The PDGFC CUB Domain Enhances Survival in PDGFC Mutant Mice Brian J

www.symbiosisonline.org Symbiosis www.symbiosisonlinepublishing.com

Research article SOJ Immunology Open Access

The PDGFC CUB Domain Enhances Survival in PDGFC Mutant Mice Brian J. Hayes1, Kimberly J. Riehle1,2, Debra G. Gilbertson3, Wendy R. Curtis3, Edward J. Kelly4, Piper M. Treuting5 and Jean S. Campbell1* 1Department of Pathology, University of Washington, Seattle, WA 98195, USA 2Department of Surgery, University of Washington, Seattle, WA 98195, USA 3Zymogenetics Inc, a Bristol-Myers Squibb Company, Seattle, WA 98102, USA 4Department of Pharmaceutics, University of Washington, Seattle, WA 98195, USA 5Department of Comparative Medicine, University of Washington, Seattle, WA 98195, USA

Received: May 01, 2015; Accepted: August 27, 2015; Published: September 14, 2015

*Corresponding author: Jean S. Campbell, Executive Director of Research and Development, Oncosec Medical, 434 N. 34th St, Suite 100; Seattle, WA 98103, USA, Tel: +(206) 221-5422; E-mail: [email protected]

PDGF-AA, PDGF-BB, and PDGF-AB are secreted as active Absract dimers [8], while PDGF-CC and PDGF-DD are secreted as Platelet-derived growth factor (PDGF) signaling pathways are inactive homodimers requiring extracellular cleavage of an necessary for normal development. Here we report a homozygous N-terminal complement components C1r/C1s sea urchin EGF Pdgf-c mutant mouse that is viable. In this mouse, alternative splicing bone morphogenic protein 1 (CUB) domain to allow receptor gives rise to a truncated transcript containing the entire coding binding (Figure 1a)[9-12]. All PDGFs share a common growth region of the complement components C1r/C1s sea urchin EGF bone factor domain (GFD), which is 110 amino acids long and contains majority of the Growth Factor Domain (GFD). A mutant protein is 8 conserved cysteines that facilitate intra- and intermolecular translatedmorphogenetic from the protein truncated 1 (CUB) sequence domain in vitro. of PDGFC However, but the lacking viability the of our homozygous mutant Pdgf-c mice depends on the presence of through the GFD, and mutations of these cysteines and loss of both Pdgfrα alleles. disulfide bonds [13]. PDGF signal transduction is mediated

Keywords: [14,15]. Furthermore, mutation of sequences in loops I, II, or III their disulfide bonds cause a lack of PDGFR signal transduction PDGFC; Cleavage, Growth factor; Knockout Introduction signalof the transduction GFD, the domain by Pdgf that-c thus physically should interacts require the with conserved PDGFRs, decreases the GFD’s ability to bind PDGFRs [16-18]. Effective The platelet-derived growth factor (PDGF) signal transduction cysteines and loops I-III of the GFD, as well as cleavage of the CUB domain. We hypothesized that deletion of the majority of the GFD would thus eliminate receptor binding and downstream andpathway deletion has ofimportant Pdgf-a, -b, functions or –c results in development. in perinatal Mice lethality lacking in signal transduction. Contrary to our hypothesis, we describe a PDGF receptor (PDGFR) -α or –β are embryonic lethal [1,2], homozygous Pdgf-c mutant mouse wherein most of the GFD is in Pdgf-a and Pdgf-c In vitro studies demonstrate indeed deleted, but the expression of the CUB domain in these thathomozygous PDGF-AA, Knockout -BB, and -CC(KO) induce animals, Pdgf thoughrα dimerization, live births PDGF-BB, are seen and PDGF-DD induce KO dimerization mice [3-5]. of Pdgfrβ, and -AB, -BB, and Pdgfrα mice is sufficient for viability. Viability, however, depends on in vitro mutations [19,20]. genetic background, as has been described for other binding studies, Pdgf-b Pdgf-b -CC induce αβ -receptor dimerization [6]. As predicted by Methods KO mice have a phenotype similar to Mouse Models KO mice, with defects in kidney and hematologic Pdgf developmentrα, which [2,4]. Mice lacking PDGFA have a defect in lung development The Pdgf-c locus was isolated from a 129S5/SvEvBrd genomic [3], and interestingly do not phenocopyPdgf deletion-c of causes abnormalitiestm1nagy in skeletal development and neural crest to as Pdgfc , have a defect in palate formation, resulting from BAC library. The targeting construct replaced a 5 kb genomic migration [1,7]. On the other hand, KO animals, referred abnormal neural crest cell migration and proliferation [5]. Ding, region on chromosome 3 with an IRES LacZ MC1 Neo cassette. et al. [5], further reported that Pdgf-a, Pdgf-c The homologous arms consisted of a 3 kb 5’ fragment and a 2.1 kb a phenotype similar to Pdgfrα that PDGF-C is 3’ fragment. Lex-1 129S5/SvEvBrd ES cells were transfected withc-2J double KO mice have generate chimeras. Chimeras were bred to albino C57BL/6J-Tyr a major activator of Pdgfrα signal transduction in the context of the targeting construct and injected into C57BL/6 blastocysts to development. KO mice, suggesting mice (The Jackson Laboratory) to generate F1 progeny. F1 hybrids were crossed to generate initial Mendelian ratios (Table 1). Mice Symbiosis Group *Corresponding author email: [email protected] The PDGFC CUB Domain Enhances Survival in PDGFC Mutant Mice Copyright: © 2015 Campbell et al.

Figure 1: Design of targeting constructs to inactivate PDGF-C. a) A linear diagram of the PDGF-C protein showing the CUB (orange) and GFD (green) above the exons that correspond to these protein domains. b) The targeting strategy for Pdgfctm1lex mice, which removes exons 4 and 5. c) The targeting strategy for the Pdgftm1nagy complement components C 1r/C1s sea urchin EGF b strain, which removes exon 2 Ding, et al. [5] Abbreviations : splice acceptor (SA), internal ribosomal entry site (IRES), Neomycin). one morphogenic protein 1 (CUB), beta galactosidase neomycin fusion protein ( β GEO), fusion polyprotein (A) tail (pA), Lac Z gene encoding beta galactosidase (Lac Z), enhancer, promoter, and neomycin phosphotransferase (MC1/ HSVtk and

approved facility, and all experiments were performed with the were further backcrossed to a C57BL/6 background six times Universityfor the Assessment of Washington and Accreditation Institutional of LaboratoryAnimal Care Animal and CareUse Centersto generate (http://www.mmrrc.org/index.php the Mendelian ratio for C57BL/6) supported (Table 1). by These the Committee approval. NIH.mice canHemizygous be obtained Pdgf fromrα mice, the Mutant Pdgfra tm11(egfp)sorMouse Regional, were purchased Resource Necropsy and Histology

housed at the University of Washington, which is an Association Homozygote Pdgfctm1lex from The Jackson Laboratory (stock # 007669). Animals were mice (n = 4) and WT C57BL/6 Citation: Page 2 of 11

Hayes BJ, Riehle KJ, Gilbertson DG, Curtis WR, Kelly EJ, et al. (2015) The PDGFC CUB Domain Enhances Survival in PDGFC Mutant Mice. SOJ Immunol 3(3): 1-11. DOI: http://dx.doi.org/10.15226/soji/3/3/00133 The PDGFC CUB Domain Enhances Survival in PDGFC Mutant Mice Copyright: © 2015 Campbell et al.

Table 1: Heterozygous Pdgfctm1lex No. of Cohort breeding +/+ pairs in two backgrounds produce Pdgfcoffspringtm1lex/+ with normal Mendelian Pdgfctm1lex distribution. / Pdgfctm1lex Chi sq value animals 129Sv/EvBrd observed 99 50 0.19

expected 2625 50 2325 C57BL/6 observed 55 147

male 265 63 3.7 observed 29

expected 146 37 8373 3437 3.1 female observed 119 29

expected 2630 6459 30 0.83 Pdgfctm1lex/+ mice were bred and the genotypes of the resulting offspring were determined from DNA extracted from

Male and female heterozygous tail snips by PCR. Two different genetic backgrounds, 129SvBrd and C57BL/6, were analyzed. The expected number of pups with a specific genotype was calculated based on the total number of pups analyzed. Analysis of normal Mendelian distribution was determined by Chi square analysis with two degrees of freedom. A Chi square number greater than 5.99 is statistically significant. ethan

2 asphyxiation followed by complete necropsy. Blood was collectedlittermates for (n chemistry = 4) aged and 5 andcomplete 8 weeks blood were counts euthanized performed by ol precipitation and resuspension in Tris-HCl 10mM EDTA CO 1mM pH 7.4 (TE). Polymerase chain reaction was carried out with 0.5 U GemTaq (MGQuest), supplied 5x buffer, and dNTPs to a final by Phoenix Central Laboratories (Everett, WA). Tissues were concentration of 0.2mM with primers 5’ CCTGGTCAAGCGCTGTGG collected for histological analysis with immersion fixation in 10% 3’(200nM), 5’ TCTGGATTCATCGACTGTGG 3’(200nM), 5’ phosphate-buffered formalin, 4-6 µm sections were made and ACGGCTAACATGGAGCACG 3’ (100 nM). All primers were adrenalstained withglands, hematoxylin gallbladder, and brown eosin. Tissuesand white examined adipose included: tissue, designed using Oligo Calc [21]. Cycling conditions were 95°C for lungs, esophagus, trachea, liver, kidneys, heart and great vessels, exocrine and endocrine pancreas, spleen, thyroid, submandibular, 3 min, and 35 cycles of 95°C for 20 sec, 60°C for 30 sec, and 72°C parotid and sublingual salivary glands, mesenteric lymph nodes, forSouthern 30 sec with blotting a final extension at 72°C for 10 min.

mesentery, preputial or clitoral glands, skeletal muscle, bladder, - and small intestine, glandular and non-glandular stomach, The targeting construct was verified using standard methods uterusmale accessory and cross sex section glands, of testesthe head or (eyes, ovaries, middle haired and skin, internal large as described [22]. Briefly, genomic DNA was extracted as de ears, oral and nasal cavities, cerebrum, cerebellum, olfactory scribed above and purified DNA was restriction digested using lobes, brain stem, pituitary, tongue and teeth). All tissues were from Pdgfctm1lex homozygous, heterozygous, and wild-Type (WT) miceEcoR1 was HF loaded(New England onto a Tris-acetate-EDTABiolabs) at 37°C overnight. (TAE) gel. 10µg Following of DNA

wereexamined processed by a board-certified by eviscerating, Veterinary removing Pathologistthe brain and (PMT) as much and given a morphological diagnosis where applicable. Skeletons pHelectrophoresis, 7.4. DNA was the transferred gel was denatured to Hybond in N+ 0.4M (GE NaOH, Healthcare) 1.5 M NaCl ny- ethanol for at least 72 hours, placed in acetone overnight, and for 10min followed by neutralization in Tris-HCl with 1.5M NaCl, muscle tissue and fat as possible, followed by immersion in 95% lon membrane in 10x SSC and cross-linked in a Stratalinker 1800- stained the next night at 37°C with a solution of 70% ethanol, 5% (Stratagene). Exonic DNA including exon 6 and the 3’ UTR was glacial acetic acid, 11.6 µM Alcian blue, and 14.6 µM Alizarin red. used as a probe, amplified by 5’ CCTTTTAGGTCCTTCAGTTGAGA The following day the skeletons were washed in 95% ethanol P] dCTP using random decamers CC 3’ and 5 ATCTATGCAAACAGGTTGGAGAAATCC32 3’. The probe and cleared in 2% KOH for 2 days and transferred to 1% KOH was labeled with 50 µCi [α- until fully cleared, with the solution refreshed every 2 to 3 days (DECAprime II, Ambion) to a specific activity >108 dpm/µg. The until soft tissues were cleared, at which point the skeletons were blot was prehybridized with Quickhyb (Stratagene) at 68°C for transferredGenotyping to 100% glycerol. 30 min and then incubated with the denatured probe (106dpm/ Genomic DNA was extracted from mouse tails by incubation ml) at 68°C for 2 hr. Labeled membranes were then washed in 2x SSC with 0.1% SDS and 0.2x SSC with 0.1% SDS at 60°C for 30 min each. The sizes of the digested genomic DNA were confirmed pHovernight 8.0). Phenol at 55°C chloroform in 20 µg/ml extraction Proteinase was performed,K (life technologies) followed byin (Fermentas). lysis buffer (200 mM NaCl, 1% W/V SDS, 10mM Tris-HCl, 1 mM EDTA by comparison with 32P- dCTP end-labeled λHin III DNA marker

Citation: Page of 11

Hayes BJ, Riehle KJ, Gilbertson DG, Curtis WR, Kelly EJ, et al. (2015) The PDGFC CUB Domain Enhances Survival in PDGFC 3 Mutant Mice. SOJ Immunol 3(3): 1-11. DOI: http://dx.doi.org/10.15226/soji/3/3/00133 The PDGFC CUB Domain Enhances Survival in PDGFC Mutant Mice Copyright: © 2015 Campbell et al.

RT-PCR analysis

pH 6.8 with 7 µl beta-mercaptoethanol per ml. Blots were then reprobed with anti-ERK1/2 pAb 7884 followed by secondary Tissues were collected and flash frozen immediately in liquid Image J software (NIH) and is presented as the relative value of the manufacturer’s instructions, and cDNA synthesized from and ECL as above. Densitometry analyzes were performed using nitrogen. RNA was extracted with Trizol (Invitrogen) as per the phosphorylated protein normalized to the total levels of the same protein after re-probing. 0.5 µgRNA. Primers (F1) 5’ CTCACGTGTGCTGCTACGAAGG 3’ Results and (R3) 5’ CCCTGCGATTCTCTGCTGCC 3’ were used with the following conditions; 95°C for 3 min, and 35 cycles of 95°C for 15 Homologous recombination targeting strategy sec, 58°C for 15 sec, and 72°C for 30 sec with a final extension at We examined a Pdgf-c mutant mouse, Pdgfctm1lex, in which 72°CCloning for 10min. exons 4 and 5 of the GFD are deleted using the targeting strategy tm1lex WT and Pdgfc depicted in Figure 1b. Surprisingly, a viable mouse resulted from - this approach; in contrast to the Pdgf-c Pdgf cDNA-c and was Pdgf amplifiedctm1lex sequences. with primers WT cDNA 5’ in perinatal lethality (Pdgfctm1nagy, Figure 1c). Figure 1 shows the GCCCTCGCCCCAGTCAGC 3’ and 5’ CTCACGTGTGCTGCTAC KO mice, which results GAAGG 3’ to generate protein domain structure of PDGF-C and compares the different was amplified with primers 5’ ATGGTGGTGAATCTAAATCTCCTC targeting approaches used to generate the two mutant strains. Pdgfctm1lex mice were derived from a 129S5/SvEvBrd embryonic and3’ and the 5’ Pdgf CTCACGTGTGCTGCTACGAAGG-c signal peptide for secretion 3’ towas generate added tothe the GFD 5’ construct. Additionally, a sequence containing a Kozak sequence- replace exons 4 and 5. This strategy should eliminate transcription GCTCCTCCTCGGCCT-CCTCCTGCTGACATCTGCCCTGGCCGGC- stem cell line (Lex1) targeted by homologous recombination to end of the GFD by Amplification (i.e., 5’GCAGAATTGCCACCAT of the entire GFD (Figure 1b). Pdgfctm1nagy mice were derived from

tm1lex CAAAGAACGGGGACTCGGGCTGAGTCC3’).The Pdgf-c, Pdgfc , and GFD sequences were cloned separately into pEF1/myc R1 embryonic stem cells targeted by homologous recombination but retained the termination codons which prevent translation CUBto replace and GFD. exon 2 of PDGFC with an SA-IRES-β-geo-pA cassette -His B plasmids (Life Technologies), [5], preventing transcription downstream of β -geo, including the England Biolabs). Verification of recombination of the myc-His tag. The plasmids were linearized with Mlu I (New Transfection and production of conditioned media (CM) we performed Southern blotting on genomic DNA isolated To confirm that our selectiontm1lex cassette was targetedtm1lex correctly, ® ™ from homozygous Pdgfc , heterozygous Pdgfc , and WT

2. Transfections were performed using Cells [HEK293](ATCC CRL1573 ) were maintained at 37°C littermates. Digestion of genomic DNA with EcoRI should produce 95% humidity with 5% CO a 12.4 kb band including exons 4, 5, 6, and the 3’ untranslated the calcium phosphate method as described [23], and the cells Pdgfctm1lex mice (Figure 2a). A region (UTR) from WT DNA, and a 6.5 kb band including exon 6 emptywere subjected vector to(pEF1empty), 500 µg/ml G418pEF1Pdgfc (Life Technologies)GFD, pEF1Pdgfc formut , twoor P labeled DNA probe with a complementary sequence to exon and32 the 3’ UTR in correctly targeted pEF1Pdgfcweeks to FL select to produce for cells untagged expressing proteins, the followingPdgf-cGFD, Pdgf constructs:-cmut and Pdgf-c Pdgf-cFL 6 and the 3’ UTR of was used to detect these 12.4 and 6.5 media for 24 hours, at which point media were collected and detected for homozygous Pdgfctm1lex, heterozygous Pdgfctm1lex, and respectively. Confluent cultures were allowed to condition WTkb bands mice (Figureby hybridization 2b). and bands of the expected size were

express Pdgfrα (BHK 570), and BHK cells transfected with Pdgfrα tm1lex frozen at -80°C. Baby Hamster Kidney (BHK) cells, which do not Pdgfc transcription and translation

Immunoblot analysis (BHK Rα) were a kind gift from Dr. Daniel Bowen-Pope [24]. production of the expected Pdgfctm1lex transcript, which should 3.4 Given our Southern blotting results, we next verified SDS-PAGE and immunoblotting were carried out as described Pdgf-c (Figure [25]. For PDGF-C detection membranes were incubated with goat anti-mouse PDGF-C result from transcription of exons 1, 2, and 3 of followed by incubation with an anti-goat Horseradish Peroxidase 1c). AttemptslacZ to amplify a transcript containing exon 3 and the antibody (1:1000, AF1447 R&D Systems) (datainternal not ribosomal shown), suggestingentry site (IRES)the targeting (Figure construct 3a, primers may F1 have and R1) or (Figure 3a, F1 and R2) did not produce a product Pdgfctm1lex cDNA (HRP) conjugated secondary antibody and detection performed 9101with ECLCell (Pierce).Signaling For Technology) ERK and p-ERKfollowed detection, by an membranesanti-rabbit facilitated skipping the KO cassette. RT-PCR of conjugatedwere first incubated secondary with antibody. anti-phospho Primary p44/42 antibody; MAPK secondary (1:1000, using primers F1 and R3 (Figure 3a) generated a 296 bp band, regionconsistent corresponding with a transcript to WT exonsin which 4 and exons 5 was 1, removed,2, 3 and 6 but remain exon and imaged with a Storm 840 phosphor imager (GE Healthcare). (Figure 3b). Sequencing this amplicon revealed that indeed the antibody complexes were detected with ECL Plus (GE Healthcare) truncated transcript (Figure 4). To detect the full-length coding region of 6 was spliced in frame to the 3’ end of exon 3 to create a Immunoblots were then stripped with 2% SDS, 62.5 mM Tris, Citation: Page 4 of 11

Figure 2: Pdgf-c locus in the Pdgfctm1lex wild type mouse and a Pdgfctm1lex Pdgfctm1lex mice.Recombination at the mouse. a) The anticipated results from EcoR1 digestion of genomic DNA from a mouse. d) Southern blot of genomic DNA digested with EcoRI from wild type, heterozygous, and homozygous

Figure 3: Pdgf-c locus in Pdgfctm1lex mice, and protein is expressed from this sequence. a) Diagram of the

An alternative mRNA is transcribed from the Pdgfctm1lex mice are shown, producing products of 722 bp for Pdgf-csplicing of wild type and Pdgfc mutanttm1lex. PDGFC with various PCR primers (F1, F2, R1, R2, R3, and R4) used to detect transcripts. b) Amplicons generated by vectorRT-PCR (empty), (F1 and theR3) GFDof RNA (Pdgf-c fromGFD kidneys), Pdgfc tm1lexof wild (Pdgf-c type,mut heterozygous,), or full-length and Pdgf-c homozygous (Pdgf-cFL ). The size of DNA ladder (b) and protein standards (c) are shown andto the 296 left bp of for each image. c) Immunoblot of conditioned media from transfected HEK293 cells expressing the coding sequences for an empty

Citation: Page 5 of 11

Signal transduction in response to conditioned and found that the Pdgfctm1lex transcript retains the endogenous medium PDGFC, we designed primers to anneal to the 5’ and 3’ UTRs, To demonstrate that the CUB domain of Pdgf-c could an elements (data not shown). 5’ and 3’ UTRs (Figure 3a, F2 and R4) and associated regulatory activates Pdgfrα The Pdgfctm1lex mutant transcript is expected to have an expression pattern similar to WT Pdgf-c, given that the selection , we assessed ERK phosphorylation in BHK cassette did not alter the Pdgf-c expressingcells treated Pdgf with-c CUB, various Pdgf-c ConditionedGFD, or an empty Media vector (CM). control. Media translated protein product of Pdgfctm1lex is expected to contain the were conditioned by HEK293 cells transfected with plasmidsPdgfrα, 5’ and 3’ regulatory elements. The When CM was added to BHK 570 cells, which have no C-terminal 38 amino acids of the GFD and the entire CUB domain, whichno phosphorylation have been transfected of ERK waswith detectedPdgfrα , phosphorylation (data not shown). of When conditioned medium α was cells added to BHK R α , codingresulting regions in a predicted for full molecularlength Pdgf weight-c (Pdgf of -c22.5fl), PdgfkDa.ctm1lex We found(Pdgf- cthatmut), HEK293or Pdgf-c cellsGFD ( transfectedPdgf-cGFD) secrete with proteins plasmids of expressing the predicted the molecular weights into culture media, as determined by ERK was detected in a time-dependent manner, with maximal phosphorylation attained after five minutes of exposure Pdgf-cFL, Pdgf-cmut and Pdgf- (Figure 5a). Media conditioned by HEK293 cells transfected cGFD, are all stable protein products. immunoblot analysis (Figure 3c). Thus towith a lesser an empty extent vector than the control PDGF-C interestingly constructs, didsuggesting show ERKthat phosphorylation in BHK R α cells but not in BHK 570 cells, albeit

Figure 4: Pdgfctm1lex consensus mouse sequence for PDGFC, CCDS17425.1. Exon junctions are indicated above the consensus sequence. Sequence of cDNA from the 296 bp band shown in 3b compared to the

Citation: Page of 11

Hayes BJ, Riehle KJ, Gilbertson DG, Curtis WR, Kelly EJ, et al. (2015) The PDGFC CUB Domain Enhances Survival in PDGFC 6 Mutant Mice. SOJ Immunol 3(3): 1-11. DOI: http://dx.doi.org/10.15226/soji/3/3/00133 The PDGFC CUB Domain Enhances Survival in PDGFC Mutant Mice Copyright: © 2015 Campbell et al.

Pdgfctm1lex mice that can signal through Pdgfrα were examined histologically and did not differ from those of transfection of HEK293 cells induces the release of a molecule WTwith littermates; the C57BL/6 clinical background chemistry [26]. and Brains blood ofcounts were also When BHK Rα cells are exposed recombinantto increasing Pdgfratio-c of CM to fresh medium we see an increase in Genotype ratios intensity Pdgfof ERK-c GFD phosphorylation and Pdgf-c just as increasing the amount of unremarkable (data not shown). increases ERK phosphorylation (Figure 5b). CM from CUB domain transfected HEK 293 of heterozygote Pdgfctm1lex breeding pairs on two genetic cells maintains some ability to induce ERK phosphorylation even We observed normal Mendelian ratios in the offspring Anatomic characterization at low CM ratio to fresh medium. in Pdgfctm1lex mice up to 12 months of age and did not see sex- Pdgfctm1lex backgrounds (Table 1). We did not observe premature death as has been reported for Pdgfctm1nagy mice [20]. Similar to Originally derived on a 129S5/SvEvBrdPdgfctm1lex progeny background, had a hunched dependent differences in viability on the C57BL/6 background, mice were backcrossed to a C57BL/6 background. Homozygous Pdgfctm1lex F1 C57BL/6 x 129S5/SvEvBrd Fredriksson L, et al. [6] we observed a statistically significant (dataappearance, not shown). and All gross other skeletal organs analyzes were grossly demonstrated normal. After spina six whetherdecrease Pdgf in bodyrα necessary mass in for C57BL/6 normal development mice in at Pdgf 3 andctm1lex 7 bifida (Figure 5a and 5b), which was confirmed by histology mice,months we (a intercrossed 17 to 24% hemizygousdecrease, data Pdgf notrα mice shown). with Toheterozygous determine homozygous Pdgfctm1lex Pdgfctm1lex mice. Progeny resulting from this cross did not include backcrosses, no overt anatomical differences were noted between mice that were homozygous Pdgfctm1lex; hemizygous Pdgfrα (Table mice and WT C57BL/6 littermates,Pdgf i.e.ctm1lex the 2). Neonatal mice homozygous for Pdgfctm1lex and hemizygous for spina bifida phenotype was rescued. Comprehensive histological Pdgfrα lesions,analyses such(see methods)as dermatitis conducted or mild on multifocal5 and 8-week extramedullary old age of weaning. This result is surprising, as hemizygous Pdgfrα homozygous mice were unremarkable or showed incidental mice are were phenotypically born but failed normal to thrive [1,27]; and we100% thus died conclude prior to that the

hematopoiesis in the liver, which are known to be associated

Figure 5: - PDGF-C CUB domain stimulates modest ERK phosphorylation in BHK cells expressing PDGFRα. HEK293 cells were transfected with an empty vector (empty), the CUB domain of PDGF-C (CUB), or the growth factor domain of PDGF-C (GF) and the conditioned media (CM) was trans transfectedferred to BHK with cell Pdgfrα lines expressing PDGFRα. a) Time-dependent ERK phosphorylation by PDGF-C CUB, PDGF-C GF, or empty vector (E). Immunoblot phospho-ERK1/2 in BHK Rα cells after addition of CM. corresponding densitometry measurements are shown to the right. b) Varying amounts of GF CM, CUB CM, and empty vector CM with non-CM stimulated ERK phosphorylation while DMEM (left lane) and DMEM conditioned from non-transfected HEK293 cells weakly phosphorylated ERK. Corresponding densitometry measurements are shown to the right. Note: no phosphorylation of ERK was seen in the parental BHK cells under similar conditions (data not shown). Citation: Page 7 of 11

Table 2: Heterozygous pdgfctm1lex breeding pairs with one copy of pdgfrα do not produce pdgfctm1lex homozygous and hemizygous pdgfrα offspring. Pdgfc+/+ Pdgfc+/- Pdgfc-/- Pdgfc+/+ Pdgfc+/- Pdgfc-/- Cohort No. of animals Chi sq value Pdgfrα +/- Pdgfrα +/- Pdgfrα +/- Pdgfrα +/+ Pdgfrα +/+ Pdgfrα +/+ observed 127 14 27 0 20 50

expected 16 30 Pdgfrtm1lex /+ mice, with a single copy of Pdgfrα, were bred, and the genotypes of the resulting offspring were 16 32 16 16 32 16 Male and female heterozygous determined from DNA extracted from tail snips by PCR. The Pdgfc-/-expected represents number of Pdgfc pupstm1lex with / tm1lexa specific mice. genotype was calculated based on the total number of pups analyzed. Analysis of normal Mendelian distribution was determined by Chi squared analysis with five degrees of freedom. A Chi square number greater than 11.07 is statistically significant.

Figure 6: Anatomic characterization of Pdgfctm1lex mice. mice have normal thoracic and lumbar vertebrae. Pdgfctm1lex homozygous mice. a) 129Sv/EvBrd x C57BL/6 F1 wild type b) Spina bifida in the thoracic and lumbar region (arrow) of Pdgfctm1lex viability requires two alleles of Pdgfrα. Histological and the remainder of exon 4 was replaced with viral and bacterial gross anatomical analysis of these neonatal animals revealed

sequences (IRES and Lac Z, respectively), which are incompatible with eukaryotic splicing machinery. The removal of the 3’ end of severe spina bifida encompassing a region from vertebraePdgfctm1nagy T11 to the inability of U1 to enhance splice site recognition [29]. The exon 4 makes splicing at this particular sequence less likely, due mice,to L1 (Figurehomozygous 6 a-c). MicroscopicPdgfctm1lex; hemizygousanalysis revealed Pdgfrα demyelinated mice had palatoschisis.spinal cords These with excessive genetic data blood indicate infiltration. that PDGF-C Likemut interacts 14 basestm1lex remaining of the endogenous exon 4 sequence are likely with Pdgfrα in some novel way, as Pdgfctm1nagy mice have reduced Pdgfc mice. insufficient to promote splicing, and thus lead to exon skipping in viability, while Pdgf tm1lex mice have lethality only in conjunction c The presumed Pdgf-c protein that is translated from with hemizygous . Pdgfrα Pdgfctm1lex should not have any GFD function, as paralogs of Discussion PDGF-C, PDGF-A and PDGF-B, require cysteines for dimerization and intramolecular and intermolecular folding [14,15]. We PDGF signaling is essential for normal development. In this hypothesized that the Pdgfctm1lex protein product (Pdgf-cmut), study we analyzed a new PDGF-C mutant mouse strain and demonstrate that the homologous recombination strategy in or absent GFD signal transduction activity. Pdgf-cmut is also this mouse results in an alternatively spliced mutant form of missinglacking 6 the of the paralogous 8 conserved loops, cysteines, I and IIwould of the have GFD, compromised which are Pdgf-c necessary for receptor binding by the PDGF-C paralog, Pdgf-b that lacks over 60% of the RNA encoding the GFD, but activation by the PDGF paralogs Placental Growth Factor (PlGF) whichexpresses is a complicatedthe entire portion event relyingof RNA onencoding proper thesequence CUB domain. of both [16,18]. Loop I has also been shown to be critical for receptor This truncated transcript likely results from pre-mRNA splicing,

tm1lex the exons themselves [28]. The targeting construct in Pdgfc Candmut, Vascularbut is not Endothelial expected to Growth bind Pdgf Factorrα in the B (VEGFB), absence asof loops well as I, the 3’ and 5’ ends of exons, as well as the proper sequence of NZ-7 ence of exon 4, but IIthe and viral the protein cysteine VEGFE required [30,31].to form loop Loop III. III Additionally, remains in PDGF-

used the endogenous 3’ splice acceptor sequ Citation: Page 8 of 11

Figure 7: Developmental divergence between wild-type and homozygous Pdgfctm1lex; hemizygous Pdgfrα mice. Pdgfctm1lex, hemizygous Pdgfrα Pdgfctm1lex; hemizygous Pdgfrα a) Live P0 pups. Homozygous mice have dark brown linear protrusions at the level of lumbar spine (white arrows). b) Formalin-fixed homozygous P0 pup with dorsal skin dissected away. Note the protruding and incompletely closed vertebral lamina (arrows) and dark meningomyelocele. c) Homozygous Pdgfctm1lex c) And d) Histologic sections through the level of the lumbar spine with kidneys (K) and vertebral body or disc (D) indicated for orientation. (contrast to d). ; hemizygous PDGFRα pup represented in b) the spinal cord and meninges have extensive hemorrhages. The arrow indicates misaligned lamina and there are no dorsal vertebral processes, epaxial skeletal muscles, or abundant subcutaneous tissue covering the spinal cord during dissection. d) Normal thoracic anatomy with proper orientation of vertebral lamina (arrows) and complete enclosure of the spine. Note the skin was removed Pdgfctm1lex severe ascending hemorrhagic myelomalacia. e) and f) Histological sections of the thoracic spine with lungs (L) indicated for orientation. e) Homozygous ; hemizygous PDGFRα pups have f) Corresponding cross section of a wild type mouse. Note that the pulmonary hemorrhage and extravasated red blood cells in the meninges are secondary to euthanasia. g) and h) Cross section of the sinuses and hard palate at the level of the vomeronasal organ (T1). g) Palatoschisis (cleft palate) is present in the Homozygous Pdgfctm1lex h) Wild-type mouse. ; hemizygous PDGFRα mouse (arrowhead).

Citation: Page 9 of 11

Cmut Pdgfcctm1nagy mice or other mutants, to determine the biological necessary for cleavage of the CUB domain, and this cleavage has functions of the PDGF-C CUB domain. been lacks suggested arginine to 231,be critical which for has Pdgf specificallyrα activation. been [9,10].shown Allto beof these structural differences suggest that PDGF-Cmut would not Acknowledgments interact with Pdgfrα data suggest CUB-mediated activation of Pdgfrα and raise the possibility that the CUB in the domain same interacts manner withas does Pdgf PDGF-C.rα outside Our of (BJH),Grant Herbert support: Coe Foundation, NHLBI, Cardiovascular American Surgical Pathology Association training grant (NIH-HL007312) and HHMI program in Molecular Medicine

the ligand binding pocket or perhaps interacts with the receptor theFoundation, School of and Pharmacy, the American University College of ofWashington Surgeons (KJR),(EJK), DrugNCI, in conjunctionCUB domains with of otherproteins proteins other to than influence PDGF-C cell are signaling. involved in Metabolism Transport and Pharmacogenetics Research Fund in a diverse range of functions, including complement activation, mechanisms of PDGF-C induced HCC (NIH-CA127228) (JSC). developmental patterning, tissue repair, axon guidance Declarations

neurotransmission, receptor-mediated endocytosis, and tumor All animal studies described in this manuscript were and angiogenesis, fertilization, hemostasis, inflammation, performed with University of Washington Institutional Animal Care and Use Committee approval. The University of Washington PDGF-Csuppression CUB [32-34].domain stimulatesCUB domains proliferation have even of been human reported coronary to is an Association for the Assessment and Accreditation of be involved in cell signaling [35-37]. The human version of the LaboratorySources of Animal Support Care approved facility. thatartery express smooth Pdgf musclerα, but cells not [38]. in the Our parental results show BHK 570that cells,the PDGF-C which doCUB not domain express simulates the receptor. modest These ERK phosphorylationresults suggest that in BHK the cellsCUB domain interacts with Pdgfrα to transduce intracellular signaling This work was supported by the NHLBI, Cardiovascular events. This notion is supported by the observations that pups Pathology training grant (NIH-HL007312) and HHMI program who are homozygous Pdgfctm1lex; hemizygous Pdgfrα (Table 2) were in Molecular Medicine (BJH), Herbert Coe Foundation, American not viable. The precise mechanisms involved with CUB domain- Surgical Association Foundation, Fred Hutchinson CRC New receptor interactions and subsequent signal transduction events FundInvestigator in the School Award of and Pharmacy, the American University College of Washingtonof Surgeons (KJR),(EJK), Drug Metabolism Transport and Pharmacogenetics Research domain seems to be less potent in activating the receptor. In vivo,are unknown. it is possible Relative that in tothe the absence PDGF-C of the GFD, GFD, however, the CUB the domain CUB NCI,References Mechanisms of PDGF-C induced HCC (NIH-CA127228) (JSC). Pdgfrα activity to prevent perinatal lethality in homozygous Pdgfctm1lex mice. 1. Soriano P. The PDGF alpha receptor is required for neural crest cell transduces sufficient development and for normal patterning of the somites. Development.

the PDGF signaling pathway in mice. For example, the Patch 2. 1997;124(14):2691-2700.Soriano P. mutantGenetic mouse background (Ph), in appearswhich a to segment have a profoundof chromosome effect on5 including Pdgfrα is deleted, has a phenotype that varies with Abnormal kidney development and hematological disorders Ph mice die earlier in in PDGF beta-receptor mutant mice. Genes Dev. 1994;8(16):1888- development than do Ph 1896.Boström H, background, as C57BL/6 homozygous Pdgfrα 3. Willetts K, Pekny M, et al. PDGF-A signaling is a critical mice on a CBA, or BALB/C background event in lung alveolar myofibroblast development and alveogenesis. [1]. Likewise, the severity of abnormalities in targeted 4. Cell. 1996;85(6):863-873. duenull micein part varies to strain depending differences, on background, Pdgfctm1lex andwith Pdgf onlyctm1nagy DBA mice Levéen P, Pekny M, Gebre-Medhin S, Swolin B, Larsson E, Betsholtz appearsurviving to untilhave different birth [1,39]. viabilities Though and our phenotypes. observations maytm1nagy be Pdgfcc C, et al. Mice deficient for PDGF B show renal, cardiovascular, and mice have developmental abnormalities on a 129S1/Sv*129X/ 5. hematologicalDing H, Wu abnormalities. Genes Dev. 1994;8(16):1875-1887.

X, Bostrom H, Kim I, Wong N, Tsoi B, et al. A specific requirement for PDGF-C in palate formation and PDGFR-alpha abnormalitiesSvJ background, [19,20]. specifically Conversely, a lethal palatePdgfcctm1lex formation mice aredefect viable [5]. These mice are viable on a C57BL/6 background but have brain signaling.so Nature genetics. 2004;36(10):1111-1116. though two alleles of Pdgfcrα 6. Fredriks n L, Li H, Eriksson U. The PDGF family: four gene thatin two are backgrounds, homozygous C57BL/6for Pdgfcc tm1lex x 129S5/SvEvBrd and hemizygous and for C57BL/6 Pdgfcrα products form five dimeric isoforms. Cytokine & Growth Factor rev. are necessary for their viability. Mice 7. 2004;15(4):197-204.Tallquist alpha in populations of cranial and cardiac neural crest cells. suggest that the CUB domain of Pdgfc-c performs a function in MD, Soriano P. Cell autonomous requirement for PDGFR Pdgfdie withincrα signaling. days of Futurebirth and experiments have severe are spina needed bifida. to Ourdetermine results whether Pdgfcctm1nagy 8. DevelopmentBetsholtz 2003;130(3):507-518. Pdgf alleles. The availability of Pdgf tm1lex mice will facilitate et al. cDNA sequence and chromosomal localization of human platelet- crα cc C, Johnsson A, Heldin CH, Westermark B, Lind P, Urdea MS, additional genetic screens, mice on either C57BL/6 alone background or in conjunction require withtwo derived growth factor A-chain and its expression in tumour cell lines.

Nature. 1986;320(6064):695-699. Citation: Page 10 of 11

9. t 24. Ferns GA, is a new protease-activated ligand for the PDGF alpha-receptor. Nat Li X, Pon én A, Aase K, Karlsson L, Abramsson A, Uutela M, et al. PDGF-C expressionSprugel determines KH, Seifertcell migration RA, Bowen-Pope to different DF, dimericKelly JD, forms Murray of M, et al. Relative platelet-derived growth factor receptor subunit 10. CellGilberts Biol.on 2000;2(5):302-9. PD, et al. Platelet-derived growth factor C (PDGF-C), a novel growth 25. PDGF.Campbell Growth J Factors. 1990;3(4):315-3. factor that DG,binds Duff to ME, PDGF West alpha JW, Kellyand betaJD, Sheppard receptor. PO,J Biol Hofstrand Chem. dependent,S, but Riehle independent KJ, Brooling of JT,Cd14, Bauer Tlr2, RL, and Mitchell Tlr4. C,J FaustoImmunol. N. Proinflammatory cytokine production in liver regeneration is Myd88- 11. 2001;276(29):27406-27414.Bergsten E 2006;176(4):2522-2528.Sundberg J , Uutela M, Li X, Pietras K, Ostman A, Heldin CH, et al. BA et al. Primary follicular dystrophy with scarring dermatitis PDGF-D is a specific, protease-activated ligand for the PDGF beta- 26. P, Taylor D, Lorch G, Miller J, Silva KA, Sundberg 12. receptor. leNat Cell Biol. 2001;3(5):512-516. in C57BL/6 mouse substrains resembles central centrifugal LaRochel WJ, Jeffers M, McDonald WF, Chillakuru RA, Giese NA, cicatricial alopecia in humans. Vet Pathol. 2011;48(2):513-524. doi: Lokker NA, et al. PDGF-D, a new protease-activated growth factor. Nat 27. 10.1177/0300985810379431.Hamilton T Cell Biol. 2001;3(5):517-521. divergence of platelet-derived growth factor alpha receptor signaling al. Platelet-derived growth factor (PDGF)-C, a PDGF family member G, Klinghoffer RA, Corrin PD, Soriano P. Evolutionary 13. Reigstad LJ, Sande HM, Fluge Ø, Bruland O, Muga A, Varhaug JE et 28. mechanisms.niatis Mol T. Cell A role Biol. for 2003;23(11):4013-4025. exon sequences and splice-site proximity with a vascular endothelial growth factor-like structure. J Biol Chem. 14. 2003;278(19):17114-17120.K, Reed R, Ma and altered conformations in the v-sis protein, a homolog of the B 29. inYue splice-site BG, usjarvi selection. G. A Cell.downstream 1986;46(5):681-690. splicing enhancer is essential for Sauer M Donoghue DJ. Identification of nonessential disulfide bonds 1018. Ak chain of platelet-derived growth factor. Mol Cell Biol. 1988;8(3):1011- inAnisimov vitro pre-mRNA A splicing. FEBS Lett. 1999;451(1):10-14. 15. Kenney WC, biological activities of vascular endothelial growth factor receptor-1 al. Formation of mitogenically active PDGF-B dimer does not require 30. , Leppänen VM, Tvorogov D, et al. The basis for the distinct Haniu M, Herman AC, Arakawa T, Costigan VJ, Lary J, et ligands.Kiba A, YaSci Signal. 2013;6(282):ra52 doi: 10.1126/scisignal.2003905. interchainKreysing J disulfide bonds. J Biol Chem. 1994;269(16):12351-9. acid residues in the B-chain of platelet-derived growth factor with 31. bana N, Shibuya M. A set of loop-1 and -3 structures signaling. in the J 16. different importance, Ostman A, vanfor bindingde Poll M, to etPDGF al. Identification alpha- and beta-receptors. of three amino novel vascular endothelial growth factor (VEGF) family member, VEGF-ENZ-7, is essential for the activation of VEGFR-2� BiolThielens Chem N 2003;278(15):13453-13461. 17. FEBSFensterma Lett. 1996;385(3):181-184. 32. M, Bersch B, Hernandez JF, et al. Structure and functions of ker RA, Poptic E, Bonfield TL, Knauss TC, Corsillo L, the interaction domains of C1r and C1s: keystones of the architecture F, Goshima Y. Structural and functional relation of receptorPiskurich binding JF, et al. and A mitogenic cationic region activity of of the the platelet-derived PDGF-AA homodimer. growth J of the C1 complex. Immunopharmacology. 1999;42(1-3):3-13. factor (PDGF) A-chain (Arg159-Lys160-Lys161) is required for 33. Nakamura J 18. Andersson neuropilins. Adv Exp Med Biol. 2002;515:55-69 Biol Chem. 1993;268(14):10482-10489. through inhibition of osteoblastogenesis and osteoclast activation. Heldin CH. Involvement of loop 2 of platelet-derived growth factor- 34. Mahoney D , Mikecz K, Ali T, et al. TSG-6 regulates bone remodeling M, Ostman A, Kreysing J, Bäckström G, Van de Poll M, J Biol Chem. 2008;283(38):25952-25962. doi: M802138200 [pii] 19. AA and -BBo in receptor binding. Growth Factors 1995;12(2):159-64. 10.1074/jbc.M802138200. Fredrikss n L, Nilsson I, Su EJ, Andrae J, Ding H, Betsholtz C, et al. abnormal cerebral vascularization, loss of neuroependymal integrity, 35. Lee HX, Mendes FA, Plouhinec JL, et al. Enzymatic regulation of pattern: Platelet-derived growth factor C deficiency in C57BL/6 mice leads to BMP4 binds CUB domains of Tolloids and inhibits proteinase activity. GenesHollway Dev. GE 2009;23(21):2551-2562. doi: 10.1101/gad.1839309. and ventricular abnormalities. Am J Pathol. 2012;180(3):1136- 20. 1144.Eitner doi:F, 10.1016/j.ajpath.2011.12.006. 36. , Maule J, Gautier P, et al. Scube2 mediates Hedgehog signallingWu YY, P ecin the zebrafish embryo. Dev Biol. 2006;294(1):104-118. Bücher E, van Roeyen C, Kunter U, Rong S, Seikrit C, et al. receptor ligand and regulates the epithelial-mesenchymal transition PDGF-C is a proinflammatory cytokine that mediates renal interstitial 37. k K, Chang YL, et al. SCUBE3 is an endogenous TGF-β fibrosis. J Am Soc Nephrol. 2008;19(2):281-289. doi: 10.1681/ 21. ASN.2007030290.Kibbe WA. in lung cancer. Oncogene. 2011;30(34):3682-3693. doi: onc201185 [pii] 10.1038/onc.2011.85. J OligoCalc: an online oligonucleotide properties calculator. 22. Crouthamel Nucleic Acids Res. 2007;35(Web Server issue):W43-6. 38. biologicalDijkmans activity, Xu J, Masure and chromosomal S, et al. Characterization localization. ofThe platelet-derived international growth factor-C (PDGF-C): expression in normal and tumor cells, MH, Kelly EJ, Ho RJ. Development and characterization of transgenic mouse models for conditional gene knockout in the blood- journal of biochemistry & cell biology. 2002;34(4):414-26. brain and blood-CSF barriers. Transgenic Res. 2012;21(1):113-130. doi: 10.1007/s11248-011-9512-z. J 39. McKinnon RD, Waldron S, Kiel ME et al. PDGF alpha-receptor signal strength controls an RTK rheostat that integrates phosphoinositol 23. Sambrook , Russell DW. Calcium-phosphate-mediated Transfection 3’-kinase and phospholipase Cgamma pathways during of Eukaryotic Cells with Plasmid DNAs. CSH Protoc 2006;2006(1). doi: oligodendrocyte maturation. J Neurosci. 2005;25(14):3499-3508. 10.1101/pdb.prot3871.

Citation: Page 11 of 11