A Specific N-Terminal Extension of the 8 Kda Domain Is Required for DNA End-Bridging by Human Polk and Polj

Published online 8 August 2013 Nucleic Acids Research, 2013, Vol. 41, No. 19 9105–9116 doi:10.1093/nar/gkt681 A specific N-terminal extension of the 8 kDa domain is required for DNA end-bridging by human Polk and Polj Maria Jose Martin*, Maria Victoria Garcia-Ortiz, Ana Gomez-Bedoya, Veronica Esteban, Susana Guerra and Luis Blanco* Centro de Biologia Molecular Severo Ochoa (CSIC-UAM), 28049 Madrid, Spain Received February 27, 2013; Revised July 12, 2013; Accepted July 14, 2013 ABSTRACT state [see Supplementary Figure S1A for an example with Polß; reviewed in (1)]. One role of this conformational Human DNA polymerases mu (Polk) and lambda change is to allow the rapid binding of substrates (and (Polj) are X family members involved in the repair release of products) in the open state, while inducing of double-strand breaks in DNA during non-homolo- optimal alignment of catalytic residues surrounding the gous end joining. Crucial abilities of these enzymes substrates in the closed state. The shape of the base pair include bridging of the two 30 single-stranded over- formed determines the fate of the weakly bound nucleotide hangs and trans-polymerization using one 30 end as during the conformational change step: only a correct base primer and the other as template, to minimize pair induces closing of the enzyme to form a tight catalytic sequence loss. In this context, we have studied complex; conversely, if a mismatched nucleotide is bound, the importance of a previously uncharacterised the enzyme does not close, but rather proceeds to release sequence (‘brooch’), located at the N-terminal the nucleotide while reducing the rate of catalysis. Structural characterization of several DNA poly- boundary of the Polß-like polymerase core, and merases from families A, B and X suggests that formed by Tyr141,Ala142,Cys143,Gln144 and Arg145 in 239 240 241 242 243 deoxynucleotide (dNTP) binding induces large conform- Polk, and by Trp ,Val ,Cys ,Ala and Gln in ational changes affecting the relative positioning of both Polj. The brooch is potentially implicated in the fingers and thumb subdomains (2–4). In the case of the maintenance of a closed conformation throughout human X family of polymerases, Polß has been the the catalytic cycle, and our studies indicate that it paradigm for structural examination of mechanistic could be a target of Cdk phosphorylation in Polk. details. The structure of free Polß showed that the The brooch is irrelevant for 1 nt gap filling, but of polymerization domain (31 kDa), composed of subdomains specific importance during end joining: single muta- fingers, palm and thumb, adopts a structure in space similar tions in the conserved residues reduced the forma- to a partially left hand, like other DNA polymerases evo- tion of two ended synapses and strongly diminished lutionarily unrelated (5,6); conversely its N-terminal domain (8 kDa) is shown to be located away from the the ability of Polk and polymerase lambda to perform polymerization domain in this structure (Supplementary non-homologous end joining reactions in vitro. Figure S1A, Polß – Apo). Crystallization of Polß complexed with different DNA molecules demonstrated the structural basis for its preference for small DNA gaps. INTRODUCTION Polß complexed with a template-primer substrate shows Most nucleic acid-synthesizing enzymes exhibit large an arrangement in which the 8 kDa domain is not interact- structural changes on binding to the DNA substrate: ing with the DNA, being positioned at a distance from the some of the substrate binding energy is used to organize polymerization domain, similar to the apoenzyme structure the active site and orient this substrate for catalysis. (7,8). In contrast, the crystal structure of Polß complexed Similarly, the binding of a nucleotide to a high-fidelity with a 1 nt gapped substrate shows that the 8 kDa domain DNA polymerase/DNA complex induces a subtle change binds to the 50-phosphate of the gap while also interacting in the structure of the enzyme from an ‘open’ to a ‘closed’ with the DNA substrate through the thumb subdomain *To whom correspondence should be addressed. Tel: +34 91 1964685; Fax: +34 91 1964420; Email: [email protected] Correspondence may also be addressed to Maria Jose Martin. Tel:+44 01707 625772; Fax:+44 0207 269 3801; Email: [email protected] Present address: Maria Jose Martin, London Research Institute, Cancer Research UK, Clare Hall Laboratories, South Mimms EN6 3LD, UK. ß The Author(s) 2013. Published by Oxford University Press. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/ by-nc/3.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact [email protected] 9106 Nucleic Acids Research, 2013, Vol. 41, No. 19 [(2,8); see Supplementary Figure S1A, Polß – Binary], thus sets of oligonucleotides were used. A first set of primers promoting a more stable binding of the polymerase to this sharing a common part (50CCCTCCCTCCC ...) and substrate. The resolution of the structure of Polß with a 1 nt bearing different 30 protrusions (1AC [...CA30], 1TG gap and incoming nucleotide allowed further study of the [...GT30], 1A [...A30], 1C [...C30], 1G [...G30], 1T polymerization mechanism and conformational changes [...T30]), were hybridized to 1D-NHEJ (50GGGAGGGA that occur during catalysis. It was determined that the GGG). A second set of primers sharing the common part incoming nucleotide causes the transition from an open (50GCACTCACGTCCC...), and bearing different 30 to a closed complex by induction of a conformational overhangs (2AC [...CA30], 2TG [...GT30], 2A [...A30], change of the thumb subdomain (2), which has a decisive 2C [...C30], 2G [...G30], 2T [...T30]), were hybridized to influence on the fidelity of the reaction [(9,10), see oligonucleotide 2D-NHEJ (50-GGGACGTGAGTGC). A Supplementary Figure S1A, Polß – Ternary]. third set of primers sharing the common part (50CCCTCC Unexpectedly, structural characterization of polymerase CTCCG...), and bearing different 30 overhangs (D3 lambda (Pol) indicated that its catalytic cycle does not [...CGGC], D3+C [...GCGGCC]), were hybridized to involve major subdomain motions [see comparison of a D1 (50CGGAGGGAGGG). A fourth set of primers binary complex with gapped DNA (PDB ID: 1XSL) sharing the common part (50 CCCTCCCTCCG...), and versus a pre-catalytic ternary complex with gapped DNA bearing different 30 overhangs (D4 [...CGCC], D4GC and incoming nucleotide (PDB ID: 1XSN), at Supple- [...CGGCC]), were hybridized to D2 (50GGGACGTGA mentary Figure S1B]. Thus, unlike Polß, Pol is in a GTGCGCG). Oligonucleotides DG1-P, DG5, 2D-NHEJ closed conformation before dNTP binding, and a shift of and D2-P contain a 50-P group when indicated. Ultrapure the DNA template is observed when comparing both crystal dNTPs, dideoxynucleotides (ddNTPs) and [g-32P]ATP complexes (11) and predicted by molecular dynamic simu- (3000 Ci/mmol) were purchased from GE Healthcare lations (12). Informative crystal structures leading to this (USA). T4 polynucleotide kinase was obtained from conclusion do not exist for polymerase mu (Polm): the New England Biolabs (Beverly, MA, USA). Pfu DNA only one solved is a ternary complex with gapped DNA polymerase was purchased from Promega Corporation and incoming nucleotide [(13); PDB ID: 2IHM; (Madison, WI, USA). Supplementary Figure S1C]. However, like for Pol,anab initio closed conformation of the Polm apoenzyme is pre- Construction and purification of human Polk and dicted by molecular dynamics simulations (14). mutant versions In this work, we describe the functional importance of a Site-directed mutagenesis by single PCR with oligonucleo- newly recognized sequence located in the N-terminal tides containing the desired mutation was performed on boundary of the polymerase ß-like core, formed by five the over-expression plasmid pRSETA-hPolm (15). The residues highly conserved in Polms (YACQR), Terminal oligonucleotides used were the following: deoxynucleotydil transferases (TdTs) (YACQR) and 0 Pols (WVCAQ) of different species, but absent in Polb. Y141F (5 TGGATGCCTGCCTTTGCCTGCCAGCGC), Y141S (50TGGATGCCTGCCTCTGCCTGCCAGCGC), This sequence, which we called ‘brooch’, seems to be C143G (50CCTGCCTATGCCGGCCAGCGCCCTACG), involved in the maintenance of a closed conformation R145A (50TATGCCTGCCAGGCCCCTACGCCCCTC), throughout the catalytic cycle, mediating interactions R145K (50TATGCCTGCCAGAAACCTACGCCCCTC), between the 8 kDa domain and the thumb subdomain. N153G (50CTCACACACCACGGCACTGGCCTCTCC), R446G (50CAGCGGGAGCTGCGCGGCTTCAGCCGGAAGGAG), Our site-directed mutagenesis studies indicate that the 0 lack of the conserved residues of the brooch affects T147A (5 GCCTGCCAGCGCCCTGCGCCCCTCACACAC), T147E (50GCCTGCCAGCGCCCTGAGCCCCTCACACAC). specific functions of human Polm and Pol,suchasend- bridging and trans-polymerization, or the filling-in of long DNA constructs were sequenced and transformed in gaps in DNA. These activities are of special importance Escherichia coli BL21(DE3)pLysS (Stratagene). Wild-type during DNA repair processes such as non-homologous and mutant Polm variants were over-expressed and purified end joining (NHEJ), a pathway completely indispensable in an A¨ kta Purifier FPLC system (GE Healthcare) with the for the maintenance of genomic stability and cell viability. following protocol: the cleared bacterial lysate was

Load more