Nsun2 ENSMUSG00000021595 0.475446391 1539 Tmem159 ENSMUSG00000030917 0.474912436 1540 Pikfyve ENSMUSG00000025949 0.474014519 1541 Rap1a ENSMUSG00000068798 0.47161947 1542 Zfp277 ENSMUSG00000055917 0.471340675 1543 Kras ENSMUSG00000030265 0.47105097 1544 Prrc1 ENSMUSG00000024594 0.46918257 1545 Meis1 ENSMUSG00000020160 0.468645237 1546 Tatdn2 ENSMUSG00000056952 0.468427648 1547 Rpl18 ENSMUSG00000059070 0.468298467 1548 Apobec2 ENSMUSG00000040694 0.467918891 1549 Nop9 ENSMUSG00000019297 0.467913558 1550 Ppme1 ENSMUSG00000030718 0.467808746 1551 Hnrnpab ENSMUSG00000020358 0.467596901 1552 Rps7 ENSMUSG00000061477 0.467217561 1553 Polr3d ENSMUSG00000000776 0.466640189 1554 Tmem131 ENSMUSG00000026116 0.466395694 1555 Rprd1a ENSMUSG00000040446 0.46630709 1556 Large1 ENSMUSG00000004383 0.465827982 1557 Ppm1a ENSMUSG00000021096 0.465810417 1558 Impdh2 ENSMUSG00000062867 0.464314265 1559 Foxk2 ENSMUSG00000039275 0.464100051 1560 Slc39a1 ENSMUSG00000052310 0.463241415 1561 Sec22b ENSMUSG00000027879 0.462370633 1562 Rnf220 ENSMUSG00000028677 0.462087496 1563 Hprt ENSMUSG00000025630 0.461867288 1564 Stt3a ENSMUSG00000032116 0.460882392 1565 Rusc2 ENSMUSG00000035969 0.460422338 1566 Fbxo30 ENSMUSG00000047648 0.459889961 1567 Ptbp1 ENSMUSG00000006498 0.459552879 1568 Pdcd6ip ENSMUSG00000032504 0.459538872 1569 Pak1ip1 ENSMUSG00000038683 0.45920386 1570 Rpl5 ENSMUSG00000058558 0.45759172 1571 Gclc ENSMUSG00000032350 0.457365506 1572 Atp6v0e ENSMUSG00000015575 0.455534365 1573 Tspo ENSMUSG00000041736 0.455357739 1574 Rngtt ENSMUSG00000028274 0.45518463 1575 Arpc5 ENSMUSG00000008475 0.455169113 1576 Vta1 ENSMUSG00000019868 0.455165181 1577 Nup153 ENSMUSG00000021374 0.452302113 1578 Rpl19-ps11 ENSMUSG00000081094 0.451845185 1579 Sdc2 ENSMUSG00000022261 0.451375996 1580 Kpna2 ENSMUSG00000018362 0.451108853 1581 Cct7 ENSMUSG00000030007 0.451064726 1582 Plekha3 ENSMUSG00000002733 0.450449321 1583 Trim47 ENSMUSG00000020773 0.450051423 1584 Ell2 ENSMUSG00000001542 0.449405846 1585 Psmd13 ENSMUSG00000025487 0.449189383 1586 Ube2s ENSMUSG00000060860 0.448979167 1587 Ncln ENSMUSG00000020238 0.448881513 1588 Tprgl ENSMUSG00000029030 0.447808781 1589 Anxa5 ENSMUSG00000027712 0.447580481 1590 C1galt1 ENSMUSG00000042460 0.447490504 1591 Otud6b ENSMUSG00000040550 0.447360687 1592 Gpr89 ENSMUSG00000028096 0.446185855 1593 Rpl6 ENSMUSG00000029614 0.445430246 1594 Creb3 ENSMUSG00000028466 0.444868288 1595 Acbd3 ENSMUSG00000026499 0.444834976 1596 Myl6 ENSMUSG00000090841 0.44477446 1597 Celf2 ENSMUSG00000002107 0.443389626 1598 Stk4 ENSMUSG00000018209 0.44306901 1599 Stam2 ENSMUSG00000055371 0.442407482 1600 Bcl10 ENSMUSG00000028191 0.441448134 1601 Ankrd13a ENSMUSG00000041870 0.441141247 1602 Ubxn4 ENSMUSG00000026353 0.440828321 1603 Txn1 ENSMUSG00000028367 0.440760263 1604 Nt5c2 ENSMUSG00000025041 0.440499317 1605 Vim ENSMUSG00000026728 0.440447875 1606 Tnpo2 ENSMUSG00000031691 0.440413941 1607 Actl6a ENSMUSG00000027671 0.439581209 1608 Apc ENSMUSG00000005871 0.438561537 1609 Ipo7 ENSMUSG00000066232 0.438287864 1610 Atxn10 ENSMUSG00000016541 0.438244785 1611 Clec16a ENSMUSG00000068663 0.438069619 1612 Hspb2 ENSMUSG00000038086 0.437749757 1613 Klhl28 ENSMUSG00000020948 0.436341544 1614 Tapt1 ENSMUSG00000046985 0.4344988 1615 Lnx2 ENSMUSG00000016520 0.433632558 1616 Raph1 ENSMUSG00000026014 0.433568542 1617 Rab8a ENSMUSG00000003037 0.433239524 1618 Dnajc14 ENSMUSG00000025354 0.432367351 1619 Lig3 ENSMUSG00000020697 0.43221014 1620 Ppp1r10 ENSMUSG00000039220 0.432036417 1621 Golgb1 ENSMUSG00000034243 0.431179617 1622 Agps ENSMUSG00000042410 0.429622442 1623 2410004B18Rik ENSMUSG00000036873 0.429123234 1624 Polr1d ENSMUSG00000029642 0.429083038 1625 Ifit2 ENSMUSG00000045932 0.428185087 1626 Pdpk1 ENSMUSG00000024122 0.427992282 1627 Shc1 ENSMUSG00000042626 0.427736386 1628 Rpl11 ENSMUSG00000059291 0.427510886 1629 Psen1 ENSMUSG00000019969 0.425337299 1630 Mob1b ENSMUSG00000006262 0.424911449 1631 Dnajb14 ENSMUSG00000074212 0.424691855 1632 Pdcl ENSMUSG00000009030 0.423479042 1633 Nfe2l1 ENSMUSG00000038615 0.423458423 1634 Cerk ENSMUSG00000035891 0.422612544 1635 Uspl1 ENSMUSG00000041264 0.422298345 1636 Zfr ENSMUSG00000022201 0.422083471 1637 Zzef1 ENSMUSG00000055670 0.421255634 1638 Arhgap35 ENSMUSG00000058230 0.421243693 1639 Cpsf2 ENSMUSG00000041781 0.421154457 1640 Senp2 ENSMUSG00000022855 0.420867142 1641 Vkorc1l1 ENSMUSG00000066735 0.419948769 1642 Tor1aip2 ENSMUSG00000050565 0.419690379 1643 Gopc ENSMUSG00000019861 0.418279038 1644 Rpl19 ENSMUSG00000017404 0.417853569 1645 Ormdl3 ENSMUSG00000038150 0.41609523 1646 Vps50 ENSMUSG00000001376 0.416003245 1647 Tmem167b ENSMUSG00000068732 0.4141696 1648 Atp2b1 ENSMUSG00000019943 0.413375903 1649 Ctr9 ENSMUSG00000005609 0.411103842 1650 Rpl32 ENSMUSG00000057841 0.410686893 1651 Shmt2 ENSMUSG00000025403 0.410606786 1652 Nfu1 ENSMUSG00000029993 0.410467612 1653 Rtfdc1 ENSMUSG00000027502 0.409129447 1654 Rpl36a ENSMUSG00000079435 0.406900204 1655 Arhgap44 ENSMUSG00000033389 0.406653807 1656 Mapkap1 ENSMUSG00000038696 0.403232633 1657 Cdc27 ENSMUSG00000020687 0.397319585 1658 Rpl38 ENSMUSG00000057322 0.395963629 1659 Rps28 ENSMUSG00000067288 0.395527258 1660 Agpat5 ENSMUSG00000031467 0.395433606 1661 Usp16 ENSMUSG00000025616 0.394837266 1662 Kmt2c ENSMUSG00000038056 0.393548682 1663 Rps11 ENSMUSG00000003429 0.390542775 1664 Nckap1 ENSMUSG00000027002 0.39046974 1665 Rps6 ENSMUSG00000028495 0.389588619 1666 Rpl23 ENSMUSG00000071415 0.388202902 1667 Spcs1 ENSMUSG00000021917 0.388074753 1668 Rer1 ENSMUSG00000029048 0.387121349 1669 Rpl21 ENSMUSG00000041453 0.387085901 1670 Herpud2 ENSMUSG00000008429 0.387057779 1671 Tex2 ENSMUSG00000040548 0.387042778 1672 Rpl34 ENSMUSG00000062006 0.384011235 1673 Rad23b ENSMUSG00000028426 0.382016811 1674 Smurf2 ENSMUSG00000018363 0.381844884 1675 Ssu72 ENSMUSG00000029038 0.378402997 1676 Actr2 ENSMUSG00000020152 0.372350328 1677 Sec16a ENSMUSG00000026924 0.368718913 1678 Vcl ENSMUSG00000021823 0.367809184 1679 Kcmf1 ENSMUSG00000055239 0.366537133 1680 Hist1h2bc ENSMUSG00000018102 0.366213554 1681 Ap3d1 ENSMUSG00000020198 0.365877498 1682 Gspt1 ENSMUSG00000062203 0.362498791 1683 Emg1 ENSMUSG00000004268 0.36048787 1684 Rpl26 ENSMUSG00000060938 0.358523171 1685 Papola ENSMUSG00000021111 0.353600692 1686 Ltn1 ENSMUSG00000052299 0.346780688 1687 Zbtb18 ENSMUSG00000063659 0.345898917 1688 Dync1i2 ENSMUSG00000027012 0.343053737 1689 Gm12338 ENSMUSG00000081485 -0.32659715 1690 Stard13 ENSMUSG00000016128 -0.33002037 1691 Mcur1 ENSMUSG00000021371 -0.331018492 1692 Anapc16 ENSMUSG00000020107 -0.334941423 1693 Ctcf ENSMUSG00000005698 -0.340043238 1694 Gid4 ENSMUSG00000018415 -0.341031179 1695 Suclg1 ENSMUSG00000052738 -0.344632806 1696 Phkb ENSMUSG00000036879 -0.345880192 1697 Mrpl16 ENSMUSG00000024683 -0.347104116 1698 Nt5c3 ENSMUSG00000029780 -0.347197258 1699 Ndufa4 ENSMUSG00000029632 -0.347321075 1700 Dld ENSMUSG00000020664 -0.348359566 1701 Ndufs5 ENSMUSG00000028648 -0.349959395 1702 Mtif2 ENSMUSG00000020459 -0.351120021 1703 Mrpl41 ENSMUSG00000036850 -0.351442806 1704 Flcn ENSMUSG00000032633 -0.353979766 1705 Apoo ENSMUSG00000079508 -0.354620094 1706 Rpa1 ENSMUSG00000000751 -0.354874065 1707 Aplp2 ENSMUSG00000031996 -0.355060563 1708 Eif4a2 ENSMUSG00000022884 -0.355081246 1709 Ktn1 ENSMUSG00000021843 -0.35553506 1710 Idh3a ENSMUSG00000032279 -0.356127016 1711 Ghr ENSMUSG00000055737 -0.356919536 1712 Uqcr11 ENSMUSG00000020163 -0.363028684 1713 Arhgef6 ENSMUSG00000031133 -0.364397921 1714 Snapin ENSMUSG00000001018 -0.364730865 1715 Rab12 ENSMUSG00000023460 -0.366912246 1716 Zbtb44 ENSMUSG00000047412 -0.3678623 1717 Tfb2m ENSMUSG00000026492 -0.368367894 1718 Bola3 ENSMUSG00000045160 -0.368409315 1719 AI314180 ENSMUSG00000050812 -0.370341583 1720 Pkig ENSMUSG00000035268 -0.370865955 1721 Gfm1 ENSMUSG00000027774 -0.372045633 1722 Rfc1 ENSMUSG00000029191 -0.373279742 1723 Mrps7 ENSMUSG00000046756 -0.373571505 1724 Tmem70 ENSMUSG00000025940 -0.373700669 1725 Rgl2 ENSMUSG00000041354 -0.374237516 1726 Comt ENSMUSG00000000326 -0.374500043 1727 Ttc3 ENSMUSG00000040785 -0.375445622 1728 Slc2a4 ENSMUSG00000018566 -0.376367489 1729 Apbb2 ENSMUSG00000029207 -0.376437254 1730 Slc29a1 ENSMUSG00000023942 -0.377334309 1731 Ephb4 ENSMUSG00000029710 -0.378476259 1732 Podxl ENSMUSG00000025608 -0.378840206 1733 Acad8 ENSMUSG00000031969 -0.380084657 1734 Nfs1 ENSMUSG00000027618 -0.380273806 1735 Mov10l1 ENSMUSG00000015365 -0.380571431 1736 Rbfa ENSMUSG00000024570 -0.380868045 1737 Vdac1 ENSMUSG00000020402 -0.38107449 1738 Cmtm4 ENSMUSG00000096188 -0.381093678 1739 Gns ENSMUSG00000034707 -0.382467044 1740 Vezf1 ENSMUSG00000018377 -0.382484952 1741 Ahcyl1 ENSMUSG00000027893 -0.383608464 1742 Ppp2r3a ENSMUSG00000043154 -0.383720923 1743 Ciapin1 ENSMUSG00000031781 -0.384716711 1744 Adh5 ENSMUSG00000028138 -0.385524887 1745 Jmy ENSMUSG00000021690 -0.386333091 1746 Palld ENSMUSG00000058056 -0.38674525 1747 Hibch ENSMUSG00000041426 -0.386842623 1748 Mrpl45 ENSMUSG00000018882 -0.386998359 1749 Irak1 ENSMUSG00000031392 -0.388013884 1750 Etfb ENSMUSG00000004610 -0.388530487 1751 Shroom4 ENSMUSG00000068270 -0.38858819 1752 Palmd ENSMUSG00000033377 -0.38982511 1753 Prex2 ENSMUSG00000048960 -0.389829878 1754 Ank ENSMUSG00000022265 -0.390274588 1755 Bves ENSMUSG00000071317 -0.39070521 1756 Spin1 ENSMUSG00000021395 -0.391893133 1757 Uqcc1 ENSMUSG00000005882 -0.392293332 1758 Mlip ENSMUSG00000032355 -0.393328936 1759 Adgre5 ENSMUSG00000002885 -0.39416034 1760 5730455P16Rik ENSMUSG00000057181 -0.394775112 1761 Uaca ENSMUSG00000034485 -0.395337858 1762 Mrpl50 ENSMUSG00000044018 -0.39562716 1763 P4ha2 ENSMUSG00000018906 -0.396374056 1764 Tcf4 ENSMUSG00000053477 -0.396465483 1765 Supv3l1 ENSMUSG00000020079 -0.39674517 1766 Pdrg1 ENSMUSG00000027472 -0.396891552 1767 Xdh ENSMUSG00000024066 -0.397427326 1768 Mrps31 ENSMUSG00000031533 -0.399327557 1769 Mrpl42 ENSMUSG00000062981 -0.400101018 1770 Tsnax ENSMUSG00000056820 -0.400419765 1771 Pdss2 ENSMUSG00000038240 -0.401185742 1772 Prdx2 ENSMUSG00000005161 -0.401256028 1773 Ecsit ENSMUSG00000066839 -0.401710685 1774 Plekha2 ENSMUSG00000031557 -0.402065752 1775 Smpdl3a ENSMUSG00000019872 -0.402201202 1776 1810037I17Rik ENSMUSG00000054091 -0.4027868 1777 Sf3b2 ENSMUSG00000024853 -0.402934623 1778 Stard8 ENSMUSG00000031216 -0.403251273 1779 Ndufc1 ENSMUSG00000037152 -0.403557617 1780 Uqcrb ENSMUSG00000021520 -0.40472659 1781 Filip1 ENSMUSG00000034898 -0.404808973 1782 Man2a2 ENSMUSG00000038886 -0.404907511 1783 Csnk1e ENSMUSG00000022433 -0.405508405 1784 Mmaa ENSMUSG00000037022 -0.405567551 1785 Man2c1 ENSMUSG00000032295 -0.405740406 1786 Atp5j2 ENSMUSG00000038690 -0.406058583 1787 Rcor3 ENSMUSG00000037395 -0.406366566 1788 Ndufa1 ENSMUSG00000016427 -0.406645634 1789 Ptprg ENSMUSG00000021745 -0.40686054 1790 Rad23a ENSMUSG00000003813 -0.406870035 1791 Vegfa ENSMUSG00000023951 -0.407265505 1792 Cox5a ENSMUSG00000000088 -0.4082817 1793 Eid1 ENSMUSG00000091337 -0.408287989 1794 St3gal6 ENSMUSG00000022747 -0.408502881 1795 Cenpb ENSMUSG00000068267 -0.409653595 1796 Atp5o ENSMUSG00000022956 -0.412328593 1797 Cox6c ENSMUSG00000014313 -0.412378508 1798 Ets1 ENSMUSG00000032035 -0.412577739 1799 Smim14 ENSMUSG00000037822 -0.412740696 1800 Hars2 ENSMUSG00000019143 -0.41348714 1801 Tspan3 ENSMUSG00000032324 -0.413902501 1802 Zfp106 ENSMUSG00000027288 -0.413933106 1803 Atp5l ENSMUSG00000038717 -0.415039908 1804 Rev1 ENSMUSG00000026082 -0.416685113 1805 Nedd4 ENSMUSG00000032216 -0.417731119 1806 Cbr4 ENSMUSG00000031641 -0.417802571 1807 Mrps16 ENSMUSG00000049960 -0.418700587 1808 Ndufb9 ENSMUSG00000022354 -0.418964058 1809 Rrm2b ENSMUSG00000022292 -0.41953781 1810 Wrnip1 ENSMUSG00000021400 -0.41975903 1811 Cd200 ENSMUSG00000022661 -0.420676199 1812 Zc3h7b ENSMUSG00000022390 -0.421420534 1813 Ctnnbip1 ENSMUSG00000028988 -0.422896573 1814 Smarcc2 ENSMUSG00000025369 -0.423145415 1815 Hmox2 ENSMUSG00000004070 -0.424059285 1816 Msra ENSMUSG00000054733 -0.425212209 1817 Tbc1d4 ENSMUSG00000033083 -0.425428003 1818 Fnip2 ENSMUSG00000061175 -0.425637595 1819 Smim10l1 ENSMUSG00000072704 -0.426200429 1820 Mllt6 ENSMUSG00000038437 -0.426853875 1821 A430105I19Rik ENSMUSG00000045838 -0.42714695 1822 Cox4i1 ENSMUSG00000031818 -0.427344389 1823 Atp5h ENSMUSG00000034566 -0.428650804 1824 Lgr6 ENSMUSG00000042793 -0.428864712 1825 Kansl1l ENSMUSG00000026004 -0.428936192 1826 Zcchc24 ENSMUSG00000055538 -0.428954267 1827 Epm2aip1 ENSMUSG00000046785 -0.429076658 1828 Tek ENSMUSG00000006386 -0.429972944 1829 Rftn1 ENSMUSG00000039316 -0.430023071 1830 Glrx ENSMUSG00000021591 -0.430608355 1831 Pde3a ENSMUSG00000041741 -0.431316752 1832 Selenoo ENSMUSG00000035757 -0.431788726 1833 Cep68 ENSMUSG00000044066 -0.433319355 1834 Cygb ENSMUSG00000020810 -0.433380582 1835 Timm8b ENSMUSG00000039016 -0.434000733 1836 Mrpl18 ENSMUSG00000057388 -0.434135841 1837 Pgm2l1 ENSMUSG00000030729 -0.434628608 1838 Tcaim ENSMUSG00000046603 -0.434875459 1839 Mrps33 ENSMUSG00000029918 -0.436279358 1840 Dtnbp1 ENSMUSG00000057531 -0.436589855 1841 Aifm2 ENSMUSG00000020085 -0.437862777 1842 Carnmt1 ENSMUSG00000024726 -0.437956886 1843 Pgm2 ENSMUSG00000025791 -0.439670892 1844 Ndufv1 ENSMUSG00000037916 -0.440429544 1845 Ndufc2 ENSMUSG00000030647 -0.440578639 1846 Polr3gl ENSMUSG00000028104 -0.440798662 1847 Tnfrsf21 ENSMUSG00000023915 -0.440842091 1848 Ndufb11 ENSMUSG00000031059 -0.441603042 1849 Rapgef3 ENSMUSG00000022469 -0.441829968 1850 Acadsb ENSMUSG00000030861 -0.444605804 1851 Gtf3c1 ENSMUSG00000032777 -0.444671925 1852 Reln ENSMUSG00000042453 -0.444903345 1853 Lrba ENSMUSG00000028080 -0.445188289 1854 Twnk ENSMUSG00000025209 -0.44587355 1855 Stard9 ENSMUSG00000033705 -0.446203538 1856 Alas1 ENSMUSG00000032786 -0.44675888 1857 Txndc15 ENSMUSG00000021497 -0.447884249 1858 Arhgef15 ENSMUSG00000052921 -0.448100767 1859 Fastk ENSMUSG00000028959 -0.448346517 1860 Ndufa7 ENSMUSG00000041881 -0.449967011 1861 Thbd ENSMUSG00000074743 -0.450155336 1862 Adgrl4 ENSMUSG00000039167 -0.45172235 1863 Cacna1c ENSMUSG00000051331 -0.452305951 1864 Timm29 ENSMUSG00000048429 -0.452729912 1865 Jph1 ENSMUSG00000042686 -0.452941575 1866 Rn7sk ENSMUSG00000065037 -0.453002356 1867 Foxo3 ENSMUSG00000048756 -0.453234902 1868 Tspan12 ENSMUSG00000029669 -0.453579874 1869 Mpc1 ENSMUSG00000023861 -0.454010318 1870 Arap3 ENSMUSG00000024451 -0.454430577 1871 Tmtc1 ENSMUSG00000030306 -0.454589227 1872 Bcap29 ENSMUSG00000020650 -0.45519177 1873 Tinagl1 ENSMUSG00000028776 -0.455269169 1874 Ndufb5 ENSMUSG00000027673 -0.456644444 1875 Ank2 ENSMUSG00000032826 -0.457002989 1876 Spg7 ENSMUSG00000000738 -0.457273898 1877 Clpb ENSMUSG00000001829 -0.45828199 1878 Uty ENSMUSG00000068457 -0.458496734 1879 Ermp1 ENSMUSG00000046324 -0.458528901 1880 Slc25a4 ENSMUSG00000031633 -0.458537686 1881 Map2k7 ENSMUSG00000002948 -0.459089576 1882 Slc16a10 ENSMUSG00000019838 -0.459239262 1883 Sod2 ENSMUSG00000006818 -0.460048499 1884 Suclg2 ENSMUSG00000061838 -0.460555344 1885 Ppp1r3c ENSMUSG00000067279 -0.46061362 1886 Cisd1 ENSMUSG00000037710 -0.461040091 1887 Cers4 ENSMUSG00000008206 -0.461041525 1888 Fnbp1l ENSMUSG00000039735 -0.462111249 1889 Cdh13 ENSMUSG00000031841 -0.462446889 1890 Naa35 ENSMUSG00000021555 -0.463136319 1891 Mcc ENSMUSG00000071856 -0.463216951 1892 E2f6 ENSMUSG00000057469 -0.463828688 1893 Rxra ENSMUSG00000015846 -0.46390427 1894 Plxna2 ENSMUSG00000026640 -0.464090077 1895 Tfpi ENSMUSG00000027082 -0.464151348 1896 Nectin2 ENSMUSG00000062300 -0.464518076 1897 Id1 ENSMUSG00000042745 -0.465373756 1898 Atp5k ENSMUSG00000050856 -0.465861938 1899 Fgd4 ENSMUSG00000022788 -0.465947898 1900 Polrmt ENSMUSG00000020329 -0.466013171 1901 Gdi1 ENSMUSG00000015291 -0.466500275 1902 Cyth1 ENSMUSG00000017132 -0.466603943 1903 Rdh14 ENSMUSG00000020621 -0.467924562 1904 Man2b1 ENSMUSG00000005142 -0.467970752 1905 Cebpzos ENSMUSG00000062691 -0.468072836 1906 Cox10 ENSMUSG00000042148 -0.46855685 1907 Lamb1 ENSMUSG00000002900 -0.468698685 1908 Sdhb ENSMUSG00000009863 -0.469939549 1909 Smim8 ENSMUSG00000028295 -0.470234616 1910 Rora ENSMUSG00000032238 -0.470431033 1911 Sash1 ENSMUSG00000015305 -0.471569521 1912 Ndufa10 ENSMUSG00000026260 -0.471907212 1913 Inppl1 ENSMUSG00000032737 -0.471926812 1914 Cog6 ENSMUSG00000027742 -0.472050199 1915 Abca8b ENSMUSG00000020620 -0.472167165 1916 Pfkl ENSMUSG00000020277 -0.472372865 1917 Fbxo3 ENSMUSG00000027180 -0.472386005 1918 Epha2 ENSMUSG00000006445 -0.472681309 1919 Lsm3 ENSMUSG00000034192 -0.472934874 1920 Mcu ENSMUSG00000009647 -0.47390754 1921 Zfp46 ENSMUSG00000051351 -0.474136595 1922 Mylk3 ENSMUSG00000031698 -0.47469853 1923 Hexim1 ENSMUSG00000048878 -0.474915967 1924 Reep5 ENSMUSG00000005873 -0.475325833 1925 Phldb2 ENSMUSG00000033149 -0.475769131 1926 Tor1aip1 ENSMUSG00000026466 -0.475785048 1927 Gm14539 ENSMUSG00000084830 -0.476505704 1928 Npr2 ENSMUSG00000028469 -0.476959568 1929 Ndufa13 ENSMUSG00000036199 -0.477006508 1930 Tnni3k ENSMUSG00000040086 -0.47721625 1931 Meox2 ENSMUSG00000036144 -0.477585602 1932 Sptb ENSMUSG00000021061 -0.477789659 1933 Dgke ENSMUSG00000000276 -0.477813778 1934 Mhrt ENSMUSG00000097652 -0.478564073 1935 Timp3 ENSMUSG00000020044 -0.479300268 1936 Clip1 ENSMUSG00000049550 -0.479458231 1937 Cry2 ENSMUSG00000068742 -0.479977792 1938 Tmed4 ENSMUSG00000004394 -0.480344669 1939 Taf9b ENSMUSG00000047242 -0.480447869 1940 Bbs2 ENSMUSG00000031755 -0.480648668 1941 Dnajc30 ENSMUSG00000061118 -0.482118886 1942 Sqor ENSMUSG00000005803 -0.48252714 1943 Got2 ENSMUSG00000031672 -0.482837514 1944 Pcmtd2 ENSMUSG00000027589 -0.483453963 1945 Ipo13 ENSMUSG00000033365 -0.483853739 1946 Msh3 ENSMUSG00000014850 -0.484420729 1947 Lama5 ENSMUSG00000015647 -0.484493385 1948 Mtg1 ENSMUSG00000039018 -0.484557299 1949 Smim20 ENSMUSG00000061461 -0.48501137 1950 Slc4a3 ENSMUSG00000006576 -0.48533774 1951 Dtx3 ENSMUSG00000040415 -0.485346335 1952 BC002163 ENSMUSG00000081824 -0.48553041 1953 Myl2 ENSMUSG00000013936 -0.485587731 1954 Coq10a ENSMUSG00000039914 -0.485795885 1955 Cipc ENSMUSG00000034157 -0.485832112 1956 Usmg5 ENSMUSG00000071528 -0.485849192 1957 Lpgat1 ENSMUSG00000026623 -0.485877902 1958 Fabp5 ENSMUSG00000027533 -0.486619568 1959 Bcl2l13 ENSMUSG00000009112 -0.487594302 1960 Jcad ENSMUSG00000033960 -0.487967018 1961 Dsp ENSMUSG00000054889 -0.488635126 1962 Rsad1 ENSMUSG00000039096 -0.490113874 1963 Ptprs ENSMUSG00000013236 -0.491214759 1964 Tmem60 ENSMUSG00000045435 -0.491417203 1965 Dhrs1 ENSMUSG00000002332 -0.491445875 1966 Pex6 ENSMUSG00000002763 -0.492441239 1967 Uros ENSMUSG00000030979 -0.493265423 1968 Plekha6 ENSMUSG00000041757 -0.493672018 1969 Coq7 ENSMUSG00000030652 -0.493836532 1970 Fahd1 ENSMUSG00000045316 -0.493997542 1971 Ldb3 ENSMUSG00000021798 -0.494007521 1972 Mrps21 ENSMUSG00000054312 -0.494314602 1973 Ndufa9 ENSMUSG00000000399 -0.494557785 1974 Ndufa5 ENSMUSG00000023089 -0.494981118 1975 Fmo1 ENSMUSG00000040181 -0.495617612 1976 Msh2 ENSMUSG00000024151 -0.495685067 1977 A630072M18Rik ENSMUSG00000101013 -0.495706507 1978 Uqcrc2 ENSMUSG00000030884 -0.496340757 1979 4930578C19Rik ENSMUSG00000037358 -0.496965055 1980 Gm10250 ENSMUSG00000068706 -0.497151867 1981 Slc25a12 ENSMUSG00000027010 -0.49772638 1982 Yae1d1 ENSMUSG00000075054 -0.497888164 1983 Itpkb ENSMUSG00000038855 -0.498209082 1984 Ndufb4 ENSMUSG00000022820 -0.498355141 1985 Hsd17b10 ENSMUSG00000025260 -0.498427365 1986 Pter ENSMUSG00000026730 -0.498531238 1987 Sgk1 ENSMUSG00000019970 -0.49854871 1988 Spry1 ENSMUSG00000037211 -0.498721526 1989 Rgs3 ENSMUSG00000059810 -0.498745317 1990 Trip10 ENSMUSG00000019487 -0.499011963 1991 Stap2 ENSMUSG00000038781 -0.499049928 1992 Scp2 ENSMUSG00000028603 -0.499407896 1993 Asb8 ENSMUSG00000048175 -0.499712609 1994 Mavs ENSMUSG00000037523 -0.499742633 1995 Taz ENSMUSG00000009995 -0.500141313 1996 Tmem141 ENSMUSG00000026939 -0.500241169 1997 Ndufb8 ENSMUSG00000025204 -0.501315562 1998 Oma1 ENSMUSG00000035069 -0.501666246 1999 Lrpprc ENSMUSG00000024120 -0.502034908 2000 Prrg1 ENSMUSG00000047996 -0.502152213 2001 Eef1a2 ENSMUSG00000016349 -0.502163664 2002 Mapk14 ENSMUSG00000053436 -0.50273589 2003 Synpo2 ENSMUSG00000050315 -0.503117568 2004 Gm24336 ENSMUSG00000077391 -0.503120293 2005 mt-Nd5 ENSMUSG00000064367 -0.503480609 2006 Araf ENSMUSG00000001127 -0.503613737 2007 Rarb ENSMUSG00000017491 -0.504450356 2008 Atp5g3 ENSMUSG00000018770 -0.504692715 2009 Agl ENSMUSG00000033400 -0.505072435 2010 Ctsh ENSMUSG00000032359 -0.505149262 2011 Aamdc ENSMUSG00000035642 -0.505593643 2012 Abcb8 ENSMUSG00000028973 -0.506077791 2013 Agpat2 ENSMUSG00000026922 -0.506377875 2014 Il17rd ENSMUSG00000040717 -0.506428322 2015 Tnni3 ENSMUSG00000035458 -0.506799461 2016 Sdhc ENSMUSG00000058076 -0.507034424 2017 Ndrg2 ENSMUSG00000004558 -0.508516892 2018 Zfp189 ENSMUSG00000039634 -0.508517962 2019 Dguok ENSMUSG00000014554 -0.508771379 2020 Sucla2 ENSMUSG00000022110 -0.50884998 2021 Ndufs6 ENSMUSG00000021606 -0.509185461 2022 Ccser2 ENSMUSG00000058690 -0.510071947 2023 Nub1 ENSMUSG00000028954 -0.510809042 2024 Tpra1 ENSMUSG00000002871 -0.511350163 2025 Pigp ENSMUSG00000022940 -0.511460763 2026 Myo18b ENSMUSG00000072720 -0.511561045 2027 Mpc2 ENSMUSG00000026568 -0.512019154 2028 Cd59a ENSMUSG00000032679 -0.51205851 2029 Rnf150 ENSMUSG00000047747 -0.512159164 2030 Dlst ENSMUSG00000004789 -0.512538436 2031 Wdr41 ENSMUSG00000042015 -0.513011152 2032 Shroom2 ENSMUSG00000045180 -0.513029325 2033 Dlat ENSMUSG00000000168 -0.513160027 2034 Ddrgk1 ENSMUSG00000068290 -0.513170347 2035 Pde4dip ENSMUSG00000038170 -0.513244328 2036 Itpripl1 ENSMUSG00000074825 -0.51328966 2037 Numa1 ENSMUSG00000066306 -0.513641914 2038 Serac1 ENSMUSG00000015659 -0.514078979 2039 Lzts2 ENSMUSG00000035342 -0.514129781 2040 Atp5sl ENSMUSG00000057229 -0.51500631 2041 Tmem164 ENSMUSG00000047045 -0.515103515 2042 Enpp5 ENSMUSG00000023960 -0.515297892 2043 Stx3 ENSMUSG00000041488 -0.515417429 2044 Oxa1l ENSMUSG00000000959 -0.515418591 2045 Ppt1 ENSMUSG00000028657 -0.515568171 2046 Rapgef5 ENSMUSG00000041992 -0.515703306 2047 Oxnad1 ENSMUSG00000021906 -0.515790707 2048 Kank3 ENSMUSG00000042099 -0.515830382 2049 Cdkl1 ENSMUSG00000020990 -0.51616523 2050 Mri1 ENSMUSG00000004996 -0.516393709 2051 Smim19 ENSMUSG00000031534 -0.518245643 2052 Mrpl28 ENSMUSG00000024181 -0.518409728 2053 Pdpr ENSMUSG00000033624 -0.518507964 2054 Osbpl1a ENSMUSG00000044252 -0.518958127 2055 Pcp4l1 ENSMUSG00000038370 -0.519000315 2056 Tpi1 ENSMUSG00000023456 -0.519242934 2057 Atp5s ENSMUSG00000054894 -0.5194767 2058 Mpc1-ps ENSMUSG00000091498 -0.519612732 2059 Rcsd1 ENSMUSG00000040723 -0.519665016 2060 Sema3g ENSMUSG00000021904 -0.519781263 2061 B4gat1 ENSMUSG00000047379 -0.520238344 2062 Rgs5 ENSMUSG00000026678 -0.520650108 2063 Apip ENSMUSG00000010911 -0.521321785 2064 Nsun4 ENSMUSG00000028706 -0.52210889 2065 Gadd45gip1 ENSMUSG00000033751 -0.522153683 2066 Dnajc19 ENSMUSG00000027679 -0.522242961 2067 Fundc2 ENSMUSG00000031198 -0.522678557 2068 Flt1 ENSMUSG00000029648 -0.522794395 2069 Sparcl1 ENSMUSG00000029309 -0.523157839 2070 Plscr4 ENSMUSG00000032377 -0.523405332 2071 Prrx1 ENSMUSG00000026586 -0.52369073 2072 Gm43185 ENSMUSG00000104621 -0.523832049 2073 Nicn1 ENSMUSG00000032606 -0.523892882 2074 Gab1 ENSMUSG00000031714 -0.524940392 2075 Erg ENSMUSG00000040732 -0.525724942 2076 Rasgrf2 ENSMUSG00000021708 -0.526410438 2077 Cobll1 ENSMUSG00000034903 -0.527084863 2078 Gm25395 ENSMUSG00000087968 -0.527095161 2079 Coa7 ENSMUSG00000048351 -0.527731415 2080 Ablim3 ENSMUSG00000032735 -0.527969009 2081 Klhl24 ENSMUSG00000062901 -0.527988182 2082 Plekhg5 ENSMUSG00000039713 -0.528518378 2083 Aven ENSMUSG00000003604 -0.52890111 2084 Uqcrfs1 ENSMUSG00000038462 -0.528921791 2085 Myadml2 ENSMUSG00000025141 -0.52926663 2086 Abl1 ENSMUSG00000026842 -0.529968934 2087 Srpk2 ENSMUSG00000062604 -0.529979216 2088 Ebf3 ENSMUSG00000010476 -0.530034174 2089 Eif2b4 ENSMUSG00000029145 -0.530988001 2090 Smpd1 ENSMUSG00000037049 -0.531888914 2091 Txnrd2 ENSMUSG00000075704 -0.532002696 2092 Neurl2 ENSMUSG00000039873 -0.532450604 2093 Spr ENSMUSG00000033735 -0.532878999 2094 Rapgef2 ENSMUSG00000062232 -0.53305432 2095 Reep1 ENSMUSG00000052852 -0.533747583 2096 Repin1 ENSMUSG00000052751 -0.533887403 2097 Clstn1 ENSMUSG00000039953 -0.534208261 2098 Stat5b ENSMUSG00000020919 -0.534617192 2099 Ppp1r13b ENSMUSG00000021285 -0.534709741 2100 Gnb5 ENSMUSG00000032192 -0.534892236 2101 Osbpl6 ENSMUSG00000042359 -0.534894054 2102 Bphl ENSMUSG00000038286 -0.535000413 2103 Ppfibp2 ENSMUSG00000036528 -0.53649997 2104 Grsf1 ENSMUSG00000044221 -0.537682027 2105 Galt ENSMUSG00000036073 -0.537758313 2106 Egfl7 ENSMUSG00000026921 -0.538029436 2107 Pik3r1 ENSMUSG00000041417 -0.538126723 2108 Lamtor4 ENSMUSG00000050552 -0.53834156 2109 Cdc14b ENSMUSG00000033102 -0.538914089 2110 Eif4e ENSMUSG00000028156 -0.539936784 2111 Cox14 ENSMUSG00000023020 -0.540267833 2112 Casq2 ENSMUSG00000027861 -0.540519494 2113 Tmed1 ENSMUSG00000032180 -0.540610932 2114 Rorc ENSMUSG00000028150 -0.540749298 2115 Ctso ENSMUSG00000028015 -0.541390369 2116 Fcgrt ENSMUSG00000003420 -0.541687569 2117 9030617O03Rik ENSMUSG00000021185 -0.541748808 2118 Ccdc88c ENSMUSG00000021182 -0.541849452 2119 Fech ENSMUSG00000024588 -0.54234129 2120 Btbd1 ENSMUSG00000025103 -0.54238738 2121 Naa38 ENSMUSG00000059278 -0.542578839 2122 Hspa12b ENSMUSG00000074793 -0.54258742 2123 Pde1c ENSMUSG00000004347 -0.542927201 2124 Idh3b ENSMUSG00000027406 -0.543102202 2125 Uqcc3 ENSMUSG00000071654 -0.543214407 2126 Ogdh ENSMUSG00000020456 -0.543340957 2127 Rbm20 ENSMUSG00000043639 -0.543644368 2128 Clpp ENSMUSG00000002660 -0.544902501 2129 Haghl ENSMUSG00000061046 -0.545113455 2130 Smoc2 ENSMUSG00000023886 -0.545236467 2131 Gid8 ENSMUSG00000027573 -0.545310605 2132 Mal ENSMUSG00000027375 -0.545362434 2133 Rcbtb2 ENSMUSG00000022106 -0.54540507 2134 Ndufb10 ENSMUSG00000040048 -0.545519229 2135 Mcts2 ENSMUSG00000042814 -0.545826839 2136 Mmab ENSMUSG00000029575 -0.545909525 2137 Stat5a ENSMUSG00000004043 -0.546141328 2138 Ndufb3 ENSMUSG00000026032 -0.547102483 2139 Gnpat ENSMUSG00000031985 -0.54808785 2140 Fam117b ENSMUSG00000041040 -0.548411002 2141 Thtpa ENSMUSG00000045691 -0.54986356 2142 Prepl ENSMUSG00000024127 -0.550011687 2143 1600014C10Rik ENSMUSG00000054676 -0.550415455 2144 Trib2 ENSMUSG00000020601 -0.550737716 2145 Angptl2 ENSMUSG00000004105 -0.550816393 2146 Tmem126a ENSMUSG00000030615 -0.551399718 2147 Appl2 ENSMUSG00000020263 -0.551485075 2148 Foxred1 ENSMUSG00000039048 -0.551843845 2149 Ogfod3 ENSMUSG00000025169 -0.551923838 2150 Sgo2a ENSMUSG00000026039 -0.552513527 2151 Mapk12 ENSMUSG00000022610 -0.554062557 2152 Pde4d ENSMUSG00000021699 -0.554099419 2153 Nt5dc2 ENSMUSG00000071547 -0.554394438 2154 Zfp383 ENSMUSG00000099689 -0.554564778 2155 Hibadh ENSMUSG00000029776 -0.555443412 2156 Rsrp1 ENSMUSG00000037266 -0.555764673 2157 Per2 ENSMUSG00000055866 -0.555989009 2158 Erbb3 ENSMUSG00000018166 -0.556119327 2159 Fam210a ENSMUSG00000038121 -0.557004182 2160 Bckdk ENSMUSG00000030802 -0.55719579 2161 Apex2 ENSMUSG00000025269 -0.557329763 2162 Tmem204 ENSMUSG00000024168 -0.558046951 2163 Pde7a ENSMUSG00000069094 -0.558104739 2164 Hmgb3 ENSMUSG00000015217 -0.558279602 2165 Obsl1 ENSMUSG00000026211 -0.558335378 2166 Mcrip2 ENSMUSG00000025732 -0.55983515 2167 Map4k2 ENSMUSG00000024948 -0.560285933 2168 3110002H16Rik ENSMUSG00000024410 -0.560602784 2169 Abraxas1 ENSMUSG00000035234 -0.56062947 2170 Prps2 ENSMUSG00000025742 -0.561116802 2171 Ramp2 ENSMUSG00000001240 -0.561222965 2172 Tmcc3 ENSMUSG00000020023 -0.561740632 2173 Slc5a6 ENSMUSG00000006641 -0.561791351 2174 Uqcrc1 ENSMUSG00000025651 -0.561881474 2175 Rhbdl3 ENSMUSG00000017692 -0.56280333 2176 Exoc6 ENSMUSG00000053799 -0.56291617 2177 Crybg1 ENSMUSG00000019866 -0.563655961 2178 Klf15 ENSMUSG00000030087 -0.56372324 2179 Pmvk ENSMUSG00000027952 -0.563989817 2180 Isca2 ENSMUSG00000021241 -0.564015297 2181 Eci2 ENSMUSG00000021417 -0.564589924 2182 Gm28661 ENSMUSG00000102070 -0.565481503 2183 Cavin2 ENSMUSG00000045954 -0.566371611 2184 Tspan13 ENSMUSG00000020577 -0.566547921 2185 Scrn3 ENSMUSG00000008226 -0.566693655 2186 Plcl2 ENSMUSG00000038910 -0.566896721 2187 St6gal1 ENSMUSG00000022885 -0.566897048 2188 Mtrf1 ENSMUSG00000022022 -0.567046144 2189 Fem1a ENSMUSG00000043683 -0.567077453 2190 Klhl7 ENSMUSG00000028986 -0.567231486 2191 Sh3glb2 ENSMUSG00000026860 -0.567374889 2192 Ppp1r9a ENSMUSG00000032827 -0.567836766 2193 Med12l ENSMUSG00000056476 -0.567943216 2194 Plcg1 ENSMUSG00000016933 -0.568154692 2195 Tfpt ENSMUSG00000006335 -0.568414535 2196 Smim5 ENSMUSG00000048442 -0.569743728 2197 Fam160a1 ENSMUSG00000051000 -0.569891918 2198 Gm12251 ENSMUSG00000084384 -0.569923703 2199 Rmdn1 ENSMUSG00000028229 -0.570146864 2200 Tmem100 ENSMUSG00000069763 -0.57030649 2201 Eif4e3 ENSMUSG00000093661 -0.570598574 2202 Crebl2 ENSMUSG00000032652 -0.571324361 2203 Myoz2 ENSMUSG00000028116 -0.571557304 2204 Sdha ENSMUSG00000021577 -0.571637663 2205 Arhgef28 ENSMUSG00000021662 -0.572618452 2206 Ralgapa2 ENSMUSG00000037110 -0.572716448 2207 Med16 ENSMUSG00000013833 -0.572768246 2208 Agap2 ENSMUSG00000025422 -0.574123746 2209 Atpaf1 ENSMUSG00000028710 -0.574359824 2210 Tmem94 ENSMUSG00000020747 -0.574475469 2211 Psap ENSMUSG00000004207 -0.575391273 2212 2510002D24Rik ENSMUSG00000071632 -0.575631521 2213 Ndufs1 ENSMUSG00000025968 -0.575750009 2214 Dcaf8 ENSMUSG00000026554 -0.575800509 2215 Adck1 ENSMUSG00000021044 -0.576037786 2216 Ndufs8 ENSMUSG00000059734 -0.576385352 2217 Hsd17b4 ENSMUSG00000024507 -0.576874791 2218 Cracr2b ENSMUSG00000048200 -0.57753154 2219 Casc4 ENSMUSG00000060227 -0.577820992 2220 Cidea ENSMUSG00000024526 -0.577898261 2221 Cuedc2 ENSMUSG00000036748 -0.577917614 2222 Dgka ENSMUSG00000025357 -0.578016322 2223 Eml2 ENSMUSG00000040811 -0.579085629 2224 Fzd4 ENSMUSG00000049791 -0.58034979 2225 Senp7 ENSMUSG00000052917 -0.580575406 2226 Zfp839 ENSMUSG00000021271 -0.580707371 2227 Cdnf ENSMUSG00000039496 -0.580774473 2228 Abca5 ENSMUSG00000018800 -0.580794466 2229 Letm1 ENSMUSG00000005299 -0.582496029 2230 Prdx5 ENSMUSG00000024953 -0.582553782 2231 Pick1 ENSMUSG00000068206 -0.583476211 2232 Daam1 ENSMUSG00000034574 -0.583523287 2233 Noa1 ENSMUSG00000036285 -0.583668444 2234 Ndufa3 ENSMUSG00000035674 -0.583810545 2235 Pdk1 ENSMUSG00000006494 -0.583994104 2236 Ttc32 ENSMUSG00000066637 -0.584212965 2237 Isoc1 ENSMUSG00000024601 -0.584740117 2238 Hmcn1 ENSMUSG00000066842 -0.584744669 2239 Asah2 ENSMUSG00000024887 -0.586012324 2240 P3h4 ENSMUSG00000006931 -0.586113055 2241 Rmdn2 ENSMUSG00000036368 -0.586367244 2242 Coq5 ENSMUSG00000041733 -0.586455553 2243 Hfe2 ENSMUSG00000038403 -0.586491918 2244 Myom1 ENSMUSG00000024049 -0.586607712 2245 Grb2 ENSMUSG00000059923 -0.586806076 2246 Tspan7 ENSMUSG00000058254 -0.587006651 2247 Pygm ENSMUSG00000032648 -0.587081629 2248 Itm2b ENSMUSG00000022108 -0.587609213 2249 Fgf16 ENSMUSG00000031230 -0.588741421 2250 Ptcd3 ENSMUSG00000063884 -0.589003643 2251 Fan1 ENSMUSG00000033458 -0.589569881 2252 Cmss1 ENSMUSG00000022748 -0.589886955 2253 Tnfaip8 ENSMUSG00000062210 -0.590070892 2254 Endog ENSMUSG00000015337 -0.59016548 2255 Lrrc10 ENSMUSG00000060187 -0.591215565 2256 Homer2 ENSMUSG00000025813 -0.591816045 2257 Ulk1 ENSMUSG00000029512 -0.592098279 2258 Ganc ENSMUSG00000062646 -0.592254547 2259 Meaf6 ENSMUSG00000028863 -0.592485427 2260 Fam173a ENSMUSG00000057411 -0.592574731 2261 Chd1l ENSMUSG00000028089 -0.593081602 2262 Ntn1 ENSMUSG00000020902 -0.593110744 2263 Atp2a3 ENSMUSG00000020788 -0.593955013 2264 Htra1 ENSMUSG00000006205 -0.593997408 2265 Cdh5 ENSMUSG00000031871 -0.594006866 2266 Def8 ENSMUSG00000001482 -0.594596081 2267 Akr7a5 ENSMUSG00000028743 -0.594801181 2268 Mylip ENSMUSG00000038175 -0.594942876 2269 Egf ENSMUSG00000028017 -0.59603806 2270 Ctsf ENSMUSG00000083282 -0.597437482 2271 Paxx ENSMUSG00000047617 -0.59802881 2272 Entpd5 ENSMUSG00000021236 -0.598319679 2273 Acyp2 ENSMUSG00000060923 -0.598495265 2274 Pstk ENSMUSG00000063179 -0.599137909 2275 Myo10 ENSMUSG00000022272 -0.599210605 2276 Pgm5 ENSMUSG00000041731 -0.599438032 2277 F3 ENSMUSG00000028128 -0.599512712 2278 Cyb5rl ENSMUSG00000028621 -0.599536517 2279 Ppfia1 ENSMUSG00000037519 -0.599879028 2280 Gm28439 ENSMUSG00000100131 -0.599879451 2281 Idua ENSMUSG00000033540 -0.600712467 2282 Gstt1 ENSMUSG00000001663 -0.600987363 2283 Tcn2 ENSMUSG00000020432 -0.601166101 2284 Mrpl34 ENSMUSG00000034880 -0.601461864 2285 Osgepl1 ENSMUSG00000026096 -0.602161945 2286 Ap4s1 ENSMUSG00000020955 -0.602362898 2287 Rnf166 ENSMUSG00000014470 -0.602610184 2288 Adamts5 ENSMUSG00000022894 -0.60265657 2289 Atp5a1 ENSMUSG00000025428 -0.602738117 2290 Tatdn3 ENSMUSG00000026632 -0.603268224 2291 Adamtsl4 ENSMUSG00000015850 -0.603337818 2292 Il15ra ENSMUSG00000023206 -0.603535482 2293 Plekhb2 ENSMUSG00000026123 -0.603670394 2294 4430402I18Rik ENSMUSG00000064202 -0.603740712 2295 Ap5s1 ENSMUSG00000068264 -0.60393339 2296 1700020I14Rik ENSMUSG00000085438 -0.604931782 2297 Tmem140 ENSMUSG00000057137 -0.605726069 2298 Bsg ENSMUSG00000023175 -0.606022379 2299 Serpinb6b ENSMUSG00000042842 -0.606956036 2300 mt-Nd4 ENSMUSG00000064363 -0.607146132 2301 Zfp366 ENSMUSG00000050919 -0.607612805 2302 Bche ENSMUSG00000027792 -0.607984338 2303 Abcc9 ENSMUSG00000030249 -0.609656213 2304 Pdlim4 ENSMUSG00000020388 -0.609723532 2305 Trpc3 ENSMUSG00000027716 -0.610083618 2306 Dcakd ENSMUSG00000020935 -0.610873386 2307 Gm5421 ENSMUSG00000097245 -0.611967223 2308 Aldh2 ENSMUSG00000029455 -0.612687306 2309 Plekhh2 ENSMUSG00000040852 -0.61281517 2310 Rab6b ENSMUSG00000032549 -0.612858467 2311 Ndufs2 ENSMUSG00000013593 -0.613461601 2312 Stom ENSMUSG00000026880 -0.613972711 2313 Atg10 ENSMUSG00000021619 -0.614399769 2314 Abtb1 ENSMUSG00000030083 -0.614970715 2315 Ccdc85a ENSMUSG00000032878 -0.615257439 2316 Fbxo31 ENSMUSG00000052934 -0.615300647 2317 0610012G03Rik ENSMUSG00000107002 -0.615565015 2318 Ptprb ENSMUSG00000020154 -0.616193965 2319 Mrpl39 ENSMUSG00000022889 -0.61628961 2320 Spry2 ENSMUSG00000022114 -0.616383611 2321 Svil ENSMUSG00000024236 -0.616632983 2322 Mid1ip1 ENSMUSG00000008035 -0.616668051 2323 S100a1 ENSMUSG00000044080 -0.617875878 2324 Pex19 ENSMUSG00000003464 -0.617916784 2325 Rassf9 ENSMUSG00000044921 -0.618119449 2326 Mpst ENSMUSG00000071711 -0.618843196 2327 Apeh ENSMUSG00000032590 -0.619613962 2328 Lifr ENSMUSG00000054263 -0.620152251 2329 She ENSMUSG00000046280 -0.62041167 2330 Alkbh7 ENSMUSG00000002661 -0.620494678 2331 Ano8 ENSMUSG00000034863 -0.621697864 2332 Spaar ENSMUSG00000028475 -0.621707606 2333 Ppm1k ENSMUSG00000037826 -0.622250599 2334 Abca1 ENSMUSG00000015243 -0.622252325 2335 Ndufaf1 ENSMUSG00000027305 -0.622352726 2336 Lims2 ENSMUSG00000024395 -0.622817177 2337 Fitm2 ENSMUSG00000048486 -0.623061042 2338 Ccnd2 ENSMUSG00000000184 -0.623132618 2339 Gramd1b ENSMUSG00000040111 -0.623378429 2340 Echdc2 ENSMUSG00000028601 -0.623697108 2341 Fgfr3 ENSMUSG00000054252 -0.623769904 2342 Nfia ENSMUSG00000028565 -0.62405673 2343 Mcf2l ENSMUSG00000031442 -0.624077836 2344 Caprin2 ENSMUSG00000030309 -0.624218285 2345 Patz1 ENSMUSG00000020453 -0.624465891 2346 Trim54 ENSMUSG00000062077 -0.624508715 2347 Ddo ENSMUSG00000063428 -0.624617482 2348 Mreg ENSMUSG00000039395 -0.624643211 2349 Cyp2j6 ENSMUSG00000052914 -0.625129429 2350 Nlrp10 ENSMUSG00000049709 -0.625685649 2351 1810011O10Rik ENSMUSG00000056313 -0.626632491 2352 Zbtb14 ENSMUSG00000049672 -0.627700018 2353 Nat6 ENSMUSG00000079334 -0.627833495 2354 D10Jhu81e ENSMUSG00000053329 -0.628350448 2355 mt-Cytb ENSMUSG00000064370 -0.628752121 2356 Aldh1a1 ENSMUSG00000053279 -0.628773356 2357 Mef2c ENSMUSG00000005583 -0.628791461 2358 Ubr2 ENSMUSG00000023977 -0.629311076 2359 Mccc2 ENSMUSG00000021646 -0.629376737 2360 Lyrm9 ENSMUSG00000072640 -0.629556868 2361 Paqr4 ENSMUSG00000023909 -0.629559624 2362 mt-Nd1 ENSMUSG00000064341 -0.630145356 2363 Epdr1 ENSMUSG00000002808 -0.630371804 2364 Klhl23 ENSMUSG00000042155 -0.630506842 2365 Ankrd9 ENSMUSG00000037904 -0.631064184 2366 Serhl ENSMUSG00000058586 -0.632630944 2367 Sik3 ENSMUSG00000034135 -0.63313064 2368 Adap2 ENSMUSG00000020709 -0.633161682 2369 Kbtbd4 ENSMUSG00000005505 -0.633572073 2370 Tmem182 ENSMUSG00000079588 -0.634084925 2371 Sept4 ENSMUSG00000020486 -0.635144146 2372 Ago4 ENSMUSG00000042500 -0.635268589 2373 Sept6 ENSMUSG00000050379 -0.636250937 2374 Usp11 ENSMUSG00000031066 -0.636641924 2375 Rmnd1 ENSMUSG00000019763 -0.637072454 2376 Clybl ENSMUSG00000025545 -0.63707277 2377 Gm38077 ENSMUSG00000104344 -0.637203272 2378 Tmem106b ENSMUSG00000029571 -0.637667576 2379 Jag2 ENSMUSG00000002799 -0.637868338 2380 Tppp ENSMUSG00000021573 -0.63801285 2381 Kif26a ENSMUSG00000021294 -0.638531653 2382 Hook1 ENSMUSG00000028572 -0.639098288 2383 Gm16793 ENSMUSG00000097357 -0.639319523 2384 Trim7 ENSMUSG00000040350 -0.639329032 2385 C1qtnf9 ENSMUSG00000071347 -0.639813758 2386 mt-Co3 ENSMUSG00000064358 -0.641376731 2387 Epb41l3 ENSMUSG00000024044 -0.642210748 2388 Rtn2 ENSMUSG00000030401 -0.642445364 2389 Rasgrp3 ENSMUSG00000071042 -0.642462539 2390 Kdr ENSMUSG00000062960 -0.642972503 2391 Gtf2i ENSMUSG00000060261 -0.643498132 2392 Lipe ENSMUSG00000003123 -0.643876897 2393 Slc12a7 ENSMUSG00000017756 -0.64447967 2394 Lynx1 ENSMUSG00000022594 -0.644516872 2395 Plcd3 ENSMUSG00000020937 -0.646104366 2396 Rarg ENSMUSG00000001288 -0.647628281 2397 Tie1 ENSMUSG00000033191 -0.648217139 2398 Nr3c2 ENSMUSG00000031618 -0.648454653 2399 Cox7a1 ENSMUSG00000074218 -0.649466383 2400 Ndufs3 ENSMUSG00000005510 -0.649718153 2401 Myct1 ENSMUSG00000046916 -0.649835555 2402 Gm31663 ENSMUSG00000108994 -0.649902664 2403 Taco1 ENSMUSG00000001983 -0.650514111 2404 Mfn1 ENSMUSG00000027668 -0.650535153 2405 Inpp5e ENSMUSG00000026925 -0.651807893 2406 Aqp1 ENSMUSG00000004655 -0.65383584 2407 Tmem135 ENSMUSG00000039428 -0.654776452 2408 Atp8a1 ENSMUSG00000037685 -0.65619606 2409 Cdkl2 ENSMUSG00000029403 -0.656212769 2410 Zfp799 ENSMUSG00000095253 -0.656354874 2411 Ipp ENSMUSG00000028696 -0.656760507 2412 Sync ENSMUSG00000001333 -0.657297551 2413 Adgrl3 ENSMUSG00000037605 -0.657299757 2414 Cdh23 ENSMUSG00000012819 -0.658134068 2415 Pank4 ENSMUSG00000029056 -0.658245758 2416 Siae ENSMUSG00000001942 -0.658763801 2417 Slc28a2 ENSMUSG00000027219 -0.659977879 2418 Amacr ENSMUSG00000022244 -0.660230382 2419 Zmym3 ENSMUSG00000031310 -0.660525683 2420 Svip ENSMUSG00000074093 -0.66063352 2421 Idh1 ENSMUSG00000025950 -0.660666564 2422 Atp5j ENSMUSG00000022890 -0.660910403 2423 Gstm1 ENSMUSG00000058135 -0.661135102 2424 Srebf1 ENSMUSG00000020538 -0.661346976 2425 Pcca ENSMUSG00000041650 -0.66137414 2426 Pex7 ENSMUSG00000020003 -0.661484054 2427 Fdft1 ENSMUSG00000021273 -0.662377568 2428 Tuba8 ENSMUSG00000030137 -0.663266428 2429 Zfp606 ENSMUSG00000030386 -0.66386637 2430 Mgme1 ENSMUSG00000027424 -0.664391236 2431 Elmod3 ENSMUSG00000056698 -0.664545769 2432 Peg13 ENSMUSG00000106847 -0.664975567 2433 Fam213b ENSMUSG00000029059 -0.665499246 2434 Acsl6 ENSMUSG00000020333 -0.665987077 2435 Zfp251 ENSMUSG00000022526 -0.666116511 2436 Eepd1 ENSMUSG00000036611 -0.66616001 2437 6820402A03Rik ENSMUSG00000103706 -0.666189114 2438 Thsd7a ENSMUSG00000032625 -0.667371186 2439 Ptcd1 ENSMUSG00000029624 -0.667993676 2440 Fgf1 ENSMUSG00000036585 -0.668086446 2441 Slc50a1 ENSMUSG00000027953 -0.668118588 2442 Hic1 ENSMUSG00000043099 -0.668568445 2443 Slc22a5 ENSMUSG00000018900 -0.669515278 2444 Dtd1 ENSMUSG00000027430 -0.66974829 2445 Rai2 ENSMUSG00000043518 -0.670077188 2446 Asb13 ENSMUSG00000033781 -0.670132981 2447 Oxct1 ENSMUSG00000022186 -0.670579592 2448 Kcnn1 ENSMUSG00000002908 -0.670870269 2449 Acox1 ENSMUSG00000020777 -0.671789499 2450 Bmf ENSMUSG00000040093 -0.674441763 2451 Nudt6 ENSMUSG00000050174 -0.675516526 2452 Sult1a1 ENSMUSG00000030711 -0.675957038 2453 Epas1 ENSMUSG00000024140 -0.676261663 2454 Hic2 ENSMUSG00000050240 -0.677667271 2455 Sec31b ENSMUSG00000051984 -0.6777256 2456 Gfra1 ENSMUSG00000025089 -0.678475203 2457 Slc25a10 ENSMUSG00000025792 -0.678907296 2458 Gm17281 ENSMUSG00000097317 -0.678984092 2459 Selenop ENSMUSG00000064373 -0.678988602 2460 Kcnn2 ENSMUSG00000054477 -0.680432324 2461 Kcnj12 ENSMUSG00000042529 -0.680890738 2462 Ppara ENSMUSG00000022383 -0.681160384 2463 Gpihbp1 ENSMUSG00000022579 -0.68161438 2464 Oplah ENSMUSG00000022562 -0.681680568 2465 Slc25a22 ENSMUSG00000019082 -0.681770585 2466 Phf24 ENSMUSG00000036062 -0.682006711 2467 Egln1 ENSMUSG00000031987 -0.682408344 2468 Aco2 ENSMUSG00000022477 -0.682804439 2469 Dusp1 ENSMUSG00000024190 -0.683248224 2470 Tnnt2 ENSMUSG00000026414 -0.683636278 2471 Ptcd2 ENSMUSG00000021650 -0.683857648 2472 Zfp970 ENSMUSG00000078866 -0.683984587 2473 Peli2 ENSMUSG00000021846 -0.684062819 2474 Gmnn ENSMUSG00000006715 -0.684189806 2475 Hs1bp3 ENSMUSG00000020605 -0.684333926 2476 8430408G22Rik ENSMUSG00000048489 -0.68433734 2477 Rilpl1 ENSMUSG00000029392 -0.685770771 2478 D2hgdh ENSMUSG00000073609 -0.685801449 2479 Ppa2 ENSMUSG00000028013 -0.686441494 2480 Klhl31 ENSMUSG00000044938 -0.687197946 2481 Cd300lg ENSMUSG00000017309 -0.687664327 2482 Gpr27 ENSMUSG00000072875 -0.68854531 2483 Prox1 ENSMUSG00000010175 -0.689321937 2484 Gm44250 ENSMUSG00000107881 -0.689499761 2485 Nmnat1 ENSMUSG00000028992 -0.689589093 2486 Jarid2 ENSMUSG00000038518 -0.690179959 2487 Ankrd29 ENSMUSG00000057766 -0.690868464 2488 Pde8b ENSMUSG00000021684 -0.690871512 2489 Tecr ENSMUSG00000031708 -0.691207984 2490 Eci1 ENSMUSG00000024132 -0.692564361 2491 Sdhaf4 ENSMUSG00000026154 -0.692825001 2492 Pcdh12 ENSMUSG00000024440 -0.693594884 2493 Maob ENSMUSG00000040147 -0.693863012 2494 Wfdc1 ENSMUSG00000023336 -0.694147029 2495 Tmem38a ENSMUSG00000031791 -0.694190603 2496 Spsb1 ENSMUSG00000039911 -0.694889534 2497 Pcyox1 ENSMUSG00000029998 -0.69499799 2498 Zswim7 ENSMUSG00000014243 -0.695351856 2499 Ushbp1 ENSMUSG00000034911 -0.695806688 2500 Rnls ENSMUSG00000071573 -0.695821433 2501 Ablim1 ENSMUSG00000025085 -0.696309985 2502 Zfp827 ENSMUSG00000071064 -0.696502693 2503 Ndufab1 ENSMUSG00000030869 -0.696551859 2504 Lrp5 ENSMUSG00000024913 -0.696833664 2505 Ttc30b ENSMUSG00000075273 -0.698535004 2506 Aldh7a1 ENSMUSG00000053644 -0.698640225 2507 Kcnj8 ENSMUSG00000030247 -0.699171701 2508 Rasl10b ENSMUSG00000020684 -0.700393113 2509 Paox ENSMUSG00000025464 -0.701810542 2510 Plin4 ENSMUSG00000002831 -0.701917575 2511 C1qtnf12 ENSMUSG00000023571 -0.703793243 2512 Tmem44 ENSMUSG00000022537 -0.704467409 2513 Gzmm ENSMUSG00000054206 -0.704623032 2514 Gm10718 ENSMUSG00000095186 -0.705433862 2515 Syt7 ENSMUSG00000024743 -0.705823927 2516 Tfdp2 ENSMUSG00000032411 -0.706039368 2517 Scn4b ENSMUSG00000046480 -0.706379455 2518 Pcdhga2 ENSMUSG00000103332 -0.707522986 2519 Gprc5c ENSMUSG00000051043 -0.707719097 2520 mt-Nd3 ENSMUSG00000064360 -0.709349661 2521 Echs1 ENSMUSG00000025465 -0.709980846 2522 Cirbp ENSMUSG00000045193 -0.71033307 2523 Zadh2 ENSMUSG00000049090 -0.710512304 2524 Gstm2 ENSMUSG00000040562 -0.710708992 2525 Efcab2 ENSMUSG00000026495 -0.712042064 2526 Camk2n1 ENSMUSG00000046447 -0.712152072 2527 Zfp30 ENSMUSG00000047473 -0.712641271 2528 Apln ENSMUSG00000037010 -0.713655903 2529 Ppip5k2 ENSMUSG00000040648 -0.714230872 2530 C130074G19Rik ENSMUSG00000039349 -0.714306655 2531 Slc25a13 ENSMUSG00000015112 -0.714569207 2532 Fabp4 ENSMUSG00000062515 -0.714831442 2533 Gm14261 ENSMUSG00000085322 -0.714895226 2534 Rgs4 ENSMUSG00000038530 -0.715066249 2535 Crat ENSMUSG00000026853 -0.716422069 2536 Adgrf5 ENSMUSG00000056492 -0.717033467 2537 Coq3 ENSMUSG00000028247 -0.717122404 2538 Cox8b ENSMUSG00000025488 -0.717363717 2539 Scamp5 ENSMUSG00000040722 -0.718445314 2540 Alad ENSMUSG00000028393 -0.718929217 2541 Mrps34 ENSMUSG00000038880 -0.719143077 2542 Aldh5a1 ENSMUSG00000035936 -0.720139965 2543 mt-Tt ENSMUSG00000064371 -0.720428493 2544 Sgcb ENSMUSG00000029156 -0.720594515 2545 Pomgnt2 ENSMUSG00000066235 -0.720795206 2546 Btbd3 ENSMUSG00000062098 -0.720862004 2547 Acbd4 ENSMUSG00000056938 -0.720929778 2548 1010001N08Rik ENSMUSG00000097222 -0.72110946 2549 Fuz ENSMUSG00000011658 -0.72122837 2550 Suox ENSMUSG00000049858 -0.722112765 2551 Bbs10 ENSMUSG00000035759 -0.722258322 2552 Erlec1 ENSMUSG00000020311 -0.72239425 2553 Mrpl14 ENSMUSG00000023939 -0.722528921 2554 Dll4 ENSMUSG00000027314 -0.722648159 2555 Card10 ENSMUSG00000033170 -0.723010669 2556 Gm10925 ENSMUSG00000100862 -0.7230275 2557 Tmem110 ENSMUSG00000006526 -0.724584545 2558 Clasp2 ENSMUSG00000033392 -0.725169753 2559 Smarca2 ENSMUSG00000024921 -0.726387329 2560 Ptgr2 ENSMUSG00000072946 -0.726456441 2561 Mgll ENSMUSG00000033174 -0.726791001 2562 Podxl2 ENSMUSG00000033152 -0.727560053 2563 Chmp4c ENSMUSG00000027536 -0.729854121 2564 Pnpla7 ENSMUSG00000036833 -0.730157453 2565 D830050J10Rik ENSMUSG00000107994 -0.73086899 2566 Nudt16l1 ENSMUSG00000022516 -0.731272383 2567 Macrod1 ENSMUSG00000036278 -0.731557102 2568 Glt28d2 ENSMUSG00000031286 -0.732389934 2569 Pyurf ENSMUSG00000043162 -0.733408675 2570 Abat ENSMUSG00000057880 -0.73374244 2571 Rasgrp2 ENSMUSG00000032946 -0.733785494 2572 Fam78a ENSMUSG00000050592 -0.733794225 2573 Vtn ENSMUSG00000017344 -0.734844016 2574 Dok7 ENSMUSG00000044716 -0.734943827 2575 Dsg2 ENSMUSG00000044393 -0.735091546 2576 Srpk3 ENSMUSG00000002007 -0.735234808 2577 Bckdhb ENSMUSG00000032263 -0.735293564 2578 Ndufs7 ENSMUSG00000020153 -0.735962895 2579 Mrps35 ENSMUSG00000040112 -0.736204656 2580 Mcee ENSMUSG00000033429 -0.736440019 2581 Pkdrej ENSMUSG00000052496 -0.737349874 2582 Abcd3 ENSMUSG00000028127 -0.737834501 2583 Mpv17 ENSMUSG00000107283 -0.738197926 2584 Fyco1 ENSMUSG00000025241 -0.738549394 2585 Map3k5 ENSMUSG00000071369 -0.738753061 2586 Tmem143 ENSMUSG00000002781 -0.738986725 2587 Hspb3 ENSMUSG00000051456 -0.739118305 2588 Cep112 ENSMUSG00000020728 -0.73932413 2589 Myh6 ENSMUSG00000040752 -0.739876607 2590 Snrk ENSMUSG00000038145 -0.739884033 2591 mt-Atp6 ENSMUSG00000064357 -0.740257904 2592 Cnst ENSMUSG00000038949 -0.740503336 2593 Npc1 ENSMUSG00000024413 -0.741679415 2594 Crocc ENSMUSG00000040860 -0.743405824 2595 Cdk5rap1 ENSMUSG00000027487 -0.743471282 2596 Vldlr ENSMUSG00000024924 -0.743540465 2597 Trabd2b ENSMUSG00000070867 -0.744158503 2598 Cpeb3 ENSMUSG00000039652 -0.74449319 2599 Prpf19 ENSMUSG00000024735 -0.744666247 2600 Mettl7a1 ENSMUSG00000054619 -0.744932601 2601 Camk2b ENSMUSG00000057897 -0.745125641 2602 Slc9a3r2 ENSMUSG00000002504 -0.745387429 2603 Rpl3l ENSMUSG00000002500 -0.745427334 2604 Nmnat3 ENSMUSG00000032456 -0.745655725 2605 Ric8b ENSMUSG00000035620 -0.746236414 2606 Dcaf4 ENSMUSG00000021222 -0.746482309 2607 Cenpp ENSMUSG00000021391 -0.746913297 2608 Akap7 ENSMUSG00000039166 -0.747518484 2609 Slc25a11 ENSMUSG00000014606 -0.748978497 2610 Tmc7 ENSMUSG00000042246 -0.749229475 2611 0610009O20Rik ENSMUSG00000024442 -0.750003149 2612 Cd36 ENSMUSG00000002944 -0.750182522 2613 Prag1 ENSMUSG00000050271 -0.750503491 2614 Sox18 ENSMUSG00000046470 -0.751310502 2615 BC026585 ENSMUSG00000033488 -0.751508003 2616 Lppos ENSMUSG00000097867 -0.751539192 2617 Vwa7 ENSMUSG00000007030 -0.751719346 2618 Smpd2 ENSMUSG00000019822 -0.753299005 2619 Cc2d2a ENSMUSG00000039765 -0.754129807 2620 BC029722 ENSMUSG00000074649 -0.754307684 2621 Mgst3 ENSMUSG00000026688 -0.754382609 2622 Abcb4 ENSMUSG00000042476 -0.755115237 2623 Casp6 ENSMUSG00000027997 -0.755830956 2624 Smim26 ENSMUSG00000074754 -0.756716004 2625 Gm9755 ENSMUSG00000030735 -0.757322821 2626 Art3 ENSMUSG00000034842 -0.758317218 2627 Auh ENSMUSG00000021460 -0.758686888 2628 Acat1 ENSMUSG00000032047 -0.759665863 2629 Bend5 ENSMUSG00000028545 -0.759702467 2630 Eml1 ENSMUSG00000058070 -0.760603288 2631 Ivns1abp ENSMUSG00000023150 -0.760832473 2632 Angpt1 ENSMUSG00000022309 -0.760950223 2633 Zrsr1 ENSMUSG00000044068 -0.760977265 2634 Emc9 ENSMUSG00000022217 -0.761720075 2635 Gm43305 ENSMUSG00000105703 -0.762403486 2636 Klhl32 ENSMUSG00000040387 -0.763651741 2637 Ebpl ENSMUSG00000021928 -0.763956553 2638 Ak3 ENSMUSG00000024782 -0.766155859 2639 Toporsos ENSMUSG00000028407 -0.766982618 2640 Gm4459 ENSMUSG00000083626 -0.767074824 2641 Pank1 ENSMUSG00000033610 -0.768053611 2642 Sirt4 ENSMUSG00000029524 -0.768977383 2643 Galc ENSMUSG00000021003 -0.769507757 2644 Pecr ENSMUSG00000026189 -0.771947853 2645 Aqp7 ENSMUSG00000028427 -0.772127676 2646 Lyl1 ENSMUSG00000034041 -0.772349084 2647 Gm26722 ENSMUSG00000096944 -0.774085326 2648 Nim1k ENSMUSG00000095930 -0.774826347 2649 Acot13 ENSMUSG00000006717 -0.7769661 2650 Tusc5 ENSMUSG00000046275 -0.777305481 2651 Pex10 ENSMUSG00000029047 -0.778109738 2652 Smtn ENSMUSG00000020439 -0.778327266 2653 Nexn ENSMUSG00000039103 -0.779078102 2654 Papln ENSMUSG00000021223 -0.779079331 2655 Fam214a ENSMUSG00000034858 -0.779212284 2656 Rapsn ENSMUSG00000002104 -0.779222722 2657 mt-Co2 ENSMUSG00000064354 -0.780598223 2658 Abhd14b ENSMUSG00000042073 -0.781088212 2659 Higd1b ENSMUSG00000020928 -0.781877654 2660 Thbs2 ENSMUSG00000023885 -0.782058174 2661 Bmp6 ENSMUSG00000039004 -0.783248168 2662 Frmd5 ENSMUSG00000027238 -0.783529131 2663 Rph3al ENSMUSG00000020847 -0.784036647 2664 Atp6v0e2 ENSMUSG00000039347 -0.784164147 2665 Sirt5 ENSMUSG00000054021 -0.784197866 2666 Rdm1 ENSMUSG00000010362 -0.786074333 2667 Mrgprh ENSMUSG00000059408 -0.786172689 2668 Acsf3 ENSMUSG00000015016 -0.786485066 2669 Pitpnc1 ENSMUSG00000040430 -0.786572263 2670 Accs ENSMUSG00000040272 -0.786864465 2671 Colgalt2 ENSMUSG00000032649 -0.787138541 2672 Rab3d ENSMUSG00000019066 -0.787763935 2673 Zfp810 ENSMUSG00000066829 -0.789687721 2674 Hey1 ENSMUSG00000040289 -0.789793461 2675 Gaa ENSMUSG00000025579 -0.790272838 2676 Pcbd2 ENSMUSG00000021496 -0.790535796 2677 Myl3 ENSMUSG00000059741 -0.790557316 2678 Gpr22 ENSMUSG00000044067 -0.792684389 2679 Eid2b ENSMUSG00000070705 -0.792885269 2680 Sirt3 ENSMUSG00000025486 -0.79503448 2681 Ddt ENSMUSG00000001666 -0.79557787 2682 Gpr155 ENSMUSG00000041762 -0.796807259 2683 Sbk1 ENSMUSG00000042978 -0.798013751 2684 Fkbp4 ENSMUSG00000030357 -0.798484943 2685 Hdac9 ENSMUSG00000004698 -0.799487498 2686 Pnpla2 ENSMUSG00000025509 -0.801503481 2687 Rapgef4 ENSMUSG00000049044 -0.801816016 2688 Mxi1 ENSMUSG00000025025 -0.801926641 2689 Aldh9a1 ENSMUSG00000026687 -0.802127631 2690 Klhdc8a ENSMUSG00000042115 -0.802567579 2691 Tcp11l2 ENSMUSG00000020034 -0.802610081 2692 Ndufa4l2 ENSMUSG00000040280 -0.802746486 2693 Nit2 ENSMUSG00000022751 -0.803530229 2694 Sox7 ENSMUSG00000063060 -0.80473381 2695 Arrdc2 ENSMUSG00000002910 -0.805654879 2696 Abcb1a ENSMUSG00000040584 -0.805927726 2697 Gpd1 ENSMUSG00000023019 -0.805964347 2698 Actc1 ENSMUSG00000068614 -0.806328421 2699 Gpam ENSMUSG00000024978 -0.806391322 2700 Smarcd1 ENSMUSG00000023018 -0.806595261 2701 Pcyt2 ENSMUSG00000025137 -0.806699774 2702 Pla2g4e ENSMUSG00000050211 -0.807634698 2703 Slc2a12 ENSMUSG00000037490 -0.807807441 2704 Rbm38 ENSMUSG00000027510 -0.80785213 2705 Lrrc24 ENSMUSG00000033707 -0.808542049 2706 Esrrg ENSMUSG00000026610 -0.808884554 2707 Dbt ENSMUSG00000000340 -0.810246503 2708 Dhrs7c ENSMUSG00000033044 -0.810946823 2709 Cbx7 ENSMUSG00000053411 -0.811664032 2710 Adhfe1 ENSMUSG00000025911 -0.811684459 2711 Hcn2 ENSMUSG00000020331 -0.812255728 2712 Tnnc1 ENSMUSG00000091898 -0.812425737 2713 Tril ENSMUSG00000043496 -0.81326399 2714 Anks1 ENSMUSG00000024219 -0.813784277 2715 mt-Nd2 ENSMUSG00000064345 -0.813827546 2716 Mybpc3 ENSMUSG00000002100 -0.813980241 2717 Iqcc ENSMUSG00000040795 -0.814297055 2718 D3Ertd751e ENSMUSG00000025766 -0.814693226 2719 Etfrf1 ENSMUSG00000040370 -0.815309925 2720 Snhg14 ENSMUSG00000100826 -0.815703021 2721 Tufm ENSMUSG00000073838 -0.816183515 2722 Scarna17 ENSMUSG00000088689 -0.817632297 2723 Yipf7 ENSMUSG00000029158 -0.818532027 2724 Ehhadh ENSMUSG00000022853 -0.818900418 2725 Mccc1 ENSMUSG00000027709 -0.819068716 2726 Me3 ENSMUSG00000030621 -0.819125088 2727 BB218582 ENSMUSG00000085218 -0.819953002 2728 Nr1d2 ENSMUSG00000021775 -0.821140955 2729 Thnsl2 ENSMUSG00000054474 -0.821497746 2730 Anapc13 ENSMUSG00000035048 -0.821614294 2731 Vwa3a ENSMUSG00000030889 -0.822289545 2732 Gpr160 ENSMUSG00000037661 -0.822349811 2733 Tmem150a ENSMUSG00000055912 -0.82371951 2734 Cdc42bpg ENSMUSG00000024769 -0.823879398 2735 Kbtbd3 ENSMUSG00000025893 -0.82396994 2736 Gstp-ps ENSMUSG00000103653 -0.82464889 2737 Celsr2 ENSMUSG00000068740 -0.825309075 2738 Fndc5 ENSMUSG00000001334 -0.825589261 2739 Klhl3 ENSMUSG00000014164 -0.827093792 2740 Tst ENSMUSG00000044986 -0.82730391 2741 Gm13479 ENSMUSG00000085591 -0.82744395 2742 Gm13910 ENSMUSG00000063684 -0.82746306 2743 Rhot2 ENSMUSG00000025733 -0.827671361 2744 Acad10 ENSMUSG00000029456 -0.82818379 2745 Gm10602 ENSMUSG00000073985 -0.828270475 2746 Ttc7 ENSMUSG00000036918 -0.828897734 2747 Prr33 ENSMUSG00000043795 -0.829301308 2748 Gm6652 ENSMUSG00000099858 -0.830246173 2749 Prickle3 ENSMUSG00000031145 -0.83071083 2750 Adra1a ENSMUSG00000045875 -0.831774568 2751 Acyp1 ENSMUSG00000008822 -0.832521689 2752 2310061I04Rik ENSMUSG00000050705 -0.833151162 2753 Trmt5 ENSMUSG00000034442 -0.833888524 2754 Ifngr2 ENSMUSG00000022965 -0.834340193 2755 Tha1 ENSMUSG00000017713 -0.83437621 2756 Abca6 ENSMUSG00000044749 -0.834427931 2757 Pik3ip1 ENSMUSG00000034614 -0.837890987 2758 Plxnb1 ENSMUSG00000053646 -0.838896607 2759 Ank1 ENSMUSG00000031543 -0.838927183 2760 Slc26a10 ENSMUSG00000040441 -0.841428669 2761 Car14 ENSMUSG00000038526 -0.84270873 2762 Asb2 ENSMUSG00000021200 -0.843163445 2763 Hrc ENSMUSG00000038239 -0.84317812 2764 Ighg2c ENSMUSG00000076612 -0.843523497 2765 Cadm4 ENSMUSG00000054793 -0.844054594 2766 Grb14 ENSMUSG00000026888 -0.845131643 2767 Igsf1 ENSMUSG00000031111 -0.847008554 2768 Ednra ENSMUSG00000031616 -0.847527316 2769 Dpep1 ENSMUSG00000019278 -0.848259822 2770 Cbr1 ENSMUSG00000051483 -0.848641508 2771 C1qtnf2 ENSMUSG00000046491 -0.848993175 2772 Zfand1 ENSMUSG00000039795 -0.849621801 2773 Nipsnap2 ENSMUSG00000029432 -0.850592243 2774 Fgf13 ENSMUSG00000031137 -0.852006682 2775 Gdpd1 ENSMUSG00000061666 -0.852430106 2776 Lmod3 ENSMUSG00000044086 -0.853231516 2777 Rtn4ip1 ENSMUSG00000019864 -0.853236041 2778 Cyp2d22 ENSMUSG00000061740 -0.853430381 2779 Sord ENSMUSG00000027227 -0.853819145 2780 Hemk1 ENSMUSG00000032579 -0.85500593 2781 Asb11 ENSMUSG00000031382 -0.85598189 2782 Sdr39u1 ENSMUSG00000022223 -0.858542837 2783 Epm2a ENSMUSG00000055493 -0.858822742 2784 Mettl26 ENSMUSG00000025731 -0.859351403 2785 Nlrx1 ENSMUSG00000032109 -0.859781875 2786 C230035I16Rik ENSMUSG00000085024 -0.860477821 2787 Tstd3 ENSMUSG00000028251 -0.863467016 2788 Acads ENSMUSG00000029545 -0.86371654 2789 Gm23119 ENSMUSG00000089235 -0.864298007 2790 Hadhb ENSMUSG00000059447 -0.866526662 2791 Khk ENSMUSG00000029162 -0.866706147 2792 Slc36a2 ENSMUSG00000020264 -0.867425477 2793 Smad9 ENSMUSG00000027796 -0.868440949 2794 Mrpl49 ENSMUSG00000007338 -0.87036318 2795 Hrasls ENSMUSG00000022525 -0.870946666 2796 Hspa12a ENSMUSG00000025092 -0.872139853 2797 Ttc21b ENSMUSG00000034848 -0.872494533 2798 Dusp7 ENSMUSG00000053716 -0.873463094 2799 Pfkfb2 ENSMUSG00000026409 -0.87394991 2800 Sh3rf2 ENSMUSG00000057719 -0.874447577 2801 Etl4 ENSMUSG00000036617 -0.874576246 2802 Fbxo21 ENSMUSG00000032898 -0.875205056 2803 Hdhd5 ENSMUSG00000058979 -0.875542455 2804 Pcsk6 ENSMUSG00000030513 -0.87580471 2805 Usp2 ENSMUSG00000032010 -0.876552288 2806 Asb15 ENSMUSG00000029685 -0.876727824 2807 mt-Nd4l ENSMUSG00000065947 -0.877120689 2808 Gm38393 ENSMUSG00000000948 -0.87730952 2809 Gm10800 ENSMUSG00000075014 -0.877731619 2810 Kcnip2 ENSMUSG00000025221 -0.877865721 2811 Tango2 ENSMUSG00000013539 -0.878500417 2812 Asb5 ENSMUSG00000031519 -0.879472511 2813 Myo5c ENSMUSG00000033590 -0.880184446 2814 Ankrd24 ENSMUSG00000054708 -0.880483077 2815 Phyh ENSMUSG00000026664 -0.881156947 2816 Prickle1 ENSMUSG00000036158 -0.881386132 2817 Ak1 ENSMUSG00000026817 -0.882281303 2818 Igfbp6 ENSMUSG00000023046 -0.884497076 2819 Grhpr ENSMUSG00000035637 -0.887265881 2820 Mmp15 ENSMUSG00000031790 -0.887919234 2821 Rhobtb2 ENSMUSG00000022075 -0.888230243 2822 Txlnb ENSMUSG00000039891 -0.88964442 2823 Timp4 ENSMUSG00000030317 -0.890229159 2824 Hopx ENSMUSG00000059325 -0.892712081 2825 Ppif ENSMUSG00000021868 -0.892765578 2826 Setd6 ENSMUSG00000031671 -0.892962604 2827 Cdk18 ENSMUSG00000026437 -0.893020603 2828 Per3 ENSMUSG00000028957 -0.895496834 2829 4921531C22Rik ENSMUSG00000085704 -0.896194187 2830 Mfap3l ENSMUSG00000031647 -0.896692221 2831 Scrn2 ENSMUSG00000020877 -0.897492124 2832 Acadm ENSMUSG00000062908 -0.897791284 2833 Lrrc2 ENSMUSG00000032495 -0.901393006 2834 Bcl7a ENSMUSG00000029438 -0.901748448 2835 Lurap1l ENSMUSG00000048706 -0.902321076 2836 Cpt1a ENSMUSG00000024900 -0.902417988 2837 Coq9 ENSMUSG00000031782 -0.903588172 2838 Gal3st3 ENSMUSG00000047658 -0.904559582 2839 Lrrc39 ENSMUSG00000027961 -0.904675463 2840 Gm44220 ENSMUSG00000107655 -0.907405613 2841 Gpsm1 ENSMUSG00000026930 -0.908202152 2842 Lpl ENSMUSG00000015568 -0.908351401 2843 Dand5 ENSMUSG00000053226 -0.908622822 2844 Stmn2 ENSMUSG00000027500 -0.909480017 2845 Hsd17b11 ENSMUSG00000029311 -0.909819393 2846 Gm10461 ENSMUSG00000107277 -0.909824707 2847 Colec11 ENSMUSG00000036655 -0.91027753 2848 Higd2a ENSMUSG00000025868 -0.911223979 2849 Pde4c ENSMUSG00000031842 -0.911589434 2850 Nudt14 ENSMUSG00000002804 -0.911669047 2851 Inca1 ENSMUSG00000057054 -0.913738658 2852 Plet1os ENSMUSG00000101304 -0.915336161 2853 Hlf ENSMUSG00000003949 -0.915557847 2854 Slc40a1 ENSMUSG00000025993 -0.918664253 2855 Cpt1b ENSMUSG00000078937 -0.919775589 2856 Mme ENSMUSG00000027820 -0.922523877 2857 Jam2 ENSMUSG00000053062 -0.923211756 2858 Gsta4 ENSMUSG00000032348 -0.925528534 2859 Rnf144b ENSMUSG00000038068 -0.927869013 2860 Etfa ENSMUSG00000032314 -0.928447357 2861 Fam213a ENSMUSG00000021792 -0.930009747 2862 mt-Ti ENSMUSG00000064342 -0.93067733 2863 mt-Nd6 ENSMUSG00000064368 -0.931104975 2864 Gm44386 ENSMUSG00000107689 -0.931894496 2865 Lmo2 ENSMUSG00000032698 -0.932777063 2866 Sobp ENSMUSG00000038248 -0.933063875 2867 Ldhd ENSMUSG00000031958 -0.933350141 2868 Atp1b2 ENSMUSG00000041329 -0.934700712 2869 AU021092 ENSMUSG00000051669 -0.937918233 2870 Ckm ENSMUSG00000030399 -0.93816446 2871 Slc25a33 ENSMUSG00000028982 -0.9402885 2872 Fam228b ENSMUSG00000050545 -0.940775714 2873 Fam81a ENSMUSG00000032224 -0.941465985 2874 5430431A17Rik ENSMUSG00000108322 -0.941737365 2875 Il2ra ENSMUSG00000026770 -0.942288619 2876 Tarsl2 ENSMUSG00000030515 -0.943537175 2877 4632428C04Rik ENSMUSG00000097184 -0.945595775 2878 Unc119 ENSMUSG00000002058 -0.949090283 2879 Sv2a ENSMUSG00000038486 -0.950702636 2880 Acot11 ENSMUSG00000034853 -0.950965714 2881 Tmem71 ENSMUSG00000036944 -0.951169612 2882 Acadvl ENSMUSG00000018574 -0.951280633 2883 Gm33609 ENSMUSG00000104736 -0.951720598 2884 Gm40457 ENSMUSG00000108626 -0.952372978 2885 Ptpn3 ENSMUSG00000038764 -0.952770283 2886 Art5 ENSMUSG00000070424 -0.953880012 2887 Adi1 ENSMUSG00000020629 -0.954935021 2888 Adamts7 ENSMUSG00000032363 -0.956271344 2889 Slc46a1 ENSMUSG00000020829 -0.956634929 2890 Acad11 ENSMUSG00000090150 -0.957106991 2891 Nampt ENSMUSG00000020572 -0.957162533 2892 Neil2 ENSMUSG00000035121 -0.957934306 2893 4633401B06Rik ENSMUSG00000105597 -0.958711109 2894 Zfp791 ENSMUSG00000074194 -0.960926562 2895 Nqo2 ENSMUSG00000046949 -0.962732676 2896 Cyp27a1 ENSMUSG00000026170 -0.963398309 2897 Nat8l ENSMUSG00000048142 -0.964304504 2898 Sgca ENSMUSG00000001508 -0.964751244 2899 Tnip3 ENSMUSG00000044162 -0.965612186 2900 Plbd1 ENSMUSG00000030214 -0.969094937 2901 Gm45206 ENSMUSG00000108389 -0.971268422 2902 Lrp3 ENSMUSG00000001802 -0.971712724 2903 Nr0b2 ENSMUSG00000037583 -0.971731496 2904 Ttc38 ENSMUSG00000035944 -0.973692559 2905 Exoc3l4 ENSMUSG00000021280 -0.97422634 2906 Glul ENSMUSG00000026473 -0.974400932 2907 L3hypdh ENSMUSG00000019718 -0.974488828 2908 Optn ENSMUSG00000026672 -0.974648007 2909 Sh3d21 ENSMUSG00000073758 -0.976004393 2910 2310040G24Rik ENSMUSG00000101655 -0.9776137 2911 Cmbl ENSMUSG00000022235 -0.978806029 2912 Impa2 ENSMUSG00000024525 -0.979310612 2913 Akr1b10 ENSMUSG00000061758 -0.979513983 2914 Apc2 ENSMUSG00000020135 -0.979782053 2915 Slc22a3 ENSMUSG00000023828 -0.98242249 2916 Hdac11 ENSMUSG00000034245 -0.982675759 2917 Retreg1 ENSMUSG00000022270 -0.983179656 2918 2310039L15Rik ENSMUSG00000100550 -0.983477268 2919 Btnl9 ENSMUSG00000040283 -0.984495261 2920 Mitf ENSMUSG00000035158 -0.985274263 2921 Gm43288 ENSMUSG00000106220 -0.986173465 2922 Gm37691 ENSMUSG00000104348 -0.987647578 2923 Nrg2 ENSMUSG00000060275 -0.9878458 2924 Cep128 ENSMUSG00000061533 -0.988840525 2925 Scara5 ENSMUSG00000022032 -0.990524464 2926 Plin3 ENSMUSG00000024197 -0.991344724 2927 Gpr157 ENSMUSG00000047875 -0.991543849 2928 Scn4a ENSMUSG00000001027 -0.992162729 2929 Mtfp1 ENSMUSG00000004748 -0.992563111 2930 Gm20712 ENSMUSG00000093677 -0.992852849 2931 Cpxm2 ENSMUSG00000030862 -0.995825171 2932 Ankrd35 ENSMUSG00000038354 -0.995973091 2933 Whrn ENSMUSG00000039137 -0.996383244 2934 Oxld1 ENSMUSG00000039670 -0.996621904 2935 2310069G16Rik ENSMUSG00000097102 -0.996914287 2936 Gm11899 ENSMUSG00000087399 -0.99920021 2937 Acsl1 ENSMUSG00000018796 -0.999476453 2938 Gm43050 ENSMUSG00000106795 -1.00051903 2939 Osbp2 ENSMUSG00000020435 -1.001347132 2940 Cxx1c ENSMUSG00000051851 -1.003518841 2941 Fstl4 ENSMUSG00000036264 -1.004906968 2942 Tef ENSMUSG00000022389 -1.007327474 2943 Zfp133-ps ENSMUSG00000083674 -1.008262489 2944 Gm7889 ENSMUSG00000099624 -1.010052315 2945 Gm19461 ENSMUSG00000101693 -1.011725335 2946 Adam11 ENSMUSG00000020926 -1.012923867 2947 Gpcpd1 ENSMUSG00000027346 -1.012946203 2948 D630003M21Rik ENSMUSG00000037813 -1.013110658 2949 Gstt2 ENSMUSG00000033318 -1.013144454 2950 Hadha ENSMUSG00000025745 -1.013688305 2951 Cux2 ENSMUSG00000042589 -1.013722447 2952 Fmo5 ENSMUSG00000028088 -1.014078015 2953 Pm20d2 ENSMUSG00000054659 -1.014437199 2954 Gnmt ENSMUSG00000002769 -1.014646858 2955 1110034G24Rik ENSMUSG00000044991 -1.015035925 2956 Gstp1 ENSMUSG00000060803 -1.015527288 2957 Il10rb ENSMUSG00000022969 -1.015903371 2958 Vwa8 ENSMUSG00000058997 -1.019871529 2959 9330162012Rik ENSMUSG00000086448 -1.021000503 2960 Gm10435 ENSMUSG00000072902 -1.021844174 2961 Gm43389 ENSMUSG00000106665 -1.022471531 2962 Gm45203 ENSMUSG00000108494 -1.022852343 2963 Zfp934 ENSMUSG00000074865 -1.022913935 2964 Bri3 ENSMUSG00000047843 -1.023056606 2965 Gm14403 ENSMUSG00000094786 -1.025311153 2966 Gper1 ENSMUSG00000053647 -1.02689718 2967 Cdkn1c ENSMUSG00000037664 -1.027042013 2968 Fsd2 ENSMUSG00000038663 -1.028381935 2969 Acadl ENSMUSG00000026003 -1.02937998 2970 Cds1 ENSMUSG00000029330 -1.029440128 2971 Galm ENSMUSG00000035473 -1.029656305 2972 Mblac2 ENSMUSG00000051098 -1.030427392 2973 Dhdh ENSMUSG00000011382 -1.031542094 2974 Gm45012 ENSMUSG00000109052 -1.036433992 2975 Gm42568 ENSMUSG00000103703 -1.037766164 2976 Acacb ENSMUSG00000042010 -1.042600338 2977 Rasl2-9 ENSMUSG00000083649 -1.04519485 2978 Dut ENSMUSG00000027203 -1.045216758 2979 0610040J01Rik ENSMUSG00000060512 -1.046029335 2980 Gm5532 ENSMUSG00000073535 -1.046366906 2981 Fam69b ENSMUSG00000036186 -1.046657605 2982 Mif4gd ENSMUSG00000020743 -1.048510346 2983 Ggnbp1 ENSMUSG00000048731 -1.048886547 2984 Hsdl2 ENSMUSG00000028383 -1.052403212 2985 Tcf15 ENSMUSG00000068079 -1.054316753 2986 Gck ENSMUSG00000041798 -1.054429563 2987 Nudt7 ENSMUSG00000031767 -1.054560606 2988 Vamp5 ENSMUSG00000073002 -1.055082504 2989 4933431K23Rik ENSMUSG00000086451 -1.056770752 2990 Tmem266 ENSMUSG00000032313 -1.056874166 2991 Zfp612 ENSMUSG00000044676 -1.058287295 2992 Lbh ENSMUSG00000024063 -1.062575114 2993 Gm14327 ENSMUSG00000074521 -1.063729109 2994 mt-Tp ENSMUSG00000064372 -1.064094033 2995 Mlycd ENSMUSG00000074064 -1.064314435 2996 Klhl38 ENSMUSG00000022357 -1.066499302 2997 Fam229b ENSMUSG00000051736 -1.06813419 2998 Gm44949 ENSMUSG00000108655 -1.070894839 2999 Ccdc141 ENSMUSG00000044033 -1.071334785 3000 Osbpl3 ENSMUSG00000029822 -1.071369944 3001 Asrgl1 ENSMUSG00000024654 -1.071606102 3002 Kyat1 ENSMUSG00000039648 -1.072370642 3003 A530013C23Rik ENSMUSG00000006462 -1.072410593 3004 Myzap ENSMUSG00000041361 -1.073298516 3005 Nrg1 ENSMUSG00000062991 -1.07430495 3006 Ephx2 ENSMUSG00000022040 -1.076550456 3007 Gstk1 ENSMUSG00000029864 -1.077075901 3008 Naprt ENSMUSG00000022574 -1.077579958 3009 A430046D13Rik ENSMUSG00000097353 -1.07782994 3010 Sesn1 ENSMUSG00000038332 -1.078562235 3011 Gm44421 ENSMUSG00000107451 -1.079272861 3012 Amy1 ENSMUSG00000074264 -1.079929831 3013 Ano4 ENSMUSG00000035189 -1.081642566 3014 Fahd2a ENSMUSG00000027371 -1.081780336 3015 mt-Rnr2 ENSMUSG00000064339 -1.08216366 3016 Lgi1 ENSMUSG00000067242 -1.082756169 3017 Sema3b ENSMUSG00000057969 -1.083197213 3018 Tcap ENSMUSG00000007877 -1.083463945 3019 Idh2 ENSMUSG00000030541 -1.084701281 3020 mt-Tw ENSMUSG00000064346 -1.087442409 3021 Acaa2 ENSMUSG00000036880 -1.088062756 3022 Gm3646 ENSMUSG00000091937 -1.089192401 3023 Ace2 ENSMUSG00000015405 -1.089199488 3024 Hhatl ENSMUSG00000032523 -1.090321835 3025 Tesc ENSMUSG00000029359 -1.091053216 3026 Gm20186 ENSMUSG00000106874 -1.092476899 3027 3425401B19Rik ENSMUSG00000071540 -1.095134825 3028 Pln ENSMUSG00000038583 -1.095582809 3029 Hs3st5 ENSMUSG00000044499 -1.096291803 3030 Retsat ENSMUSG00000056666 -1.099116341 3031 Dhrs4 ENSMUSG00000022210 -1.102827166 3032 Dpysl4 ENSMUSG00000025478 -1.102956308 3033 Car4 ENSMUSG00000000805 -1.104007528 3034 Mb ENSMUSG00000018893 -1.105490432 3035 Selenbp1 ENSMUSG00000068874 -1.108493119 3036 Fbxo44 ENSMUSG00000029001 -1.109371327 3037 Pfkm ENSMUSG00000033065 -1.109724719 3038 Peli3 ENSMUSG00000024901 -1.110707862 3039 6430573F11Rik ENSMUSG00000039620 -1.113472696 3040 Celsr1 ENSMUSG00000016028 -1.113678402 3041 Fblim1 ENSMUSG00000006219 -1.114194993 3042 Klhdc1 ENSMUSG00000051890 -1.115614331 3043 Acss1 ENSMUSG00000027452 -1.116309317 3044 Dgat2 ENSMUSG00000030747 -1.116341081 3045 Bckdha ENSMUSG00000060376 -1.117683661 3046 Rxrg ENSMUSG00000015843 -1.118586113 3047 Myot ENSMUSG00000024471 -1.119671173 3048 Dbp ENSMUSG00000059824 -1.120104998 3049 Bcl11a ENSMUSG00000000861 -1.120801394 3050 1700123M08Rik ENSMUSG00000085614 -1.126677328 3051 Cd59b ENSMUSG00000068686 -1.127338543 3052 Slc27a1 ENSMUSG00000031808 -1.128374228 3053 Etfdh ENSMUSG00000027809 -1.129099485 3054 Itgb1bp2 ENSMUSG00000031312 -1.129564361 3055 Hnmt ENSMUSG00000026986 -1.129850214 3056 Msrb2 ENSMUSG00000023094 -1.130511119 3057 Adra2b ENSMUSG00000058620 -1.130953137 3058 Gm15543 ENSMUSG00000086863 -1.131607026 3059 Carmil3 ENSMUSG00000022211 -1.134805775 3060 Pnmal2 ENSMUSG00000070802 -1.137119937 3061 Bcl11b ENSMUSG00000048251 -1.137896146 3062 Prodh ENSMUSG00000003526 -1.139746748 3063 Atcayos ENSMUSG00000085779 -1.141887338 3064 Gm42418 ENSMUSG00000098178 -1.143004231 3065 Slc25a42 ENSMUSG00000002346 -1.143080285 3066 Gm31105 ENSMUSG00000109587 -1.143691648 3067 Lsmem1 ENSMUSG00000071342 -1.145498353 3068 Wnk2 ENSMUSG00000037989 -1.145530672 3069 Asb10 ENSMUSG00000038204 -1.145735722 3070 Ppargc1a ENSMUSG00000029167 -1.147367226 3071 Grm1 ENSMUSG00000019828 -1.148561434 3072 Map2k6 ENSMUSG00000020623 -1.148884904 3073 Gpt ENSMUSG00000022546 -1.149324244 3074 Spata33 ENSMUSG00000048478 -1.151483501 3075 Irx4 ENSMUSG00000021604 -1.151963632 3076 Gm37829 ENSMUSG00000104453 -1.153922176 3077 Art4 ENSMUSG00000030217 -1.155633092 3078 Ciart ENSMUSG00000038550 -1.156445194 3079 Acsf2 ENSMUSG00000076435 -1.159362105 3080 Tcea3 ENSMUSG00000001604 -1.160441522 3081 Grhl2 ENSMUSG00000022286 -1.161023386 3082 Art1 ENSMUSG00000030996 -1.161026363 3083 Mir133a-1hg ENSMUSG00000095438 -1.161070715 3084 Hadh ENSMUSG00000027984 -1.1647778 3085 Gpld1 ENSMUSG00000021340 -1.16508171 3086 Lmod2 ENSMUSG00000029683 -1.166283518 3087 Ripply3 ENSMUSG00000022941 -1.168470374 3088 Clcn1 ENSMUSG00000029862 -1.16859351 3089 D830039M14Rik ENSMUSG00000043126 -1.170441555 3090 Decr1 ENSMUSG00000028223 -1.170808345 3091 G0s2 ENSMUSG00000009633 -1.173743664 3092 Pex11a ENSMUSG00000030545 -1.174261513 3093 Fam131a ENSMUSG00000050821 -1.177724473 3094 Adssl1 ENSMUSG00000011148 -1.178539024 3095 Masp1 ENSMUSG00000022887 -1.181926604 3096 Ubxn10 ENSMUSG00000043621 -1.183131487 3097 Prr29 ENSMUSG00000009210 -1.183153469 3098 Fgf9 ENSMUSG00000021974 -1.183912651 3099 Perm1 ENSMUSG00000078486 -1.184081299 3100 Gpat3 ENSMUSG00000029314 -1.184513647 3101 Atp1a2 ENSMUSG00000007097 -1.18603222 3102 Txnip ENSMUSG00000038393 -1.1903996 3103 Ctf1 ENSMUSG00000042340 -1.190788769 3104 Gm5514 ENSMUSG00000045104 -1.190835358 3105 Cutc ENSMUSG00000025193 -1.191014933 3106 Dhtkd1 ENSMUSG00000025815 -1.193470072 3107 Lonrf2 ENSMUSG00000048814 -1.194049943 3108 Abhd18 ENSMUSG00000037818 -1.194127651 3109 Coro6 ENSMUSG00000020836 -1.194972633 3110 Pdzd3 ENSMUSG00000032105 -1.197816904 3111 Tbc1d10c ENSMUSG00000040247 -1.19855164 3112 Tmem150c ENSMUSG00000050640 -1.199658439 3113 Dnah7b ENSMUSG00000041144 -1.200674102 3114 Rragb ENSMUSG00000041658 -1.201058563 3115 Frem2 ENSMUSG00000037016 -1.201861415 3116 Rnf207 ENSMUSG00000058498 -1.204774423 3117 Rbp7 ENSMUSG00000028996 -1.204832761 3118 Slc7a4 ENSMUSG00000022756 -1.205300042 3119 Gm9903 ENSMUSG00000097271 -1.209571345 3120 CN725425 ENSMUSG00000078932 -1.21072226 3121 Gm14703 ENSMUSG00000087644 -1.212980197 3122 Kcnj11 ENSMUSG00000096146 -1.215461486 3123 Mterf2 ENSMUSG00000049038 -1.215741322 3124 Lrrc14b ENSMUSG00000021579 -1.217240755 3125 Kbtbd13 ENSMUSG00000054978 -1.217928373 3126 Asb14 ENSMUSG00000021898 -1.22249016 3127 1700040L02Rik ENSMUSG00000019945 -1.226527603 3128 A930018M24Rik ENSMUSG00000091089 -1.22686898 3129 Paqr7 ENSMUSG00000037348 -1.227742628 3130 Efnb3 ENSMUSG00000003934 -1.229266384 3131 Gm45163 ENSMUSG00000109419 -1.230381694 3132 Pfkfb1 ENSMUSG00000025271 -1.231363939 3133 2010107G23Rik ENSMUSG00000020083 -1.23169514 3134 Rhobtb1 ENSMUSG00000019944 -1.235028161 3135 1810034E14Rik ENSMUSG00000097101 -1.239581107 3136 mt-Ta ENSMUSG00000064347 -1.242281225 3137 Ldhb ENSMUSG00000030246 -1.248140182 3138 Gm2011 ENSMUSG00000107741 -1.249105324 3139 Pkd2l2 ENSMUSG00000014503 -1.250439434 3140 Ces1d ENSMUSG00000056973 -1.251442559 3141 Gstm6 ENSMUSG00000068762 -1.252661532 3142 Dnajc28 ENSMUSG00000039763 -1.253106073 3143 4930452B06Rik ENSMUSG00000021747 -1.254686107 3144 Gnb3 ENSMUSG00000023439 -1.255777476 3145 Cst6 ENSMUSG00000024846 -1.2561602 3146 Wipf3 ENSMUSG00000086040 -1.256386079 3147 Mir133a-2 ENSMUSG00000065460 -1.257422183 3148 Pxmp2 ENSMUSG00000029499 -1.257612863 3149 Gm10603 ENSMUSG00000099137 -1.258981936 3150 Gm8113 ENSMUSG00000089901 -1.263247821 3151 Rom1 ENSMUSG00000071648 -1.26486349 3152 Gm4956 ENSMUSG00000025936 -1.265433176 3153 Gm826 ENSMUSG00000074623 -1.265694667 3154 Gm11734 ENSMUSG00000085419 -1.266503712 3155 Lrp1b ENSMUSG00000049252 -1.266856005 3156 Gm572 ENSMUSG00000070577 -1.268319908 3157 Gm43672 ENSMUSG00000106019 -1.268807853 3158 Rbfox1 ENSMUSG00000008658 -1.269620216 3159 Gm20522 ENSMUSG00000092241 -1.272304916 3160 Kcnk2 ENSMUSG00000037624 -1.273199588 3161 BC037032 ENSMUSG00000087221 -1.282525456 3162 Ech1 ENSMUSG00000053898 -1.285960757 3163 Fabp3-ps1 ENSMUSG00000056366 -1.287005673 3164 Slc46a3 ENSMUSG00000029650 -1.288590264 3165 Glns-ps1 ENSMUSG00000082100 -1.28951477 3166 Alox12 ENSMUSG00000000320 -1.292683326 3167 Plekhh1 ENSMUSG00000060716 -1.294707791 3168 Srrm4 ENSMUSG00000063919 -1.297778461 3169 Arhgef19 ENSMUSG00000028919 -1.306615492 3170 Myom2 ENSMUSG00000031461 -1.307139947 3171 Slc25a20 ENSMUSG00000032602 -1.307349159 3172 Kcnv2 ENSMUSG00000047298 -1.307793653 3173 Sh2d4a ENSMUSG00000053886 -1.311358263 3174 Csdc2 ENSMUSG00000042109 -1.311590607 3175 Smco1 ENSMUSG00000046345 -1.331318384 3176 Fabp3 ENSMUSG00000028773 -1.335957877 3177 Ptprn ENSMUSG00000026204 -1.341673166 3178 Map3k21 ENSMUSG00000031853 -1.348702929 3179 Cacna1s ENSMUSG00000026407 -1.356885022 3180 Krt222 ENSMUSG00000035849 -1.357991658 3181 Acad12 ENSMUSG00000042647 -1.36229579 3182 Mfsd4b1 ENSMUSG00000038522 -1.362817899 3183 Ccrl2 ENSMUSG00000043953 -1.365266828 3184 Magix ENSMUSG00000031147 -1.366433446 3185 Mir208a ENSMUSG00000065432 -1.369653349 3186 Mccc1os ENSMUSG00000086392 -1.373886049 3187 Unc13a ENSMUSG00000034799 -1.376024873 3188 4930458D05Rik ENSMUSG00000087611 -1.383346548 3189 Plin5 ENSMUSG00000011305 -1.392322443 3190 Pfn4 ENSMUSG00000020639 -1.394021192 3191 Spata2l ENSMUSG00000033594 -1.401642039 3192 Plxnb3 ENSMUSG00000031385 -1.402146155 3193 Capn3 ENSMUSG00000079110 -1.402187838 3194 Ptgds ENSMUSG00000015090 -1.405537765 3195 Cmtm8 ENSMUSG00000041012 -1.405711428 3196 Gfra4 ENSMUSG00000027316 -1.408922551 3197 Nrn1 ENSMUSG00000039114 -1.417394585 3198 E330011O21Rik ENSMUSG00000109841 -1.424155483 3199 Tmem25 ENSMUSG00000002032 -1.424395886 3200 Gm34302 ENSMUSG00000103476 -1.428462909 3201 Gm10699 ENSMUSG00000074461 -1.430274418 3202 Lrrc52 ENSMUSG00000040485 -1.432298226 3203 Agbl2 ENSMUSG00000040812 -1.439180094 3204 Tmod4 ENSMUSG00000005628 -1.440979157 3205 Lrtm1 ENSMUSG00000045776 -1.452630127 3206 Lgi3 ENSMUSG00000033595 -1.456746041 3207 Foxred2 ENSMUSG00000016552 -1.457388753 3208 Gm12519 ENSMUSG00000085643 -1.459198157 3209 Nmb ENSMUSG00000025723 -1.459632991 3210 9030612E09Rik ENSMUSG00000045008 -1.462111853 3211 Ccdc189 ENSMUSG00000057176 -1.466492114 3212 Gm20619 ENSMUSG00000093482 -1.470913864 3213 P2ry1 ENSMUSG00000027765 -1.478547649 3214 Dhrs3 ENSMUSG00000066026 -1.485480146 3215 Rasd2 ENSMUSG00000034472 -1.502500427 3216 Dcaf12l1 ENSMUSG00000045284 -1.50295348 3217 Acy3 ENSMUSG00000024866 -1.505525483 3218 Paqr9 ENSMUSG00000064225 -1.507219972 3219 Kcna7 ENSMUSG00000038201 -1.51962661 3220 Ky ENSMUSG00000035606 -1.521105304 3221 Cpt2 ENSMUSG00000028607 -1.546700563 3222 Ociad2 ENSMUSG00000029153 -1.54931381 3223 Klhl33 ENSMUSG00000090799 -1.551297275 3224 P2rx6 ENSMUSG00000022758 -1.551666095 3225 Hmgcs2 ENSMUSG00000027875 -1.555810995 3226 Fah ENSMUSG00000030630 -1.557877241 3227 Tmem196 ENSMUSG00000048004 -1.557902735 3228 Cyp1a1 ENSMUSG00000032315 -1.563510036 3229 Gm5069 ENSMUSG00000055676 -1.583367073 3230 1500026H17Rik ENSMUSG00000097383 -1.595989867 3231 Poln ENSMUSG00000045102 -1.605717186 3232 Ttll1 ENSMUSG00000022442 -1.618000571 3233 Lrrc4b ENSMUSG00000047085 -1.620767358 3234 Pdp2 ENSMUSG00000048371 -1.622674208 3235 Acsm5 ENSMUSG00000030972 -1.623060194 3236 Lix1 ENSMUSG00000047786 -1.650475797 3237 Rtn4r ENSMUSG00000043811 -1.656677431 3238 Tpd52l1 ENSMUSG00000000296 -1.677962008 3239 Echdc3 ENSMUSG00000039063 -1.680348036 3240 Armc2 ENSMUSG00000071324 -1.689499242 3241 Mylk4 ENSMUSG00000044951 -1.713399449 3242 Esrrb ENSMUSG00000021255 -1.724388138 3243 Gm20594 ENSMUSG00000096887 -1.729589199 3244 Fn3k ENSMUSG00000025175 -1.770367777 3245 Pnck ENSMUSG00000002012 -1.79339723 3246 D7Ertd443e ENSMUSG00000030994 -1.794174424 3247 A530016L24Rik ENSMUSG00000043122 -1.814446005 3248 Uckl1os ENSMUSG00000010492 -1.823225698 3249 Nudt17 ENSMUSG00000028100 -1.833632626 3250 Scgb1c1 ENSMUSG00000038801 -1.866522579 3251 Scd4 ENSMUSG00000050195 -1.885374552 3252 Ripor2 ENSMUSG00000036006 -1.906096489 3253 Tmem82 ENSMUSG00000043085 -1.943550535 3254 9430062P05Rik ENSMUSG00000104263 -1.950562933 3255 Bmp7 ENSMUSG00000008999 -1.951083338 3256 Bdh1 ENSMUSG00000046598 -1.96275389 3257 Igfals ENSMUSG00000046070 -1.995145669 3258 Ogdhl ENSMUSG00000021913 -2.024478749 3259 Gm45670 ENSMUSG00000109635 -2.027657599 3260 Fbp2 ENSMUSG00000021456 -2.035397682 3261 Myh7b ENSMUSG00000074652 -2.05635109 3262 Ucp3 ENSMUSG00000032942 -2.089765907 3263 Gchfr ENSMUSG00000046814 -2.106077278 3264 Slc25a34 ENSMUSG00000040740 -2.121871686 3265 Snai3 ENSMUSG00000006587 -2.140545121 3266 B430212C06Rik ENSMUSG00000046415 -2.212029917 3267 Lars2 ENSMUSG00000035202 -2.220350519 3268 Angptl3 ENSMUSG00000028553 -2.261570039 3269 Ano5 ENSMUSG00000055489 -2.265706879 3270 Gm36670 ENSMUSG00000109696 -2.289250624 3271 Clec18a ENSMUSG00000033633 -2.41653806 3272 Cngb3 ENSMUSG00000056494 -2.495569712 3273 Aldob ENSMUSG00000028307 -2.533973922 3274 Lgals4 ENSMUSG00000053964 -2.549164923 3275 Acot1 ENSMUSG00000072949 -2.630300791 3276 Pde11a ENSMUSG00000075270 -2.650558147 3277 Slc15a2 ENSMUSG00000022899 -3.106933705 Table IV: 7-day TAC echocardiographic parameters

Con Con+Rheb ATF6 cKO ATF6 cKO+Rheb Sham Sham Sham Sham (n = 5) (n = 5) (n = 5) (n = 5) FS (%) 31.47±4.07 33.63±1.68 28.61±2.54 28.28±1.67 EF (%) 59.40±5.61 63.18±2.30 55.60±4.07 54.94±2.72 LVEDV (l) 55.61±9.30 56.30±2.97 59.41±3.99 75.90±6.83 LVESV (l) 23.61±2.83 20.84±2.03 26.91±4.19 34.54±4.42 LVIDD (mm) 3.59±0.24 3.65±0.08 3.73±0.10 4.12±0.16 LVIDS (mm) 2.48±0.27 2.42±0.10 2.67±0.16 2.96±0.15 PWTD (mm) 0.72±0.06 0.68±0.05 0.93±0.08 0.72±0.08 PWTS (mm) 1.03±0.11 1.02±0.06 1.15±0.14 0.94±0.08 AWTD (mm) 0.91±0.07 0.87±0.02 0.92±0.08 0.83±0.03 AWTS (mm) 1.21±0.05 1.16±0.08 1.21±0.08 1.12±0.05 HR (bpm) 488±18.43 516±16.48 464±33.55 504±35.34 HW (mg) 138.60±7.91 134.75±2.55 137.73±3.05 161.60±8.84 BW (g) 26.14±0.97 26.64±0.43 27.13±0.26 28.05±0.65 TL (mm) 19.00±0.37 18.50±0.26 19.67±0.26 22.00±0.37 HW/BW (mg/g) 5.29±0.13 5.07±0.15 5.08±0.13 5.75±0.21 HW/TL (mg/mm) 7.28±0.29 7.29±0.19 7.00±0.07 7.34±0.32

Con Con+Rheb ATF6 cKO ATF6 cKO+Rheb TAC TAC TAC TAC (n = 7) (n = 8) (n = 7) (n = 8) FS (%) 29.73±2.25 31.60±1.08 17.71±2.201,2 26.25±1.07 EF (%) 57.77±1.54 60.57±1.54 37.25±4.151,2 52.41±1.88 LVEDV (l) 46.54±4.61 50.55±2.03 61.26±4.532 52.73±5.771 LVESV (l) 19.71±1.81 19.92±1.08 38.91±4.661,2 25.46±3.782 LVIDD (mm) 3.36±0.15 3.49±0.061 3.77±0.122 3.53±0.161 LVIDS (mm) 2.36±0.13 2.39±0.05 3.11±0.161,2 2.61±0.151 PWTD (mm) 1.78±0.121 1.54±0.081 1.03±0.042 1.45±0.141 PWTS (mm) 1.99±0.111 1.66±0.141 1.07±0.082 1.68±0.131 AWTD (mm) 1.28±0.051 1.23±0.081 0.91±0.122 1.27±0.131 AWTS (mm) 1.49±0.091 1.61±0.061 1.28±0.132 1.62±0.131 HR (bpm) 523±9.02 519±13.29 505±13.20 514±22.54 HW (mg) 212.44±3.891 217.20±14.081 176.89±7.441,2 232.95±9.991,2 BW (g) 24.34±0.66 23.99±0.511 25.63±0.47 25.52±0.731 TL (mm) 19.60±0.40 19.00±0.31 20.86±0.32 20.17±0.44 HW/BW (mg/g) 8.75±0.241 9.10±0.691 6.90±0.271,2 9.15±0.391 HW/TL (mg/mm) 10.86±0.221 11.39±0.561 8.50±0.411,2 11.54±0.331

FS = fractional shortening EF = ejection fraction LVEDV = left ventricular end diastolic volume LVESV = left ventricular end systolic volume LVIDD = left ventricular inner diameter in diastole LVIDS = left ventricular inner diameter in systole PWTD = left ventricular posterior wall thickness in diastole PWTS = left ventricular posterior wall thickness in systole AWTD = left ventricular anterior wall thickness in diastole AWTS = left ventricular anterior wall thickness in systole HR = heart rate in beats per minute HW = heart weight BW = body weight TL = tibia length HW/BW = heart weight/body weight HW/TL = heart weight/tibia length

Statistical analyses used a one-way ANOVA with a Newman-Keuls post-hoc analysis.

1 = p 0.05 different from respective Sham 2 = p 0.05 different from Con TAC ൑

൑ Online Table IV Table V: TAC time course echocardiographic parameters for Wild-Type mice

3-Hours 2-Days 7-Days Sham TAC TAC TAC (n = 4) (n = 4) (n = 4) (n = 4) FS (%) 30.76±1.69 32.27±1.83 28.32±3.21 25.36±1.85 EF (%) 59.11±2.58 61.40±2.64 54.95±4.98 50.51±3.001 LVEDV (l) 55.18±3.16 50.76±3.82 58.16±1.60 62.66±1.321 LVESV (l) 22.82±2.74 19.94±2.60 26.38±3.44 30.87±1.671 LVIDD (mm) 3.62±0.08 3.49±0.11 3.70±0.04 3.82±0.031 LVIDS (mm) 2.51±0.11 2.37±0.13 2.65±0.14 2.85±0.061 PWTD (mm) 0.70±0.04 0.78±0.03 0.91±0.12 1.30±0.051 PWTS (mm) 1.03±0.04 1.12±0.06 1.22±0.09 1.69±0.061 AWTD (mm) 0.79±0.04 0.93±0.05 1.03±0.051 1.50±0.041 AWTS (mm) 1.10±0.04 1.22±0.06 1.25±0.04 1.78±0.051 HR (bpm) 517±11.32 503±13.78 509±11.75 517±7.18 HW (mg) 121.05±5.23 158.95±4.051 162.90±3.391 208.50±10.041 BW (g) 23.09±0.28 31.00±0.851 27.94±1.561 29.06±0.371 TL (mm) 18.50±.0.29 23.50±0.291 21.50±0.501 22.75±0.251 HW/BW (mg/g) 5.24±0.22 5.13±0.06 5.85±0.43 7.19±0.421 HW/TL (mg/mm) 6.54±0.21 6.76±0.10 7.56±0.511 9.15±0.351

FS = fractional shortening EF = ejection fraction LVEDV = left ventricular end diastolic volume LVESV = left ventricular end systolic volume LVIDD = left ventricular inner diameter in diastole LVIDS = left ventricular inner diameter in systole PWTD = left ventricular posterior wall thickness in diastole PWTS = left ventricular posterior wall thickness in systole AWTD = left ventricular anterior wall thickness in diastole AWTS = left ventricular anterior wall thickness in systole HR = heart rate in beats per minute HW = heart weight BW = body weight TL = tibia length HW/BW = heart weight/body weight HW/TL = heart weight/tibia length

Statistical analyses used a one-way ANOVA with a Newman-Keuls post-hoc analysis.

1 = p 0.05 different from Sham

൑

Online Table V Table VI: 3-hour TAC echocardiographic parameters for Con and ATF6 cKO mice

Con ATF6 cKO Con ATF6 cKO Sham Sham TAC TAC (n = 5) (n = 4) (n = 5) (n = 4) FS (%) 34.06±2.95 33.88±3.13 31.91±1.57 31.59±3.66 EF (%) 63.57±3.78 63.18±4.30 60.66±2.26 59.72±5.30 LVEDV (l) 51.52±3.83 58.55±2.44 61.47±4.92 63.15±5.20 LVESV (l) 18.28±1.23 21.79±3.28 24.33±2.86 26.21±5.31 LVIDD (mm) 3.51±0.11 3.71±0.07 3.78±0.12 3.82±0.13 LVIDS (mm) 2.30±0.06 2.46±0.15 2.57±0.12 2.63±0.23 PWTD (mm) 0.84±0.08 0.76±0.07 0.72±0.05 0.81±0.06 PWTS (mm) 0.90±0.23 1.16±0.18 1.08±0.05 1.16±0.07 AWTD (mm) 0.86±0.10 0.90±0.09 0.88±0.04 0.93±0.04 AWTS (mm) 1.77±0.16 1.24±0.08 1.21±0.04 1.22±0.04 HR (bpm) 493±19.31 517±10.09 510±10.16 512±14.34 HW (mg) 128.88±5.32 137.30±6.35 148.00±2.161 152.78±6.371 BW (g) 24.58±0.88 25.88±1.04 26.58±0.40 28.16±0.651 TL (mm) 19.40±.0.51 19.00±0.41 21.00±0.32 21.75±0.481 HW/BW (mg/g) 5.24±0.11 5.31±0.16 5.58±0.15 5.42±0.14 HW/TL (mg/mm) 6.65±0.25 7.23±0.23 7.06±0.16 7.02±0.22

FS = fractional shortening EF = ejection fraction LVEDV = left ventricular end diastolic volume LVESV = left ventricular end systolic volume LVIDD = left ventricular inner diameter in diastole LVIDS = left ventricular inner diameter in systole PWTD = left ventricular posterior wall thickness in diastole PWTS = left ventricular posterior wall thickness in systole AWTD = left ventricular anterior wall thickness in diastole AWTS = left ventricular anterior wall thickness in systole HR = heart rate in beats per minute HW = heart weight BW = body weight TL = tibia length HW/BW = heart weight/body weight HW/TL = heart weight/tibia length

Statistical analyses used a one-way ANOVA with a Newman-Keuls post-hoc analysis.

1 = p 0.05 different from respective Sham 2 = p 0.05 different from Con TAC ൑ ൑

Online Table VI