DOCSLIB.ORG

Cyclic AMP Dependent Protein Kinase a (PKA) Mutant Associated with Fibrolamellar Hepatocellular Carcinoma (FLHCC): Structure, Dynamics and in Cell Studies

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Cyclic AMP Dependent Protein Kinase a (PKA) Mutant Associated with Fibrolamellar Hepatocellular Carcinoma (FLHCC): Structure, Dynamics and in Cell Studies Cyclic AMP dependent Protein Kinase A (PKA) mutant associated with Fibrolamellar Hepatocellular carcinoma (FLHCC): Structure, dynamics and in cell studies. A Dissertation SUBMITTED TO THE FACULTY OF THE UNIVERSITY OF MINNESOTA Adak Karamafrooz IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY ■ David D Thomas Laurie Parker March 2020 © Adak N Karamafrooz ALL RIGHTS RESERVED This work is dedicated to: All genuine souls who have remained loyal to their integrity, despite all odds. …and to my dear ones who bear with me all the way through. “To strive, to seek, to find, and not to yield…” ALFRED, LORD TENNYSON i List of Tables 3.1 Michaelis-Menten Kinetics constants for PKA-CDNAJB1and PKAWT .................... 110 3.2 Midpoint of thermal denaturation (Tm) for PKA-CDNAJB1and PKAWT................... 110 µ 3.3 Dissociation constants ( M) of nucleotides and inhibitor peptide PKI5-24 .......... 110 5.1 Subset of PRKACA-Dnajb1 direct Peptide Substrates identified by KALIP ...... 127 5.2 subset of PRKACA-Dnajb1 direct Protein Substrates identified by KALIP ....... 128 5.3 Canonical pathways that are enriched in both protein and peptide KALIP ....... 128 5.4 Subset of PRKACA-Dnajb1 substrates affected by the two PKA inhibitors ....... 129 6.2 Catalytic parameters derived from coupled enzyme assay for Human PKA and Cushing’s disease related PKA mutants W196R and L205R ........................... 142 6.3 Comparison of the Thermodynamic parameters for the two Cushing's disease mutant compared to the wild type PK ............................................................... 143 ii List of Figures CHAPTER 1 1.1 Position of the catalytic and glycine rich loop in the conformation of the PRKACA. ........................................................................................................................ 102 1.2 Hydrophobic C-spine and R-spine in the conformation of PRKACA and their relative position compared to important loops in the PKA catalytic subunit ...... 102 1.3 Glycine-rich loop of the C subunit in its closed and open conformation ........... 103 1.4 Post translational modifications in the N-terminal tail of PKA-Cα...................... 103 1.5 hydrogen bonding of the tip of the loop in the PKA-C:PKI ............................... 103 1.6 Reaction pathway for catalysis ........................................................................ 103 1.7 Regulatory and catalytic subunit complex in PKA ............................................ 104 1.8 Sequence alignment of the hinge of different R subunit isoforms .................... 104 1.9 A kinase anchoring protein (AKAP) bound to the regulatory subunit ............... 104 1.10 A schematic representation of cAMP signaling pathway inside the cell ........... 105 1.11 A simplified scheme of the possible role of cAMP/PKA pathway in cancer ...... 105 CHAPTER 3 3.1 PKA DANJB1 (Cyan, PDB:4WB7) crystal structure superimposed on PKAWT ...... 106 3.2 Statistical analysis of the chemical shift changes in PKA DANJB1 ....................... 106 DANJB1 3.3 A. Chemical shift analysis of PKA in complex with PKI5-24 vs PKIFL ......... 107 WT 3.3 B. Chemical shift analysis of PKA in complex with PKI5-24 vs PKIFL .............. 107 3.4 Mutual information and allosteric networks in PKAWT and PKA DANJB1 .............. 108 3.5 Emergence of allosteric hubs upon ATP binding in PKAWT and PKA DANJB1 ...... 109 CHAPTER 4 4.1 Structures of J-PKAcα chimera and wild-type PKAcα. ..................................... 111 4.2 RMSF per residue. RMSF for both J-PKACα and wild-type PKACα ................ 112 4.3 Movement of the J-domain in J-PKAcα chimera. .............................................. 113 4.4 Top four clusters by population from cluster analysis ...................................... 114 4.5 Top clusters from cluster analysis modeled into the RIIβ holoenzyme ............ 115 iii 4.6 Residue-specific T1/T2 ratio of NMR relaxation of J-PKACα ........................... 116 S.1 Backbone assignment of PKA-DNAJB1 ........................................................... 117 S.2 1H-15N TROSY-HSQC spectra for PKADNAJB1 .................................................... 118 S.3 Mutual information and allosteric networks in the binary and ternary forms of PKA WT .............................................................................................................................. 119 CHAPTER 5 5.1 A. Schematic presentation of Kinase assay linked with phosphoproteomic (KALIP). .......................................................................................................... 120 5.1 B. Overlap of the in-cell phospho-proteins ....................................................... 120 5.2 Comparison of some of enriched canonical pathways derived from phosphorylation analysis of in-cell PRKACA and PRKACA-Dnajb1 ................. 121 5.3 Comparison of Phosphorylation sites in each of PRKACA and its mutant PRKACA-Dnajb1.............................................................................................. 122 5.4 Comparison of canonical pathways derived from IPA phosphorylation analysis of PRKACA and PRKACA-Dnajb1 Peptide direct substrates .............................. 123 5.5 Comparison of canonical pathways derived from IPA phosphorylation analysis of PRKACA and PRKACA-Dnajb1 Protein direct substrates ............................... 124 5.6 A. Pattern of downregulated phosphorylation sites in each species ................ 125 5.6 B. Comparison of phosphorylated substrates percentage in PRKACA-Dnajb1 in the presence of inhibitors PKI and rp-cAMP ..................................................... 125 5.7 Inhibition of canonical pathways derived from IPA phosphorylation analysis of PRKACA and PRKACA-Dnajb1 ....................................................................... 126 S.1 Western blot of kinases expressed in HEK293 cells ......................................... 130 CHAPTER 6 6.1 Location of the Cushing’s disease mutations at the interface of R-Cα binding site ........................................................................................................................ 142 6.2 Affinity pull-down assay using His-tagged RIIB and untagged W196R ............ 143 6.3 Inhibitory mechanism using Non-Radioactive Protein Kinase Assays .............. 143 6.4 TROSY-HSQC for PKA-Human Isoform II (Apo form) ...................................... 144 6.5 TROSY-HSQC of Isoform 2 in APO and AMPPNP bound form overlaid ......... 144 6.6 PKA-Human isoform II in complex with nucleotide and PKI ............................ 145 iv 6.7 TROSY-HSQC spectra of 15N, 13C perdeuterated Human PKA bound to ATPγN and PKI Ternary complex) ......................................................................... 145 5-24 ( 6.8 PKA mutant “L205R” in the apo and in ATP-γN bound (binary) and PKI5-25 (ternary) form ................................................................................................... 146 6.9 CONCISE analysis applied to PKA mutant “L205R” ........................................ 147 6.10 TROSY-HSQC spectra of 15N-labeled W196R ................................................. 147 6.11 Comparison of correlation matrix of the sidechain movements in W196R with that of PKA-WT ....................................................................................................... 148 v List of Abbreviations: ADP: Adenosine Diphosphate AKAP: A kinase anchoring protein ATP: Adenosine Triphosphate ATPγN: Adenylyl-imidodiphophate cAMP: cyclic adenosine monophosphate CHESCA: chemical shift covariance analysis CNC: Carney complex CONCISE: COordinated ChemIcal Shifts bEhavior CREB: cAMP Response Element-binding protein SCP: chemical shift perturbation EPK: Eukaryotic Protein kinase EPR: Electron Paramagnetic Relaxation ERK: Extracellular signal-Regulated Kinase FL-HCC: Fibrolamellar Hepatocellular Carcinoma FLC: Fibrolamellar Hepatocellular Carcinoma FPLC: Fast protein liquid chromatography FRET: Förster resonance energy transfer HSQC: Heteronuclear Single Quantum Correlation Spectroscopy ITC: isothermal titration calorimetry KALIP: Kinase Assay Linked with Phosphoproteomic LC-MS: Liquid Chromatography-Mass spectrometry MAPK: Mitogen-Activated Protein Kinase mTOR: mammalian target of rapamycin MD: Molecular Dynamics NMR: Nuclear Magnetic Resonance NMT: N-myristoyltransferase NOE: Nuclear Overhauser Effect vi NOESY: Nuclear Overhauser Enhancement Spectroscopy PCR: Polymerase Chain Reaction PKA: cAMP-dependent protein kinase A PKA-C: catalytic subunit of cAMP-dependent protein kinase A PKA-Cα: catalytic subunit of cAMP-dependent protein kinase A PKI: Protein Kinase Inhibitor PKI5-24: 20 amino acid fragment of Protein Kinase Inhibitor PTMs: post-translational modifications RMSD: Root Mean Square Deviation RMSF: Root Mean Square Fluctuation SAXS: Small angle x-ray scattering SMOAC: Sequential enrichment by Metal Oxide Affinity Chromatography TMS: Tetramethylsilane TOCSY: TOtal Correlated SpectroscopY TROSY: Transverse Optimized Spectroscopy vii Contents Dedication .......................................................................................................................i List of Tables .................................................................................................................ii List of Figures ...............................................................................................................iii List of Abbreviations ....................................................................................................v
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • Tumour-Agnostic Therapy for Pancreatic Cancer and Biliary Tract Cancer
    diagnostics Review Tumour-Agnostic Therapy for Pancreatic Cancer and Biliary Tract Cancer Shunsuke Kato Department of Clinical Oncology, Juntendo University Graduate School of Medicine, 2-1-1, Hongo, Bunkyo-ku, Tokyo 113-8421, Japan; [email protected]; Tel.: +81-3-5802-1543 Abstract: The prognosis of patients with solid tumours has remarkably improved with the develop- ment of molecular-targeted drugs and immune checkpoint inhibitors. However, the improvements in the prognosis of pancreatic cancer and biliary tract cancer is delayed compared to other carcinomas, and the 5-year survival rates of distal-stage disease are approximately 10 and 20%, respectively. How- ever, a comprehensive analysis of tumour cells using The Cancer Genome Atlas (TCGA) project has led to the identification of various driver mutations. Evidently, few mutations exist across organs, and basket trials targeting driver mutations regardless of the primary organ are being actively conducted. Such basket trials not only focus on the gate keeper-type oncogene mutations, such as HER2 and BRAF, but also focus on the caretaker-type tumour suppressor genes, such as BRCA1/2, mismatch repair-related genes, which cause hereditary cancer syndrome. As oncogene panel testing is a vital approach in routine practice, clinicians should devise a strategy for improved understanding of the cancer genome. Here, the gene mutation profiles of pancreatic cancer and biliary tract cancer have been outlined and the current status of tumour-agnostic therapy in these cancers has been reported. Keywords: pancreatic cancer; biliary tract cancer; targeted therapy; solid tumours; driver mutations; agonist therapy Citation: Kato, S. Tumour-Agnostic Therapy for Pancreatic Cancer and 1.
    [Show full text]
  • Phospholipase C-Related Catalytically Inactive Protein: a Novel Signaling Molecule for Modulating Fat Metabolism and Energy Expenditure
    Journal of Oral Biosciences 61 (2019) 65e72 Contents lists available at ScienceDirect Journal of Oral Biosciences journal homepage: www.elsevier.com/locate/job Review Phospholipase C-related catalytically inactive protein: A novel signaling molecule for modulating fat metabolism and energy expenditure * Takashi Kanematsu a, b, , Kana Oue a, c, Toshiya Okumura a, Kae Harada a, 1, Yosuke Yamawaki a, 2, Satoshi Asano a, Akiko Mizokami d, Masahiro Irifune c, Masato Hirata e a Department of Cellular and Molecular Pharmacology, Division of Basic Life Sciences, Institute of Biomedical and Health Sciences, Hiroshima University, Hiroshima, 734-8553, Japan b Department of Cell Biology and Pharmacology, Faculty of Dental Science, Kyushu University, Fukuoka, 812-8582, Japan c Department of Dental Anesthesiology, Division of Applied Life Sciences, Institute of Biomedical and Health Sciences, Hiroshima University, Hiroshima, 734- 8553, Japan d OBT Research Center, Faculty of Dental Science, Kyushu University, Fukuoka, 812-8582, Japan e Fukuoka Dental College, Fukuoka, 814-0193, Japan article info abstract Article history: Background: Overweight and obesity are defined as excessive or abnormal fat accumulation in adipose Received 16 March 2019 tissues, and increase the risk of morbidity in many diseases, including hypertension, dyslipidemia, type 2 Received in revised form diabetes, coronary heart disease, and stroke, through pathophysiological mechanisms. There is strong 17 April 2019 evidence that weight loss reduces the risk of metabolic syndrome by limiting blood pressure and Accepted 19 April 2019 improving the levels of serum triglycerides, total cholesterol, low-density lipoprotein-cholesterol, and Available online 15 May 2019 high-density lipoprotein-cholesterol. To date, several attempts have been made to develop effective anti- obesity medication or weight-loss drugs; however, satisfactory drugs for clinical use have not yet been Keywords: Adipose tissue developed.
    [Show full text]
  • DNAJB1–PRKACA Fusion Kinase Interacts with Β-Catenin and the Liver
    DNAJB1–PRKACA fusion kinase interacts with INAUGURAL ARTICLE β-catenin and the liver regenerative response to drive fibrolamellar hepatocellular carcinoma Edward R. Kastenhubera,b, Gadi Lalazarc, Shauna L. Houlihana, Darjus F. Tschaharganehd,e, Timour Baslana, Chi-Chao Chena, David Requenac, Sha Tiana, Benedikt Bosbachf, John E. Wilkinsong, Sanford M. Simonc, and Scott W. Lowea,h,1 aDepartment of Cancer Biology and Genetics, Memorial Sloan Kettering Cancer Center, New York, NY 10065; bLouis V. Gerstner Jr. Graduate School of Biomedical Sciences, Memorial Sloan Kettering Cancer Center, New York, NY 10065; cLaboratory of Cellular Biophysics, The Rockefeller University, New York, NY 10065; dHelmholtz University Group “Cell Plasticity and Epigenetic Remodeling,” German Cancer Research Center (DKFZ), 69120 Heidelberg, Germany; eInstitute of Pathology, University Hospital, 69120 Heidelberg, Germany; fOncology Target Discovery Program, Pfizer Inc., Pearl River, NY 10965; gDepartment of Pathology, University of Michigan School of Medicine, Ann Arbor, MI 48109; and hHoward Hughes Medical Institute, New York, NY 10065 This contribution is part of the special series of Inaugural Articles by members of the National Academy of Sciences elected in 2017. Contributed by Scott W. Lowe, October 26, 2017 (sent for review September 22, 2017; reviewed by Nabeel M. Bardeesy and David A. Largaespada) A segmental deletion resulting in DNAJB1–PRKACA gene fusion is any known etiological risk factors such as alcoholism, chronic hep- now recognized as the signature genetic event of fibrolamellar hepa- atitis infection, or liver flukes (8). tocellular carcinoma (FL-HCC), a rare but lethal liver cancer that pri- Currently, FL-HCC is diagnosed on the basis of histological marily affects adolescents and young adults.
    [Show full text]
  • The Protein Phosphatase PP2A Plays Multiple Roles in Plant Development by Regulation of Vesicle Traffic—Facts and Questions
    International Journal of Molecular Sciences Review The Protein Phosphatase PP2A Plays Multiple Roles in Plant Development by Regulation of Vesicle Traffic—Facts and Questions Csaba Máthé *, Márta M-Hamvas, Csongor Freytag and Tamás Garda Department of Botany, Faculty of Science and Technology, University of Debrecen, H-4032 Debrecen, Hungary; [email protected] (M.M.-H.); [email protected] (C.F.); [email protected] (T.G.) * Correspondence: [email protected] Abstract: The protein phosphatase PP2A is essential for the control of integrated eukaryotic cell functioning. Several cellular and developmental events, e.g., plant growth regulator (PGR) mediated signaling pathways are regulated by reversible phosphorylation of vesicle traffic proteins. Reviewing present knowledge on the relevant role of PP2A is timely. We discuss three aspects: (1) PP2A regulates microtubule-mediated vesicle delivery during cell plate assembly. PP2A dephosphorylates members of the microtubule associated protein family MAP65, promoting their binding to microtubules. Regulation of phosphatase activity leads to changes in microtubule organization, which affects vesicle traffic towards cell plate and vesicle fusion to build the new cell wall between dividing cells. (2) PP2A-mediated inhibition of target of rapamycin complex (TORC) dependent signaling pathways contributes to autophagy and this has possible connections to the brassinosteroid signaling pathway. (3) Transcytosis of vesicles transporting PIN auxin efflux carriers. PP2A regulates vesicle localization and recycling of PINs related to GNOM (a GTP–GDP exchange factor) mediated pathways. The proper intracellular traffic of PINs is essential for auxin distribution in the plant body, thus in whole Citation: Máthé, C.; M-Hamvas, M.; plant development.
    [Show full text]
  • Studies on Cellular Nutrient Responses and Protein Degradation
    STUDIES ON CELLULAR NUTRIENT RESPONSES AND PROTEIN DEGRADATION APPROVED BY SUPERVISORY COMMITTEE Melanie Cobb, Ph.D. (Mentor) Joel Goodman, Ph.D. (Chair) Paul Sternweis, Ph.D. Joseph Albanesi, Ph.D. DEDICATION: I dedicate this dissertation to my parents and grandparents, for inspiring me to pursue science, and for their unconditional love and support. STUDIES ON CELLULAR NUTRIENT RESPONSES AND PROTEIN DEGRADATION by ANWESHA GHOSH DISSERTATION / THESIS Presented to the Faculty of the Graduate School of Biomedical Sciences The University of Texas Southwestern Medical Center at Dallas In Partial Fulfillment of the Requirements For the Degree of DOCTOR OF PHILOSOPHY / MASTER OF SCIENCE / MASTER OF ARTS The University of Texas Southwestern Medical Center at Dallas Dallas, Texas August, 2015 Copyright by Anwesha Ghosh, 2015 All Rights Reserved iv STUDIES ON CELLULAR NUTRIENT RESPONSES AND PROTEIN DEGRADATION Publication No. Anwesha Ghosh The University of Texas Southwestern Medical Center at Dallas, Graduation Year Supervising Professor: Melanie H. Cobb (Ph.D.) I have worked on two projects. The first project investigates mechanisms involved in cellular responses to amino acids. Amino-acid abundance promotes protein synthesis and cell growth via activation of the protein kinase mTOR, while amino-acid deprivation promotes protein degradation by autophagy. The heterodimeric G protein coupled receptor (GPCR) T1R1-T1R3 can act as an extracellular sensor for amino acids, promoting mTOR activity while repressing autophagy in cells. Quantitative PCR analysis revealed that T1R3 depletion increases mRNA expression of amino acid transporters as a compensatory mechanism induced by perceived starvation. The arrestin proteins can bind GPCRs to mediate their internalization or to facilitate downstream signaling.
    [Show full text]
  • Analyses of PDE-Regulated Phosphoproteomes Reveal Unique and Specific Camp-Signaling Modules in T Cells
    Analyses of PDE-regulated phosphoproteomes reveal unique and specific cAMP-signaling modules in T cells Michael-Claude G. Beltejara, Ho-Tak Laua, Martin G. Golkowskia, Shao-En Onga, and Joseph A. Beavoa,1 aDepartment of Pharmacology, University of Washington, Seattle, WA 98195 Contributed by Joseph A. Beavo, May 28, 2017 (sent for review March 10, 2017; reviewed by Paul M. Epstein, Donald H. Maurice, and Kjetil Tasken) Specific functions for different cyclic nucleotide phosphodiester- to bias T-helper polarization toward Th2, Treg, or Th17 pheno- ases (PDEs) have not yet been identified in most cell types. types (13, 14). In a few cases increased cAMP may even potentiate Conventional approaches to study PDE function typically rely on the T-cell activation signal (15), particularly at early stages of measurements of global cAMP, general increases in cAMP- activation. Recent MS-based proteomic studies have been useful dependent protein kinase (PKA), or the activity of exchange in characterizing changes in the phosphoproteome of T cells under protein activated by cAMP (EPAC). Although newer approaches various stimuli such as T-cell receptor stimulation (16), prosta- using subcellularly targeted FRET reporter sensors have helped glandin signaling (17), and oxidative stress (18), so much of the define more compartmentalized regulation of cAMP, PKA, and total Jurkat phosphoproteome is known. Until now, however, no EPAC, they have limited ability to link this regulation to down- information on the regulation of phosphopeptides by PDEs has stream effector molecules and biological functions. To address this been available in these cells. problem, we have begun to use an unbiased mass spectrometry- Inhibitors of cAMP PDEs are useful tools to study PKA/EPAC- based approach coupled with treatment using PDE isozyme- mediated signaling, and selective inhibitors for each of the 11 PDE – selective inhibitors to characterize the phosphoproteomes of the families have been developed (19 21).
    [Show full text]
  • Towards Relating the Evolution of the Gene Repertoire in Mammals to Tissue Specialisation
    Towards Relating the Evolution of the Gene Repertoire in Mammals to Tissue Specialisation Shiri Freilich Wolfson College This dissertation is submitted to the University of Cambridge for the degree of Doctor of Philosophy 21 December 2006 To Leon, who was the wind blowing in my sails, in the deep blue sea of this journey of ours. This Thesis is the result of my own work and includes nothing which is the outcome of work done in collaboration except where specifically indicated in the text. This Thesis does not exceed the specified length limit of 300 pages as defined by the Biology Degree Committee. This Thesis has been typeset in 12pt font according to the specifications defined by the Board of Graduate Studies and the Biology Degree Committee. 3 Summary: Towards Relating the Evolution of the Gene Repertoire in Mammals to Tissue Specialisation The sequencing efforts of recent years have provided a rich source of data for investigating how gene content determines similarity and uniqueness in a species’ phenotype. Work described in this PhD Thesis attempts to relate innovations in the gene repertoire along the mammalian lineage to the most obvious phenotypic characteristic of animals: the appearance of highly differentiated tissue types. Several different approaches, outlined below, have been followed to address some aspects of this problem. Initially, a comprehensive study of the pattern of expansion of the complement of enzymes in various species was performed in order to obtain a better view of the principles underlying the expansion of the gene repertoire in mammals. Although several studies have described a tendency toward an increase in sequence redundancy in mammals, not much is known about the way such sequence redundancy reflects functional redundancy.
    [Show full text]
  • Antigen-Specific Memory CD4 T Cells Coordinated Changes in DNA
    Downloaded from http://www.jimmunol.org/ by guest on September 24, 2021 is online at: average * The Journal of Immunology The Journal of Immunology published online 18 March 2013 from submission to initial decision 4 weeks from acceptance to publication http://www.jimmunol.org/content/early/2013/03/17/jimmun ol.1202267 Coordinated Changes in DNA Methylation in Antigen-Specific Memory CD4 T Cells Shin-ichi Hashimoto, Katsumi Ogoshi, Atsushi Sasaki, Jun Abe, Wei Qu, Yoichiro Nakatani, Budrul Ahsan, Kenshiro Oshima, Francis H. W. Shand, Akio Ametani, Yutaka Suzuki, Shuichi Kaneko, Takashi Wada, Masahira Hattori, Sumio Sugano, Shinichi Morishita and Kouji Matsushima J Immunol Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Author Choice option Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Freely available online through http://www.jimmunol.org/content/suppl/2013/03/18/jimmunol.120226 7.DC1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material Permissions Email Alerts Subscription Author Choice Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2013 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 24, 2021. Published March 18, 2013, doi:10.4049/jimmunol.1202267 The Journal of Immunology Coordinated Changes in DNA Methylation in Antigen-Specific Memory CD4 T Cells Shin-ichi Hashimoto,*,†,‡ Katsumi Ogoshi,* Atsushi Sasaki,† Jun Abe,* Wei Qu,† Yoichiro Nakatani,† Budrul Ahsan,x Kenshiro Oshima,† Francis H.
    [Show full text]
  • PRKACA Mediates Resistance to HER2-Targeted Therapy in Breast Cancer Cells and Restores Anti-Apoptotic Signaling
    Oncogene (2015) 34, 2061–2071 © 2015 Macmillan Publishers Limited All rights reserved 0950-9232/15 www.nature.com/onc ORIGINAL ARTICLE PRKACA mediates resistance to HER2-targeted therapy in breast cancer cells and restores anti-apoptotic signaling SE Moody1,2,3, AC Schinzel1, S Singh1, F Izzo1, MR Strickland1, L Luo1,2, SR Thomas3, JS Boehm3, SY Kim4, ZC Wang5,6 and WC Hahn1,2,3 Targeting HER2 with antibodies or small molecule inhibitors in HER2-positive breast cancer leads to improved survival, but resistance is a common clinical problem. To uncover novel mechanisms of resistance to anti-HER2 therapy in breast cancer, we performed a kinase open reading frame screen to identify genes that rescue HER2-amplified breast cancer cells from HER2 inhibition or suppression. In addition to multiple members of the MAPK (mitogen-activated protein kinase) and PI3K (phosphoinositide 3-kinase) signaling pathways, we discovered that expression of the survival kinases PRKACA and PIM1 rescued cells from anti-HER2 therapy. Furthermore, we observed elevated PRKACA expression in trastuzumab-resistant breast cancer samples, indicating that this pathway is activated in breast cancers that are clinically resistant to trastuzumab-containing therapy. We found that neither PRKACA nor PIM1 restored MAPK or PI3K activation after lapatinib or trastuzumab treatment, but rather inactivated the pro-apoptotic protein BAD, the BCl-2-associated death promoter, thereby permitting survival signaling through BCL- XL. Pharmacological blockade of BCL-XL/BCL-2 partially abrogated the rescue effects conferred by PRKACA and PIM1, and sensitized cells to lapatinib treatment. These observations suggest that combined targeting of HER2 and the BCL-XL/BCL-2 anti-apoptotic pathway may increase responses to anti-HER2 therapy in breast cancer and decrease the emergence of resistant disease.
    [Show full text]
  • Analysis of the Indacaterol-Regulated Transcriptome in Human Airway
    Supplemental material to this article can be found at: http://jpet.aspetjournals.org/content/suppl/2018/04/13/jpet.118.249292.DC1 1521-0103/366/1/220–236$35.00 https://doi.org/10.1124/jpet.118.249292 THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS J Pharmacol Exp Ther 366:220–236, July 2018 Copyright ª 2018 by The American Society for Pharmacology and Experimental Therapeutics Analysis of the Indacaterol-Regulated Transcriptome in Human Airway Epithelial Cells Implicates Gene Expression Changes in the s Adverse and Therapeutic Effects of b2-Adrenoceptor Agonists Dong Yan, Omar Hamed, Taruna Joshi,1 Mahmoud M. Mostafa, Kyla C. Jamieson, Radhika Joshi, Robert Newton, and Mark A. Giembycz Departments of Physiology and Pharmacology (D.Y., O.H., T.J., K.C.J., R.J., M.A.G.) and Cell Biology and Anatomy (M.M.M., R.N.), Snyder Institute for Chronic Diseases, Cumming School of Medicine, University of Calgary, Calgary, Alberta, Canada Received March 22, 2018; accepted April 11, 2018 Downloaded from ABSTRACT The contribution of gene expression changes to the adverse and activity, and positive regulation of neutrophil chemotaxis. The therapeutic effects of b2-adrenoceptor agonists in asthma was general enriched GO term extracellular space was also associ- investigated using human airway epithelial cells as a therapeu- ated with indacaterol-induced genes, and many of those, in- tically relevant target. Operational model-fitting established that cluding CRISPLD2, DMBT1, GAS1, and SOCS3, have putative jpet.aspetjournals.org the long-acting b2-adrenoceptor agonists (LABA) indacaterol, anti-inflammatory, antibacterial, and/or antiviral activity. Numer- salmeterol, formoterol, and picumeterol were full agonists on ous indacaterol-regulated genes were also induced or repressed BEAS-2B cells transfected with a cAMP-response element in BEAS-2B cells and human primary bronchial epithelial cells by reporter but differed in efficacy (indacaterol $ formoterol .
    [Show full text]