Gut Microbiome Analysis As a Tool Towards Targeted Non-Invasive

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Gut microbiota ORIGINAL ARTICLE Gut microbiome analysis as a tool towards Gut: first published as 10.1136/gutjnl-2017-315084 on 25 July 2018. Downloaded from targeted non-invasive biomarkers for early hepatocellular carcinoma Zhigang Ren,1,2,3 Ang Li,2,3,4 Jianwen Jiang,1,4,5 Lin Zhou,1,4 Zujiang Yu,2,3 Haifeng Lu,4 Haiyang Xie,1,4 Xiaolong Chen,2,3 Li Shao,4 Ruiqing Zhang,6,7 Shaoyan Xu,1 Hua Zhang,4 Guangying Cui,2,3 Xinhua Chen,1,4 Ranran Sun,2,3 Hao Wen,7 Jan P Lerut,8 Quancheng Kan,9 Lanjuan Li,4 Shusen Zheng1,4,10 ► Additional material is ABSTRact published online only. To view Objective To characterise gut microbiome in patients Significance of this study please visit the journal online with hepatocellular carcinoma (HCC) and evaluate the (http:// dx. doi. org/ 10. 1136/ What is already known on this subject? gutjnl- 2017- 315084). potential of microbiome as non-invasive biomarkers for HCC. ► Hepatocellular carcinoma (HCC) is the For numbered affiliations see third leading cause of cancer-related death end of article. Design We collected 486 faecal samples from East China, Central China and Northwest China prospectively worldwide due to the poor prognosis, high incidence and postsurgical recurrence. Correspondence to and finally 419 samples completed Miseq sequencing. Professor Shusen Zheng, We characterised gut microbiome, identified microbial ► The gut microbiota promotes HCC development Department of Hepatobiliary markers and constructed HCC classifier in 75 early HCC, by the microbiota-liver axis in HCC animal and Pancreatic Surgery, the First 40 cirrhosis and 75 healthy controls. We validated the models, but microbial characteristics in Affiliated Hospital, School of patients with HCC have not been reported. Medicine, Zhejiang University, results in 56 controls, 30 early HCC and 45 advanced The concept of the gut microbiome serving Hangzhou 310003, China; HCC. We further verified diagnosis potential in 18 HCC ► shusenzheng@ zju. edu. cn, from Xinjiang and 80 HCC from Zhengzhou. as a tool towards for achieving targeted non- Professor Lanjuan Li, State Results Faecal microbial diversity was increased invasive biomarkers for specific diseases or Key Laboratory for Diagnosis from cirrhosis to early HCC with cirrhosis. Phylum cancer, including type 2 diabetes, liver cirrhosis and Treatment of Infectious and colorectal cancer, has been established by Disease, the First Affiliated Actinobacteria was increased in early HCC versus Hospital, School of Medicine, cirrhosis. Correspondingly, 13 genera including compelling studies, but it is unclear whether http://gut.bmj.com/ Zhejiang University, Hangzhou Gemmiger and Parabacteroides were enriched in early gut microbial markers could discriminate HCC. 310003, China; ljli@ zju. edu. HCC versus cirrhosis. Butyrate-producing genera were cn and Professor Quancheng What are the new findings? Kan, Department of Pharmacy, decreased, while genera producing-lipopolysaccharide ► Faecal microbial diversity was decreased the First Affiliated Hospital were increased in early HCC versus controls. The optimal from healthy controls to cirrhosis, but it was of Zhengzhou University, 30 microbial markers were identified through a fivefold increased from cirrhosis to early HCC with Zhengzhou 450052, China; cross-validation on a random forest model and achieved cirrhosis. qckan19632012@ 163. com on October 2, 2021 by guest. Protected copyright. an area under the curve of 80.64% between 75 early ► Butyrate-producing bacterial genera ZR, AL, JJ, LZ and ZY contributed HCC and 105 non-HCC samples. Notably, gut microbial were decreased, while genera producing- equally. markers validated strong diagnosis potential for early lipopolysaccharide were increased in early HCC HCC and even advanced HCC. Importantly, microbial versus healthy controls. Received 17 August 2017 markers successfully achieved a cross-region validation of Revised 5 June 2018 ► The optimal 30 microbial markers were Accepted 7 June 2018 HCC from Northwest China and Central China. identified through a fivefold cross-validation on Conclusions This study is the first to characterise gut a random forest model and achieved an area microbiome in patients with HCC and to report the under the curve of 80.64% between 75 early successful diagnosis model establishment and cross- HCC and 105 non-HCC samples. region validation of microbial markers for HCC. Gut ► Gut microbial markers validated strong microbiota-targeted biomarkers represent potential non- diagnosis potential for early HCC and even invasive tools for early diagnosis of HCC. advanced HCC. Importantly, microbial markers successfully achieved a cross-region validation © Author(s) (or their employer(s)) 2018. Re-use of HCC from Northwest China and Central permitted under CC BY-NC. No China. commercial re-use. See rights INTRODUCTION and permissions. Published Hepatocellular carcinoma (HCC) is the third by BMJ. leading cause of cancer-related death worldwide.1 2 Currently, there are an estimated 29 200 new HCC the prevalence of hepatitis B virus (HBV) persistent To cite: Ren Z, Li A, Jiang J, et al. Gut Epub ahead of cases in males and 11 510 cases in females in the USA infection and HBV-induced cirrhosis. Due to the 3 print: [please include Day in 2017. More seriously, estimated new HCC cases absence of specific symptoms in early stages and the Month Year]. doi:10.1136/ achieved 343 700 in males and 122 300 in females lack of early diagnostic markers, most patients with gutjnl-2017-315084 in China in 2015,4 which is mainly attributed to HCC are often diagnosed in an advanced stage with Ren Z, et al. Gut 2018;0:1–10. doi:10.1136/gutjnl-2017-315084 1 Gut microbiota of the First Affiliated Hospital, School of Medicine, Zhejiang Significance of this study University (2014–334); the First Affiliated Hospital of Zheng- zhou University (2017-XY-002) and the First Affiliated Hospital Gut: first published as 10.1136/gutjnl-2017-315084 on 25 July 2018. Downloaded from How might it impact on clinical practice in the foreseeable of Xinjiang Medical University. All participants signed written future? informed consents on enrolment. ► This is the first report to illustrate gut microbial A total of 486 faecal samples from East China, Central characteristics in patients with early HCC through large- China and Northwest China were prospectively collected, and cohort Miseq sequencing. finally 419 samples were included and subjected to 16S rRNA ► Gut microbial alterations may contribute to the development Miseq sequencing. Participants’ demographics, clinicopatholog- of HCC, which implies that the changed gut microbiota may ical data, CT scan, histopathology images and diet habit were represent a potential target to prevent HCC development by collected from hospital electronic medical records and ques- the gut-microbiota-liver axis. tionnaires (online supplementary table S1). Detailed diagnostic ► This study is the first to report the successful diagnosis criteria and inclusion and exclusion criteria of the participants model establishment and cross-region validation of microbial are described in the online supplementary methods. markers for HCC, notably including data from three different regions of China. Gut microbiota-targeted biomarkers Faecal sample collection and DNA extraction represent potential non-invasive tools for early diagnosis of Each individual provided a fresh tail stool sample at 06:30– HCC. 08:30 hours. Each stool sample completed faecal routine testing. The sample was divided into five aliquots of 200 mg and imme- diately stored at −80°C. DNA extraction was conducted as we poor prognosis (the overall ratio of mortality to incidence is previously described.22 23 The details are described in the online 0.95).5 6 Therefore, novel diagnostic markers for early HCC and supplementary methods. new therapeutic strategies are urgently needed to improve the prognosis of this population. The human gut microbiota have been considered the most Stool moisture measurement important microecosystem living in symbiosis with the body.7–11 Stool consistency was assessed using stool routine testing results. It is identified as a crucial determinant of intestinal inflammation Stool moisture content was determined in duplicate on the and as a key player in chronic inflammatory liver diseases.12 Gut frozen homogenised faecal material (−80°C) as the percentage microbial alterations contribute to the onset and progression of of stool mass loss after lyophilisation (Labconco FreeZone, alcoholic liver disease, non-alcoholic fatty liver disease,13 liver LABCONCO, USA).24 cirrhosis and its complications.14 Recent studies in animal models indicate that the intestinal microbiota promote HCC develop- 15 16 PCR amplification, MiSeq sequencing and Sequence data ment through the gut microbiota-liver axis. However, until process now, gut microbial characteristics in clinical patients with HCC Extracted DNA samples were amplified, DNA libraries were have not yet been reported. constructed and the sequencing was performed on an Illumi- http://gut.bmj.com/ The concept of gut microbiome serving as a non-invasive naMiSeq platform by Shanghai Itechgene Technology, China. diagnosis tool for specific diseases or cancer, including type 2 17 18 Amplified reads were processed. The details are described in diabetes (T2D) and colorectal cancer (CRC), has been estab- the online supplementary methods. Raw Illumina read data lished by compelling studies. We previously established an accu- for all samples were deposited in the European
Recommended publications
  • And Dysenteric Pigs ISADORE M

    And Dysenteric Pigs ISADORE M

    APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Nov. 1984, p. 964-969 Vol. 48, No. 5 0099-2240/84/110964-06$02.00/0 Copyright C) 1984, American Society for Microbiology Characterization of Predominant Bacteria from the Colons of Normal and Dysenteric Pigs ISADORE M. ROBINSON,* SHANNON C. WHIPP, JERRY A. BUCKLIN, AND MILTON J. ALLISON National Animal Disease Center, Agricultural Research Service, U.S. Department of Agriculture, Ames, Iowa 50010 Received 20 April 1984/Accepted 7 August 1984 Bacterial populations adherent to the mucosa of the proximal colons of weaned, healthy pigs were compared with populations from pigs with dysentery induced by inoculation with a culture of Treponema hyodysenteriae. Isolates (136) representative of the predominant flora adherent to colonic epithelia of normal pigs and isolates (162) from pigs with dysentery were cultured anaerobically on a rumen fluid-based medium and characterized. Most (71%) of the isolates from colonic epithelia of normal pigs were gram positive, whereas 88% of the epithelia-associated isolates from pigs with dysentery were gram negative. The geometric mean of colony counts was 5.7 x 107/cm2 of colonic tissue from three normal pigs and 7.7 x 108/cm2 from four pigs with dysentery. A number of isolates obtained from contents of the lumens of normal pigs and pigs with dysentery were also characterized. Comparison of isolates from epithelial tissue and from contents of the lumens of the same pig indicated that these populations were different. Our results indicate that physiological changes that occur in the colons of pigs with dysentery are accompanied by marked changes in the microbial populations in the colons.
  • A Walnut-Enriched Diet Affects Gut Microbiome in Healthy Caucasian Subjects: a Randomized, Controlled Trial

    A Walnut-Enriched Diet Affects Gut Microbiome in Healthy Caucasian Subjects: a Randomized, Controlled Trial

    nutrients Article A Walnut-Enriched Diet Affects Gut Microbiome in Healthy Caucasian Subjects: A Randomized, Controlled Trial Charlotte Bamberger 1, Andreas Rossmeier 1, Katharina Lechner 1, Liya Wu 1, Elisa Waldmann 1, Sandra Fischer 2, Renée G. Stark 3 ID , Julia Altenhofer 1, Kerstin Henze 1 and Klaus G. Parhofer 1,* 1 Department of Internal Medicine 4, Ludwig-Maximilians University Munich, Marchioninistraße 15, 81377 Munich, Germany; [email protected] (C.B.); [email protected] (A.R.); [email protected] (K.L.); [email protected] (L.W.); [email protected] (E.W.); [email protected] (J.A.); [email protected] (K.H.) 2 ZIEL—Institute for Food & Health Core Facility, Technical University Munich, Weihenstephaner Berg 3, 85354 Freising, Germany; sandra.fi[email protected] 3 Helmholtz-Zentrum Munich, Institute for Health Economics and Healthcare Management, 85764 Neuherberg, Germany; [email protected] * Correspondence: [email protected]; Tel.: +49-89-4400-73010; Fax: +49-89-4400-78879 Received: 21 December 2017; Accepted: 20 February 2018; Published: 22 February 2018 Abstract: Regular walnut consumption is associated with better health. We have previously shown that eight weeks of walnut consumption (43 g/day) significantly improves lipids in healthy subjects. In the same study, gut microbiome was evaluated. We included 194 healthy subjects (134 females, 63 ± 7 years, BMI 25.1 ± 4.0 kg/m2) in a randomized, controlled, prospective, cross-over study. Following a nut-free run-in period, subjects were randomized to two diet phases (eight weeks each); 96 subjects first followed a walnut-enriched diet (43 g/day) and then switched to a nut-free diet, while 98 subjects followed the diets in reverse order.
  • Characteristics of the Gut Microbiome of Healthy Young Male Soldiers in South Korea: the Effects of Smoking

    Characteristics of the Gut Microbiome of Healthy Young Male Soldiers in South Korea: the Effects of Smoking

    Gut and Liver https://doi.org/10.5009/gnl19354 pISSN 1976-2283 eISSN 2005-1212 Original Article Characteristics of the Gut Microbiome of Healthy Young Male Soldiers in South Korea: The Effects of Smoking Hyuk Yoon1, Dong Ho Lee1, Je Hee Lee2, Ji Eun Kwon3, Cheol Min Shin1, Seung-Jo Yang2, Seung-Hwan Park4, Ju Huck Lee4, Se Won Kang4, Jung-Sook Lee4, and Byung-Yong Kim2 1Department of Internal Medicine, Seoul National University Bundang Hospital, Seongnam, 2ChunLab Inc., Seoul, 3Armed Forces Capital Hospital, Seongnam, and 4Korean Collection for Type Cultures, Biological Resource Center, Korea Research Institute of Bioscience and Biotechnology, Jeongeup, Korea Article Info Background/Aims: South Korean soldiers are exposed to similar environmental factors. In this Received October 14, 2019 study, we sought to evaluate the gut microbiome of healthy young male soldiers (HYMS) and to Revised January 6, 2020 identify the primary factors influencing the microbiome composition. January 17, 2020 Accepted Methods: We prospectively collected stool from 100 HYMS and performed next-generation se- Published online May 13, 2020 quencing of the 16S rRNA genes of fecal bacteria. Clinical data, including data relating to the diet, smoking, drinking, and exercise, were collected. Corresponding Author Results: The relative abundances of the bacterial phyla Firmicutes, Actinobacteria, Bacteroide- Dong Ho Lee tes, and Proteobacteria were 72.3%, 14.5%, 8.9%, and 4.0%, respectively. Fifteen species, most ORCID https://orcid.org/0000-0002-6376-410X of which belonged to Firmicutes (87%), were detected in all examined subjects. Using cluster E-mail [email protected] analysis, we found that the subjects could be divided into the two enterotypes based on the gut Byung-Yong Kim microbiome bacterial composition.
  • Gemmiger Formicilis, N.Gen., N.Sp., an Anaerobic Budding Bacterium from Intestines

    Gemmiger Formicilis, N.Gen., N.Sp., an Anaerobic Budding Bacterium from Intestines

    hTERNATIONAL JOURNALOF SYSTEMATIC BACTERIOLOGY,Apr. 1975, p. 202-207 Vol. 25, No. 2 Copyright 0 1975 International Association of Microbiological Societies Printed in USA. Gemmiger formicilis, n.gen., n.sp., an Anaerobic Budding Bacterium from Intestines JENNIFER GOSSLING' AND W. E. C. MOORE Department of Microbiology, West Virginia University Medical Center, Morgantown, West Virginia 26506 and Anaerobe Laboratory, Virginia Polytechnic Institute and State University, Blacksburg, Virginia 24061 A species of strictly anaerobic, carbohydrate-fermenting, formic- and butyric acid-producing, gram-negative to gram-variable bacteria is described on the basis of 35 isolates from human feces and one isolate from chicken cecal contents. Members of this species produce morphological forms with the appearance of buds. This species cannot be assigned to any known genus, and therefore a new genus, Gernrniger (L. n. gernrna a bud; L. v. gero to bear; M. L. masc. n. gernrniger bud bearer), is proposed with G. forrnicilis n.sp. (M. L. adj. forrnicilis pertaining to formic acid) as the type species. The type strain of this species is Virginia Polytechnic Institute strain X2-56 ( = ATCC 27749). This report describes 35 bacterial isolates of a gen. Carbohydrate (0.2%)was added to this medium species that appears to be common in the large before autoclaving or, for the determination of fer- intestines of man and chickens. Strains of this mentation products, 0.5% of filter-sterilized glucose species, conforming to the description below, was added after autoclaving. Other tests in series I1 followed the methods of Holdeman and Moore (4). occurred at 8.32 (*1.8 standard deviation) x A representative strain of series I1 (Gossling L-61) 109/g (dry weight) of feces of 20 clinically healthy was examined by electron microscopy.
  • Gut Microbial Composition Differs Extensively Among Indian Native Chicken Breeds Originated in Different Geographical Locations

    Gut Microbial Composition Differs Extensively Among Indian Native Chicken Breeds Originated in Different Geographical Locations

    microorganisms Article Gut Microbial Composition Differs Extensively among Indian Native Chicken Breeds Originated in Different Geographical Locations and a Commercial Broiler Line, but Breed-Specific, as Well as Across-Breed Core Microbiomes, Are Found Shyam Sundar Paul 1,* , Rudra Nath Chatterjee 2, Mantena Venkata Lakshmi Narasimha Raju 1 , Bhukya Prakash 1, Savaram Venkata Rama Rao 1, Satya Pal Yadav 3 and Alagarsamy Kannan 1 1 Poultry Nutrition Lab, ICAR—Directorate of Poultry Research, Poultry Nutrition, Hyderabad 500030, India; [email protected] (M.V.L.N.R.); [email protected] (B.P.); [email protected] (S.V.R.R.); [email protected] (A.K.) 2 Director’s Lab, ICAR—Directorate of Poultry Research, Hyderabad 500030, India; [email protected] 3 Animal Biotechnology Lab, ICAR—Directorate of Poultry Research, Hyderabad 500030, India; [email protected] * Correspondence: [email protected] Abstract: Gut microbiota plays an important role in the health and performance of the host. Charac- terizations of gut microbiota, core microbiomes, and microbial networks in different chicken breeds Citation: Paul, S.S.; Chatterjee, R.N.; are expected to provide clues for pathogen exclusion, improving performance or feed efficiency. Raju, M.V.L.N.; Prakash, B.; Rama Here, we characterized the gut microbiota of “finishing” chickens (at the end of production life) Rao, S.V.; Yadav, S.P.; Kannan, A. Gut of indigenous Indian Nicobari, Ghagus, and Aseel breeds, originating from the Nicobari island, Microbial Composition Differs coastal India, and the Indian mainland, respectively, as well as a global commercial broiler line, Extensively among Indian Native VenCobb 400, using 16S rDNA amplicon sequencing.
  • Mihai's Favorite

    Mihai's Favorite

    Computational Challenges in Microbiome Research Mihai Pop DIARRHEAL DISEASE KILLS 800,000 CHILDREN EACH YEAR (more than HIV, malaria, and measles combined) GEMS study: 22,000 children under 5 from 7 African and Asian countries (Lancet, 2013) Over half of all cases could not be attributed to any known pathogen ~1000 clinical variables 3000 samples ~60,000 "organisms" Healthy ~10,000 sequences/sample Sick 17th century biology 21st century biology >F4BT0V001CZSIM rank=0000138 x=1110.0 y=2700.0 length=57 ACTGCTCTCATGCTGCCTCCCGTAGGAGTGCCTCCCTGAGCCAGGATCAAACGTCTG >F4BT0V001BBJQS rank=0000155 x=424.0 y=1826.0 length=47 ACTGACTGCATGCTGCCTCCCGTAGGAGTGCCTCCCTGCGCCATCAA >F4BT0V001EDG35 rank=0000182 x=1676.0 y=2387.0 length=44 ACTGACTGCATGCTGCCTCCCGTAGGAGTCGCCGTCCTCGACNC >F4BT0V001D2HQQ rank=0000196 x=1551.0 y=1984.0 length=42 ACTGACTGCATGCTGCCTCCCGTAGGAGTGCCGTCCCTCGAC >F4BT0V001CM392 rank=0000206 x=966.0 y=1240.0 length=82 AANCAGCTCTCATGCTCGCCCTGACTTGGCATGTGTTAAGCCTGTAGGCTAGCGTTCATCCCTGAGCCAGGATCAAACTCTG >F4BT0V001EIMFX rank=0000250 x=1735.0 y=907.0 length=46 ACTGACTGCATGCTGCCTCCCGTAGGAGTGTCGCGCCATCAGACTG >F4BT0V001ENDKR rank=0000262 x=1789.0 y=1513.0 length=56 GACACTGTCATGCTGCCTCCCGTAGGAGTGCCTCCCTGAGCCAGGATCAAACTCTG >F4BT0V001D91MI rank=0000288 x=1637.0 y=2088.0 length=56 ACTGCTCTCATGCTGCCTCCCGTAGGAGTGCCTCCCTGAGCCAGGATCAAACTCTG >F4BT0V001D0Y5G rank=0000341 x=1534.0 y=866.0 length=75 GTCTGTGACATGCTGCCTCCCGTAGGAGTCTACACAAGTTGTGGCCCAGAACCACTGAGCCAGGATCAAACTCTG >F4BT0V001EMLE1 rank=0000365 x=1780.0 y=1883.0 length=84 ACTGACTGCATGCTGCCTCCCGTAGGAGTGCCTCCCTGCGCCATCAATGCTGCATGCTGCTCCCTGAGCCAGGATCAAACTCTG
  • A Korean-Style Balanced Diet Has a Potential Connection with Ruminococcaceae Enterotype and Reduction of Metabolic Syndrome Incidence in Korean Adults

    A Korean-Style Balanced Diet Has a Potential Connection with Ruminococcaceae Enterotype and Reduction of Metabolic Syndrome Incidence in Korean Adults

    nutrients Article A Korean-Style Balanced Diet Has a Potential Connection with Ruminococcaceae Enterotype and Reduction of Metabolic Syndrome Incidence in Korean Adults Xuangao Wu 1,2, Tatsuya Unno 3 , Suna Kang 1,2 and Sunmin Park 1,2,* 1 Obesity/Diabetes Research Center, Department of Food and Nutrition, Hoseo University, Asan 31499, Korea; [email protected] (X.W.); [email protected] (S.K.) 2 Department of Bio-Convergence System, Hoseo University, Asan 31499, Korea 3 Faculty of Biotechnology, School of Life Sciences, SARI, Jeju National University, Jeju 63243, Korea; [email protected] * Correspondence: [email protected]; Tel.: +82-41-540-5345; Fax: +82-41-548-0670 Abstract: Metabolic syndrome is associated with usual dietary patterns that may be involved in enterotypes. We aimed to understand the potential relationship of enterotypes and dietary patterns to influence metabolic syndrome in the Koreans. Using the Korea National Health and Nutrition Examination Survey (KNHANES)-VI in 2014, metabolic parameters were also analyzed among the dietary patterns classified by principal component analysis in Korean adults. The fecal microbiota data of 1199 Korean adults collected in 2014 were obtained from the Korea Centers for Disease Control and Prevention. Enterotypes were classified based on Dirichlet multinomial mixtures (DMM) by Mothur v.1.36. The functional abundance of fecal bacteria was analyzed using the PICRUSt2 pipeline. Korean adults were clustered into three dietary patterns including Korean- style balanced diets (KBD, 20.4%), rice-based diets (RBD, 17.2%), and Western-style diets (WSD, 62.4%) in KNHANES. The incidence of metabolic syndrome was lowered in the order of RBD, WSD, Citation: Wu, X.; Unno, T.; Kang, S.; and KBD.
  • Faecal Microbiota in Patients with Neurogenic Bowel Dysfunction and Spinal Cord Injury Or Multiple Sclerosis—A Systematic Review

    Journal of Clinical Medicine Review Faecal Microbiota in Patients with Neurogenic Bowel Dysfunction and Spinal Cord Injury or Multiple Sclerosis—A Systematic Review Willemijn Faber 1,*, Janneke Stolwijk-Swuste 2 , Florian van Ginkel 3 , Janneke Nachtegaal 4, Erwin Zoetendal 5, Renate Winkels 6 and Ben Witteman 6 1 Heliomare Rehabilitation Centre, 1949 EC Wijk aan Zee, The Netherlands 2 Center of Excellence for Rehabilitation Medicine, Brain Center Rudolf Magnus, University Medical Center Utrecht and De Hoogstraat Rehabilitation, Utrecht University, 3583 TM Utrecht, The Netherlands; [email protected] 3 Faculty of Medicine, Utrecht University, 3584 CG Utrecht, The Netherlands; [email protected] 4 Heliomare Rehabilitation Center, Department of Research & Development, 1949 EC Wijk aan Zee, The Netherlands; [email protected] 5 Laboratory of Microbiology, Wageningen University and Research, Wageningen University, 6708 PB Wageningen, The Netherlands; [email protected] 6 Division of Human Nutrition and health, Wageningen University and Research, Wageningen University, 6708 PB Wageningen, The Netherlands; [email protected] (R.W.); [email protected] (B.W.) * Correspondence: [email protected]; Tel.: +31-88-9208257 Abstract: Background: Neurogenic bowel dysfunction (NBD) frequently occurs in patients with spinal cord injury (SCI) and multiple sclerosis (MS) with comparable symptoms and is often difficult Citation: Faber, W.; Stolwijk-Swuste, to treat. It has been suggested the gut microbiota might influence the course of NBD. We system- J.; van Ginkel, F.; Nachtegaal, J.; atically reviewed the literature on the composition of the gut microbiota in SCI and MS, and the Zoetendal, E.; Winkels, R.; Witteman, possible role of neurogenic bowel function, diet and antibiotic use.
  • A Systematic Review of the Effect of Bariatric Surgery

    178:1 Y Guo, Z-P Hunag, C-Q Liu Microbiota and bariatric surgery 178:1 43–56 Clinical Study and others Modulation of the gut microbiome: a systematic review of the effect of bariatric surgery Yan Guo1,*, Zhi-Ping Huang2,3,*, Chao-Qian Liu3,*, Lin Qi4, Yuan Sheng3 and Da-Jin Zou1 Correspondence 1 2 Department of Endocrinology, Changhai Hospital, Shanghai, China, Third Department of Hepatic Surgery, should be addressed 3 Shanghai Eastern Hepatobiliary Surgery Hospital, Shanghai, China, Department of General Surgery, Shangai to Y Sheng or D-J Zou 4 Changhai Hospital, Shanghai, China, and Department of Orthopaedics, the Second Xiangya Hospital, Central Email South University, Changsha, Hunan, China shengyuan.smmu@aliyun. *(Y Guo, Z-P Hunag and C-Q Liu contributed equally to this work) com or zoudajin@hotmail. com Abstract Objective: Bariatric surgery is recommended for patients with obesity and type 2 diabetes. Recent evidence suggested a strong connection between gut microbiota and bariatric surgery. Design: Systematic review. Methods: The PubMed and OVID EMBASE were used, and articles concerning bariatric surgery and gut microbiota were screened. The main outcome measures were alterations of gut microbiota after bariatric surgery and correlations between gut microbiota and host metabolism. We applied the system of evidence level to evaluate the alteration of microbiota. Modulation of short-chain fatty acid and gut genetic content was also investigated. Results: Totally 12 animal experiments and 9 clinical studies were included. Based on strong evidence, 4 phyla (Bacteroidetes, Fusobacteria, Verrucomicrobia and Proteobacteria) increased after surgery; within the phylum Firmicutes, Lactobacillales and Enterococcus increased; and within the phylum Proteobacteria, Gammaproteobacteria, European Journal European of Endocrinology Enterobacteriales Enterobacteriaceae and several genera and species increased.
  • Whole Genome Sequencing and Function Prediction of 133 Gut

    Medvecky et al. BMC Genomics (2018) 19:561 https://doi.org/10.1186/s12864-018-4959-4 RESEARCH ARTICLE Open Access Whole genome sequencing and function prediction of 133 gut anaerobes isolated from chicken caecum in pure cultures Matej Medvecky1, Darina Cejkova1, Ondrej Polansky1, Daniela Karasova1, Tereza Kubasova1, Alois Cizek2,3 and Ivan Rychlik1* Abstract Background: In order to start to understand the function of individual members of gut microbiota, we cultured, sequenced and analysed bacterial anaerobes from chicken caecum. Results: Altogether 204 isolates from chicken caecum were obtained in pure cultures using Wilkins-Chalgren anaerobe agar and anaerobic growth conditions. Genomes of all the isolates were determined using the NextSeq platform and subjected to bioinformatic analysis. Among 204 sequenced isolates we identified 133 different strains belonging to seven different phyla - Firmicutes, Bacteroidetes, Actinobacteria, Proteobacteria, Verrucomicrobia, Elusimicrobia and Synergistetes. Genome sizes ranged from 1.51 Mb in Elusimicrobium minutum to 6.70 Mb in Bacteroides ovatus. Clustering based on the presence of protein coding genes showed that isolates from phyla Proteobacteria, Verrucomicrobia, Elusimicrobia and Synergistetes did not cluster with the remaining isolates. Firmicutes split into families Lactobacillaceae, Enterococcaceae, Veillonellaceae and order Clostridiales from which the Clostridium perfringens isolates formed a distinct sub-cluster. All Bacteroidetes isolates formed a separate cluster showing similar genetic
  • Supplementary Table 8 Spearman's Correlations Between Targeted Urinary Urolithins and Microbiota

    Supplementary Table 8 Spearman's Correlations Between Targeted Urinary Urolithins and Microbiota

    Supplementary material Gut Supplementary Table 8 Spearman's correlations between targeted urinary urolithins and microbiota. Urolithin- Urolithin- Urolithin- Total A- B- C- Urolithins Family level Taxonomy glucuronid glucuronid glucuronid (A+B+C) e e e Actinobacteria; Actinobacteria; Bifidobacteriales; Bifidobacteriaceae; Bifidobacterium adolescentis_msp_0263 -0.18 -0.09 -0.16 -0.18 Bifidobacteriaceae Bifidobacterium; Bifidobacterium adolescentis Actinobacteria; Actinobacteria; Bifidobacteriales; Bifidobacteriaceae; Bifidobacterium bifidum_msp_0419 -0.12 -0.2 -0.08 -0.13 Bifidobacteriaceae Bifidobacterium; Bifidobacterium bifidum Actinobacteria; Coriobacteriia; Coriobacteriales; Coriobacteriaceae; Collinsella; Collinsella aerofaciens_msp_1244 -0.15 -0.06 -0.04 -0.18 Coriobacteriaceae Collinsella aerofaciens Actinobacteria; Coriobacteriia; Eggerthellales; Eggerthellaceae; Adlercreutzia; unclassified Adlercreutzia_msp_0396 0.09 0.01 0.16 0.12 Eggerthellaceae unclassified Adlercreutzia Actinobacteria; Coriobacteriia; Eggerthellales; Eggerthellaceae; Eggerthella; Eggerthella lenta_msp_0573 0.03 -0.15 0.08 0.03 Eggerthellaceae Eggerthella lenta Actinobacteria; Coriobacteriia; Eggerthellales; Eggerthellaceae; Gordonibacter; Gordonibacter urolithinfaciens_msp_1339 0.19 -0.05 0.18 0.19 Eggerthellaceae Gordonibacter urolithinfaciens Bacteroidetes; Bacteroidia; Bacteroidales; Bacteroidaceae; Bacteroides; Bacteroides cellulosilyticus_msp_0003 0.12 0.11 0.15 0.15 Bacteroidaceae Bacteroides cellulosilyticus Bacteroidetes; Bacteroidia; Bacteroidales;
  • Vitamin C Supplementation in Healthy Individuals Leads to Shifts of Bacterial Populations in the Gut—A Pilot Study

    Vitamin C Supplementation in Healthy Individuals Leads to Shifts of Bacterial Populations in the Gut—A Pilot Study

    antioxidants Article Vitamin C Supplementation in Healthy Individuals Leads to Shifts of Bacterial Populations in the Gut—A Pilot Study Antonius T. Otten 1,†, Arno R. Bourgonje 1,† , Vera Peters 1,2 , Behrooz Z. Alizadeh 2 , Gerard Dijkstra 1,‡ and Hermie J. M. Harmsen 3,*,‡ 1 Department of Gastroenterology and Hepatology, University of Groningen, University Medical Center Groningen, 9713 GZ Groningen, The Netherlands; [email protected] (A.T.O.); [email protected] (A.R.B.); [email protected] (V.P.); [email protected] (G.D.) 2 Department of Epidemiology, University of Groningen, University Medical Center Groningen, 9713 GZ Groningen, The Netherlands; [email protected] 3 Department of Medical Microbiology, University of Groningen, University Medical Center Groningen, 9713 GZ Groningen, The Netherlands * Correspondence: [email protected]; Tel.: +31-50-361-3480 † These authors contributed equally to this work. ‡ Authors share senior authorship. Abstract: Gut microbes are crucial to human health, but microbial composition is often disturbed in a number of human diseases. Accumulating evidence points to nutritional modulation of the gut microbiota as a potentially beneficial therapeutic strategy. Vitamin C (ascorbic acid) may be of particular interest as it has known antioxidant and anti-inflammatory properties. In this study, we investigated whether supplementation with high-dose vitamin C may favourably affect the composition of the gut microbiota. In this pilot study, healthy human participants received 1000 mg Citation: Otten, A.T.; Bourgonje, vitamin C supplementation daily for two weeks. Gut microbiota composition was analysed before and A.R.; Peters, V.; Alizadeh, B.Z.; after intervention by performing faecal 16S rRNA gene sequencing.