Mal Secco Disease of Citrus: a Journey Through a Century of Research

001_JPPInvitedReview_523 15-11-2011 17:35 Pagina 523

Journal of Plant Pathology (2011), 93 (3), 523-560 Edizioni ETS Pisa, 2011 523

INVITED REVIEW MAL SECCO DISEASE OF CITRUS: A JOURNEY THROUGH A CENTURY OF RESEARCH

F. Nigro, A. Ippolito and M.G. Salerno

Dipartimento di Biologia e Chimica Agro-Forestale ed Ambientale, Università degli Studi “Aldo Moro”, Via Amendola 165/A, 70126 Bari, Italy

SUMMARY first name (“Poros’s disease”), soon spreading to Pelo- ponnesus, Crete, Eubea and Thessaly (Sarejanni, 1935, “Mal secco”, an Italian name meaning “dry disease”, 1939). In Italy, MSD was first reported in 1918 in the is a severe tracheomycotic disease of citrus caused by district of Messina (eastern Sicily), apparently following the mitosporic fungus Phoma tracheiphila (Petri) the introduction of infected plants from Greece (Rug- Kantsch. et Gik. It appeared in 1894 in two Aegean gieri, 1949). The distinct symptomatology of the dis- Greek islands, from which it spread almost to the whole ease, characterized by desiccation of twigs, branches, or Mediterranean basin and the Black Sea. Due to its high the whole plant, suggested its extant name, “mal secco” susceptibility, lemon is the most damaged citrus species. (“dry disease”) (Savastano, 1925), a denomination ever Disease damage consists of substantial reduction of the since adopted internationally. quality and quantity of the crop, mainly due to the diffi- In 1925, after the bewilderment for the tremendous culties of controlling the disease and the replacement of damages suffered by the eastern Sicilian citrus industry susceptible valuable cultivars by others which are less (primarily lemon), the Ministry of Italian National vulnerable, but have low productivity and scarce fruit Economy entrusted Lionello Petri, head of Royal Plant quality. Control of mal secco disease has relied on a Pathology Station of Rome, with the task of investigat- number of diverse chemical and nonchemical strategies, ing the causes of the widespread decline of lemon plants but is still faced with efficacy problems. Host resistance in the Messina district. The pathogen was identified as remains a most desirable goal, but it will not be ulti- Deuterophoma tracheiphila (Petri, 1929a), following mately achieved until the genetic basis of resistance to P. which a research station (“Osservatorio”) was estab- tracheiphila are not fully elucidated. The present paper lished at S. Teresa Riva (province of Messina) with the reviews the different aspects of citrus mal secco as stud- financial contribution of the “Messina’s Camera Agru- ied worldwide over almost a century of research, from maria”, with the aim of studying in loco the biology, epi- the first appeareance of the disease in Italy (1918) to demiology and control of the fungus. Notwithstanding date. Milestones and pitfalls about the symptomatology, the efforts to keep MSD under control, it soon spread aetiology, host-parasite relationship, diagnosis, epidemi- to the other main lemon-growing areas of Sicily, reached ology, and control are discussed in a historical perspec- continental Italy, affecting the groves of Calabria, Cam- tive, emphasizing the advancements in knowledge. Fi- pania, Apulia and Lucania (southern Italy), Latium nally, some issues and challenges are highlighted that (central Italy), Liguria (northern Italy), and crossed need to be more comprehensively addressed prior to again the sea to land in Sardinia. deployment of effective disease control measures. The current geographical distribution of MSD comprises the east coast of the Black Sea (Georgia) and all citrus-growing countries of the Mediterranean Basin, HISTORY, GEOGRAPHICAL DISTRIBUTION AND except for Morocco, Portugal and Spain. Its occurrence ECONOMIC IMPACT in Yemen has not been confirmed (EPPO/CABI, 1997; EPPO/OEPP, 2007). “Mal secco” (MSD) is a severe vascular disease of cit- Besides lemon [C. limon (L.) Burm. f.], the MSD rus caused by the mitosporic fungus Phoma tracheiphila pathogen infects, with a relevant economic impact, oth- (Petri) Kantschaveli et Gikachvili. It appeared in the er citrus species, such as cedar (C. medica L.), lime (C. th second half of 19 century (1894) in the Greek Aegean aurantifolia Christ.), bergamot (C. bergamia Risso), islands of Chios and Poros, from which it derived its chinotto (C. myrtifolia Raf.), sour orange (C. aurantium L.), rough lemon (C. jambiri Lush) and Volkamerian lemon (C. volkameriana Ten. et Pasq.). The erratic field Corresponding author: F. Nigro Fax: +39.080.5442911 behaviour of the disease, makes its damages difficult to E-mail: [email protected] estimate. In fact, one of the typical characteristics of 001_JPPInvitedReview_523 15-11-2011 17:35 Pagina 524

524 Mal secco disease of citrus Journal of Plant Pathology (2011), 93 (3), 523-560

MSD is the alternation of years with high or very high stripes on the affected organs. Ruptured epidermis per- incidence with years in which infections are less severe mits the observation of pycnidia by the naked eye or or nearly negligible. Furthermore, besides the direct with a low magnification lens. As reported by Grasso damage to the plants, which can be crippled, if not and Perrotta (1978), pycnidia were produced on a num- killed, and suffer heavy yield losses, there are indirect ber of species and hybrids belonging to the family Ru- damages originating from: (i) the presence in the or- taceae, with the exception of C. myrtifolia, C. paradisi, chards of plants of different age and susceptibility be- Fortunella sp. and Severinia buxifolia. cause of the replacement of dead trees, which makes Double infections can be observed in malsecco-dis- lemon production heterogeneous and lowers its qualita- eased trees. For instance, acervula of Colletotrichum tive standard; (ii) the higher costs due to disease con- gloeosporioides (Penz.) Sacc., which are readily distin- trol. According to a realistic evaluation, in the absence guished because of their arrangment in concentric rings of MSD it would be possible to double the average Ital- (Fig. 3B) often occur on desiccated shoots in Sicily, ian lemon production (Salerno and Cutuli, 1977). whereas the presence of Epicoccum granulatum Penzig According to Ruggieri (1953), in the years 1918-1953 on different citrus species was recorded in Georgia MSD has destroyed in Sicily no less than 12,000 ha of (Shumakova and Grube, 1957). lemon groves, whereas in the Turkish district of Mersin According to Ruggieri (1956), MSD symptoms show (Icel), the disease has killed about 20,000 lemon plants a seasonal fluctuation. The first signs of infection gener- in 15 years (Karel, 1956). In the same Turkish area, Ak- ally appear and become more intense in spring-early teke and Karaka (1977) recorded an average annual summer, to recede in the hight of summer and winter. yield loss of 12.3%, which is much less than the Greek Although the appearance of symptoms and their more estimates, that registered a 50-60% drop in the yield, or less rapid course depend from various factors related with an average loss of 70, 45, 54, and 53% in the dis- to the age, vegetative stage and susceptibility of the tricts of Patras, Temeni, Alissos and Chania, respectively host, the environmental conditions and the virulence of (Thanassoulopoulos and Manos,1992). the pathogen’s strains, there are no doubts that the localization of primary infections play an important role on their evolution. Infections starting from the canopy THE DISEASE of adult plants generally progress slowly towards the base, so that many years elapse before the plant dies. In MSD induces a range of specific symptoms (Fig.1-3), the meantime, the plant reacts by producing sprouts not all of which occur consistently in the different forms from the still uninfected branches or suckers from the that characterize the disease. The first symptoms usually crown, which will be also infected. By contrast, when appear on the leaves of the uppermost shoots, which the infection proceeds upwards from the base of a shoot display a slight discoloration of the primary and the sec- or branch, the time-course of the disease is quite rapid ondary veins. The leaves then turn yellow and fall, most- as a quick wilting of whole shoots or branches can en- ly without the petioles that persit on the shoots (Fig. sue, accompanied by falling of the fruits and defoliation. 1C). These often show a chlorotic condition of the api- Exceptionally, wilted fruits and leaves remain attached cal part, sometimes only on one side, while retaining a to the branch, as the rapid course of the disease pre- normal green color in the basal part. Sometimes the vents the formation of the abscission layers. shoots turn brown. Newly infected shoots show a yel- When the pathogen infects the outermost woody low or pink-salmon to reddish discoloration of the rings of large roots or at the crown, symptoms appear- wood, which occurs also in the wood of the main and ance involves just a sector of the host, less frequently the secondary branches, as well as in the trunk, where the entire plants. However, within a short time, the plant pathogen is advancing. A progressive basipetal desicca- dies, a condition called “mal fulminante” (sudden tion of shoots, branches, and trunk follows and, finally, death). If the infection starts from rootlets, as it fre- the whole plant may die (Fig. 1A). Generally, in the first quently happens in young nursery plants but also in stages of infection, there is no clear-cut separation be- bearing trees in the grove, P. tracheiphila may remain tween green and desiccated tissues. While the impact of segregated for many years in the inner wood layers. In MSD increases witht the age of the plant, its severity is this instance the course of the disease is initially very higher in young subjects. slow. However, as soon as the pathogen reaches the A specific MSD trait is the occurrence of small, black most external woody rings the disease progresses very and globose pycnidia of the pathogen (Fig. 3B) that can rapidly and the plant shows symptoms similar to those readily be observed from the end of autumn on 1- to 2- produced by “mal fulminante” (Carrante, 1938; Cutuli, year-old slowly desiccating shoots or suckers. Their 1972). In this case, instead of the characteristic salmon- presence elicits the detachment of the epidermis from like color, the withering young shoots and main branch- the underneath tissues, which is followed by penetration es display a browning of the innermost woody cylinder. of air, resulting in the apperance of long silver-gray Wood discoloration becomes progressively more intense 001_JPPInvitedReview_523 15-11-2011 17:35 Pagina 525

Journal of Plant Pathology (2011), 93 (3), 523-560 Nigro et al. 525

Fig. 1. Symptoms caused by Phoma tracheiphila infections. A. A completely desiccated susceptible cv. Femminello lemon (fore- ground) and a resistant cv. Monachello (background). B. Symptoms of “mal nero” caused by natural root infection of sour orange rootstock. Note the discoloured triangular wood section expanding to a necrotic stripe on the cortex. C. Symptoms on the leaves of a lemon shoot. The first symptoms usually appear on apical leaves as vein chlorosis. Symptomatic leaves often fall without the petiole. D. Vascular vessels colonized by fungal hyphae. This mycelium produces phialo- and blastoconidia that move acropetally with the transpiration stream.

in a downward direction until it acquires a blackish hue. onto susceptible rootstocks such as sour orange. Re- Black-discoloured wood has a characteristic smell of cently, severe cases of “mal nero” on mandarin (cv. Cas- overripe melon. Sometimes it happens that in corre- sar) and sweet orange (cv. New Hall), have been report- spondence of a trunk sector, a lengthwise stripe of cor- ed from Tunisia (Hajlaoui et al., 2007). tex appears necrotic and remains firmly attached to the According to Stepanov and Shaluishkina (1952) underneath necrotic woody tissue (Fig. 1B). This partic- fruits and seeds of diseased lemon trees may be invaded ular syndrome, described in detail by several authors by P. tracheiphila (Fig. 2). When unripe lemon fruits are (Savastano and Fawcett, 1930; Carrante, 1938; Ruggieri, infected, they show partial or total yellowing of the peel, 1940), is called “mal nero” (black disease). The two syn- depending on the age of the infection, whereas ripe dromes, i.e. “mal fulminante” and “mal nero”, can also fruits turn dark yellow to reddish. Diseased fruits nor- be shown by resistant citrus species if they are grafted mally show signs of withering and fall to the ground. 001_JPPInvitedReview_523 15-11-2011 17:35 Pagina 526

526 Mal secco disease of citrus Journal of Plant Pathology (2011), 93 (3), 523-560

Fig. 2. Mal secco symptoms on lemon fruits. A. Extensive necrosis of the pericarp in the peduncular area. Infected fruits are generally smaller and tougher than the healthy ones. B. Discoloured seeds from infected fruits (upper row) compared with seeds form healthy fruits (lower row). C. Vessels of infected fruits, showing various degrees of browning, those of the central axis in particular, depending on the age of the infection.

However, when infected branches desiccate rapidly the genus (Deuterophoma Petri). Althouh this finding was fruits remain attached, showing necrosis of the pericarp repeatedly confirmed by L. Petri and endorsed by other around the calyx (Fig. 2A), which may extend to the researchers (Savastano and Fawcett, 1930; Carrante and equatorial zone and even further. Such fruits eventually Ruggieri, 1947), it remained for some time a controver- mummify on the tree. Infected fruits show a red-brown- sial issue. For instance, Gassner (1940) attributed the ae- ish discoloration of the vascular bundles which is more tiology of MSD to Phoma limoni Thum., which he con- intense at the basal end but may also be seen in the up- sidered as a synonym of D. tracheiphila; an opinion per end (Fig. 2C). This symptom is not specific as it may harshly opposed by Petri (1940). On the other hand, occur also in fruits not affecd by MSD, as in the case of Pasinetti (1942) excluded the pathogenic role of D. tra- endoxerosis (Cutuli and Salerno, 1998). Seeds of infect- cheiphila attributing the disease to unfavourable environ- ed fruits are darker than those from healthy fruits, mental conditions. This hypothesis did not go very far. mainly in the chalaza zone (Fig. 2B). Besides the lemon, The genus Deutherophoma was established to set a fruits and seeds of other susceptible citrus species can difference from Sclerophoma von Höhn, which is char- also be infected (Ippolito et al., 1987a, 1992). acterized by endogenous spores, contrary to the supposed exogenous origin of D. tracheiphila pycnoconidia, which are produced by budding. However, also Petri’s THE PATHOGEN new genus was at the center of a controversy, as that between Petri himself (Petri, 1934) and Klebahn (1933), Initially, the cause of MSD was erroneously attributed who erected the sub genus Blastophoma as a synonym of to bacteria, which are common on citrus and many other Deuterophoma, maintaining that the pycnoconidia of fruit trees (Savastano, 1923), then to C. gloeosporioides Sclerophoma were of both endogenous and exogenous (Petri 1926, 1926a, 1927, 1927a, 1929), until the agent origin. A decade later Ciferri (1946) found that the mal was ultimately identified by Petri (1929a) as secco pathogen had the characters of the genus Deuterophoma tracheiphila, the type species of a new Bakerophoma Diedicke and proposed the new combina- 001_JPPInvitedReview_523 15-11-2011 17:35 Pagina 527

Journal of Plant Pathology (2011), 93 (3), 523-560 Nigro et al. 527

tion Bakerophoma tracheiphila (Petri) Ciferri. Shortly af- cheiphila in artificial media observing that the maximum terwards, Goidanich and Ruggieri (1947), then Graniti fungal growth occurs between 20 and 25°C and that, in (1955) amended the description of Deuterophoma sensu the same temperature range, pycnidia are formed more Petri (1929a). Graniti, in particular, studied the mor- rapidly. At lower temperatures (10°C) pycnidia reach a phology of the pycnidial and hyphal spores of D. tra- larger size and are profusely produced at 15°C. Pycno- cheiphila, concluding that the fungus had characters dif- conidia germinate between 5 to 30°C, with an optimum fering from those described by Petri as, for instance, the at 25°C. At 30°C, the growth of the germ tubes ceases. mesondogenous origin of pycnoconidia. Following a Growth inhibition was observed at 0°C and 30°C, but further re-examination of the fungal morphology with after 10 days at 30°C the fungus resumed its growth, the electron microscope, Ciccarone and Russo (1969) when grown at 20°C. The color of the mycelial mat confirmed that D. tracheiphila is a phyalidic species with changes in function of the incubation temperature, i.e. meristogenous pycnidia provided with an ostiole and a white at 5°C but dark-grey at 25°C. On the whole, these neck, and proposed its transferring to the genus Phoma results were in agreement with those by Stepanov Saccardo. Later on, Ciccarone (1971) illustrated the ra- (1950), but not always with those by Petri (1939). tionale whereby the fungus, according to the decision of As to the provenance of the pathogen, Ruggieri the VIII Congress of Botany, had to be named Phoma (1948) agreed with Petri (1930) in hypothesizing its ori- tracheiphila (Petri) Kantschaveli et Gikashvili, a binomi- gin from Asia Minor, as suggested by the disease pro- al already used in the past (Kantschaveli and Gikashvili, gression from east to the west (Chios, Poros, Crete, and 1948) and provided the amended description of the Sicily), and to the south (Palestine) (Petri, 1930). More- fungus. An English description of the same fungus, still over, it was also hypothesized that during this spreading under the obsolete name of D. tracheiphila Petri, was the pathogen increased its virulence (Petri 1930). shortly afterwards produced by Punithalingam and Hol- The natural occurrence of two different races of P. liday (1973). tracheiphila was first reported by Petri (1930a, 1939). Finally, it is worth mentioning that electron micro- Later, Baldacci (1950) labelled the two races as “DPR” scope observations by Lo Giudice et al. (1982) revealed (colonies with dematiaceous mycelium, producing pyc- that the septa of the fungal hyphae are monoporic with nidia and red pigment) and “PD” (colonies with dema- a simple structure, a characteristic feature of the Phy- tiaceous mycelium, producing pycnidia but no red pig- lum Ascomycota. Magnano di San Lio and Graniti ment). A third avirulent race (Petri 1939; Scrivani, (1987) investigated the nuclear condition of P. tra- 1954), that usually appears after 2 or 3 subcultures on cheiphila reporting that: (i) the mycelium is consitued by agarized media (Salerno and Perrotta, 1966; Messina, mono- and plurinucleate cells; (ii) young hyphae and 1988) was called “R” (colonies without dematiaceous apical cells are generally plurinucleate, whereas pycnidia mycelium, producing abundant red pigment but no py- and conidiogenous phialide cells are uninucleate; (iii) cnidia). Race “DPR”, unlike “DP”, seems to occur pycnoconidia and free phialoconidia are mostly wherever MSD is present. Contrary to the above views, mononucleate; (iv) anastomoses occur among both hy- Goidanich and Ruggieri (1948) sustained that P. tra- phae and conidial germ tubes. cheiphila is monotypic, and that the color and other Although there are no doubts that P. tracheiphila is morphological traits vary in relation to different factors. the causal agent of MSD, it should be kept in mind that Only the production of the red pigment, though in vari- other pathogens can produce similar symptoms (Saler- able amounts, is a constant character of the fungus. no, 1959). For example, Ruggieri (1946), reported the Salerno and Perrotta (1966) investigated the cultural occurrence of vascular wilts of citrus due to Verticillium characteristics of some P. tracheiphila populations from albo-atrum Rein. et Bert., and several other authors Sicily. All fungal isolates produced the red pigment and pointed out the constant association between MSD and fluidized peptone gelatin, indicating that they belonged infections by other fungal and bacterial pathogens, such to the “PDR” or “chromogenic” race (Petri, 1930b). as C. gloeosporioides in Italy and Israel [see among the However, measurements of pycnidia and phialoconidia others, Baldacci and Garofalo (1950); Reichert and conformed more with those characterizing the “PD” or Chorin (1956)], Pseudomonas syringae Van Hall in “non chromogenic” race (Petri, 1930a; Baldacci, 1950). Turkey (Chapot, 1963) and Epicoccum granulatum in These findings were confirmed by De Cicco and Luisi Georgia (Shumakova and Grube, 1957). (1977), who studied 67 fungal isolates from different ar- After repeated sub-culturing on agarized medium, P. eas and hosts from the Mediterranean basin. After- tracheiphila loses some of the characters exhibited soon wards, Magnano di San Lio and Perrotta (1986) exam- after isolation from infected tissues, in particular, the ined 600 P. tracheiphila isolates from Sicily, recovering ability to produce pycnidia soon after the first or second non-chromogenic strains from a single plant near Paler- subculturing. By contrast, repeated transferrings do not mo. These strains were similar to those of Baldacci’s inhibit the production of phialides and phialoconidia. (1950) race “DP”, which had been found in the same Salerno (1964) investigated the behaviour of P. tra- area. Studying isolates from lemon, orange, tangerine 001_JPPInvitedReview_523 15-11-2011 17:35 Pagina 528

528 Mal secco disease of citrus Journal of Plant Pathology (2011), 93 (3), 523-560

and grapefruit, Kantschaveli et al. (1976) distinguished anamorphic and teleomorphic taxa retrieved in BLAST four different forms of the fungus, based on morpho- searches, revealed a close relationship between P. tra- logical characters, as well as on carbon and nitrogen as- cheiphila and Leptosphaeria congesta (Balmas et al., similation and pH requirements. 2005a). However, the low number of fungal isolates Colonies of P. tracheiphila growing on agarized media analysed (36) and the weak confidence value of the show variant sectors, characterized by change in color, branch node did not lead the authors to deduce different growth rate, and mycelial pattern. This vari- anamorphic/teleomorphic connection between the two ability was partly attributed to the eterocariotic condi- species (Balmas et al., 2005a). tion of the fungus (Graniti, 1969), which could deter- Comparable results were obtained by Ezra et al. mine the separation of genetically different nuclei. (2007), who examined a small population of the fungus However, conidiogenous cells of pycnidia and free (22 isolates) collected in Israel from various citrus phialides are homocariotic. Then the nuclei of conidia species and growing areas. The isolates exhibited similar produced by a single phialide would come from the morphological characteristics when grown in vitro. The same ancestor, thus excluding that the variability occur- only difference was the inability of some isolates from ring in the mitosporic and monocytogenetic lineage is lime and sour orange to express the red-orange pig- due to heterocariotic dissociation. Moreover, consider- ment. The arbitrary primed polymerase chain reaction ing the high frequency of the variant sectors in P. tra- (apPCR) profiling showed very similar patterns, regard- cheiphila, it seems hazardous to hypothesize that this less of the fungal isolates examined, the different citrus phenomenon is due to mutations or mitosis aberrations. species, the different locations and the different tissues. Rather, it is reasonable to speculate that the variability Comparison of ITS1-5.8S-ITS2 sequences confirmed of cultural characteristics in the monoconidial lineage the results of apPCR, and no significant differences has an extranuclear origin (Jinks, 1966; Burnett, 1968). were found among the different isolates. This morpho- Chromogenic and non-chromogenic variants show logical and genetic homogeneity would suggest that the indistinguishable electrophoretic banding patterns of Israeli fungal population probably descends from a total mycelial proteins and isoenzymes (catalase, es- common ancestor. terase, glucose-phosphate isomerase), as determined by The analysis of a larger number of isolates from Italy polyacrylamide gel electrophoresis (PAGE) of proteins and Greece, further confirmed the high homogeneity in extracted from mycelium of pure cultures grown in liq- P. tracheiphila population. In fact, several isolates were uid medium (Cacciola et al., 1986). Electrophoresis of identical over a ITS sequence 536 bp long, whereas only mycelial extracts could however help in the identifica- two showed differences consisting of 2-4 nucleotide tion of strains that differ in their capacity to produce substitution. A comparison of these sequences with pigments or do not produce pycnidia (EPPO/OEPP, those deposited in GenBank revealed that 10 of 44 iso- 2007). lates tested showed only 2% sequences variation. More- Despite the wealth of data available on the high vari- over, analysis of selected isolates, with or without se- ability of phenotypic characters, such as colony mor- quence variation, confirmed a relationship with fungi phology, pigmentation, and virulence, some recent pa- belonging to the Leptosphaeria sensu stricto group pers suggest that such differences are not correlated (Grasso, 2008). The use of the amplified fragment with the genetic variability of the fungus, as determined length polymorphism (AFLP) technique allowed a cer- by molecular methods. Based on the analysis of ran- tain differentiation among P. tracheiphila isolates, al- domly amplified polymorphic DNA (RAPD), mi- though no relationships were found with the geographic crosatellite markers and sequencing of the internal tran- origin, cultural characteristics, and virulence (Grasso scribed spacer (ITS) region of the nuclear rRNA genes, and Catara, 2006). By using the fAFLP variant of this Balmas et al. (2005a) inferred phylogenetic relationships technique, in which primer labelled with a fluorophore among isolates of P. tracheiphila, suggesting that the at 5’ terminus are used in the selective amplification Italian population of the fungus is represented by a step, better results were recently achieved, although no clonal lineage. In fact, the results obtained with RAPD clear-cut relationship with the geographic origin or oth- and microsatellite markers showed that the Italian iso- er characters of the pathogen were found (Russo et al., lates of the fungus are genetically homogeneous, pro- 2011). ducing identical patterns upon amplification with all The pathogenicity of P. tracheiphila has been investi- primers tested. Accordingly, ITSI-5.8S-ITS2 sequences gated on a large number of isolates (142), collected of all P. tracheiphila isolates were highly conserved (98- from different areas in the Mediterranean basin and var- 100% identity along a 544 character alignment). A ious natural hosts, by means of artificial inoculation of neighborjoining analysis of P. tracheiphila ITS sequences sour orange, sweet orange and lemons of cvs Femminel- in comparison with those of other Phoma species (P. lo and Monachello. Results of these trials led to conclu- glomerata, P. esigua, P. betae, P. cava, P. fimeti, P. lingam, sion that there is no significant variation in the patho- P. medicaginis) and with alignable sequences from genicity of P. tracheiphila, nor any apparent specializa- 001_JPPInvitedReview_523 15-11-2011 17:35 Pagina 529

Journal of Plant Pathology (2011), 93 (3), 523-560 Nigro et al. 529

tion (De Cicco and Luisi, 1977; Luisi et al., 1979, um and excised tomato plants, Graniti (1957) reported 1979a). that many of the symptoms reported by Scrivani (1954) As mentioned, in artificial culture P. tracheiphila pro- were not caused by the phytotoxic activity of the duces abundant red pigments of various hues, that form pathogen but by the cultural liquid. The same author, crystalline aggregates on the surface of the hyphae and however, pointed out that the cultural liquid in which are scarcely diffusible in the medium. Among them, the the fungus was grown, induced stronger and sometimes anthrachinone derivatives helmintosporin and cinodon- different symptoms as compared with those described tin have been identified (Quilico et al., 1952). More re- by Scrivani (1954). Some time later, Surico and Jacobel- cently, a third pigment was found, chrysophanol, that lis (1980) studied the effect of cultural conditions on the has a yellow colour and is probably responsible for the production of phytotoxins by P. tracheiphila obtaining red-carrot or orange tonality that fungal colonies show the best results with static cultures exposed to light. The on various artificial media (Ballio et al., 1979). P. tra- toxic activity of cultural liquids was maximum after 11- cheiphila produces also humus-like substances, both in 12 days at 27°C, few days before the colonies had artificial culture and during the colonization of citrus reached the maximum growth, to decrease afterwards, as plants (Dzneladze, 1975), and the presence of flavins the mycelium underwent lysis. To evaluate the toxic ac- and carotenoids has also been ascertained (Dzneladze, tivity of the cultural filtrates of the pathogen, testing ex- 1974). Culture filtrates of the fungus have an inhibitory cised or whole young tomato plants seemed to be more effect on Citrus infectious variegation virus (CVV) and appropriate than citrus seedlings. The role of phytotoxic on Tobacco mosaic virus (TMV), due to a polysaccharide compounds in the virulence of P. tracheiphila will be dis- moiety and, to a lesser extent, a protein (Grasso et al., cussed in the heading “Toxins and Pathogenesis”. 1970; Grasso and Davino, 1974). In artificial media P. tracheiphila produces enzymes, e.g pectinolytic and inducible cellulosolytic enzymes HOST-PARASITE RELATIONSHIP (Cx) as shown by Graniti (1969) and Cacciola et al., (1990). Evola et al. (1973) found the same, and showed Xylem colonization, wood discoloration, and gum that the fungus is able to produce constitutively pectin- production. Once vascular tissues are infected, P. tra- methyl-esterase (PME), and b-glucosidase. The same cheiphila spreads within the xylem vessels and move authors, evaluated the effect of three different growth acropetally with the transpiration stream. The fungus temperatures (12, 19 and 26°C) on enzyme production, then emerges from xylem vessels and colonize the reporting that a higher activity of polygalacturonase neighbouring vascular tissues (Fig. 1D) thus inducing (PG), trans-eliminase of polygalacturonate (PGTE), the sectorial symptoms seen in the wood. As a conse- PME and macerating enzymes (MA) was evident at quence of xylem clogging, due to the presence of the 12°C, while b-glucosidase and CX were more active at fungal hyphae and the reaction of the host (gum pro- 19°C and 26°C, respectively. duction), the water and solute transport is compromised The presence of phytotoxins in the cultural filtrates and water-stress symptoms appear. However, the wilting of P. tracheiphila was first detected by Russian re- associated with MSD can only be in part justified by searchers (Polyakov and Shumakova, 1951; Orshan- vessel occlusion. Electron microscopy observations skaya, 1952), who investigated also the most favourable showed that only a thin layer of gum-like substances is conditions for toxin production (Polyakov and Shu- visible inside the xylem vessels of infected plants (Mag- makova, 1954). It was later shown that these toxic com- nano di San Lio and Perrotta, 1979; Bassi et al., 1980). pounds derive from the lysis of the fungal mycelium and Perrotta et al. (1979a, 1981) investigated and dis- that both lysis and toxin accumulation in the medium cussed the pathogenesis of P. tracheiphila in relation to are higher at 23°C and above (Shumakova, 1964). xylem colonization. According to their findings, the Studies on the production of toxins by P. tracheiphila fungus moves inside the vessels as passively transported were also pursued by Italian scientists since the early spores, reaching the leaves before they show disease 1950s. Scrivani (1954) carried out a series of investiga- symptoms; moreover, it emerges from the vessels tions on the occurrence of toxic metabolites in liquid through their punctuations, colonizing the neighbour- culture of P. tracheiphila in Czapek medium amended ing xylem tissues. The rate and extent of xylem colo- with corn-meal extract. The diluted cultural filtrates, ob- nization proved to be directly related to symptoms tained by growing the fungus on this medium, were tox- severity and to the virulence of the different fungal ic to lemon and tomato cuttings. The same author strains, and was a pre-requisite for symptoms appear- proved also that the two pigments produced by race “R” ance. Moreover, the relative water content of the leaves sensu Baldacci (1950) and identified by Quilico et al. did not show significant reduction until the wilt ap- (1952) as anthraquinone derivatives were insoluble in peared, whereas an increase in the electrolyte leakage water and were not phytotoxic. In a series of investiga- was observed in the early stages of disease development tions carried out a few years later, using Scrivani’s medi- (Magnano di San Lio et al., 1992). 001_JPPInvitedReview_523 15-11-2011 17:35 Pagina 530

530 Mal secco disease of citrus Journal of Plant Pathology (2011), 93 (3), 523-560

Direct evidence of xylem impairment and water of these enzymes occurred in advanced disease stages, transport alteration by P. tracheiphila was provided by these authors excluded a role in the stages correspon- Raimondo et al. (2007), who ascertained an increase of ding to infection and vessel colonization. This conclu- hydraulic resistance in stems and leaves of infected sour sion was supported by the lack of correlation between orange seedlings. In particular, in infected leaves the the in vitro pectinolytic and cellulosolytic activity and pathogen determined extensive clogging of the veins, the virulence of different isolates of the pathogen on due to the progressive digestion of the interconduit pit sour orange seedlings (Pacetto and Grasso, 1974). More membranes, which decreased the water potential recently, Cacciola et al. (1990) and Natoli et al. (1990) threshold for the penetration of air into functioning showed that pectinolytic enzymes produced by P. tra- conduits, thus facilitating the spread of the pathogen in cheiphila induce electrolyte leakage in the tissue of sour the tissue. The time course of depression of leaf water orange leaves. status and gas exchange was much more rapid when the stem was infected, as compared with the values meas- Toxins and pathogenesis. Since the early studies on ured when a leaf was inoculated (Raimondo et al., MSD, it was hypothesized that toxic substances pro- 2007), although the relationship between hydraulic con- duced by P. tracheiphila could play a role in pathogene- ductance of the two organs and the leaf gas exchange sis (Petri, 1930). Several attempts to demonstrate the were qualitatively similar (Raimondo et al., 2010). presence of toxins in the lymph or extracts from infect- As mentioned, young infections confer a pink-salmon ed wood were successful (Kiyashko, 1951; Akhvlediani, discoloration to the wood which with the time becomes 1958; Graniti, 1969), but the chemical nature of these darker up to black, as in the facies of the disease known substances was not determined. Surico et al. (1981) as “mal nero” (Figs. 1B and 4). The origin of these dis- studied the relationships between the degree of P. tra- colorations was extensively discussed in the past. Petri cheiphila virulence and the in vitro production of toxins. (1930, 1930a) attributed them to pathogen-produced When the phytotoxicity of culture filtrates was assessed pigments absorbed by the walls of the vessels and of the on sour orange leaves, the two parameters (phytoxicity- woody parenchyma cells, then diffusing into the gum virulence) were positively correlated, not so when ex- masses of the xylem. However, histological observations cised tomato plants were used as indicators. In this case, and the results of artificial inoculations with P. tra- the toxicity of filtrates was directly correlated with the cheiphila isolates with different ability to form pigments in vitro growth of the fungus, rather than with the viru- in artificial culture, cast doubts on the fact that wood lence of the tested isolates. Thus it appears that P. tra- discolorations were due to diffusing fungal pigments. It cheiphila can produce more than one phytotoxic sub- was thought, instead, that the discoloration was the ex- stance, with different selectivity. Subsequently, Pennisi pression of the gummosis reaction of infected vascular et al. (1988) addressed the same topic, and found a sig- elements (Goidanich and Ruggieri, 1948, 1953; Bugiani nificant correlation between virulence and electrolyte et al., 1959). However, gums that, like those observed in leakage in sour orange leaf discs treated with toxins pro- mal secco-infected tissues, may show a shade of pink, duced in liquid medium by hyper- and hypo-virulent are produced in the wood of citrus plants infected by isolates of P. tracheiphila. The elution of toxins from a other pathogens (Salerno, 1959) or damaged by cold, or sepharose column produced two protein peaks, but on- wounded. Therefore, gum production is an aspecific rely the one with lower molecular weight showed biologi- sponse of citrus to injuries of various origin. Later inves- cal activity. Pennisi and Graniti (1987) measured the tigations (Ballio et al., 1979; Matarrese Palmieri et al., electrolyte leakage from leaf tissues, in the attempt to 1979; Perrotta et al., 1981) confirmed that the discol- correlate symptoms with changes in the permeability of oration of infected wood is mainly associated with the cell membranes. Yellow leaves close to abscission gums accumulating in xylem tissues, and ultra-structural showed more important changes than those with milder examination of these tissue showed that the gums origi- symptoms, whereas in symptomless leaves from infected nate from the alteration of the primary cell wall and twigs the permeability changes registered were small. middle lamella complex (Magnano di San Lio and Lo The converging observations of Magnano di San Lio et Giudice, 1982; Cacciola, 1989). al. (1992), led to the hypothesis that alterations of cell membrane permeability contribute to the water stress Hydrolitic enzyme activity. Production of gums was syndrome associated with MSD. also observed after artificial introduction of pectinolytic The phytotoxic activity of P. tracheiphila was also ex- enzymes in the wood of sour orange shoots (Bugiani et tensively investigated in Israel. In the culture extracts of al., 1959). Pacetto and Davino (1976) studying PME the pathogen Nachmias et al. (1977) found the presence and Cx in citrus plants artificially and naturally infected of an extracellular glycopeptidic substance, that was by P. tracheiphila, found that the activity of both en- phytotoxic and able to induce disease symptoms in zymes was higher in extracts from infected xylem than lemon shoots. The toxin had an estimated molecular in those from healthy tissues. Since the highest activity weight of 93 kDa and an isoelectric point of 4.3. The 001_JPPInvitedReview_523 15-11-2011 17:35 Pagina 531

Journal of Plant Pathology (2011), 93 (3), 523-560 Nigro et al. 531

carbohydrate moiety (29.5%) consisted of mannose, treated plants, possibily because of the toxin’s interfer- galactose and glucose whereas the peptide moiety ence with the genetic control of chlorophyll biosynthe- (36%) contained most of the common amino acids, as- sis. Finally, a compound identified as mellein (Parisi et partate, glutamate, threonine and serine being the most al., 1993), and occurring at a very low concentration in represented. 14C-labelled toxin was obtained by grow- P. tracheiphila culture filtrates, was not phytotoxic when ing the fungus in the presence of radioactive amino tested on lemon leaves but, according to the authors, it acids, and radioactivity was readily translocated to could have synergistic action with other phytotoxic lemon cuttings. The detection of radioactivity in the metabolites produced by the pathogen. leaves was correlated with the appearance of symptoms. The toxin induced electrolyte leakage from plant tis- Mechanisms of resistance. This issue has been the sues, reduced the transpiration rate, and inhibited the object of attention since the aetiology of MSD was es- growth of callus of lemon cv. Eureka, at concentration tablished. Although in the early 1930s it was thought which were ineffective on Shamouti sweet orange that resistance could be related with the number of (Nachmias et al., 1977a). The toxin was then searched stomata occurring on the leaves, Rabinovitz-Sereni for in infected plants, as evidence for its role in disease (1931) dismissed this notion as he was unable to find development (Nachmias et al., 1979). From artificially such a correlation. The subsequent studies of Petri infected leaves of rough lemon, a glycopeptide, very (1939, 1940), led him to conclude that the chemical similar to the phytotoxic compound present in cultural properties of the xylem sap contribute to the resistance filtrates, was isolated. Since this glycopeptide was de- of sweet orange to MSD. tected in infected plants in a quantity that could justify Insofar as a structural type of resistance is concerned, the production of symptoms, the authors concluded it is worth reporting both the Goidanich and Ruggieri that this compounds had a role in pathogenesis and was (1947, 1947a) hypothesis about the histological and classified as a “vivotoxin” (Dimond and Waggoner, functional modifications that take place following deep 1953), for which the name of “malseccin” was proposed infections by wounding, and the observations by Som- (Nachmias et al., 1979). Subequently it was found that ma et al. (1979), according to which the resistance of malseccin is a complex of glycoproteins with different lemon (cv. Monachello) observed in the first year post molecular weight, whose major phytotoxic fraction, de- infection, is due to the formation of new wood in ad- noted Pt60, has a molecular weight of 60 kDa. When vance of the spreading of the fungus. More recently, the properties of mycotoxin Pt60 were examined, no se- Lanza et al. (1980) examined the wood anatomy and quence homology was found with any known protein water conductivity of old and nucellar clones of some (Fogliano et al., 1994, 1998). lemon cultivars in relation to their resistance to MSD, Other Israeli studies showed that partially purified concluding that the different behaviour of the analyzed preparations of the malseccin complex damaged the cultivars was not associated with the length and diame- chloroplasts and inhibited the photosynthetic fixation ter of the vessels, nor with water conductivity. In previ- of carbon in the leaves of rough lemon (Nachmias et al., ous studies, however, Paculija (1959) and Scaramuzzi et 1980). When the effect of partially purified Pt60 was al. (1964) associated the susceptibility to mal secco in- evaluated on the viability of protoplasts of several Ru- fections with luxuriant vegetation. Finally, according to taceae species and cultivars a differential sensitivity was Tokhadze (1971) the resistances to MSD seems directly observed. Non-citrus species were more tolerant to the correlated with linked water and inversely with free wa- toxin. Electron microscopy observations revealed severe ter content. ultrastructural alterations of the cellular membrane, and Following the results of Luisi et al. (1979), who re- the chloroplast bounding membrane and thylakoids ported that artificially inoculated mature leaves of dif- similar to those observed in in vivo infected tissues (Ses- ferent resistant and susceptible cultivars exhibit the to et al., 1990). Damage to chloroplasts and/or reduc- same level of susceptibility/resistance of mature plants tion of photosynthesis since the first stages of MSD, has in the field, Bassi et al. (1980) and Perrotta et al. (1979, been reported by several authors (Demetradze and 1979a, 1981) investigated the cytological and histologi- Dzhanelidze, 1970; Demetradze et al., 1972; Kantschaveli cal changes of infected leaves of differently susceptible et al., 1972; Uturguari et al., 1973). citrus species. The alterations more frequently encoun- Other phytotoxic substances have also been identi- tered were: hyperplasia and hypertrophy of xylem fied and characterized. A termostable, hydrophilic, low parenchyma cells, plasmolysis, gumming of the vessels, molecular weight (350-700 Da) phytotoxin, acting as cell wall modifications, crushing of the vessels, derange- de-coupling of the electron transport in chloroplasts ment of plastids, increased number of mitochondria. In and inducing chlorosis in lemon leaves was identified the susceptible Femminello lemon, P. tracheiphila prolif- and partially purified by Barash et al. (1981). Goliadze erated actively invading the vascular bundles, the xylem et al. (1972), by treating lemon seeds and seedlings with parenchyma reacted hyperplastically and hypertrophy- P. tracheiphila toxins obtained albinism in 57% of the cally, xylem tissues were disrupted and the necrosis ex- 001_JPPInvitedReview_523 15-11-2011 17:35 Pagina 532

532 Mal secco disease of citrus Journal of Plant Pathology (2011), 93 (3), 523-560

tended to the cambium, but the fungus was not restrict- gree of susceptibility to MSD, and a variable phenolic ed. Instead, in the resistant Monachello lemon the content in the roots and leaves. However, irrespective of pathogen progressed for a short distance from the site the lower or higher susceptibility to the disease, several of infection and only within the injured tissues. The phenols (m-hydroxybenzoic, o-cumaric, and pherulic cambium was unaffected and remained active. Similarly, acids) increased in response to P. tracheiphila infection. Goliadze and Kerkadze (1971) observed in an artificial- Subsequently, Evola et al. (1976) investigated the effect ly inoculated susceptible Georgian cultivar a necrosis of of some phenolic compounds and hesperidin on the en- the cambium and a phloem and medulla significantly zymatic activity of P. tracheiphila, showing that the de- larger than in the resistant Meyer lemon. velopment of the fungus was significantly inhibited in As to the supposed role of gum deposits in the resist- substrates containing either one of the following: hes- ance to MSD, it can be hypothesized that this substance peredin, m-coumaric, gentisic, ferulic, 4-hydrox- can only slow down the spread of P. tracheiphila, since yphenylpyruvic and o-coumaric acid. Polygalacturonate the fungus survives and sporulates in vessels filled with transeliminase, pectinmethyl-esterase, ß-glucosidase and gum (Bugiani et al., 1959; Graniti, 1969). Nevertheless, polyphenoloxidase activity was reduced most consis- gums may have a bearing in the transmission of infec- tently in the presence of hesperedin, whereas variable tion from the leaves to the branches, as suggested by increase or reduction in activity were observed with the Traversa et al. (1991) who found more gum than myceli- different phenolic compounds. Therefore, the conclu- um in the main veins and petioles of artificially inoculat- sion was that there is no correlation between the com- ed resistant Monachello and sour orange leaves, where- pounds exerting a inhibitory activity on the pathogen’s as the mycelium was more abundant in the leaf veins of enzyme production and the accumulation of the same susceptible Femminello. compounds following mal secco infections of sour or- The chemical mechanisms of resistance, both pre- ange seedling (Salerno et al., 1971a). and post-infection have attracted much attention. Ac- Catara et al. (1971, 1972, 1973), after testing the cording to Egorova (1958), resistant lemon cultivars dif- fungistatic activity of phenolic extracts from healthy fer from the susceptible ones (e.g. Novogeorgian plants and plants affected by infectious variegation or lemon), because of the higher activity of peroxidases, exocortis, studied the post-infectional phenolic metabo- the higher and different acid and alkaloid content, and lism, and observed that in sour orange and Feminello the quantity of nitrogen and soluble alkali. Reduced lemon P. tracheiphila induced an accumulation of free catalase and peroxydase activity and a higher ascorbic phenols 6-8 days post inoculation. The accumulation acid content were reported in susceptible cultivars was higher in plants with the resistant Vaniglia orange (Tsiklauri, 1972). However, according to Pacetto and interstock (Davino et al., 1974). Later, the same authors Grasso (1969) and Pacetto and Davino (1980), it does examined the variations of free acid phenols during the not seem that the activity of oxidative enzymes can be time course of MSD but did not reach ultimate conclu- related to the degree of susceptibility to MSD. Goliadze sions on the role of these substances in the mechanism (1960) refers of substances generically indicated as phy- of resistance to the disease (Davino et al., 1979, 1979a). toncides, which he found active only in resistant lemon More recently, Reverberi et al. (2008) conducted an cultivars and in the roots of Poncirus trifoliata. in planta and in vitro study on the role of the oxidative In resistant citrus plants Ben-Aziz et al. (1962) found stress in the lemon-P. tracheiphila interaction, using the two substances, one of which strongly inhibited the cvs Monachello, Interdonato, and Femminello, which growth of P. tracheiphila in culture. In subsequent inves- are considered as resistant, partially resistant, and sus- tigations (Ben-Aziz, 1967) some compounds of the ceptible to mal secco infections, respectively. When in- flavone group were isolated from tangerine plants, oculated with P. tracheiphila, cv. Interdonato leaves among which, nobiletin and tangeritin afforded a high showed chlorosis and necrosis and an increase in fungistatic activity. Pinkas et al. (1968) isolated five lipoxygenase and glutathione peroxidase. Furthermore, flavones from tangerine, four of which were active in extracellular proteins of P. tracheiphila infiltrated into vitro against P. tracheiphila. Subsequently, Piattelli and the leaves induced lipoperoxide formation tenfold high- Impellizzeri (1971) found no correlation between the er in cvs Interdonato and Femminello, and threefold concentration of nobiletin, tangeritine and 5,4’-dihy- higher in cv. Monachello compared with the control, droxy-6,7-8,3’ tetrametoxiflavon and resistance of some with Monachello reacting earlier. Results from in vitro citrus species. experiments indicated that the amendment of the fungal The role of phenolic compounds in the defence growth medium with lyophilized twigs and leaves of cv. mechanism of citrus plants against mal secco infection Monachello stimulated the concentration of superoxide was first investigated by Salerno et al. (1970, 1971a). dismutases, glutathione peroxidase, and catalase in the Sour orange seedlings inoculated with the agents of viral mycelium. When lyophilized twigs and leaves of cv. diseases known as concave gum and infectious variega- Femminello were added, the pathogen produced a high- tion, and with the exocortis viroid showed a variable de- er quantity of hydrolytic enzymes, such as polygalactur- 001_JPPInvitedReview_523 15-11-2011 17:35 Pagina 533

Journal of Plant Pathology (2011), 93 (3), 523-560 Nigro et al. 533

onase and laccase. After growth in malseccin-conducive (PAGE) is also recommended (EPPO/OEPP, 2007). media, a high amount of monoamine oxidase was found in the extracellular proteins of P. tracheiphila. The en- Conventional methods. Conventional detection pro- zyme catalyzes oxidative deamination of primary cedures rely on the observation of symptoms in the

amines, leading to a toxic accumulation of H2O2 and field, the isolation of the fungus from infected tissues NH4 in the host cell. Thus, the extracellular enzyme and a comparative study to establish whether its mor- monoamine oxidase could be among the different com- phological characteristics matches those of P. tracheiphi- pounds involved in MSD. la. Mal secco symptoms have been largely described above. However, since the occurrence of symptomless infections has been reported (Di Silvestro et al., 1988; DIAGNOSIS Balmas et al., 2005; Russo et al., 2008), this possibility should be taken in due consideration when propagative Based on the symptoms shown by infected plants, material is tested. As mentioned, the presence of pycni- one would assume that MSD diagnosis is easy. This is dia (Fig. 3B) on infected plants is a specific symptom of why the early diagnosis techniques developed during MSD, and the in vivo characteristics of these organs are the 1940s through the 1960s, were simple and readily very important for species differentiation. As stated be- applicable, as exemplified by the use of substances such fore, pycnidia can be easily observed by the end of au- as potassium hydroxide, sodium hydroxide, alcohol, tumn-winter on 1- or 2-year-old shoots which desiccat- and ammonia on the woody cylinder of infected plants ed slowly. These fruiting bodies are scleroplectenchyma- for the early detection of wood discoloration, tous, black at maturity, globose or more often rather (Kantschaveli and Gikachvili, 1948; Orshanskaya, 1952, flattened, lenticular ostiolate, and measure 60-165 × 45- 1953; Fedorinchick, 1953; Sinitsyna, 1953; Bazzi and 140 mm. They occur rarely on the leaf stipules (Graniti, Scrivani, 1954). 1963) and are formed primarily around the leaf scars or P. tracheiphila is a quarantine pathogen of great con- in the cracks of wilted cortical tissues. Pycnidia then cern for regional and national Plant Protection Services emerge in large and undefined areas of the wilting worldwide, i.e. European and Mediterranen Plant Pro- shoots, which acquire a silver-gray colour originated by tection Organization (EPPO), Asia and Pacific Plant the lifting of the epidermis detached from the underly- Protection Commission (APPPC), Caribbean Plant Pro- ing tissue and the black shade of the fruiting bodies. Py- tection Commission (CPPC), Comité de Sanidad Vege- cnidia are scattered or densely aggregated in small tal del Cono Sur (COSAVE), Inter-African Phytosani- groups which coalesce, freely settled in the disrupted tary Council (IAPSC), North American Plant Protec- and frayed cortical tissue. tion Organization (NAPPO), Pacific Plant Protection One of the most complete and detailed in vivo de- Organization (PPPO) which provide detailed informa- scription of P. tracheiphila structures (pycnidia, pycno- tion for avoiding or restraining the spread of the conidia, phialides, and phialoconidia) was provided by pathogen and for its correct identification. For APPPC, Ciccarone (1971), and will be briefly recalled here. De- COSAVE, CPPC, and PPPO the recommended regula- veloping pycnidia are astomatous, but at maturity devel- tory status of P. tracheiphila is in the A1 list, i.e., “a op a long neck 45-70 µm in diameter and up to 250 µm quarantine pest not present in that area”. Instead, the in length. The necks are cylindrical or tendentially ob- IAPSC and EPPO include P. tracheiphila in the A2 list, conical, quite often flared at the top, surrounded by a as a “quarantine pest present in that area but not widely dense and very dark hyphal mat that gathers under the distributed there, and being officially controlled” (EP- epidermis, cementing the fruiting bodies to the epider- PO/OEPP, 2009; 2010). As mentioned, P. tracheiphila mis and together in groups. The necks are easily re- does not occur in several citrus-growing countries of the moved with the epidermis, leaving behind widely and EPPO region, like the Iberian peninsula, Corsica (insu- irregularly opened pycnidial bodies. The wall of mature lar France) and Morocco, although no obvious climatic pycnidia consists of randomly arranged polygonal scle- or cultural factors prevent its potential establishment in roplectenchymatous cells, and is of about the same these uninfected areas. As the introduction of P. tra- thickness throughout. The surface of the pycnidial cavi- cheiphila is a serious threat to lemon-growing areas, re- ty is uniformly covered by very small phialides (3-4.5 x strictions on the movement of citrus propagating mate- 3-5.5 µm), irregularly saccular, widely conical or pyri- rial are mandatory. To be effective, these provisions form, tapering apically in a very short neck, no more must be supported by the availability of procedures for than 1 µm tall. They produce minute unicellular, a reliable, quick, and sensitive diagnosis. According to mononucleate and sometimes binucleate, hyaline pyc- the standard diagnostic protocol of EPPO, P. tracheiphi- noconidia (0.5-1.5 × 2-4 mm), with rounded ends, la can be identified by conventional and molecular shortly ellipsoid, irregularly pyriform, and sometimes methods. In some particular cases, the analysis of slightly curved. Conidia are sometimes extruded mycelial proteins by polyacrylamide gel electrophoresis through the ostioles in whitish cirri. Free hyphae grow- 001_JPPInvitedReview_523 15-11-2011 17:35 Pagina 534

534 Mal secco disease of citrus Journal of Plant Pathology (2011), 93 (3), 523-560

ing on exposed wood surfaces, wounded plant tissues, giving significantly higher absorbance values with in- and within the xylem elements of the infected host gen- fected than healthy lemon tissue extracts. However, un- erate thin phialides (12-30 × 3-6 mm) that produce larg- solved problems originated by high background levels, er conidia (phialoconidia) (Fig. 3A). These are mucosal, lowered the reliability of the test which, therefore has hyaline, unicellular, uninucleate (occasionally binucleate not been included among the diagnostic protocols ap- or trinucleate), straight or slightly curved, with rounded proved by EPPO/OEPP (2007). A procedure for the apices (3-8 × 1.5-3 mm). Blastoconidia are also formed. specific detection of P. tracheiphila propagules using im- They are 15-17 × 7-9 mm in size, ovoid, subpyriform, munofluorescent antibody staining was developed by sometimes bicellular, and are produced apically or inter- Rosciglione et al. (1989). The specificity of three antis- calary on the hyphae inside the xylem vessels and in cul- era raised against soluble antigens, boiled, and non ture on liquid media (Goidanich et al., 1948). Excellent boiled phialospores was tested against P. tracheiphila figures depicting the morphological traits of P. tra- mycelial, phyalospore and pycnidiospore extracts. The cheiphila can be found in Goidanich and Ruggieri antisera to boiled and non boiled phyalospores reacted (1947b, 1947c), Goidanich et al. (1948), Graniti (1955), with the target pathogen and with some P. lingam iso- Ciccarone and Russo (1969). lates, suggesting its serological relatedness with P. tra- Detailed information on collection and treatment of cheiphila. infected citrus samples, as well as on isolation proce- Serological methods have not found practical appli- dures for P. tracheiphila (agarized media, duration and cation for the diagnosis and identification of P. tra- temperatures of plate incubation, etc.) are reported in cheiphila. the specific diagnostic protocol issued by EPPO/OEPP (2007) [see also a recent extensive and highly informa- Molecular methods. The necessity of disposing of tive review by Migheli et al. (2009)]. fast, dependable and accurate methods as needed for In vitro-produced pycnidia often remain incomplete, reliable detection of a quarantine pathogen has fostered are thin-walled and open irregularly at maturity (Boere- the development of molecular identification protocols ma et al., 2004). In any case, as previously stated, almost in the last decades (Table 1). Nucleic acid-based meth- all fungal isolates lose the ability to produce pycnidia af- ods (e.g. cloned probes and/or PCR assays) are very ter the first-second culture transfer. Thus, the morpho- sensitive and potentially highly specific. Various proce- logical identification of P. tracheiphila relies mainly on dures are now available for extracting and purifying the characteristics of phialoconidia, which are usually DNA from fungal cultures, infected plants, soil or air produced after 8-10 days incubation at 21±2°C. On ar- samples. Reagents for detecting the fungal DNA are tificial media the fungus differentiates only phialoconi- easier to prepare and more stable than those used for dia, although some isolates can also lose this ability after RNA. However, since DNA can also be extracted from repeated subculturing (EPPO/OEPP, 2007; Migheli et dead pathogen cells, RNA-based procedures should be al., 2009). preferred since their use can more accurately reflect the presence of viable targets. PAGE analysis and serological methods. P. tra- At the end of the 1980s, Rollo et al. (1987) developed cheiphila strains that do not produce phialoconidia and a hybridization protocol based on a cloned probe tar- pycnidia, regardless of whether they are chromogenenic geted to an undetermined DNA region of a sequence or not, can be identified using a method based on poly- from a genomic library of P. tracheiphila, which success- acrylamide gel electrophoretic (PAGE) analysis of fully detected the fungus also in symptomless woody mycelial proteins and isozymes (EPPO/OEPP, 2007; samples and in infested soil (Di Silvestro et al., 1988, Cacciola et al., 1987). Total proteins are visualized by 1990). Subsequently, based on the sequence of a sub- Coomassie blue staining, and esterase (EC 3.1.1.1 or EC clone obtained from the initial probe, two primers and 3.1.1.2) and glucose phosphate isomerase (EC 5.3.1.9) an internal probe were designed (Rollo et al., 1990). are suggested as alternative diagnostic isoenzymes. This The ensuing conventional PCR protocol allowed the method is laborious, time-consuming, and the interpre- sensitive diagnosis of MSD (Albanese et al., 1998), the tation of results may not be easy if a reference strain of evaluation of lemon somaclones for tolerance to the dis- P. tracheiphila and other Phoma spp., such as P. med- ease, and the monitoring of P. tracheiphila colonization icaginis, are not included in the test as controls (EP- of lemon plants treated with Pseudomonad biocontrol PO/OEPP, 2007). strains (Coco et al., 2004). A diagnostic technique based on immuno-enzymatic Balmas et al. (2005a), studying the genetic diversity tests (ELISA) was developed by Nachmias et al. of isolates of P. tracheiphila and other Phoma species (P. (1979a), using an antiserum against an acetone precipi- betae, P. cava, P. exigua, P. fimeti, P. glomerata, P. lingam, tate of a P. tracheiphila culture fluid. This antiserum re- and P. medicaginis) designed a pair of specific primers acted positively in agar double-diffusion tests and in (PtFOR2 and PtREV2) on the consensus sequence ob- DAS-ELISA, but the latter assay was more sensitive, tained from the alignment of newly generated ITS se- 001_JPPInvitedReview_523 15-11-2011 17:35 Pagina 535

Journal of Plant Pathology (2011), 93 (3), 523-560 Nigro et al. 535

Table 1. Oligonucleotide primers and fluorescent probes used for the molecular detection (dot blot, conventional and real time PCR) of Phoma tracheiphila.

Primer Name Sequence (5'-3') Target Reference GR70 GATCCGTACGCCTTGGGGAC Genomic DNA (cloned probe) Rollo et al. (1987; 1990) GR71 GATCCGAGCGGGACGAGCAG Pt-FOR GGATGGGCGCCAGCCTTC ITS1-5.8S-ITS2 Balmas et al. (2005a) Pt-REV2 GCACAAGGGCAGTGGACAAA ITS1-5.8S-ITS2 GR70 GATCCGTACGCCTTGGGGAC

Rollo et al. (1990) GL1 AGAAGCGTTTGGAGGAGAGAATG Genomic DNA Licciardello et al. (2006) PP1 (probe) FAM-CACGCAATCTTGGCGACTGTCGTT-TAMRA

P.trachITSF CAGGGGATGGGCGCCAGCC

Ezra et al. (2007) P.trachITSR CCGTCCTGCACAAGGGCAGTGG ITS

Phomafor GCTGCGTCTGTCTCTTCTGA

Phomarev GTGTCCTACAGGCAGGCAA De Montis et al. ITS (2008)

Phomaprobe FCCACCAAGGAAACAAAGGGTGCGQ TaqMan®

quences. A conventional PCR-based assay allowed the ventional isolations on agarized media. Interestingly, the specific detection of P. tracheiphila in naturally infected pathogen was not detected by conventional and molec- citrus woody tissue collected from both symptomatic ular diagnostic methods in the new vegetation flushes and symptomless plants. The limit of detection was 10 during summer, indicating that symptomatic plants can pg of genomic DNA and 5 fg of the ITS target se- recover, and confirming that high temperature inhibits quence. With this test, “mal nero” disease was also diag- xylem colonization by the fungus (De Patrizio et al., nosed on Fortune mandarin and the Tacle hybrid [C. 2009). These findings appear in disagreement with EP- sinensis (L.) Osbeck ‘Nucellar Tarocco’ x C. clementina PO’s current diagnostic protocol stating that field sam- Hort. ex Tanaka ‘Monreal’], and the results correlated ples for isolation can be taken at any time of the year with isolations from symptomatic wood. Subsequent (EPPO/OEPP, 2007). tests conducted by Kalai et al. (2010) confirmed the The genetic characterization of a population of P. tra- specificity of primers PtFOR2 and PtRev2, and moni- cheiphila isolates from Israel using ITS sequences was tored the migration of the pathogen in sour orange ves- pursued by Ezra et al. (2007), who developed a conven- sels, showing that within 10 days post inoculation (dpi) tional PCR assay that differed from the Balmas and fungal DNA was detectable 10 cm above the inocula- coworkers protocol (Balmas et al., 2005a) in the anneal- tion point and 30 dpi the fungus had travelled a dis- ing temperature used for the reaction. tance in excess of 50 cm. The method developed by Bal- The advent of real-time PCR made diagnostic tests mas et al. (2005a) was also used to test the susceptibility more accurate, sensitive, and less time-consuming than to MSD of various lemon cultivars and hybrids artifi- conventional PCR, eliminating the postamplification cially inoculated with P. tracheiphila. The susceptibility processing steps. A specific primer pair and a dual-la- of lemon plants evaluated on symptom severity correlat- beled fluorogenic probe were used by Licciardello et al. ed with the colonization of the xylem by the pathogen, (2006) for real-time PCR assays with the Cepheid Smart and the results of PCR assays were consistent with con- Cycler II System to detect P. tracheiphila in citrus plants. 001_JPPInvitedReview_523 15-11-2011 17:35 Pagina 536

536 Mal secco disease of citrus Journal of Plant Pathology (2011), 93 (3), 523-560

Conventional and real-time PCR assays successfully de- EPIDEMIOLOGY tected the pathogen in woody samples of naturally infected lemon and artificially inoculated sour orange Mal secco primary infections, commonly referred to seedlings. Real-time PCR was about ten- to twentyfold as “ordinary”, take place annually and originate from more sensitive than conventional PCR, showing a detec- the spores released by pycnidia, which differentiate in tion limit of 500 fg of fungal DNA, whereas convention- autumn-winter on infected organs still on the plant or al PCR required a minimum of 10 pg of pathogen DNA lying on the ground. When the temperature averages ca. for its successful detection. Morevover, real-time PCR 10°C and citrus plants are dormant the pathogen is still assay could detect P. tracheiphila in symptomless sec- active. It infects the host through injuries on the canopy tions of twigs from infected lemon plants. Coupling re- and/or through wounds at the base of the trunk and on al-time PCR with a simple and rapid procedure to ob- the roots, and starts colonization (Ruggieri, 1953, 1956). tain suitable DNA from citrus plants to be tested, en- Symptoms appear during spring-early summer, when abled the diagnosis of MSD within about 10 min. In ad- the hosts are in full vegetation but they do not proceed dition to detection, real-time PCR can be used for quan- further during the plant’s vegetative rest in summer. titative monitoring of P. tracheiphila biomass in infected Symptom development resumes in late summer and au- plant tissues (Licciardello et al., 2006). tumn, with the invasion of the new vegetation and the Employing the same primers but a modified version subsequent formation and maturation of pycnidia, of the probe, consisting in the use as quencher of the which are responsible for the primary infections. Al- Black Hole Quencer1 (BHQ1) instead of TAMRA, the though pycnidia can be found on the host throughout real-time protocol resulted unprecedently more sensi- the year, pycnoconidia lose germinating power during tive (0.1 pg fungal DNA), allowing also the quantitative summer (Grasso and Perrotta, 1980). Therefore, they monitoring of P. tracheiphila spread in the host (Russo, are not responsible for those infections that take place 2008; Russo et al., 2011) The versatility of this protocol in years when heavy rain, wind, and hail storms occur at was such that variable DNA amounts were detected and the end of summer-beginning of autumn. These infec- quantified in naturally contaminated soil, sampled from tions, referred to as “extraordinary”, are caused by spring to autumn beneath infected lemon trees in four phialoconidia, that are produced quickly and abundant- different citrus groves (Russo et al., 2011). ly on infected and wounded shoots (Salerno and Cutuli, Another real-time protocol for in planta-specific de- 1976; Salerno et al., 1976). tection and absolute quantification of P. tracheiphila was developed by De Montis et al. (2008). The primers and Susceptibility of citrus species and related genera to hybridization probe were designed on the sequences of the disease. Besides the species of the genus Citrus, P. the ITS nuclear rRNA genes, and the SYBR Green I de- tracheiphila is potentially able to infect members of oth- tection dye and a TaqMan hybridization probe were er genera, such as Poncirus, Severinia and Fortunella, as used in the assay. The testing material was sour orange well as interspecific and intergeneric hybrids. As previ- inoculated with P. tracheiphila, and the results were ously mentioned, lemon is the most important species compared with the classical isolation and plating among those affected by MSD, due to its economic rele- method. Detection and quantification of the pathogen vance and high susceptibility. Before the appearance of was possible by both technologies, the detection limit the disease in Sicily, the Italian lemon industry consisted being ten copies of the cloned target sequence and 15 of an heterogeneous population of Femminello, mainly pg of genomic DNA extracted from fungal spores. The derived from seed propagation. This propagation sys- presence of non-target fungal DNA did not affect the tem may have allowed the establishment and dissemina- specificity of the assay, but caused a tenfold drop in sen- tion of resistant sub-populations such as Monachello sitivity (De Montis et al., 2008). and Interdonato, about 50 years before the epidemic Although the validity of molecular methods for P. tra- explosion of MSD (Ruggieri, 1931, 1931a, 1937a, 1938). cheiphila detection has been questioned because of the Interdonato is grown in a very restricted area and is extant uncertainty in the classification of species of the of limited commercial interest, thus it does not seem to genus Phoma (Aveskamp et al., 2008), the addition by have much future. International Plant Protection Services of real-time PCR Monachello comprises a number of clones (Ruggieri, to the MSD detection protocols is most desirable for: (i) 1937a), all of which show good levels of resistance to speeding-up the control procedures required by sani- mal secco (Fig. 2A). Notwithstanding the excellent be- tary certification; (ii) adding a touch of certainty to diag- haviour of this population towards MSD, there are sev- nosis, as molecular methods allow the detection of P. eral reasons that restrain its diffusion: (i) unsatisfactory tracheiphila also in symptomless but infected tissues (Di qualitative and quantitative production level, such as Silvestro et al., 1988; Balmas et al., 2005; Russo et al., low yield of juice and essence, low acidity of the juice, 2008). higher susceptibility of the fruits to black pit (Pseudomonas syringae pv. syringae), low diversification 001_JPPInvitedReview_523 15-11-2011 17:35 Pagina 537

Journal of Plant Pathology (2011), 93 (3), 523-560 Nigro et al. 537

of the yield; (ii) poor adaptability to the different In other countries where MSD is severe, the behavior lemon-growing areas; (iii) limited grafting affinity with of lemon cultivars is variable, though resistance levels sour orange rootstocks (Cutuli and Salerno, 1976). comparable to those of Monachello and Interdonato Femminello lemon has a clonal progeny more numer- have not yet been found, except for the Meyer lemon. ous and variable than Monachello as far as productivity As far as the susceptibility to MSD of some citrus and susceptibility to MSD are concerned. However, genera, species, hybrids, and cultivars other than lemon none of the Femminello clones equals the resistance of is concerned, the numerous literature reports do not al- Monachello. It should also be noted that the less sus- ways allow an appropriate comparison. Anyhow, their ceptible cultivars such as Santa Teresa (Ruggieri, 1937, susceptibility and relative references are repoted in 1956), besides a low qualitative and quantitative pro- Table 2. duction level, shows a low adaptability to different pe- doclimatic conditions. Even the quite resistant lemon Primary source of inoculum. The consensus is that cv. Quattrocchi (Ruggieri, 1940a) shows a strong graft- one of the primary sources of inoculum is represented ing disaffinity with sour orange. Other Femminello by the pycnidia which differentiate primarily on young clones that are rather widespread in Sicily and are less shoots of diseased plants (Petri, 1929a; Goidanich and susceptible to MSD than common Femminello are Con- Ruggieri, 1947b, 1947c; Stepanov, 1950) and on suckers tinella and Fior d’arancio, the latter also known as Za- of pollarded infected plants (Cutuli and Salerno, 1977). gara bianca (Damigella and Continella, 1970, 1971, Based on laboratory observations, Petri (1930b) 1971a; Salerno and Cutuli, 1992). thought that another metagenetic form of P. tracheiphila The foreign lemon cultivars introduced into Italy and putatively working in nature was of hyphal origin, con- grown in the areas affected by MSD, such as Lisbon, sisting of free phialids that developed abundantly from Eureka, Messina, Mesero, Verna, etc., have a suscepti- the mycelium under high humidity conditions. The exis- bility similar to that of common Femminello (Russo, tence of this form of propagules, which had not been 1977). found in nature, was confirmed by laboratory experi- The Greek lemon industry is essentially based on cvs ments (Goidanich and Ruggieri, 1947, 1947b). Cutuli Maglini and Karystini, which are susceptible and mod- and Salerno (1980) observed the differentiation of erately susceptible to MSD, respectively. By contrast cv. phialoconidia in the field and initiated studies to define Adamopoulou, is considered as moderately resistant, their epidemiological significance. Phialoconidia are and still more resistant is cv. Messaras (Protopapadakis, produced quickly and abundantly on wounded infected 1983). Thanassoulopoulos (1983) reported that none of shoots, and are responsible for the epidemic explosion the major Greek lemon cultivars are resistant, but later of the infections after hail storms and/or heavy rain with he described as resistant cv. Hermioni, derived from cv. strong wind during late summer-early autumn, when Maglini by bud mutation (Thanassoulopoulos, 1991). there are no longer pycnoconidia able to germinate. In Turkey, an important lemon-producing country, Subsequently, De Cicco et al. (1986) determined that the degree of susceptibility of the cultivars to MSD is the production of phialoconidia is optimal at humidity quite variable. Cultivars showing a certain level of resist- levels close to saturation and at a temperature of 20- ance are Molla Memed and Finike Yuvarlak, less resist- 25°C, and it is usually completed within two-three days ant are the cvs Kibris, Anatolia Yuvarlak, Interdonato, (exceptionally within one day) in the lesions of infected and Santa Teresa. Susceptibility similar to that of Fem- organs exposing the naked wood, thus confirming the minello is shown by the local cvs Kütdiken, Lamas, earlier hypothesis by Cutuli and Salerno (1980). Consid- Peri, and those introduced from abroad, such as Lisbon ering that the apical or intercalary production of blas- and Eureka (Akteke and Karaca, 1977; Karel, 1956; Ak- tospores on the hyphae is uncommon, it seems that teke, 1978). phialides and pycnidia are the only structures dissemi- In Georgia, the cold weather is an aggravating factor nating P. tracheiphila with an epidemiological relevance, that renders citrus species other than lemon susceptible and with different roles, according to the season and the to MSD. Generally, lemon cvs Novogeorgian, Villafran- prevailing environmental conditions. ca, Udorarik, and Genoa are retained as susceptible, As previously mentioned, pycnidia differentiate at whereas a good level of resistance is shown by Meyer relatively low temperatures in late autumn and winter and Monachello (Dzaneladze and Razmadze, 1960; and their spores lose germinability in summer (Grasso Samolodas, 1977; Hohryakov, 1952; Donadze, 1966; and Perrotta, 1980) Thus, the spread of mal secco infec- Egorova, 1958). tions that commonly occur after hail storms, at a time In Israel, where no MDS-free area exists (Monselise, differing from that of “ordinary” infections (Cutuli and 1983), mal secco is more severe on cvs Villafranca, Lis- Li Destri Nicosia, 1976), can be explained only by as- bon and Eureka, whereas Santa Teresa is less severely suming the massive presence of phialoconidia concomi- affected and even less so Interdonato and Monachello tantly with the presence of wounds that expose the (Solel and Oren, 1975). wood or are consequent to the traumatic detachment of 001_JPPInvitedReview_523 15-11-2011 17:35 Pagina 538

538 Mal secco disease of citrus Journal of Plant Pathology (2011), 93 (3), 523-560

the leaves from the shoots. These breaches provide the less, the fungus does not seem to experience any diffi- pathogen with a way for penetrating the host or for es- culty of survival, thanks to its localization in the tissues caping from it, allowing differentiation of phialides and of a long-lived host. In fact, P. tracheiphila can survive as phialoconida. living mycelium in the shoots, branches, trunks and P. tracheiphila can spread from several inoculum roots as well as pycnidia and, perhaps, mycelium in de- sources: (i) infected aerial organs fallen to the ground; tached parts of the plants. Its survival as latent infector (ii) infected superficial roots; (iii) propagules present in of non-host plants cannot be excluded either (Salerno the soil. The relevant epidemiological role of infected and Catara, 1967). pruning material left on the ground has been demon- The presence of the fungus in the soil has been stud- strated (De Cicco et al., 1984), and results from specific ied in relation to the importance and frequency of root trials have shown that soil containing infected wood ma- infections (Cutuli, 1972). P. tracheiphila inoculum in the terial is a source of inoculum for wounded citrus roots soil derives from propagules originated by epigean in- over a period longer than four months. The nature of fections, especially from infected plants organs left on the soil did not appear to affect significantly its infective the soil surface after pruning or fallen naturally to the capacity, although a lower percentage of infected plants ground (De Cicco et al., 1984), as it happens with the was registered in clayey soil (De Cicco et al., 1987). leaves (Traversa et al., 1991, 1992). The hypothesis that The presence of air-borne P. tracheiphila inoculum in infected leaves could be responsible for root infection infected lemon groves was assessed quantitatively in was verified under controlled experimental conditions, Sicily. The highest number of propagules was found and found to be true, particularly at 10°C, the lowest from late autumn to early spring, being apparently cor- temperature tested (Traversa and Lima, 1993). The related with rainfalls. The mobility of propagules from presence of P. tracheiphila inoculum in the soil was first the source of inoculum is limited (Tuttobene, 1994), as demonstrated by Di Silvestro et al. (1990) using a DNA previously determined by Laviola and Scarito (1989). probe, and recently confirmed by quantitative real-time PCR (Russo et al., 2011), which detected a high number Survival and dissemination of the pathogen. No rest- of fungal propagules, particularly in the superficial soil ing structures of P. tracheiphila are known. Neverthe- layers (first 10 cm) and, in accordance with the previous

Table 2. Susceptibility to mal secco disease of some Citrus species, allied genera, and hybrids other than lemon (1).

Latin binomial and common name Susceptibility (2) References Ruggieri, 1948; Reichert and Chorin, 1956; Citrus jambiri Lush., Rough lemon +++ Solel and Oren, 1975; Russo, 1977; Reforgiato Recupero, 1979 ++ Russo, 1977; C. volkameriana Ten. et Pasq., Volkamer lemon +++ Salerno et al., 1967; Catara and Cutuli, 1972; Ruggieri, 1948; Russo, 1977; ++ Citrus meyeri Y. Tan., Meyer lemon Goladze, 1966; Egorova, 1958; Hohryakov, + 1952; Dzaneladze and Razmadze, 1960; C. limonimedica Lush., Citron lemon + Russo, 1977; Catara and Cutuli, 1972; C. ichangensis Swing. x C. grandis (L.) Osbeck, Russo, 1977, 1985; De Cicco et al, 1984a; + Ichang lemon CRC. 1215 Ippolito et al. 1991; Nigro et al., 1996; C. webberii West. +++ Russo, 1977; Citrus Karna Raf., Karna lemon +++ Ruggieri, 1948; Catara and Cutuli, 1972; Petri, 1930; Ruggieri, 1948; Catara and C. medica L., citron +++ Cutuli, 1972; Reichert and Fawcett, 1930; Solel and Oren, 1975; Catara and Cutuli, 1972; Solel and Oren, C. limettoides Tan., sweet lime of Palestine + 1975; C. limonia Osbeck, Rangpur lime +++ Ruggieri, 1948; Chapot, 1963; Russo, 1977; C. aurantiifolia (Christm.) Swing., Mexican lime +++ Ruggieri, 1948; Catara and Cutuli, 1972; Catara and Cutuli, 1972; Terranova and C. bergamia Risso, bergamot +++ Cutuli, 1975; Ruggieri, 1931; 1948; Gassner, 1940; Battiato, 1948; Baldacci and Garofalo, 1948; Grasso C. deliciosa Ten., common mandarin + and Pacetto, 1971; Catara and Cutuli, 1972; Grasso, 1973; Donadze, 1966; Sole and Oren, 1975; Catara and Cutuli, C. reticulata Blanco, Wilking mandarin ++ 1972; 001_JPPInvitedReview_523 15-11-2011 17:35 Pagina 539

Journal of Plant Pathology (2011), 93 (3), 523-560 Nigro et al. 539

Table 2. Susceptibility to mal secco disease of Citrus species, allied genera, and hybrids other than lemon cont.

Latin binomial and common name Susceptibility (2) References C. reshni Hort. ex Tan., Cleopatra mandarin + Ruggieri, 1953b; Russo, 1977;

Catara and Cutuli, 1972; Grasso, 1973; Solel C. clementina Tan., common clementine ++ and Oren, 1975; Cutuli and Salerno, 1980;

Catara and Cutuli, 1972; Crescimanno et al., 1973; Russo, 1977; Reforgiato Recupero, C. macrophylla Wester, alemow +++ 1979; Protopapadakis and Zambettakis; 1982; Ippolito et al., 1991; Nigro et al., 2000; Ruggieri, 1948; Catara and Cutuli, 1972; C. junos Sieb. ex Tan., Yuzu orange +++ Russo, 1977; Reforgiato Recupero, 1979; Nigro et al., 1996, 2008; ++ Crescimanno et al., 1973; C. sinensis (L.) Osbeck, sweet orange + Ruggieri, 1948; Ruggieri, 1940a, 1948; Salerno, 1964; Catara C. aurantium L., common sour orange +++ and Cutuli, 1972; Nigro et al., 1996; C. aurantium L., S. Marina selection ++ Reforgiato Recupero, 1979; Nigro et al., 2008 Ruggieri, 1948; Catara and Cutuli, 1972; Solel C. paradisi Macf., grape fruit + and Oren, 1975; Russo, 1977 C. myrtifolia Raf., chinotto +++ Ruggieri, 1948; Catara and Cutuli, 1972; C. madurensis Lour., calamondin ++ Ruggieri, 1948; Catara and Cutuli, 1972; Crescimanno et al., C. pennivesculata Tan., gajanimma +++ 1973; Reforgiato Recupero, 1979; Crescimanno, et al., 1973; Russo, 1977; C. taiwanica (Tan. and Shim), Taiwan orange +++ Reforgiato Recupero, 1979; Ippolito et al., 1991; Nigro et al., 1996; Nigro et al., 2008 C. latipes (Swing.) Tan., Khasi papeda + Russo, 1977; C. paradisi Macf. x C. sinensis (L.) Osbeck, Russo, 1977; Reforgiato Recupero, 1979; siamelo Ippolito et al.,1991; Nigro et al., 1996, 2008; Citrus ⋅ tangelo, Orlando tangelo CRC 2790 + Russo, 1977; Reforgiato Recupero, 1979; Citrus ⋅ tangelo, Orlando tangelo ++ Catara and Cutuli, 1972; Poncirus trifoliata (L.) Raf., trifoliate orange + Petri, 1930; Ruggieri, 1948; Fortunella sp., kumquat + Hohryakov, 1952; Catara and Cutuli, 1972; Severinia buxifolia (Poir.) Ten., box orange ++ Catara and Cutuli, 1972; Russo, 1977 P. trifoliata (L.) Raf., x C. sinensis(L.) Osbeck Russo, 1977; Catara and Cutuli, 1972; Solel ++ ‘Washington Navel’, citrange carrizo and Oren, 1975; C. sinensis (L.) Osbeck ‘Washington Navel’ x C. Russo, 1977; Catara and Cutuli, 1972; Solel ++ trifoliata (L.) Raf., citrange troyer and Oren, 1975.

(1) Adapted and updated from Cutuli et al., 1984; (2) Susceptibilty level: + = low; ++ = medium; +++ = high.

literature data (Daraseliya, 1953; Danelija, 1968; Faval- moved the fruiting bodies crack at the base of the neck oro and Somma, 1983; Garbeva et al., 2004), substanti- and expose large masses of conidia embedded in the ated that complex interactions of competition and an- surrounding mucilage to the disseminating action of tagonism exist between soil-borne fungi and bacteria. rain and wind. In fact, rainfalls and infection rate were Petri (1930a) believed that conidia could be dissemi- found to be correlated (Solel, 1976) and the same rela- nated by wind after they had been released from pycni- tionship appears in the observations by Somma and dia. Shortly after he thought more likely that whole pyc- Scarito (1986). nidia, once detached from host tissue, could be trans- Ruggieri (1948) attributed a preminent disseminating ported by the wind and deposited at the site of infection role to the wind, but he thought that other biotic and (Petri, 1930c, 1930d). However, as illusrated by Cic- abiotic vectors could be involved in spreading of the in- carone (1971), it should be remembered that, due to the oculum. Later, Kouyeas and Anastassiadis (1962) and basal attachment of pycnidia to the cortex and of their Salerno and Cutuli (1977) discussed the role of birds in ostiole to the lifted epidermis, when the latter is re- the dissemination of pycnoconidia. Laviola and Scarito 001_JPPInvitedReview_523 15-11-2011 17:35 Pagina 540

540 Mal secco disease of citrus Journal of Plant Pathology (2011), 93 (3), 523-560

(1989), investigated the distance and direction of Butera et al. (1986) showed that physiological or propagules (pycnidia and pycnoconidia) dissemination traumatic leaf shedding generates points of entry that by placing groups of sour orange seedlings around an remain receptive in the field for a week after leaf de- inoculum source. They found that dispersion is over a tachment (D’Anna et al., 1986). In partial agreement relatively short distance (no more than 30-40 m) and with the above, Salerno and Cutuli (1977) and De Cicco follows the direction of the prevailing wind. This short et al. (1987) claimed that wounds caused by traumatic distance indicates that P. tracheiphila pycnoconidia do leaf shedding remain receptive for a longer period of not follow the rules of anemophilous dissemination, time as the temperature drops, whereas the physiologi- which tallies with the notion that they are immersed in cal detachment of the leaves does not allow infection in mucilage. Instead, these spores are more likely scattered the abscission zone. by rain drops which are wind-borne over short dis- Traversa et al. (1991) investigating specifically the tances (Tuttobene, 1994). conditions affecting the movement of the fungus from As reported by Adonia (1991), the spatial distribu- leaves to twigs found that at 15°C, the lowest tempera- tion of mal secco-infected plants in lemon groves tends ture tested, there was the highest transferring activity. to be uniform, but plants with older infections give rise On the other hand, data also showed that in Femminel- major compact foci of secondary infections. The same lo lemon, the most susceptible among the hosts tested author believes that the effects of local conditions pre- (sour orange, Femminello, and Monachello lemons), the vail over large-scale factors, such as the climatic condi- tender leaves always sustained a higher transfer rate of tions in a wider sense. Moreover, the Moran index indi- the pathogen, according to the findings by Somma et al. cated that mal secco infections do not spread in a circu- (1981). Electron microscope investigations of the infec- lar pattern, in agreement with the findings of Laviola tion process taking place in wounded leaves of sour or- and Scarito (1989). ange showed that P. tracheiphila hyphae develop inter- Finally, the role of seeds from infected lemon plants cellularly, through both the spongy and the palisade in the spread of the pathogen has been investigated by mesophyll, and then localize in the tracheids. Once in Ippolito et al. (1987, 1992), who concluded that this dis- the xylem, P. tracheiphila remains confined there as long semination mechanism is unlikely, although the use of as the tissue stays alive (Perrotta et al., 1976). Propag- seeds from infected fruits should cautiously be avoided. ules of the fungus have been observed in the vascular bundles, in xylematic tissue disorganized by the infec- Infection and host colonization. P. tracheiphila pene- tion, and in necrotized cells of the perivasal parenchyma trates the host mainly through wounds. Petri (1930, (Perrotta et al., 1979). In the vessels the fungus differen- 1930d) thought that penetration could also occur tiates hyfal-type spores (Goidanich et al., 1948), which through the stomata, but despite numerous attempts, he are passively transported by the ascendant lymph and was unable to prove experimentally this hypothesis. Ak- rapidly spread the infection in the wood. In sour orange teke and Karaka (1977) reported 20 and 40% successful seedlings, inoculated in the basal portion of the stem, P. infections by inoculating apparently intact leaves of tracheiphila was re-isolated from top leaves (about 30 lemon seedlings on the adaxial and abaxial leaf surface, cm upwards) 24 h after inoculation (Scrivani, 1954). Us- respectively. However, the consensus is that the ing molecular detection methods, 30 days after inocula- pathogen penetrates axile organs, leaves (Solel, 1976; tion in the leaves, P. tracheiphila DNA was found in the Cutuli and Laviola, 1977; Cutuli and Salerno, 1980; xylem vessels at a distance of 50 cm or more below the Zucker and Catara, 1985; D’Anna et al., 1986) and roots inoculation point. Therefore, basipetal translocation of (Cutuli, 1972) exclusively through wounds. All current the pathogen seems very rapid and occurs prior to inoculation procedures for reproducing the disease are symptom expression (Kalai et al., 2010). based on the introduction of the inoculum, either Besides the passive movement of the spores which mycelium or conidia, in the host tissues through follows a direction parallel to the vascular vessels, fun- wounds. The higher incidence of mal secco infections gal spreading occurs also in radial direction due to hy- which are usually registered after meteoric events that phae passing from one vessel to another through the injury the plants (gales, hail), seems to confirm indirect- pits or by direct attack of the primary wall (Magnano di ly that wounds are the main port of entry of P. tra- San Lio and Perrotta, 1979; Perrotta et al., 1979). As a cheiphila in the host. In this regard, Lanza et al. (1980) consequence of such active movement, the fungus is found that after a month from their occurrence, the able to colonize several xylematic rings. The microscop- wounds are still receptive to infections. Other sources ic examination of woody tissue with the typical orange of injuries are frost, animal bites, thornes of the host, coloration, reveals, as mentioned, the presence of gum, and cultural practices, such as pruning, harvesting, hyphae and conidia in the lumen of vessels throughout plowing, etc. Any injury exposing the vascular bundles the xylem. However, most the vessell lumen remains constitutes a possible way of entry for the pathogen free. Sometimes, living hyphae enclosed in gum-like- (Bassi et al., 1980). substances extruded in the lumen of vessels have been 001_JPPInvitedReview_523 15-11-2011 17:35 Pagina 541

Journal of Plant Pathology (2011), 93 (3), 523-560 Nigro et al. 541

observed (Bugiani et al., 1960; Perrotta et al., 1979a). leaf shedding (De Cicco et al., 1987) or by any other In the advanced stages of the infection process, when cause (Lanza et al., 1988), which are longer receptive the host starts to wilt and necrosis of parenchyma tis- under these conditions. Moreover, as reported before, sues and cambium occurs, the fungal hyphae reach the some enzymes involved in pathogenesis are more active cortical parenchyma to form in the outermost layers, at 12°C than at warmer temperatures (Evola et al., just underneath the epidermis, a hyphaenchyma in 1973). which pycnidia differentiate. Sometimes, especially in Studying MSD in Turkey, Gassner (1940) claimed little susceptible hosts (e.g. Monachello), the cambium that frost is an essential factor for the onset of the dis- remains functional and continues to differentiate new ease. Petri (1940) and, later, Goidanich and Ruggieri woody rings, while the infection sites in the vascular (1949), rejected this hypothesis demonstrating that frost bundles remain trapped into the adventitious meristem can, on occasion, predispose the plants to P. tracheiphila produced by the xylem parenchyma (Somma et al., attacks, but is not essential to this aim. It is anyhow 1979; Perrotta et al., 1979). In such cases, the shoots do widely accepted that frost injuries provide a easier entry not wilt, and the pathogen can remain alive for several points for the pathogen, and facilitate the subsequent months, if not years. If these shoots are sectioned, the infectious process (Thanassoulopulos, 1986). typical discoloration can be seen in the innermost The importance of rain in determining MSD that had woody rings. already emerged in the past, was confirmed by Solel The realization that leaves detached from infected (1976) and Somma and Scarito (1986), who found a branches can serve as an inoculum source for root infec- close relationship between rainfall and infection rate. As tions (Traversa, 1991), promoted additional investiga- mentioned, Laviola and Scarito (1989) recognized the tions under growth chamber conditions which showed rain as a major agent of pathogen dissemination by the that the highest percentage of leaf infection was regis- wind, a meteoric event that, by itself, plays an epidemio- tered at 10°C and on Femminello rather than on logical role by creating ports for P. tracheiphila entry, Monachello and sour orange (Traversa et al., 1992). through a wide type of injuries directly caused to the Similar results were obtained from field studies, the plants. The role of the hail as wounding factor has also presence of the pathogen being higher in the leaves col- been largely recognized, as well as the relationship be- lected in spring than in autumn. As noted before, lemon tween massive infections and strong hail-storms (Rug- fruits and seeds from infected plants can be colonized gieri, 1950). Cutuli and Salerno (1980) highlighted the by P. tracheiphila (Stepanov and Shaluishkina, 1952), as role of the hail on some biological and epidemiological well as those from other susceptible species, including aspects of the pathogen. According to these authors, the some rootstocks (Ippolito et al., 1987, 1992). wounds have a dual role, serving as a way for the penetration of the pathogen in the ordinary infections (later Environmental factors. The effects of relative humidi- autumn and winter), and its evasion trough the produc- ty (RH) have not been investigated in detail. Petri tion of phialoconidia during the late summer-beginning (1930b) thought that RH values ranging from 65 to 90% of autumn, if wounds occur on infected organs. The ra- were necessary for conidial dissemination and infection, pidity of phialide and phialoconidia formation (De Cic- but Reichert and Chorin (1956) attributed a secondary co et al., 1986) and the easyness of phialoconidia dissem- role to this parameter. This contrasted with D’Anna et ination would facilitate the onset of new infections, al. (1986) findings, who claimed that saturated RH levels when inoculum and wounds occur simultaneously. Final- or nearly so are necessary for conidia germination and ly, Cutuli and Li Destri Nicosia (1976) underlined the phialoconidia production on organs whose infected negative effect of heavy hail on the resistance of citrus wood is exposed. These data concord with those by De species such as mandarin, Clementine and Monachello Cicco et al. (1986) who ascertained that on infected lemon. plant material observed over a 4-day period, the differentiation of phialoconidia occurred at 20 and 25°C with Orchard management. The direct and indirect effects RH close to saturation, but not at 15°C. of cultural practices on mal secco infections have re- Keeping inoculated plants at low temperature (5°C) ceived much attention, although the investigations and speeds up disease progression (Scaramuzzi et al., 1964). most of the conclusions come from field observations. A low temperature, i.e. around the minimum value (12- According to Ruggieri (1948) and Raciti et al. (1990) the 13°C) at which citrus plants start vegetating (Reuther, frequent irrigation combined with high level of nitrogen 1973), is propitious for the growth of P. tracheiphila fertilization would favour the disease, as well as the ex- (Salerno, 1964) and favours disease incitement. Indeed, cessive flushing caused by severe pruning (Cutuli and these temperatures promote: (i) the passage of the Salerno, 1977). Moreover, over-head irrigation in infected pathogen from the leaves to branches and vice-versa lemon groves facilitates pathogen dissemination, especial- (Traversa et al., 1991, 1992); (ii) the occurrence of new ly when the practice is anticipated in spring or postponed infections at the site of wounds produced by traumatic to autumn due to particular weather conditions. 001_JPPInvitedReview_523 15-11-2011 17:35 Pagina 542

542 Mal secco disease of citrus Journal of Plant Pathology (2011), 93 (3), 523-560

Soil tillage from mid-autumn to late spring, a period tial (a general measure of prophylactic nature); (ii) a in which the inoculum is abundant, may result in a high more specific intervention based on appropriate soil incidence of root infections. The no-tillage system is al- management (Cutuli and Salerno, 1977) which has been so detrimental, as it enables the roots to reach the upper dealt with in “Orchard management”. Pruning infected soil layers, thus facilitating the contact between inocu- shoots and branches represents the basic cultural prac- lum and rootlets (Salerno and Cutuli, 1977). Other tice on which rely prophylaxis and curative interven- detrimental cultural practices are intercropping with tions. Sanitation pruning, which should be carried out herbaceous host that require abundant fertilization and repeatedly as soon as symptoms become evident in irrigation in the period favourable to P. tracheiphila in- spring and early summer, preferably before the infected fections, and transplanting young and susceptible citrus leaves fall to the ground (Traversa and Lima, 1993), can plants during autumn and winter (Ruggieri, 1948). eliminate all diseased parts of the host, especially if done on young subjects. In fact, in older chronically diseased plants that may carry latent infections, the at- CONTROL tempts to sanitize through pruning may result in a more abundant vegetation and in a faster colonization of the Legislation. Legislative measures on MSD issued in healthy parts, as the infection can hardly be completely Italy since 1928 are many, and refer primarily to subsi- removed. In any case, to achieve this goal in practice, it dies to lemon growers for the replacement of the plants is necessary to cut the branches a bit under the last dis- killed by the disease. Only a few address the study and colored section, where no traces of the typical discol- prevention of the disease, but these have not always oration are visible. When symptoms are very extensive it been thoroughly enforced. is preferable to pollard the plant at a level always a bit Among these measures, worth of mention are the under the last diseased section, and regraft. With hard- Ministerial Decrees (D.M.) of October 5th 1928 and ened plant, where the disease progresses slowly, it June 30th 1929, which made MSD control compulsory, would be advisable to remove just the diseased limbs. requiring the cutting the diseased branches and the in- Cutting must be performed in autumn, shortly before cineration of pruning material. Later, to better coordi- the formation of picnidia on recently infected shoots nate control operations, the D.M. of February 18th 1933 and twigs. Equally important is the uprooting of the in- appointed the Director of the Plant Pathology Station fected stumps, as they may produce many suckers on of Rome as “Special Commissioner” for MSD control. which, once infected, numerous pycnidia are produced. In the 1950s these duties were passed onto the Director Suckers of healthy plants should also be promptly re- of the Fruit and Citrus Research Station of Acireale moved since their infection may result in the syndrome (Sicily), who was also entrusted with the responsibility known as “mal fulminante”. It seem worth reiterating of MSD control in Campania and Latium (D.M. March that in the MSD control strategy, removal of infected 11th 1950 and D.M. of April 20th 1956). The numerous shoots and branches and their subsequent destruction bylaws issued by the Sicilian regional authorities since by fire is a must, as their presence favours the formation August 1957, providing subsidies for lemon growers of the pathogen infective propagules, with serious con- and allotting research fundings, are not listed for brevity sequences for aerial and root infections. Moreover, it sake. The D.M. April 17th 1998, reaffirmed that MSD should be kept in mind that during uprooting of infect- control is compulsory throughout the Italian territory, ed trees, infected plant debris (e.g. sawdust, wood and that the infected citrus plants cannot be commer- chips, etc.) fall to the ground, constituting a source of cialized. Said D.M. called upon the Regional Plant Pro- inoculum which may seriously endanger newly trans- tection Services for the conduction of systematic surveys planted trees. Careful elimination of these debris is for disease detection and for implementing control therefore advisable. Finally, in areas where MSD is en- measures. Since 2005 (D.M. March 31th 2005), P. tra- demic, heavy pruning of healthy plants should be avoid- cheiphila is included among the harmful organisms ed, since the subsequent vigorous vegetation exposes whose introduction in the territory of the Italian Repub- them to infection. lic is prohibited. The protection of plants from meteoric adversities, such as wind, frost, and hail, is also an important prac- Cultural practices. Cultural practices deserve atten- tice to reduce mal secco infections. In windy areas, tion, since they may be relevant for disease epidemiolo- windbreaks should be installed and sheltering the plants gy and its impact. As a general rule, since young plants with anti-hail nets would be advisable. This is of para- are more susceptible than the adult ones, they need mount importance in the nurseries, especially when they more accurate cultural and prophylactic cares. are located in the proximity of potential inoculum Cultural practices which play a major role in root in- sources (e.g. infected groves) but has proven useful also fections are essentially two: (i) removal and destruction with commercial lemon orchards in terms of protection of diseased plant material for reducing inoculum poten- from P. tracheiphila infections and productivity. 001_JPPInvitedReview_523 15-11-2011 17:35 Pagina 543

Journal of Plant Pathology (2011), 93 (3), 523-560 Nigro et al. 543

Mineral fertilization plays an important role in pre- were also able to differentiate resistant and susceptible disposing plants to MSD. For instance, nitrogen appli- plants when applied to the roots of lemon hybrids cations at an optimal rate for yield, increases plant sus- (Kashakashvili et al., 1990) or infiltrated into the leaf tis- ceptibility (Gassner, 1940; Karel, 1956). By converse, sues of citrus seedlings (Graniti et al., 1998). Converse- the use of manure with a low nitrogen content, still bet- ly, the use of culture filtrates of P. tracheiphila was inef- ter if in combination with appropriate doses of phos- fective in differentiating known resistant and suscepti- phorus and potassium, slows disease progression and fa- ble citrus plants when applied to callus or leaves of cilitate the surgical treatments (Salerno and Cutuli, lemon, the literature reporting contrasting results 1982). (Graniti and Pennisi, 1987; Gentile et al., 1992; As mentioned, over-head irrigation should be avoid- Rosciglione et al., 1991; Traversa et al., 1992). This ined in infected lemon groves. Tree spacing is also of im- consistency was attributed to the relatively high hor- portance, since the disease impact is lower in dense- mone contents of the cultures that increased the weight spaced plantations. Finally, as a precutionary measure, of the calli, whereas partially purified preparation of seeds for rootstocks production should be soaked in malseccin induced a weight reduction. HPLC analysis water at 52°C for 10 min. This treatment, devised by of culture filtrates disclosed a low content of kinetin Klotz (1973) for eliminating Phytophtora spp., will erad- and gibberellic acid, and a high content of indolacetic icate P. tracheiphila as well (Ippolito et al., 1992). acid (Gentile et al., 1992). Thus, according to published records, it seems that a reliable relationship between Genetic resistance. The search for lemon lines resist- susceptibility to mal secco and sensitivity to the culture ant to P. tracheiphila has been one of the main goal pur- filtrates of the pathogen does not exist. sued since the appearance of the disease and is still on Several other methods have been utilized over the the way. Although the results so far obtained have not years to obtain lines resistant to MSD, including classi- been entirely satisfactory, yet they have ensured the sur- cal (mass selection, hybridization, and mutagenesis) and vival of lemon groves in many areas afflicted by the dis- innovative approaches (somaclonal variation, somatic ease. hybridization, and genetic transformation). One of the major constraints in the search for resist- The first reports on MSD-resistant plants are due to ance to MSD is the long time required for obtaining ef- Ruggieri (1935, 1936, 1937a) who described the occur- fective and reliable resistant lines. To shorten this time, rence in the groves of two resistant lemon cvs shortcuts have been taken, based on the indications Monachello and Interdonato. Afterwards, the same au- provided either by the response of citrus leaves to inoc- thor reported that also the Santa Teresa clone of Fem- ulation P. tracheiphila or of citrus cells and tissues to the minello lemon was resistant (Ruggieri, 1956). Notwhis- phytotoxic compounds produced by this fungus. tanding these encouraging observations, the clonal se- The first method allows a rapid screening of a high lection approach did not give the expected results, al- number of seedlings or young grafted plants under con- though it was intensively pursued in Italy and abroad trolled conditions (Luisi et al., 1978; Somma et al., (Crescimanno and Sacco, 1955; Chapot, 1963; Don- 1979). For practical screening purposes, the inoculation adze, 1969; Damigella and Continella, 1970; Goliadze, of mature leaves is suggested. In fact, these are more 1972, 1972a; Spina, 1975; Akteke and Karaca, 1977; consistent in their response to infections than whole Granata et al., 1977, 1979; Baratta et al., 1979; Con- seedlings, and provide enough information for assessing tinella and Tribulato, 1979; Cutuli, 1979; Cutuli et al., the susceptibility of single seedlings. This method al- 1983; Continella, 1983). lows a reliable and reproducible assessment of the level Russo (1977) believed that only “intermediate resist- of resistance with results fully comparable with the be- ance” could be obtained through clonal selection (10- haviour of adult plants in the field. Moreover, it does 30% of dead plants during 15-20 years of field observa- not kill the seedling, as infected leaves are removed be- tions), as shown by data on the clones of Femminello fore the pathogen reaches the stem (Luisi et al., 1978). (Santa Teresa, Continella, Zagara Bianca, etc.) and Lis- The same method was used in Israel by Solel and bon (Rosemberger, Monroe, and Strong) lemon. There- Spiegel-Roy (1978). fore, according to the author very slim are the chances to The second method, based on testing P. tracheiphila select by cloning plants with a resistance comparable to phytotoxic compounds on tissue cultures and citrus that of Monachello and Interdonato lemons, which are protoplasts, yields very consistent results, indicating the spontaneous hybrids between lemon and citron. The existence of a good relationship between virulence of conclusion was that resistant lines can only be obtained fungal isolates and resistance (Nachmias et al., 1977; by hybridization (Russo, 1977). In this connection, it Nadel and Sahar, 1983; Geraci and Tusa, 1988, 1988a; should be recalled that also the resistant Meyer lemon is Pennisi et al., 1988; Sesto et al., 1990; Deng et al., thought to be a natural hybrid between lemon and sweet 1995a; Gentile et al., 1992a, 1993, 2000). Partially puri- orange (Hohryakov, 1952; Egorova, 1958; Dzhanelidze fied or purified preparation of the malseccin complex and Razmadze, 1960; Goliadze et al., 1991). 001_JPPInvitedReview_523 15-11-2011 17:35 Pagina 544

544 Mal secco disease of citrus Journal of Plant Pathology (2011), 93 (3), 523-560

For identifying genotypes with an acceptable level of vation. The nucellar mutant 2Kr of Femminello Siracu- MSD resistance and a seedlessness character, 105 acces- sano was selected, although it did not behave towards sions of lemon Zagara Bianca and Monachello were mal secco infection any better than the wild type. Re- evaluated in the field, starting from the end of 1980s, cently, searching for desirable levels of resistance and a which led to the selection and decription of five culti- low seed content, more than 300 mutants of cv. Küt- vars (Akragas, Erice, Kamarina, Segesta, and Selinunte) diken have been obtained with cobalt (60Co) gamma ir- (Calabrese et al., 2001). radiation of budsticks (Gulsen et al., 2007). The level of Nucellar selections have also been tested in the past, resistance ranged from 1.0 (no symptom) to 4.3 (high without relevant results. In fact, nucellar clones of both level of disease susceptibility), and the seed number var- Femminello and Monachello lemon showed a higher ied from 0 to 4 per fruit. Among the different mutants, susceptibility to MSD and a higher and faster disease stabilized after three vegetative generations, several progression then the old lines (Catara and Cutuli, 1972; plants showed both milder mal secco symptoms and Perrotta and Tribulato, 1977). lower seed number than wild type Kütdiken lemon. Lemon improvement by hybridization has been limit- These plants were then characterized and evaluated in ed due to nucellar embryony, extended juvenility, and the field, and four new cultivars were identified, i.e., Ala- high level of heterozygosis occurring in Citrus spp. Nev- ta, Gulsen, and Uzun seedless lemons and Eylul lemon, ertheless, hybridization studies have been carried out the latter showing no disease symptoms after controlled since 1946 by the Experimental Station of Citriculture inoculations with P. tracheiphila (Uzun et al., 2008). of Acireale (Carrante and Bottari, 1951; Russo and Tor- As to somaclonal variation, embryogenic culture lines risi, 1952; Russo, 1985, 1990) and the Research Institute of lemon resistant to mal secco toxins were selected, for Citrus Genetics of Palermo (Geraci, 1986; Tusa et that produced somatic embryos retaining resistance to al., 1992), without much success. When lines possessing the toxin (Nadel and Spiegel-Roy, 1987). In vitro selec- good vigor and fair MSD resistance were obtained, their tion of Femminello lemon calli with P. tracheiphila tox- fruits often had low qualitative characteristics (Russo, ins yielded a cell line named Femminello-S, from which 1977, 1985; Cutuli et al., 1981). These hybrids consti- numerous plants tolerant to the toxins were regenerated tute a valuable genetic resource and are still utilized for from protoplasts, and planted in the field (Gentile et al., back-crosses. 1992a). The Femminello-S callus, and the regenerated Ploidy increase by conventional methods has also plants tolerant to the toxins in vitro showed a ten-fold been attempted, but with poor results. Triploid hybrids increase in chitinase and glucanase enzymatic activity in obtained using the tetraploid Lisbon lemon and the extracellular extracts, as compared to common Fem- diploid Trovita sweet orange proved resistant, but their minello. Callus and regenerated plants of Femminello-S fruits had a poor commercial quality (Geraci, 1986). In behaved as the resistant genotypes (Gentile et al., 1993). a comparative trial conducted under controlled condi- Among the different somaclones grafted on sour or- tion with different cultivars and inter- and intra-specific ange, two (FS01 and FS11) showed mild symptoms of lemon hybrids grafted on sour orange, Lemox, a disease, having the same resistance level as that of triploid obtained by crossing the tetraploid lemon Monachello (Gentile et al., 2000). Similarly, two toxin- Doppio Lentini and the spontaneous lemon hybrid resistant cell lines were obtained by an embryogenic cal- Femminello x Pera del Commendatore (Reforgiato Re- lus line of Femminello Siracusano lemon, and plants recupero et al., 2005), and Femminello Siracusano 2Kr regenerated from each line showed a resistance to the tox- sulted the most susceptible, followed by Lunario and ins equivalent to that of the resistant Monachello. A Femminello comune. By contrast, nucellar and old high chitinase activity was detected among the intra- clones of Monachello were resistant. Moreover, triploid and extracellular proteins extracted from leaves of re- hybrid of Femminello x allotetraploid somatic hybrids generated plants (Deng et al., 1995, 1995a). of Valencia sweet orange x Femminello, were very sus- From callus of Kütdiken lemon, Bas et al. (2006) se- ceptible, whereas, Milam lemon x Femminello, and Key lected a resistant cells line, named 20b. The growth of P. lime x Valencia sweet orange were moderately resistant, tracheiphila was strongly inhibited by a filtrate of Küt- although not as much as Monachello lemon (Cacciola et diken 20b cell suspension culture, as compared with al., 2010). comparable filtrates from cell suspension cultures of Mutagenic agents such as nitroethylurea and ni- sensitive Kütdiken lemon and moderate resistant Zagara tromethylurea have been used by Goliadze and Bianca. The same boiled liquid inhibited fungal growth, Tikanadze (1972) on lemon seedlings, with the aim to in- indicating that secondary metabolites toxic to the fun- duce resistance. In Italy, since the early 1950s, pollen gus produced in addition to pathogenesis-related pro- from different lemon cultivars was exposed to X rays teins, might be involved in the defense reaction. and electromagnetic fields (Russo, 1977), whereas Star- Somatic hybridization via symmetric and asymmetric rantino and Russo (1977) exposed young fruits to cobalt protoplast fusion represents a primary strategy for ob- (60Co) rays, and used the nucellas for in vitro tissue culti- taining improved disease-resistant scion and rootstocks. 001_JPPInvitedReview_523 15-11-2011 17:35 Pagina 545

Journal of Plant Pathology (2011), 93 (3), 523-560 Nigro et al. 545

It allows the production of hybrids that incorporate the genomes of both parents without recombination, thus avoiding the problem of high heterozygosity that occurs in citrus. Morevor, cybridization is obtained by coupling the nuclear DNA of one parental species and the cyto- plasmic DNA from both parents. Tusa et al. (2000) investigated the response to MSD of the amphidiploid somatic hybrid Valencia+Femminello and of two Fem- minello lemon cybrids, obtained by symmetrical and asymmetrical protoplast fusion. Resistance was evaluated by stem and leaf inoculation tests and by analysis of propagule number of P. tracheiphila in the xylem of stem-inoculated plants. The somatic hybrid and the cybrids showed an intermediate degree of resistance, with slight differences in disease symptoms, in comparison with resistant Monachello and susceptible Femminello, Fig. 3. Reproductive structures of Phoma tracheiphila. A. My- celium, phialides, and phialoconidia. Free phialides are pro- used as controls. The lower mortality in the asymmetri- duced on the hyphae growing on artificial media, on exposed cal lemon cybrids suggests that specific mechanisms of infected wood surfaces and within xylem elements. B. Scatte- resistance to the disease could be activated in these red pycnidia under the epidermis of a desiccated shoot (up- genotypes. Somatic hybridization of protoplast from sus- per silver-gray area) and acervula of C. gloeosporioides with a ceptible lemon and from resistant genotype has been typical concentric disposition. combined both with the in vitro selection of the hybrids, using the toxins of P. tracheiphila, and their molecular identification by RAPD markers (Deng et al., 1995). Based on the notion that chitinases from different organisms had successfully been used to induce transgenic resistance to pathogenic fungi, lemon plants were trans- formed with the chitinase gene (chit42) from T. harzianum. Chit42 was introduced into Femminello Sir- acusano lemon by Agrobacterium-mediated transformation, and the transgenic clones were tested in vitro and in vivo for disease resistance. Conidia germination and fungal growth of P. tracheiphila were strongly inhibited in vitro by the transgenic foliar proteins, whereas no ef- Fig. 4. Different severity of “mal nero” symptoms on Yuzu orange rootstocks (A) and sour orange, selection S. Marina II fects were observed on controls (Gentile et al., 2007). (B), 14 years after artificial inoculation of the roots. Chit42 was also introduced into Citrange Troyer by Agrobacterium-mediated transformation of stem intern- ode segments. Regenerated transgenic plants showed a rootstocks show a lower disease severity than the corre- reduction of infected sites and tissue colonization sponding graft combinations with lemon scions (Ippoli- around the inoculation site and proved more tolerant to et al., 1991; Nigro et al., 1996), except for the most than wild type towards wilting induced by crude fil- susceptible alemow (C. macrophylla Wester) and yuzu trates of P. tracheiphila (Russo et al., 2009). Considering orange [(C. junios (Sieb. ex Tan)] (De Cicco et al., the current Italian and EU rules that restrain field ex- 1984a; De Cicco and Ippolito, 1986; Nigro et al., 2000) periments with transgenic plant, and the general reluc- (Fig. 4A). Moreover, a higher susceptibility was found tance of consumers for transgenic commodities, it is in graft combinations with susceptible Femminello than hard to foresee further developments and practical ap- the resistant Monachello lemon (Protopapadakis and plications of transgenic resistance. Zambettakis, 1982; De Cicco et al., 1984a; Ippolito et The search for new resistant rootstocks, to replace al., 1990). the susceptible sour orange, has long been pursued Among the different rootstocks tested, Citrumelos (Ruggieri, 1953b; Russo, 1956, 1977; Crescimanno et Swingle 4475 and FF9 (C. paradisi x Poncirus trifoliata) al., 1973; Reforgiato Recupero, 1979; Protopapadakis and the hybrids Cleopatra mandarin x Poncirus and and Zambettakis, 1982; Pionnat, 1982), also with nearly Poncirus Christian x Cleopatra (P. trifoliata x C. reshnii), three decades of studies conducted at the University of behaved well when tested under controlled conditions, Bari, by the research group on MSD. exhibiting a lower susceptibility to MSD than the other Results from tests under controlled conditions and rootstocks (De Cicco et al., 1989; Ippolito et al., 1991). decennial field investigations, showed that ungrafted However, under field conditions, Citrumelos Swingle 001_JPPInvitedReview_523 15-11-2011 17:35 Pagina 546

546 Mal secco disease of citrus Journal of Plant Pathology (2011), 93 (3), 523-560

4475 and FF9 behaved differently, according to whether of MSD have focused mainly on resistance induction they were ungrafted or grafted with lemon. Grafted and microbial antagonism. An early example of resist- trees were less resistant than the ungrafted ones. The ance induction by cross-protection, involving two dif- hybrid Cleopatra mandarin x P. trifoliata, either ungraft- ferent pathogens but with a similar host–pathogen rela- ed or grafted with lemon, was susceptible to trunk but tionships, was provided by Grasso and Tirrò (1982). not to leaf infection. Similarly, lemon grafted onto P. tri- MSD symptoms on sour orange seedlings were less se- foliata x Cleopatra mandarin hybrid was less susceptible vere and delayed if plants were pre-inoculated with Ver- to leaf than to trunk infection (De Cicco et al., 1989; Ni- ticillium dahliae below the site of P. tracheiphila intro- gro et al., 2000). duction. Instead, pre-inoculation above P. tracheiphila Ichang lemon C.R.C. 1215 (C. ichangensis x C. gran- inoculum site merely delayed symptoms. Other success- dis) and siamelo C.R.C. 2586 (C. paradisi x C. sinensis), ful attempts were conducted by Paradies et al. (1985), both grafted and ungrafted with Monachello and Fem- in growth chamber trials at 20°C, by pre-inoculating a minello lemon, except for some variations depending on hypovirulent strain of the pathogen (Pt52) 2-4 months the tests, behaved similarly and better than the other before inoculation with a virulent fungal isolate. How- rootstocks. Siamelo C.R.C. 2586, confirmed its known ever, when the cross-inoculated apparently healthy sour resistance to MSD (De Cicco and Ippolito 1986; Nigro orange seedlings were transferred from the growth et al., 1996), in line with literature reports (Russo, 1977; chamber to the field, mal secco symptoms became evi- Reforgiato Recupero, 1979). Based on data collected dent and no statistical differences were found among over almost two decades of observations and tests, it the different treatments (Ippolito et al., 1988). can be concluded that Siamelo shows excellent Hypovirulence has been found in a number of plant prospects for practical utilisation. pathogenic fungi and, in many cases, it is associated C. taiwanica, a putative naturaI hybrid of sour orange with the presence of mycoviruses or unencapsidated (Castle, 1987), behaved on the whole like the resistant dsRNA (Pearson et al., 2009). However, attempts of iso- Siamelo in disagreement with literature reports (Cresci- lating dsRNA from the Pt52 strain of P.trachiphila were manno et al., 1973; Russo, 1977; Reforgiato Recupero, unsuccessful (Ippolito et al., 1988). Subsequently, Lima 1979; Tuzcu et al., 1989). This differential behaviour (1991) pursued the same line of research, trying to ob- could be attributed to the fact that zygotic seedlings of tain hypovirulent fungal strains either through isolation C. taiwanica occur frequently (Castle, 1987). C. taiwani- from infected plants with mild disease symptoms, or by ca behaved similarly to resistant Siamelo also towards exposing conidial suspension to UV light, or transfect- the “mal nero” facies of MSD, being the percentage of ing protoplast of the pathogen with the mycovirus from dead plants and black discoloured area similar in un- Penicillium chrysogenum ATCC 9480 (Wood and grafted plants. However, in the graft combination with Bozart, 1972). Hypovirulent isolates of P. tracheiphila Femminello these two traits were slightly higher for C. were found among those already in collection but not taiwanica than Siamelo (Nigro et al., 1996, 2008). among those recovered from mildly diseased plants, or Sour orange selections have been reported to behave exposed to UV-light, or transfected with the mycovirus. differently towards MSD (Ruggieri, 1948; Radogna and In trials performed at 20°C, hypovirulent strains were Geraci, 1986; Tuzcu et al., 1989). Results from two of tested by pre-inoculating them in sour orange seedlings such selections (S. Marina II and an unnamed one) con- 90 days before the pathogen. Only one induced a signif- firm the importance of clonal selection in this species. icant symptom reduction at 20°C, whereas at 15°C In fact, grafted and ungrafted S. Marina II selections symptoms were severe. Hypovirulence was found to be consistently showed the lowest susceptibility to the dis- associated with a low degree of host colonization (Lima ease (Fig. 4B). On the contrary, the unnamed selection et al., 1994a) showed high susceptibility, especially when grafted with Microbial antagonism relies on the use of endophytic lemon (Ippolito et al., 1991; Nigro et al., 1996, 2008). bacteria that penetrate and invade systemically the host Moreover, when grafted with Femminello, S. Marina II plant, colonize actively the internal tissue of the plant showed an appreciable ability in reducing ‘mal nero’ showing no external sign of infection or negative effect symptoms, and the percentage of dead plants (Nigro et on their host. This colonization occurs in the same eco- al., 2008). Observations on the behaviour of l-year-old logical niche occupied by plant pathogens, thus endo- S. Marina II seedlings towards natural mal secco infec- phytic bacteria can act as biological control agents tions made by Reforgiato Recupero (1979), showed a re- (Ryan et al., 2008). Many bacterial isolates were ob- sponse similar to the resistant Siamelo. Thus, the resist- tained from woody tissues of lemon and sour orange ance of S. Marina II sour orange seems very useful, also plants with mild MSD symptoms, and tested for their considering that this is one of the most frequently antagonistic activity against P. tracheiphila. Nine of the utilised selections (Reforgiato Recupero, 1992). isolates most effective in vitro were inoculated in the stem of sour orange seedlings 15 days before pathogen Biological control. Studies on the biological control inoculation. Significantly lower MSD symptoms were 001_JPPInvitedReview_523 15-11-2011 17:35 Pagina 547

Journal of Plant Pathology (2011), 93 (3), 523-560 Nigro et al. 547

observed in the plants inoculated with three isolates of plication to citron production. However, Rangpur lime Bacillus subtilis and one of Pseudomonas fluorescens is not visibly affected by CEVd, thereby suggesting this compared to control plants inoculated only with P. tra- viroid as a possible source of protection of this root- cheiphila. Moreover, higher bacterial populations were stock against mal secco infection. found in seedlings inoculated with isolates most effective in controlling MSD (Lima et al., 1994). To these pi- Chemical control. The use of fungicides against MSD oneering researches others followed, using antagonistic was taken into consideration since the appearance of se- strains of Ps. mediterranea and Ps. corrugata on Fem- vere epidemics. The first trial on the chemical control minello Lunario plants, artificially inoculated with the dates back to 1927, when Petri (1927) published the mal secco pathogen. All bacterial strains significantly re- promising results obtained by treating the soil with duced the number of P. tracheiphila infections com- manganese sulphate, soon followed by foliar treatments pared to the water-treated control, Ps. mediterranea be- with copper oxychloride, Bordeaux mixture, and sodi- ing the best (Coco et al., 2003, 2004). um arsenate (Petri, 1927a) The occurrence in the soil of microorganisms antago- The first attempts of endo-therapeutic control were nistic to P. tracheiphila was reported by Daraseliya also made by Petri (1932) who treated infected plants (1953), Danelija (1968) and Favaloro and Somma with a technique called by the author “internal thera- (1983). As to fungal antagonists, of 11 species isolated py”, consisting in the application through the soil of Us- from citrus soils in Catania and Siracusa (Italy), Gliocla- pulum universale (mercury-based compound). Only a dium roseum and G. virens showed the greatest in vitro temporary slowing down of the infection progress was antagonistic activity against the pathogen, whereas Tri- obtained. Similar results were reported by Ruggieri choderma spp. isolates were ineffective (Leonardi et al., (1942) using Cryptonal (horto-oxyquinoline). 1990). Recently, the population of antagonistic root-as- Applications of calcium-cyanamide to the soil to eval- sociated fluorescent pseudomonads of transgenic and uate its effect on infection and subsequent disease de- non-transgenic citrange Troyer plants has been charac- velopment were made by Ciccarone (1956) with un- terized and several strains producing a diverse array of promising results. Subsequently, Donadze (1975) tested inhibitory compounds towards P. tracheiphila have been the effect of soil liming, but no effects in the induction identified (Cirvilleri et al., 2005). Genetically modified of resistance to the disease were observed. Mkerval and citrange Troyer plants did not appear to have any influ- Mgeladze (1976) reported that the introduction in the ence in decreasing potentially beneficial populations of soil of substances such as succinic acid, copper sul- these bacteria, but rather they seemed to select (or pro- phate, and manganese sulphate, determined growth im- mote) root colonization of antagonistic fluorescent provement and increased resistance to P. tracheiphila in pseudomonads producing an array of inhibitory com- lemon plants. pounds absent in the roots of wild type. The effect of naphthalenic acid (NAA) on sour or- Partial and variable protection against P. tracheiphila ange seedlings artificially inoculated with P. tracheiphila was also induced by pre-inoculating citrus plants with was tested by Pacetto and Grasso (1969). They found viruses and viroids (Salerno et al., 1970, 1971; Catara et that the disease course was slowed down when the NAA al., 1971). Citrus exocortis viroid (CEVd) was also treatment preceded inoculation; on the contrary, when shown to confer partial protection against MSD in Et- the NAA treatment followed the inoculation the disease rog citron and Rangpur lime plants. In these trials, inva- course was expedited. Treating with maleic hydrazide sion of the canopy branches of citron by the fungal lemon plants of a very vigorous cultivar susceptible to mycelium was reduced by 90% in CEVd-infected mal secco determined a reduction of the plant size and plants, while the effect was less evident in Rangpur lime hardening of the tissues (Kantschaveli et al., 1972). Like- (Solel et al., 1995). CEVd infection reduced the sys- wise, Paclobutrazol treatments reduced the development temic spread of P. tracheiphila mycelium from the leaves of lemon seedlings, to which the observed lower suscep- to the shoots and probably accounts for the relative re- tibility to MSD was attributed (Çimen et al., 1994). sistance of old clones observed in Sicily and Israel (Solel As to the use of antibiotics, Romano (1957) tested et al., 1995). The reduced spreading of the fungal Griseofulvin, whose effects were apparently nihil on mycelium to the branches following leaf inoculation pot-grown plants but showed a certain fungistatic activ- suggests an induction of systemic resistance to the fun- ity in in vitro tests. Pinkas and Chorin (1967) obtained gus by the preceding inoculation with the viroid. The positive responses using Actidione both in in vitro and mechanism by which CEVd impairs the pathogen pro- in vivo trials. However, these results were not confirmed gression is unknown, but it may involve the production by Somma and Sammarco (1971), who tested Actidione of host pathogenesis-related (PR) proteins (Hadidi, and Aureofungin. The latter compound gave negative 1988). Since CEVd infection results in a severe reaction results in trials carried out by Elia (1969). of citron normally employed for biological indexing, it Preventive foliar treatments with copper compounds is unlikely that this observation can have a practical ap- were re-proposed by Ruggieri (1953, 1953a, 1954, 1956) 001_JPPInvitedReview_523 15-11-2011 17:35 Pagina 548

548 Mal secco disease of citrus Journal of Plant Pathology (2011), 93 (3), 523-560

after shortening the calendar of treatments, consequent compounds. Triphorine and Thiocur were tested in vit- to the advanced knowledge of MSD epidemiology. De- ro and in vivo, with results indicating a better perform- spite the promising results, Ruggieri (1956) concluded ance of Thiocur, although at a lower level than Benomyl that the preventative application of fungicides is effec- used as a reference control (Gimenez-Verdù and De Ci- tive only if healthy plants are treated, or if it is done af- cco, 1978). Finally, a substantial reduction of canopy inter the complete removal of infected limbs. In agree- fections was registered by spraying a mixture of Maneb ment with the above, Fedorinchik (1961) suggested fre- and Methyl-thiophanate in severely affected commercial quent inspections of the plants, removal of infected groves (Pionnat, 1982). branches, and spraying the canopy with 3% Bordeaux To increase the absorption and the efficacy of the mixture. new systemic fungicides, several coadjuvant and modali- Because of copper toxicity to citrus plants, the possi- ties of application were tested throughout the 1970s, bility of copper replacement with new synthetic fungi- yielding positive though not exhaustive results (Solel et cides was explored first by Kovacs (1961), then by al., 1972, 1979; Somma and Salerno, 1973; Tirrò and Salerno and Cartia (1965, 1967). According to the latter Granata, 1978). authors Ziram and Phaltane, tested in vitro and in vivo The consistently positive efficacy of Benomyl in- on sour orange seedlings, were more active towards P. duced Somma et al. (1974) to evaluate its activity in tracheiphila, compared with copper and calcium oxy- commercial lemon groves severely affected by MSD. chloride, and other synthetic fungicide. These results Treatments consisted in spraying the canopy. Soil treat- encouraged field trials in lemon groves, in which Ziram, ments, although more effective (Salerno and Somma, Phaltane, and tetraramic oxychloride were applied four 1971), were discarded because of the high amount of times at monthly intervals, starting from mid-November fungicide needed. After a series of trials over a 3-year (Somma et al., 1969). The outcome of these trials sug- period, very good results were obtained by anticipating gested the preferential use of Ziram treatments which, the monthly fungicide applications to the first week of however, as underlined by the authors, were not enough September and discontinuing them in March. This to control MSD, as they just reduced the number of in- schedule was aimed at increasing the fungicide concen- fections. In Israel, Captafol performed better than other tration in the plant at the beginning of the infections pe- fungicides (Solel, 1977). riod, and maintaining it high during spring, when occa- The appearance of systemic fungicides promoted a sional late infections may occur. On the whole, the re- drastic change in the strategy of MSD control. The first sults disclosed that Benomyl did not afford a better pro- encouraging results were reported by Elia (1969), who tection than that obtained with cheaper coverage fungi- succeeded in preventing the disease or delaying symp- cides. Subsequently, Somma et al. (1978) determined tom appearance by treating with Benomyl sour orange the accumulation of Benomyl and Methyl-thiofanate in seedlings artificially inoculated with P. tracheiphila. Sim- the vegetative organs and fruits. Accumulation in the ilar results were obtained by Thanassoulopoulos (1969) leaves of both fungicides reached the highest values af- who, subsequently, raised doubts on the efficacy of ter the last of the five monthly treatments. By contrast, Benomyl for controlling MSD (Thanassoulopoulos, accumulation was lower in the bark, still less in the 1977; Thanassoulopoulos and Kitsos, 1979). Benomyl, woody cylinder as a whole, and completely undetectable Thiabendazol, and Vitavax in in vitro and in vivo tests in the inner xylem layers. Therefore, the plants would inhibited P. tracheiphila development and reduced not be protected from infections in case of hailstorms or symptoms severity on sour orange seedlings (Perrotta et other events causing deep lesions. al., 1970). The interesting activity of Benomyl was con- As a further attempt to MSD control, the anti-sporu- firmed, both with tests under controlled environment lating activity of DL-P-fluorine-phenylanine, cadmium and field trials on sour orange seedlings. The absorp- chloride, Benomyl and Fenarimol was evaluated by in tion, accumulation and persistence of this fungicide vitro and greenhouse tests. The results were encourag- were investigated by Salerno and Somma (1971), who ing, but not enough to justify field trials (Luisi et al., demonstrated that absorption took place through roots, 1976a; De Cicco et al., 1982). leaves, and cortex, translocation in plant tissues oc- In summary, the possible use of fungicides for MSD curred through the apoplast and accumulation was in control has extensively been investigated over the last the upper parts of the canopy and at the tip of the leaf century. Protective, cytotropic, systemic, and antisporu- blades. At the same time, the activity of Thiophanate lating compunds have been tested as soon as they be- and Methyl-thiophanate was tested, the latter affording came available. Several contact fungicides proved to be a better control of the disease (Somma and Sammarco effective in protecting the host canopy from infections, 1971). Luisi et al. (1976) used Methyl-benzimidazole at least to a certain extent. Beside copper compounds, carbamate (MBC) and its chlorinated salt (MBC-HCl) the best results were obtained with Ziram, Phaltane, in comparison with Benomyl and Methyl-thiophanate, Mancozeb, and Captafol. However, since the new sys- confirming the satisfactory efficacy of the two latter temic fungicides did not provide a better control than 001_JPPInvitedReview_523 15-11-2011 17:35 Pagina 549

Journal of Plant Pathology (2011), 93 (3), 523-560 Nigro et al. 549

the old contact protective compounds, Cutuli et al. of Citrus species and other genera in the family Rutaceae (1977) adviced lemon growers to abstain from their use. are likely to improve the picture in the next future. The This precautionary suggestion found its rationale in the rapidly developing molecular technology and the map- danger that the prolonged and indiscriminate use of sys- based cloning approach will hopefully soon cast light on temic fungicides could lead to the emergence of resist- the citrus genome and the genetics of several QTLs re- ant P. tracheiphila strains, as already reported by lated to diseases and stresses resistance (Talon and Gimenez-Verdu and Luisi (1978). Finally, it must be Gmitter, 2008). Due to their extraordinary high- stressed that the chemical control of MSD in commer- throughput sequencing capacity, the “next generation cial groves is to be considered just a complement to oth- sequencing” methods (Schneider and Collmer, 2010; er control measures, as already highlighted by Salerno Boava et al., 2011) will allow highlighting the complex and Perrotta (1978), but it remains essential in the nurs- molecular events taking place in the host, in the eries located in areas affected by the disease. pathogen and during their interaction.

CONCLUDING REMARKS REFERENCES

Although many goals aimed at elucitanting the multi- Adonia G., 1991. Analisi spaziale delle epidemie di mal secco ple aspects of the biology, epidemiology, and control of degli agrumi. Ph.D. Thesis. University of Bari, Italy. MSD have been achieved over almost a century of re- Akhvlediani K.S., 1958. The isolation of a toxic substance search, there are still a number of questions pending from the wood of lemon trees infected by mal secco. Soob- that should be addressed for a better and effective dis- shcheniya Akademii Nauk Gruzinskoi SSR 21: 89-90. ease control. Some aspects are related to the epidemiol- Akteke S.A., Karaca I., 1977. Studies on the survey and biology of mal secco disease (Phoma [Deuterophoma] tracheiphi- ogy and the host/pathogen relationships. As to the first, la (Petri) Kanciaveli et Ghikascvili) of lemon trees. Journal the role of herbaceous hosts in the survival and dissemi- of Turkish Phytopathology 6: 91-103. nation of P. tracheiphila and the endophytic habitus of Akteke S.A., 1978. The reaction of some Turkish and foreign the fungus clearly need additional investigations. Fur- lemon varieties against “mal secco” disease (Phoma tra- thermore, largely incomplete information exists on: (i) cheiphila (Petri) Kanc. et Gik.). European Discussion Group the meaning of seasonal variation in the frequency of on Citrus “mal secco”, Acireale-Palermo, Italy, 1977. Phy- fungal isolation; (ii) the effect on P. tracheiphila of the topathologia Mediterranea, 12: 76. temperature within the host; (iii) the possibility that in- Albanese G., Grimaldi V., La Rosa R., Di Silvestro I., Catara fected plants can recover from the disease; (iv) the bear- A., 1998. PCR analysis applied to Citrus mal secco diagno- ing on the infections of the wounds consequent to the sis. Journal of Plant Pathology 80: 251. physiological or traumatic leaf shedding; (v) the specific Aveskamp M.M., de Gruyter J., Woudenberg J.H.C., Verkley relationship between temperature and activity of cell G.J.M., Crous P.W., 2010. Highlights of the Didymellaceae: polyphasic approach to characterise Phoma and related wall-degrading enzymes. Other relevant but little pleosporalean genera. Studies in Mycology 65: 1-60. known aspects concern the life cycle of the pathogen Baldacci E., 1950. Caratteri colturali delle razze di Bakero- and its anamorph/teleomorph relationships, the genetic phoma tracheiphila. Ricerca Scientifica 18: 5-6. diversity of P. tracheiphila populations, that impair any Baldacci E., Garofalo F., 1948. Conoscenze e ricerhe sul “Mal solid inference on its phylogenesis within the taxon secco” degli agrumi. Humus 4: 21-24. Phoma and with related genera. Baldacci E., Garofalo F., 1950. Knowledge and researches re- Chemical control trials using new and safer endoter- lating to wiffer tip of Citrus trees. Foreign Agricultural Cir- apic molecules, (e.g. resistance-inducing compounds), cular, Washington DC (USA): 4-11. need to be pursued, the same as the identification of Ballio A., Bottalico A., Graniti A., Randazzo G., 1979. Pro- truly resistant rootstocks and scions, which would con- duzione di crisofanolo da Phoma tracheiphila (Petri) Kanc. stitute an useful complement to an intergrated control et Ghik e note sulla colorazione dei tessuti legnosi nel mal strategy. Although data of no little consequence have secco degli Agrumi. Phytopathologia Mediterranea 18: 187- been collected on the susceptible/resistant behaviour of 188. several citrus species, this knowledge has yet to find Balmas V., De Montis M.A., Lo Giudice V., Raudino F., practical application, likely because of the complex ge- Migheli Q., Cacciola S.O., 2005. Diagnosis of mal nero disease of citrus by conventional methods and PCR. Journal netic traits of the most important and valuable cultivars of Plant Pathology 87: 288. and to the paucity of information on the genetic mecha- Balmas V., Scherm B., Ghignone S., Salem A.O.M., Cacciola nisms that control important traits, such as bioagronom- S.O., Migheli Q., 2005a. Characterization of Phoma tra- ic features and resistance towards MSD and other biotic cheiphila by RAPD-PCR, microsatellite-primed PCR and and abiotic stresses. The identification of molecular ITS rDNA sequencing and development of specific markers linked to quantitative trait loci (QTLs) govern- primers for in planta PCR detection. European Journal of ing the mechanism of susceptibility/resistance to MSD Plant Pathology 111: 235-247. 001_JPPInvitedReview_523 15-11-2011 17:35 Pagina 550

550 Mal secco disease of citrus Journal of Plant Pathology (2011), 93 (3), 523-560

Barash I., Pupkin G., Koren L., Ben-Hayyim G., Strobel of the triploid hybrid Lemox to mal secco disease caused G.A., 1981. A low molecular weight phytotoxin produced by Phoma tracheiphila. Journal of Plant Pathology 92: by Phoma tracheiphila, the cause of mal secco disease in S4.76. citrus. Physiological Plant Pathology 19: 17-29. Calabrese F., De Michele A., Barone F., Peri G., Somma V., Baratta B., De Pasquale F., Somma V., 1979. Prove orientative 2001. Cinque nuove cultivar di limone apirene e tolleranti sulla resistenza al mal secco in vivaio di cloni di limone. At- il “mal secco”. Frutticoltura 63: 33-36. ti del II Seminario di Studio sul Miglioramento Genetico del Carrante V., 1938. Il mal secco dei limoni ed i mezzi di lotta Limone, Giovinazzo, Italy: 135-139. più consigliabili allo stato attuale delle conoscenze. Bollet- Bas B., Koç N.K., 2006. In vitro selection of Kütdiken lemon tino della Regia Stazione Sperimentale di Agrumicoltura e di 20b to canditate for resistance to Phoma tracheiphila. Plant Frutticoltura di Acireale 70: 32. Pathology Journal 5: 35-40. Carrante V., Ruggeri G., 1947. Esperienze di inoculazione del- Bassi M., Magnano di San Lio G., Perrotta G., 1980. Mor- la Deutherophoma tracheiphila Petri. Annali della Speri- phological observations on the host parasite relations in mentazione Agraria 2: 239-253. sour orange leaves infected with Phoma tracheiphila. Phy- Carrante V., Bottari V., 1952. Miglioramento genetico del topathologische Zeitschrift 98: 320-330. Limone e ricerca di varietà resistenti al “mal secco”. An- Battiato C., 1948. Nuovi casi di “Mal secco” in Citrus nali della Sperimentazione Agraria 6: 323-346. deliciosa. Italia Agricola 85: 341-342. Castle W.S., 1987. Citrus rootstock. In: Rom C., Carlson F. Bazzi B., Scrivani P., 1954. Un metodo diagnostico per il ri- (eds). Rootstock for Fruits Crops, pp. 361-399. John Wiley conoscimento del decorso del “mal secco” degli agrumi. and Sons, New York, NY, USA. Phytopathologische Zeitschrift 21: 333-334. Catara A., Todaro M., Scaramuzzi G., 1971. Decorso del “mal Ben-Aziz A., 1967. Nobiletin is the main fungistat in tanger- secco” e comportamento di Phoma tracheiphila su estratti ines resistant to Mal Secco. Science 155: 1026-1027. agarizzati in rapporto alle variazioni del contenuto fenolico Ben-Aziz A., Chorin M., Monselise S.P., Reichert I., 1962. In- in semenzali di arancio amaro affetti da “variegatura infet- hibitors of Deuterophoma tracheiphila in Citrus varieties re- tiva”. Rivista di Patologia Vegetale 7: 227-238. sistant to “mal secco”. Science 135: 1066-1067. Catara A., Cutuli G., 1972. Osservazioni sulla suscettibilità di Boava L.P., Cristofani-Yaly M.,. Mafra V.S, Kubo K., Kishi alcune Rutacee alle infezioni epigee di Phoma tracheiphila. L.T., Takita M.A., Ribeiro-Alves M., Machado M.A., 2011. Annali dell’Istituto Sperimentale di Agrumicoltura 5: 29-49. Global gene expression of Poncirus trifoliata, Citrus sunki Catara A., Longo M., Cartia G., 1972. Growth of Phoma tra- and their hybrids under infection of Phytophthora parasiti- cheiphila on culture media in relation to fungistatic pheno- ca. BMC Genomics 12: 39. doi:10.1186/1471-2164-12-39. lic compounds in excortis infected sour orange seedlings. Boerema G.H., de Gruyter J., Noordeloos M.E, Hamers Proceedings of the 6th Conference of the International Orga- M.E.C., 2004. Phoma Identification Manual. Differentia- nization of Citrus Virologists, University of California, tion of Specific and Infra-specific Taxa in Culture. CABI Berkeley, USA: 957-962. Publishing, Wallingford, UK. Catara A., Longo M., Ginoprelli B., Scaramuzzi G., 1973. Bugiani A., Scrivani P., Loprieno N., 1959. Indagini sul paras- Ricerche sull’attività fungistatica di estratti di Arancio sitismo da Deuterophoma tracheiphla Petri. Società Monte- amaro e di Citrus volkameriana nei confronti di Phoma tra- catini, Milano, Italy. cheiphila. Rivista di Patologia Vegetale 7: 227-238. Bugiani A., Scrivani P., Loprieno N., 1960. Indagini sul paras- Chapot H., 1963. Le ‘mal secco’. Al Awamia 9: 89-125. sitismo da Deuterophoma tracheiphila Petri. Contributi Isti- Ciccarone A., 1956. Applicazione di calciocianamide agli tuto Ricerca Agraria, Milano, Italy, 1959: 31-52. Agrumi ed infezioni di “mal secco”. Prove orientative. Riv- Burnett J.H., 1968. Fundamentals of Mycology. Arnolds Ed., ista di Agrumicoltura 1: 361-368. London, UK. Ciccarone A., 1971. Il fungo del “ma1 secco” degli agrumi. Butera N., Cupperi L., Zuckher W.V., Catara A., Grasso S., Phytopathologia Mediterranea 10: 68-75. 1986. Observation on the localization of Phoma tracheihila Ciccarone A., Russo M., 1969. First contribution to the sys- in canopy infections. In: Cavalloro R., Di Martino E. (eds). tematic and morphology of the causal agent of the “mal Integrated Pest Control in Citrus Groves. Proceedings of secco” disease of Citrus (Deuterophoma tracheiphila Petri). the Expert Meeting, Acireale 1985, Italy: 257-266. Proceedings of the 1st International Citrus Symposium, Uni- Cacciola S.O.,1989. Attività pectolitica di Phoma tracheiphila versity of California, Riverside, USA: 1239-1249. (Petri) Kanc. & Ghik. Ph.D. Thesis. University of Bari, Ciferri R., 1946. La posizione sistematica del fungo del “mal Italy. secco” del Limone (Bakerophoma tracheiphila (Petri) Cacciola S.O., Perrotta G., Graniti A., Magnano di San Lio nob.). Atti dell’Istituto Botanico Università di Pavia, Labo- G., 1986. Esame preliminare di ceppi di Phoma tracheiphi- ratorio Crittogamico 5: 307-309. la (Petri) Kanc. et Ghick. mediante elettroforesi. Atti del Çimen I., Çinar A., Erkiliç A., 1994. The effect of Paclobutra- Convegno “Il recente Contributo della Ricerca allo Sviluppo zole on Mal secco (Phoma tracheiphila Kanc. et Gik.) on dell’Agrumicoltura Italiana”, Sassari, Italy: 687-691. lemon seedlings. Proceedings of the 9th Congress of the Cacciola S.O, Natoli M., Pane A., Perrotta G., Petrone G., Mediterranean Phytopathological Union, Kusadasi, Turkey: 1990. Characterization of polygalacturonase activities from 383-384. Phoma tracheiphila. Italian Journal of Biochemistry 39:3. Cirvilleri G., Spina S., Scuderi G., Gentile A., Catara A., Cacciola S.O., De Patrizio A., Raudino F., Pane A., Lo Giu- 2005. Characterization of antagonistic root-associated fluo- dice V., Magnano di San Lio G., 2010. High susceptibility rescent pseudomonads of transgenic and non-transgenic 001_JPPInvitedReview_523 15-11-2011 17:35 Pagina 551

Journal of Plant Pathology (2011), 93 (3), 523-560 Nigro et al. 551

Citrange troyer plants. Journal of Plant Pathology 87: 179- etale e Organizzazione della Ricerca nell’Agrumicoltura 186. Mediterranea”, Paternò, Italy: 303-310. Coco V., Grimaldi V., Grasso S., Catara A., 2003. Valutazione Cutuli G., Laviola C., Perrotta G., Salerno M., Spina P., 1984. di pseudomonadi come potenziali antagonisti di Phoma Il mal secco degli agrumi. Seminario Internazionale di Stu- tracheiphila. Atti del Convegno Mi.P.A.F. “Ricerche e Speri- dio - Programma di Ricerche Agrimed 1984-88, della Com- mentazioni nel Settore dell’Agrumicoltura Italiana”, missione della Comunità Europea. Capo d’Orlando, Italy: Acireale, Italy: 23-25. 136 pp. Coco V., Grimaldi V., Licciardello G., Cirvilleri G., Grasso S., Cutuli G., Salerno M., 1998. Alterazioni dei Frutti di Agrumi. Catara A., 2004. Inhibition of Phoma tracheiphila by Edagricole, Bologna, Italy. Pseudomonas in citrus seedling. Proceedings of the 8th Inter- Damigella P., Continella G., 1970. Il miglioramento genetico national Citrus Congress, Agadir, Morocco: 729-732. del limone. Osservazioni comparative su alcune selezioni Continella G., 1983. Comportamento bio-agronomico di al- clonali. Tecnica Agricola, Catania 22: 553-569. cune selezioni di limone. Atti del Convegno Internazionale Damigella P., Continella G., 1971. II miglioramento genetico “Evoluzione del Quadro Varietale e Organizzazione della del limone. Osservazioni comparative su alcune selezioni Ricerca nell’Agrumicoltura Mediterranea”, Paternò, Italy: clonali (parte seconda). Tecnica Agricola, Catania 23: 28-41. 287-302. Damigella P., Continella G., 1971a. II miglioramento genetico Continella G., Tribulato E., 1979. Preliminari osservazioni del limone. Osservazioni comparative su alcune selezioni comparative su ventidue selezioni clonali di limone (Citrus clonali (parte terza). Tecnica Agricola, Catania 23: 684-744. limon (L) Burm.). Tecnica Agricola, Catania 31: 131-141. Danelija B.K., 1968. The effect of some ecological factors on Crescimanno F.G., Sacco S., 1955. Ricerche su alcune cultivar the survival of the fungal causal agent of mal secco of Cit- siciliane di limone. Rivista di Ortoflorofrutticoltura Italiana rus (Phoma tracheiphila). Subtropicheskie Kul’tury 5: 34-42. 3-4: 137-147. D’Anna R., Trigila P.L., Catara A., 1986. Aspetti della mor- Crescimanno F.G., Somma V., Calabrese F., 1973. Preliminary fologia e della biologia di Phoma tracheiphila esaminati al reaserch on resistance of rootstocks to mal secco. Proceed- microscopio elettronico a scansione. Atti Giornate Fitopa- ings of the 1st International Citrus Congress, Murcia, Spain: tologiche 1986, Riva del Garda, Italy: 105-114. 119-120. Daraseliya N.A., 1953. On the presence in the soil of bacteria Cutuli G., 1972. Il “mal nero”: una particolare forma di “mal antagonistic to Phoma tracheiphila. Mikrobiologyia 22: 203- secco” (Phoma tracheiphila (Petri) Kanc. et Ghik. osservata 205. su specie diverse di agrumi. Annali dell’Istituto Sperimen- Davino M., Catara A., Perrotta G., Grasso S., 1974. Vari- tale per l’Agrumicoltura di Acireale 5: 281-290. azioni del contenuto in fenoli liberi in piante di agrumi in- Cutuli G., 1979. Un pregevole clone di limone ‘Femminello’ oculate con Phoma tracheiphila. Rivista di Patologia Vege- con promettenti caratteristiche di resistenza al “mal sec- tale, 10: 123-136. co”. L’Informatore Agrario 35: 7269-7271. Davino M., Catara A., Caccamese S., Cartia G., 1979. Analisi Cutuli G., 1982. Il limone in coltura sotto rete: effetti sul mi- degli acidi fenolici post-infezionali in limoni inoculati con croclima e sullo stato fitosanitario delle piante con partico- Phoma tracheiphila mediante HPLC. Rivista di Patologia lare riguardo al mal secco. L’Informatore Agrario 38: 425- Vegetale 15: 35-41. 429. Davino M., Perrotta G., Catara A., Caccamese S., 1979a. Cutuli G., Li Destri Nicosia O., 1976. L’influenza della gran- Modificazione nel contenuto fenolico in piante di limone dine sulle infezioni di mal secco. Terra e Vita 17: 60-61. Femminello e Monachello inoculate con Phoma tracheiphi- Cutuli G., Salerno M., 1976. Il Mal secco degli Agrumi. Terra la. Rivista di Patologia Vegetale 15: 163-171. Viva, 8 1-13. De Cicco V., Luisi N., 1977. Variabilità della patogenicità e di Cutuli G., Laviola C., 1977. Attuali conoscenze sulla epidemi- alcuni caratteri colturali in isolati di Phoma tracheiphila, ologia del “mal secco” degli Agrumi. Annali dell’Istituto provenienti da aree e ospiti diversi del Mediterraneo. An- Sperimentale per l’Agrumicoltura di Acireale 9-10: 93-102. nali della Facoltà di Agraria, Università degli Studi di Bari Cutuli G., Salerno M., 1977. Il significato di alcune pratiche 29: 565-573. colturali nella lotta contro il “mal secco” degli Agrumi. An- De Cicco V., Luisi N., Salerno M., 1982. Attività di alcuni nali dell’Istituto Sperimentale per l’Agrumicoltura di composti nei riguardi delle fruttificazioni picnidiche di Acireale 9-10: 223-230. Phoma tracheiphila. Atti Giornate Fitopatologiche, 1982, Cutuli G., Salerno M., 1980. On the epidemiological meaning San Remo, Italy: 189-195. of phialospores in Phoma tracheiphila (Petri) Kanc. et De Cicco V., Paradies M., Cutuli G., Salerno M., 1984. The Ghik. Proceedings of the 5th Congress of the Mediterranean role of mal secco infected lemon twigs and leaves left on Phytopathological Union, Patras, Greece: 72-73. the ground in root infection. Proceedings of the 6th Con- Cutuli G., Starrantino A., Reforgiato Recupero G., Russo F., gress of Mediterranean Phytopathological Union, Cairo, 1981. Il miglioramento genetico del limone ai fini della re- Egypt: 218-221. sistenza al mal secco. Annali dell’Istituto Sperimentale per De Cicco V., Paradies M., Salerno M., 1984a. Behaviour of l’Agrumicoltura di Acireale 13-14: 149-158. some lemon rootstocks towards mal secco root infections: Cutuli G., Starrantino A., Reforgiato Recupero G., Russo F., preliminary results. Proceeding of the 5th International Cit- 1983. Orientamenti per la scelta varietale del limone. Dati rus Congress, São Paulo, Brazil 1: 428-430. preliminari e osservazioni su alcuni cloni promettenti. Atti De Cicco V., Ippolito A., 1986. Ulteriori osservazioni sul com- del Convegno Internazionale “Evoluzione del Quadro Vari- portamento di alcuni portinnesti del limone nei riguardi 001_JPPInvitedReview_523 15-11-2011 17:35 Pagina 552

552 Mal secco disease of citrus Journal of Plant Pathology (2011), 93 (3), 523-560

delle infezioni radicali di mal secco. Atti del Convegno “Il Donadze V.Z., 1975. The importance of soil liming in the in- recente Contributo della Ricerca allo Sviluppo dell’Agrumi- crease of resistance in new Georgian lemon to mal secco. coltura Italiana”, Cagliari, Italy: 423-428. Trudy Nauchno-Issledovatel’skogo. Instituta Zashchity Ras- De Cicco V., Paradies M., Ippolito A., Salerno M., 1986. Pro- tenii Gruzinskoi SSR 27: 114-118. duzione di fialidi libere di Phoma tracheiphila in condizioni Dzhanelidze V.S., Razmadze, E.G. 1960. First results of gov- controllate. Phytopathologia Mediterranea 25: 107-110. ernment trials of lemons. Sadovodstvo 10: 27-30. De Cicco V., Ippolito A., Salerno M., 1987. Duration of the Dzneladze A.A., 1974. Activity and fluorescence spectra of a infective capacity of soil containing mal secco infected pure culture of the plant pathogen Phoma tracheiphila. lemon twigs. Proceedings of the 7th Congress of the Mediter- Soobshcheniya Akademii Nauk Gruzinskoi SSR 76: 697- ranean Phytopathological Union, Granada, Spain: 175-176. 700. De Cicco V., Ippolito A., Lima G., Reforgiato Recupero G., Dzneladze A.A., 1975. Optical parameters of the alcohl ex- 1989. Behaviour of some candidate rootstocks of lemon tract of a pure culture of Phoma tracheiphila. Soob- tree to Phoma infections [Phoma tracheiphila] in Italy. shcheniya Akademii Nauk Gruzinskoi SSR 77: 729-732. Agricoltura Ricerca 11: 93-96. Egorova G.N., 1958. Distinguishing features of citrus forms De Montis M.A., Cacciola S.O., Orrù M., Balmas V., Chessa resistant to mal secco. Akadmya Nauk SSSR, Moskva, Bio- V., Maserti B.E., Mascia L., Raudino F., Magnano di San himiya iz fruktov i ovoshchyei 4: 112-117. Lio G., Migheli Q., 2008. Development of real-time PCR Elia M., 1969. Brevi note preliminari su tentativi di lotta en- systems based on SYBR® Green I and TaqMan® tech- doterapica del “mal secco” degli Agrumi. Informatore Fi- nologies for specific quantitative detection of Phoma tra- topatologico 19 (8): 403-404. cheiphila in infected Citrus. European Journal of Plant EPPO/CABI, 1997. Deutherophoma tracheiphila. Quarantine Pathology 120: 339-351. Pests for Europe, 2nd Ed. CAB International, Wallingford, De Patrizio, A., Raudino F., Pane A., Migheli Q., Magnano di UK. 733-736. San Lio G., Cacciola S.O., 2009. Evaluation of susceptibili- EPPO/OEPP, 2007. Phoma tracheiphila. EPPO/OEPP Bul- ty of lemon cultivars to mal secco disease by a molecular letin 37: 521-527. method. Journal of Plant Pathology 91: S4.59. EPPO/OEPP, 2009. EPPO Standard PM 5/3(4). Decision-sup- Demetradze T., Dzhanelidze M.T., 1970. Studies of some port scheme for quarantine pests from www.eppo.org/ physiological and biochemical indices in lemon trees in QUARANTINE/quarantine.htm connection with mal secco disease. Subtropicheskie Kul’tu- EPPO/OEPP, 2010. EPPO Alert List from: www.eppo.org/ ry 4: 94-100. QUARANTINE/quarantine.htm Demetradze T., Bakanidze M., Tavdumadze E., 1972. The Evola C., Rosciglione B., Salerno M., 1973. Attività pectinoliti- carbohydrate-nitrogen metabolism in the leaves of differ- ca, cellulosolitica e glucosidasica di Phoma (Deuterophoma) ent Citrus species and varieties in relation to mal secco and tracheiphila (Petri) Kanc. et Ghik. Phytopatologia Mediter- frost resistance Subtropicheskie Kul’tury 2: 70-73. ranea 12: 36-42. Deng Z.N., Gentile A., Domina F., Nicolosi E., Tribulato E., Evola C., Rosciglione B., Cannizzaro G., 1976. Effect of some Vardi A., 1995. Recovery of Citrus somatic hybrids tolerant phenolic compounds on the enzymatic activity of Phoma to Phoma trocheiphila toxin, combining selection and iden- tracheiphila (Petri) Kanc. et Ghik., causal agent of citrus tification by RAPD markers. In: Terzi M., Cella R., Falavi- “mal secco”. Phytopathologia Mediterranea 15: 119-121. gna A. (eds). Current Issue in Plant Molecular and Cellular Biology, pp. 177-183. Kluwer Academic International, Ezra D., Kroitor T., Sadowsky A., 2007. Molecular characteri- Dordrecht, The Netherlands. zation of` Phoma tracheiphila, causal agent of Mal secco disease of citrus, in Israel. European Journal of Plant Deng Z.N., Gentile A., Nicolosi E., Domina F., Tribulato E., Pathology 118: 183-191. 1995a. Selection of lemon protoplast for insensitivity to Phoma tracheiphila toxin and regeneration of tolerant Favaloro M., Somma V., 1983. Osservazioni preliminari sullla plants. Journal of the American Society of Horticultural Sci- fungistasi nella rizosfera di piante di Agrumi in relazione ence 120: 902-905. all’attivita di Phoma tracheiphila (Petri) Kanc. et Ghik. Tec- nica Agricola, Catania 35: 7-12. Di Silvestro I., Leonardi M., Leonardi O., Catara A., Sesto F., 1988. Osservazioni sul comportamento di Phoma tracheiphi- Fedorinchick N.S., 1953. Control of infectious desiccation la nel terreno mediante l’impiego di una sonda a DNA. Atti (mal secco) of Citrus. Orchard and Garden 8: 21-23. Giornate Fitopatologiche 1988, Lecce, Italy: 139-148. Fedorinchik N.S., 1958. An experiment in the control of in- Di Silvestro I., Raciti M., Lanza G., Di Martino A., Bonforte fectious desiccation (mal secco) of Citrus. Sbornik Rabot M., 1990. Analisi della presenza di P. tracheiphila nel ter- Instituta Prikladnoi Zoologi i Fitopathologii 5: 140-174. reno impiegando una sonda a DNA. Atti Giornate Fitopa- Fogliano V., Graniti A., Marchese A., Ritieni A., Randazzo tologiche 1990, Pisa, Italy: 355-362. G.E., Visconti A., 1994. Purification of a phytotoxic glyco- Dimond A.E., Waggoner P.E., 1953. On the nature and role protein from the malseccin complex produced in culture of vivotoxins in plant disease. Phytopathology 43: 229-235. by Phoma tracheiphila. Theoretical and Applied Genetics 86: 527-532. Donadze V.Z., 1966. On the study of resistance to dessicca- tion (mal secco) in different varieties and forms of citrus. Fogliano V., Marchese A., Scaloni A., Ritieni A., Visconti A., Trudy Nauchno-Issledovatel’skogo. Instituta Zashchity Ras- Randazzo G., Graniti A., 1998. Characterization of a 60 tenii Gruzinskoi SSR 18: 209-216. kDa phytotoxic glycoprotein produced by Phoma tracheiphila and its relation to malseccin. Physiological and Donadze V.Z., 1969. Wilt resistance in Lemon. Proceedings of Molecular Plant Pathology 53: 149-161. the Plant Protection Institute of Georgian SSR 21: 23-27. 001_JPPInvitedReview_523 15-11-2011 17:35 Pagina 553

Journal of Plant Pathology (2011), 93 (3), 523-560 Nigro et al. 553

Garbeva P., van Veen J.A, van Elsas J.D., 2004. Microbial di- Goidanich G., Ruggieri G., 1947c. Le Deuterophomaceae di versity in soil: selection of microbial populations by planta Petri. Annali della Sperimentazione Agraria 1: 431-438. and soil type and implications for disease suppressiveness. Goidanich G., Ruggieri G., 1948. Aspetti e problemi del “mal Annual Review of Phytopathology 42: 243-270. secco” degli agrumi in Sicilia. Humus 4: 22-25. Gassner G., 1940. Untersuchungen uber das “mal secco” Goidanich G., Ruggieri G., Cagnotto A., 1948. Presenza di oder “Kurutan” der Limonbaume. Phytopathologische una terza forma di moltiplicazione agamica in Zeitschrift 13: 1-90. Deuterophoma tracheiphila Petri. Annali della Sperimen- Gentile A., Tribulato E., Continella G., Vardi, A. 1992. Dif- tazione Agraria 2: 671-675. ferential responses of citrus calli and protoplasts to culture Goidanich G., Ruggieri G., 1949. Effetti del freddo e “mal filtrate and toxin of Phoma tracheiphila. Theoretical and secco” negli Agrumeti siciliani. Annali della Sperimen- Applied Genetics 83: 759-764. tazione Agraria 3: 391-397. Gentile A., Tribulato E., Deng Z.N., Vardi A., 1992a. In vitro Goidanich G., Ruggieri G., 1953. Il mal secco degli agrumi. selection of nucellar lemon callus and regeneration of Giornale di Agricoltura 63: 21-22. plants tolerant to Phoma tracheiphila toxin. Advances in Goliadze S.K., 1960. The effect of phytoncides from some Horticultural Science 6: 151-154. Lemon varieties on the fungus causing mal secco disease. Gentile A., Tribulato E., Deng Z.N., Galun E., Fluhr R., Var- Subtropicheskie Kul’tury 3: 63-66. di A., 1993. Nucellar callus of “Femminello” lemon, select- Goliadze S.K., Kerkadze I.K., 1971. Cytoanatomical resist- ed for tolerance to Phoma tracheiphila toxin, shows en- ance to mal secco. Subtropicheskie Kul’tury 4: 76-80. hanced release of chitinase and glucanase into the culture Goliadze S.K., Kashakashvili T., Tikanadze L., 1972. The ge- medium. Theoretical and Applied Genetics 86: 527-532. netic relationship of the Lemon tree with the “mal secco” Gentile A., Deng Z.N., Tribulato E., Vardi A., Albanese G., casual fungus. Subtropicheskie Kul’tury 5: 97-100. Grimaldi V., Catara A., 2000. Evaluation of lemon so- Goliadze S.K., 1972. Selection of lemon for mal secco resist- maclones for tolerance to mal secco disease by artificial in- ance. Subtropicheskie Kul’tury 5: 56-63. oculation. Acta Horticolturae 535: 259-263. Goliadze S.K., 1972a. Obtaining resistant lemons by hy- Gentile A., Deng Z.N., La Malfa S., Distefano G., Domina F., bridization. Subtropicheskie Kul’tury 5: 108-114. Vitale A., Polizzi G., Lorito M., Tribulato E., 2007. En- hanced resistance to Phoma tracheiphila and Botrytis Goliadze S.K., Tikanadze L.N., 1972. The effect of chemical cinerea in transgenic lemon plants expressing a Trichoder- mutagens on the resistance of lemon trees to mal secco. ma harzianum chitinase gene. Plant Breeding 126:146-151. Subtropicheskie Kul’tury 5: 68-72. Geraci G., 1986. Osservazioni su alcuni ibridi di Citrus limon Goliadze S. K., Kashakashvili T., Tikanadze L., 1991. Results x Citrus sinensis (Lisbon 4n X Trovita 2n) e di Citrus retic- of a study of combining ability in lemon. Part I. Subtropich- ulum x C. deliciosa (Fortune x Avana). Atti del Convegno: eskie Kul’tury 5: 57-71. “Il Recente Contributo della Ricerca allo Sviluppo dell’Agru- Granata G., Perrotta G., Tirrò A., Grasso S., 1977. Compor- micoltura Italiana”, Cagliari, Italy: 45-48. tamento di selezioni clonali di limone nei confronti di in- Geraci G., Tusa N., Buiatti M., Scala A., 1988. Correlation fezioni naturali di Phoma tracheiphila. Atti Giornate Fi- between resistance in vivo to Malsecco and in vitro to cul- topatologiche1977, Acireale, Italy: 431-438. ture filtrate of Phoma tracheiphila on calli and ovules of cit- Granata G., Tirrò A., Perrotta G., 1979. Comportamento di rus genotypes. Proceedings of the 2nd International Meeting selezioni clonali di limone nei confronti di infezioni natu- on Mediterranean Tree Crops, Chania, Greece: 94-97. rali di Phoma tracheiphila. Nota II. Tecnica Agricola, Cata- Geraci G., Tusa N., Somma V., 1988a. Culture filtrates of nia 31: 103-109. Phoma tracheiphila (Petri) Kanc. et Ghik. to test lemon re- Graniti A., 1955. Morfologia di Deuterophoma tracheiphila sistance to mal secco disease. Proceedings of the 6th Interna- Petri e considerazioni sul genere Deuterophoma. Bollettino tional Citrus Congress, Tel-Aviv, Israel: 829-832. Accademia Gioenia 3: 93-110. Gimenez-Verdu I., De Cicco V., 1978. Saggio di attivitá di due Graniti A., 1957. Alcune ricerche intorno alla attività fitotossi- fungicidi sistemici verso il “mal secco” degli Agrumi. Atti ca dei liquidi colturali di Deuterophoma tracheiphila Petri. Giornate Fitopatologiche 1978, Catania-Acireale Italy: 407- I. Phytopathologische Zeitschrift 31: 25-44. 415. Graniti A., 1963. Picnidi di Deuterophoma tracheiphila Petri Gimenez-Verdu I., Luisi N., 1978. Tolleranza al benomyl in su organi fogliari. Phytopathologia Mediterranea 2: 95. Phoma tracheiphila. Atti Giornate Fitopatologiche 1978, Graniti A., 1969. Host-parasite relation in Citrus diseases as Catania-Acireale, Italy: 157-164. exemplified by Phytophthora gummosis and Deuterophoma Goidanich G., Ruggieri G., 1947. Una rapida riproduzione “mal secco”. Proceedings of the 1st International Citrus sperimentale del “mal secco” degli agrumi. Annali della Symposium, University of California, Riverside, USA: 1187- Sperimentazione Agraria 1: 141-144. 1200. Goidanich G., Ruggieri G., 1947a. Sulla natura della resisten- Graniti A., 1998. Toxins and other metabolites of Phoma tra- za di varietà di agrumi al parassitismo di Deuterophoma cheiphila involved in pathogenesis of ‘mal secco’ disease of tracheiphila Petri. Annali della Sperimentazione Agraria 1: citrus trees. In: Kohmoto K., Yoder O.C. (eds). Molecular 473-484. genetics of host-specific toxins in plant disease. Proceed- rd Goidanich G., Ruggieri G., 1947b. Recenti osservazioni sulla ings of the 3 Tottori International Symposium on Host-Spe- biologia di Deuterophoma tracheiphila Petri e consider- cific Toxins, Daisen, Tottori, Japan 1997: 195-197. Kluwer azioni sull’eziologia del “mal secco” degli agrumi. Atti del- Academic Publishers, Dordrecht, The Netherlands. l’Accademia Nazionale dei Lincei 3: 395-402. Grasso F.M., Catara V., 2006. Preliminary characterization of 001_JPPInvitedReview_523 15-11-2011 17:35 Pagina 554

554 Mal secco disease of citrus Journal of Plant Pathology (2011), 93 (3), 523-560

Phoma tracheiphila isolates from Italy and Greece by Ippolito A., Maurantonio V., D’Anna R., 1992. Role of infect- DNA-based typing methods. Journal of Plant Pathology 88: ed seeds of citrus rootstocks in the spread of Mal secco 45. disease. Proceedings of the 7th International Citrus Grasso F.M., 2008. Caratterizzazione fenotipica di isolati del Congress, Acireale, Italy: 877-878. fungo Phoma tracheiphila e sviluppo di un metodo di rile- Jinks J.L., 1966. Mechanisms of inheritance. In: Ainsworth vamento quantitativo mediante real-time PCR. Ph.D. The- C.G., Sussman A.S. (eds.). The Fungi, pp. 619-660. Acade- sis. University of Catania, Italy. mic Press, New York, NY, USA. Grasso S., Pacetto M., Perrotta G., 1970. Effetto inibitorio Kalai L., Mnari-Hattab M., Hajlaoui M.R., 2010. Molecular del filtrato di coltura di Deuterophoma tracheiphila Petri diagnostics to assess the progression of Phoma tracheiphila sul virus della “variegatura infettiva” degli Agrumi. Rivista in Citrus aurantium seedlings and analysis of genetic diver- di Patologia Vegetale 6: 219-230. sity of isolates recovered from different citrus species in Grasso S., Pacetto M., 1971. Infezioni di Phoma tracheiphila Tunisia. Journal of Plant Pathology 92: 629-636. su piante di mandarino osservate in Sicilia. Rivista di Pa- Kantschaveli L.A., Gikashvili K.G., 1948. Materials for the tologia Vegetale 7: 239-248. study of “mal secco” or drying up of lemon trees in SSR. Grasso S., 1973. Infezioni di Phoma tracheiphila su clemen- Trudy Nauchno-Issledovatel’skogo. Instituta Zashchity Ras- tine, riscontrate in Sicilia. Tecnica Agricola, Catania 25: tenii Gruzinskoi SSR 5: 1-43. 157-162. Kantschaveli L.A., Gegenava C.V., Nishnianidze N.O., Sein- Grasso S., Davino M., 1974. Caratterizzazione di un inibitore ishvili O.N., Gogiberidze G.S., 1972. On the question of virale presente in filtrati colturali e micelio di Phoma tra- using inhibitors of plant growth against mal secco of citrus cheiphila. Rivista di Patologia Vegetale 10: 195-206. plants. Trudy Nauchno-Issledovatel’skogo. Instituta Zashchi- ty Rastenii Gruzinskoi SSR 24: 58-60. Grasso S., Perrotta G., 1978. Production of pycnidia in trees of the Rutaceae family affected by Phoma tracheiphila. Riv- Kantschaveli L.A., Gikashvili K.G., Donadze V.Z., Tsiklauri ista di Patologia Vegetale 14: 41-45. M.S., 1976. Determination of forms of Phoma tracheiphila causing blight of citrus trees. Trudy Nauchno-Issle- Grasso S., Perrotta G., 1980. Variazioni stagionali nella ger- dovatel’skogo. Instituta Zashchity Rastenii Gruzinskoi SSR minabilita delle picnidiospore di Phoma tracheiphila. Riv- 28: 43-47. ista di Patologia Vegetale 16: 19-24. Karel G., 1956. The Lemon disease, kurutan (mal secco) and Grasso S., Tirrò A., 1982. Primi risultati sull’effetto della its control. Ziraat Vekal Mucad Enstitu Mudurlugu 9: 1-30. preinoculazione di Verticillium dahliae in piante di arancio Kashakashvili T.S., Goliadze S.K, 1990. Reaction of tissue of amaro inoculate con Phoma tracheiphila. Tecnica Agricola, lemon hybrids to treatment with toxin of the fungus caus- Catania 3: 1-10. ing mal secco. Subtropicheskie Kul’tury 2: 55-61. Gulsen O., Uzun A., Pala H., Canihos E., Kafa G., 2007. De- Kiyashko P.I., 1951. On the toxicaction of the fungus velopment of seedless and Mal Secco tolerant mutant Deuterophoma tracheiphila Petri, the causal agent of infec- lemons through budwood irradiation. Scientia Horticultur- tious desiccation of lemon trees (mal secco). Trudy Nauch- ae 112: 184-190. no-Issledovatel’skogo. Instituta Zashchity Rastenii Gruin- Hadidi A., 1988. Synthesis of disease-associated proteins in skoi SSR 3: 176-177. viroid infected tomato leaves and binding of viroid to host Klebahn, 1933. Uber Bau undKonidienbildung bei einigen proteins. Phytopathology 78: 575-578. stromatischen Spheropsideen. Phytopathologische Zeitschrift Hajlaoui M.R., Kalai L., Mnari-Hattab M., Guermech A., Ben 6: 229- 304. Abdelaal N., 2007. Occurrence of mal nero disease on Klotz L.J., 1973. Color Handbook of Citrus diseases. Univer- mandarin and orange trees in Tunisia. New Disease Reports sity of California, Division of Agricultural Science, Berke- 16: 25. ley, CA, USA. Hohryakov M.K., 1952. Specificity of the causal agent of in- Kouyeas V., Anastassiadis D., 1962. Dissemination of fectious desiccation of Lemon trees (Deuterophoma tra- Deuterophoma tracheiphila Petri by the common Magpie cheiphila Petri). Microbiology 21: 210-218. (Pica pica L.). Annales de l’Institut Phytopathologique Bena- Ippolito A., De Cicco V., Cutuli G., Salerno M., 1987. The ki 4: 52-55. role of infected citrus fruits and seeds in the spread of th Kovacs A., 1961. Prove di lotta con funghicidi contro “mal secco” disease. Proceedings of the 7 Congress of Deuterophoma tracheiphila Petri. Phytopathologia Mediter- Mediterranean Phytopathological Union, Granada, Spain: ranea 1: 129-132. 166-167. Lanza G., De Cicco V., Cutuli G., Salerno M., 1980. Xylem Ippolito A., De Cicco V., Gallitelli D., 1988. Partial character- anatomy and water conductivity of lemon cultivars in rela- ization of a Phoma tracheiphila strain with properties of hy- tion to resistence to mal secco. Proceedings of the 5th Con- th povirulence. Proceedings of the 6 International Citrus gress Mediterranean Phytopathological Union, Patras, Congress, Tel Aviv, Israel: 1361-1366. Greece: 73-74. Ippolito A., De Cicco V., Lima G., Traversa E., 1990. Behav- Lanza G., De Cicco V., Ippolito A., Cutuli G., 1988. Xylem iour of some grafted rootstocks towards mal secco infec- factors in susceptibility to citrus mal secco. Proceedings of rd tions in controlled environment. Proceedings of the 23 In- the 6th International Citrus Congress, Tel Aviv, Israel: 1355- ternational Horticultural Congress, Firenze, Italy: 2151. 1359. Ippolito A., De Cicco V., Salerno M., 1991. Comportamento Laviola C., Scarito G., 1989. Distance and direction of dis- di eventuali portinnesti del limone verso infezioni di mal semination of Phoma tracheiphila (Petri) Kanc. et Ghik. secco. Informatore Fitopatologico 41 (9): 23-26. propagules. Phytopathologia Mediterranea 28: 161-163. 001_JPPInvitedReview_523 15-11-2011 17:35 Pagina 555

Journal of Plant Pathology (2011), 93 (3), 523-560 Nigro et al. 555

Leonardi O., Sesto F., Polizzi G., Di Silvestro I., Astuto A., Magnano di San Lio G., Cacciola S.O., Pane A., Grasso S., 1990. Antagonismo in vitro di microrganismi presenti nei 1992. Relationship between xylem colonization and symp- terreni agrumetati nei confronti di Phoma tracheiphila. Tec- tom expression in mal secco infected sour orange nica Agricola, Catania 42: 61-67. seedlings. Proceedings of the 7th International Citrus Con- Licciardello G., Grasso F.M., Bella P., Cirvilleri G., Grimaldi gress, Acireale, Italy: 873-876. V., Catara V., 2006. Identification and detection of Phoma Matarrese Palmieri R., Tomasello D., Magnano di San Lio G., tracheiphila, causal agent of citrus mal secco disease, by re- 1979. Origine e caratterizzazione delle gomme in piante di al-time polymerase chain reaction. Plant Disease 90: 1523- agrumi con sindromi a diversa eziologia. Rivista di Patolo- 1530. gia Vegetale 15: 43-49. Lima G., 1991. Tentativi di lotta biologica contro il mal secco Messina F., 1988. Variabilità nelle popolazioni di Phoma tra- degli agrumi. Ph.D. Thesis, University of Bari, Italy. cheiphila (Petri) Kanc. et Gik. Ph.D. Thesis. University of Lima G., Nigro F., Santomauro A., Ippolito A., 1994. Ulteri- Bari, Italy. ori tentativi di lotta biologica contro il mal secco degli Migheli Q., Cacciola S.O., Balmas V., Pane A., Ezra D., Mag- agrumi mediante isolati ipovirulenti del patogeno. La Dife- nano di San Lio G., 2009. Mal secco disease caused by sa delle Piante 17: 135-144. Phoma tracheiphila: a potential threat to lemon production Lima G., Ippolito A., Nigro F., Salerno M., 1994a. Tentativi di worldwide. Plant Disease 93: 852-867. lotta biologica contro il mal secco degli agrumi (Phoma tra- Mkerval V.G, Mgeladze E.M., 1976. Increase in the resistance cheiphila) a mezzo di batteri endofiti. La Difesa delle Piante of lemon-plants to mal secco. Mikologiya Fitopatologiya 10: 16: 43-49. 138-139. Lo Giudice L., Magnano Di San Lio G., Celsa V., Tuttobene Monselise S.P., 1983. La situazione varietale della ricerca R., 1982. Ultrastruttura dei setti delle ife di Phoma tra- agrumicola in Israele. Atti del Convegno Internazionale cheiphila. Rivista di Biologia Normale e Patologica 1: 29-36. “Evoluzione del Quadro Varietale e Organizzazione della Luisi N., De Cicco V., Salerno M., 1976. Attività di fungicidi Ricerca nell’Agrumicoltura Mediterranea”, Paternò, Italy: benzimidazolici contro il mal secco degli Agrumi. Informa- 51-62. tore Fitopatologico 26 (6): 19-24. Nachmias A., Barash I., Solel Z., Strobel G.A., 1977. Purifica- Luisi N., De Cicco V., Salerno M., 1976a. DL-p-fluoropheny- tion and characterization of a phytotoxin produced by lanina activity against citrus “mal secco” in vitro and Phoma tracheiphila, the causal agent of mal secco disease of greenhouse tests. Proceedings of the 4th Congress of the citrus. Physiological Plant Pathology 10: 147-157. Mediterranean Phytopathological Union, Zagreb, Nachmias A., Barash I., Solel Z., Strobel G.A., 1977a. Yugoslavia: 321-326. Translocation of mal secco toxin in lemons and its effect Luisi N., De Cicco V., Cutuli G., Salerno M., 1978. Factors in on electrolyte leakage, transpiration, and citrus callus early testing for Citrus mal secco resistance. Proceedings of growth. Phytoparasitica 5: 94-103. the 3rd International Citrus Congress, Sydney, Australia: Nachmias A., Barash I., Solel Z., Strobel G.A., 1979. A phyto- 197-200. toxic glycopeptide from lemon leaves infected with Phoma Luisi N., De Cicco V., Cutuli G., Salerno M., 1979. Ricerche tracheiphila. Physiological Plant Pathology 14: 135-140. su un metodo di studio della patogenicità del fungo del Nachmias A., Bar-Joseph M., Solel Z., Barash I., 1979a. Diag- Mal secco degli Agrumi. Annali dell’Istituto Sperimentale nosis of mal secco disease in lemon by enzyme-linked im- di Agrumicoltura 9-10: 167-173. munosorbent assay. Phytopathology 69: 559-561. Luisi N., De Cicco V., Cutuli G., Salerno M., 1979a. Analisi Nachmias A., Barash I., Solel Z., Strobel G.A., 1980. Effect of della patogenicità di Phoma tracheiphila (Petri) Kanc. et mal secco toxin on lemon leaf cells. Phytoparasitica 8: 51-60. Ghik. su alcune specie e cultivar di agrumi. Phytopatholo- Nadel B.L., Sahar N., 1983. Differential sensitivity between gia Mediterranea 18: 162-165. and within species to Mal secco toxin. Physiological Plant Luisi N., De Cicco V., Salerno M., 1980. Formation of pycni- Pathology 23: 241-244. dia of Phoma tracheiphila in controlled environments. Pro- Nadel B., Spiegel-Roy P., 1987. Selection of Citrus limon cell ceedings of the 5th Congress of the Mediterranean Phy- culture variants resistant to the mal secco toxin. Plant Sci- topathological Union, Patras, Greece: 69-71. ence 53: 177-182. Magnano Di San Lio G., Perrotta G., 1979. Osservazioni Natoli M., Petrone G., Cacciola S.O., Pane A. 1990. Charac- morfologiche sul processo di infezione di Phoma tra- terization and phytotoxic activity of pectic enzymes pro- cheiphila in piante di agrumi con particolare riferimento a duced by Phoma tracheiphila (Petri) Kanc. et Gik. Atti VII possibili meccanismi di resistenza. Rivista di Patologia Veg- Congresso “Aspetti Chimici e Fisiologici delle Fitotossine”, etale 15: 173-180. Viterbo, Italy: 265. Magnano di San Lio G., Lo Giudice L., 1982. Role of cell wall Nigro F., Ippolito A., Lima G., Salerno M., 1996. Field trials in gum production in “Citrus”. Caryologia 35: 388-389. on the behaviour of putative lemon rootstock towards mal Magnano di San Lio G., Perrotta, G. 1986. Variabilità in secco disease. Basal and root infection of some grafted and Phoma tracheiphila. In: Cavalloro R., Di Martino E. (eds). ungrafted rootstocks. Proceedings of the 8th International Integrated Pest Control in Citrus Groves, pp. 267-270. Citrus Congress, Sun City Resort, South Africa: 440-444. Balkema A.A., Rotterdam, The Netherlands. Nigro F., Ippolito A., Salerno M., 2000. Susceptibility of po- Magnano di San Lio G., Graniti A., 1987. Osservazioni sulla tential lemon rootstock to mal secco disease. Proceeding 9th condizione nucleare di Phoma tracheiphila (Petri) Kanc. et International Citrus Congress, Orlando, USA: 1049-1050. Ghick. Phytopathologia Mediterranea 26: 100-107. Nigro F., Pentimone I., Ippolito A., Salerno M.G., 2008. Be- 001_JPPInvitedReview_523 15-11-2011 17:35 Pagina 556

556 Mal secco disease of citrus Journal of Plant Pathology (2011), 93 (3), 523-560

haviour of putative lemon rootstocks towards Phoma tra- bility of nucellar lines of lemon to mal secco disease in Sici- cheiphila root infections. Proceedings of the 11th Interna- ly. Proceedings of the 2nd International Citrus Congress, Or- tional Citrus Congress, Wuhan, China: 1153-1156. lando, USA: 1004-1005. Orshanskaya M.V.N., 1952. Some results of a study of cul- Perrotta G., Magnano di San Lio G., Bassi M., 1979. Some tures of the fungus Deuterophoma tracheiphila Petri and anatomical and morpho-functional aspects of resistance to some aspects of their application to the control of wilt dis- Phoma tracheiphila in citrus plants. Phytopathologische ease of citrus “mal secco”. Izvestiya Akademii Nauk SSR, Zeitschrift 98: 346-358. Seriya Biologiya 1: 89-100. Perrotta G., Magnano di San Lio G., Lo Giudice L., Bassi M., Orshanskaya M.V.N., 1953. Results of the work on research 1979a. Ultrastructural modifications induced by Phoma and application of a method of early diagnosis of mal secco tracheiphila in sour orange. Rivista di Patologia Vegetale 14: in Lemon trees for the control of grafting material. 25-33. Izvestiya Akademii Nauk SSR, Seriya Biologiya 6: 90-97. Perrotta G., Magnano di San Lio G., Lo Giudice V., 1981. Pacetto M., Grasso S., 1969. Influenza di trattamenti con aci- Histology and cytology of citrus mal secco diseased tissues do-naftalenacetico (NAA) e attività polifenolossidasica in induced by Phoma tracheiphila. Proceedings of the 4th Inter- semenzali di agrumi, nei riguardi del Mal secco. Notiziario national Citrus Congress, Tokyo, Japan: 354-360. Malattie delle Piante 80-81: 85-90. Petri L., 1926. Ricerche sulle cause del disseccamento dei Pacetto M., Grasso S., 1974. Attività enzimatiche e patogenic- limoni in provincia di Messina. Bollettino della Regia ità di isolati di Phoma tracheiphila. Rivista di Patologia Veg- Stazione di Patologia Vegetale 2: 108-118. etale 10: 225-235. Petri L., 1926a. Ulteriori osservazioni sul disseccamento dei Pacetto M., Davino M., 1976. Attività pectinmetilesterasica e limoni in provincia di Messina. Bollettino della Regia cellulosolitica in piante di Agrumi con infezioni di Phoma Stazione di Patologia Vegetale 2: 209-211. tracheiphila. Rivista di Patologia Vegetale 12: 137-144. Petri L., 1927. Effetti del solfato di manganese sulle piante di Pacetto M., Davino M., 1980. Indagine sull’attività perossida- limone attaccate da Colletotrichum gleosporioides Penz. sica e polifenolossidasica di piante di agrumi resistenti e Bollettino della Regia Stazione di Patologia Vegetale 7: 213- suscettibili a Phoma tracheiphila. Tecnica Agricola, Catania 214. 32: 279-290. Petri L., 1927a. Ricerche sulle cause del mal secco dei limoni Paculija K.F., 1959. The significance of the texture of lemon in provincia di Messina e sui mezzi per combatterlo. Bollet- wood in relation to the entry and development of the fun- tino della Regia Stazione di Patologia Vegetale 7: 229-284. gus pathogen of mal secco. Subtropicheskie Kul’tury 2: 40- Petri L., 1929. Batteriosi dei rametti e mal secco dei limoni in 43. Sicilia. Bollettino della Regia Stazione di Patologia Vegetale Paradies M., De Cicco V., Salerno M., 1985. Prove di lotta bi- 9: 282-290. ologica contro il mal secco degli agrumi a mezzo di un cep- Petri L., 1929a. Sulla posizione sistematica del fungo parassita po ipovirulento del patogeno. Atti del Convegno “Lotta Bi- delle piante di limone affette da “mal del secco”. Bollettino ologica”, Torino, Italy: 12 della Regia Stazione di Patologia Vegetale 9: 393-396. Parisi A., Piattelli M., Tringali C., Magnano Di San Lio G., Petri L., 1930. Lo stato attuale delle ricerche sul “mal del sec- 1993. Identification of the phytotoxin mellein in culture co” dei limoni. Bollettino della Regia Stazione di Patologia fluids of Phoma tracheiphila. Phytochemistry 32: 865-867. Vegetale 10: 63-107. Pasinetti L., 1952. Sulle vere cause determinanti il “malsecco” Petri L., 1930a. Ulteriori ricerche sulla morfologia, biologia e degli agrumi e su nuovi orientamenti terapeutici. Annali parassitismo della Deuterophoma tracheiphila. Bollettino Fitopatologici 1: 1-67. della Regia Stazione di Patologia Vegetale 10: 191-221. Pearson M.N., Beever R.E., Boine B., Arthur K., 2009. My- Petri L., 1930b. I risultati di alcune ricerche sperimentali so- coviruses of filamentous fungi and their relevance to plant pra il ‘mal secco’ degli agrumi. Bollettino della Regia pathology. Molecular Plant Pathology 10: 115-128. Stazione di Patologia Vegetale 10: 353-359. Pennisi A.M., Graniti A., 1987. Alterazioni della permeabilità Petri L., 1930c. Nuove osservazioni sulla biologia della cellulare in tessuti di agrumi infetti da Phoma tracheiphila Deuterophoma tracheiphila. Bollettino della Regia Stazione (Petri) Kanc. et Ghik. Phytopathologia Mediterranea 25: di Patolologia Vegetale 10: 437-447. 142-145. Petri L., 1930d. La riproduzione sperimentale del “mal secco” Pennisi A.M., Di Pasquale G., Bonforte M., Sesto F., 1988. del limoni. Atti dell’Accademia Nazionale dei Lincei 11: Phytotoxic metabolites of ipovirulent Phoma tracheiphila. 146-149. th Proceedings of the 6 International Citrus Congress, Tel- Petri L., 1932. L’applicazione della terapia interna contro il Aviv, Israel: 817-827. “mal secco” dei limoni. Bollettino della Regia Stazione di Perrotta G., Pacetto M., Tirrò A., 1970. L’attività di nuovi Patologia Vegetale 12: 236-237. prodotti sistemici (Benlate, Tiabendazolo e Vitavax) sag- Petri L., 1934. Some reflections on the genera Deuterophoma giata “in vitro” e “in vivo” verso Deuterophoma tracheiphi- and Blastophoma. Phytopathologische Zeitschrift 7: 117-119. la Petri. Notiziario sulle Malattie delle Piante 82-83: 51-69. Petri L., 1939. Rassegna dei casi fitopatologici osservati nel Perrotta G., Magnano Di San Lio G., Bassi M., 1976. Alcune 1938. Bollettino della Regia Stazione di Patologia Vegetale fasi del processo di infezione di Phoma tracheiphila in 19: 115-188. foglie di arancio amaro, visualizzate al microscopio elet- Petri L., 1940. Recenti ricerche sul “mal secco” degli Agrumi tronico. Rivista di Patologia Vegetale 12: 145-154. in Turchia. Bollettino della Regia Stazione di Patologia Veg- Perrotta G., Tribulato E., 1977. Observations on the suscepti- etale 20: 81-98. 001_JPPInvitedReview_523 15-11-2011 17:35 Pagina 557

Journal of Plant Pathology (2011), 93 (3), 523-560 Nigro et al. 557

Piattelli A.H., Impellizzeri G., 1971. Fungistatic flavones in per gli agrumi. Rivista di Frutticoltura 54: 12-15. the leaves of Citrus species resistant and susceptible to Reforgiato Recupero G., Russo G., Recupero S., 2005. New Deuterophoma tracheiphila. Phytochemistry 10: 2657-2659. promising Citrus triploid hybrids selected from crosses be- Pinkas J., Chorin M., 1967. Control of the mal-secco disease tween monoembryonic diploid female and tetraploid male of lemons with the systemic fungicide Actidione. Proceed- parents. HortScience 40: 516-520. ings of the 1st Israel Congress of Plant Pathology, Rehovot, Reichert I., Fawcett H.S., 1930. Citrus diseases new to Pales- Israel: 56-58. tine. Phytopathology 20: 1003. Pinkas J., Lavie D., Chorin M., 1968. Fungistatic constituents Reichert I., Chorin M., 1956. Mal secco of citrus in Israel and in Citrus varieties resistant to the mal-secco disease. Phyto- neighboring countries. Bulletin of Research Council Israel chemistry 7: 169-174. 5: 176-180. Pionnat J.C., 1982. Le mal sec Phoma tracheiphila (Petri) Reuther W., 1973. Climate and citrus behavior. In: Reuter W. Kanc. et Ghik.: perspestives sur la lutte chimique et les (ed.). The Citrus Industry. 2nd Ed., Vol. 3, pp. 280-337. variétés résistantes. Fruits 37: 237-248. University of California Press, Berkeley, CA, USA. Polyakov I.M., Shumakova A.A., 1951. An investigation of Reverberi M., Betti C., Fabbri A.A., Zjalic S., Spadoni S., the toxic properties of the fungus Deuterophoma tra- Mattei B., Fanelli C., 2008. A role for oxidative stress in cheiphila Petri. Trudy Nauchno-Issledovatel’skogo. Instituta the Citrus limon/Phoma tracheiphila interaction. Plant Zashchity Rastenii Gruzinskoi SSR 3: 165-175. Pathology 57: 92-102. Polyakov I.M., Shumakova A.A.. 1954. Toxin accumulation Rollo F., Amici A., Foresi F., Di Silvestro I., 1987. Construc- during the development of the fungus Deuterophoma tration and characterization of a cloned probe for the detec- cheiphila Petri under different growing conditions. Dokla- tion of Phoma tracheiphila in plant tissues. Applied Micro- dy Vsesoyuznoi Ordena Lenina Akademii biology and Biotechnology 26: 352-357. Sel’Skokhozyaistvennykh Nauk, 19: 43-48. Rollo F., Salvi R., Torchia P., 1990. Highly sensitive and fast Protopapadakis E., 1983. Importance des Agrumes en Grece. detection of Phoma tracheiphila by polymerase chain reac- Atti del Convegno Internazionale “Evoluzione del Quadro tion. Applied Microbiology and Biotechnology 32: 572-576. Varietale e Organizzazione della Ricerca nell’Agrumicoltura Romano A., 1957. Sul possibile impiego dell’antibiotico grise- Mediterranea”, Paternò, Italy: 47-49. ofulvina contro l’agente del “mal secco” degli agrumi Protopapadakis E., Zambettakis C.H., 1982. Contribution à (Deuterophoma tracheiphila Petri). Notiziario sulle Malattie l’étude de la résistance des diverses combinaisons dele Piante 40-41: 19-20. scion/porte-greffe au mal secco. Fruits 37: 467-471. Rosciglione B., Burgio A., Laviola C., 1989. Specific detection Punithalingam E., Holliday P., 1973. Deuterophoma tra- of Phoma tracheiphila (Petri) Kanc. et Gik. propagules by cheiphila. CMI Descriptions of Pathogenic Fungi and Bac- immunofluorescent antibody staining. Phytopathologia teria, No. 399. CABI, Wallingford, UK. Mediterranea 28: 210-213. Quilico A., Cardani C., Piozzi F., Scrivani E.P., 1952. I pig- Rosciglione B., Burgio A., Bottalico A., Laviola C., 1991. Re- menti del Deuterophoma tracheiphila. Rendiconti dell’Ac- lationship between phytotoxicity of metabolites produced cademia Nazionale dei Lincei 12: 650-657. in vitro by strains of Phoma tracheiphila (Petri) Kanc. et Rabinovitz-Sereni O., 1931. Sulla presenza degli stomi nel- Ghik. and their virulence. Journal of Phytopathology 133: l’epidermide della pagina superiore delle foglie di varie 23-28. specie di “Citrus”. Bollettino della Regia Stazione di Patolo- Ruggieri G., 1931. Sulla presunta influenza di certi terreni nel gia Vegetale 11: 164-170. rendere resistenti al “mal secco” le piante di Limone. Bol- Raciti G., Cutuli G., Intrigliolo F., Giuffrida A., 1990. Indagi- lettino della Regia Stazione di Patologia Vegetale 11: 170- ni sull’influenza delle tecniche colturali sul mal secco degli 171. agrumi. L’Informatore Agrario 41: 61-64. Ruggieri G., 1931a. Note tecniche sul “mal secco” degli agru- Radogna L., Geraci G., 1986. Osservazioni preliminari sul mi. Citrus 17: 91-95. comportamento, nei confronti di infezioni naturali di mal Ruggieri G., 1935. Sopra i presunti rapporti genetici col secco, di un limone Femminello nucellare innestato su 20 Limone e col Cedro di una particolare varietà di Limone portinnesti. Atti del Convegno “Il recente Contributo della assai resistente alla ‘Deuterophoma tracheiphila’ Petri. Bol- Ricerca allo Sviluppo dell’Agrumicoltura Italiana”, Cagliari, lettino della Regia Stazione di Patologia Vegetale 15: 490- Italy: 699-702. 499. Raimondo F., Raudino F., Cacciola S.O., Salleo S., Lo Gullo Ruggieri G., 1936. Varietà di limoni resistenti al “mal secco”. M.A., 2007. Impariment of leaf hydraulics in young plants Giornale di Agricoltura Domen. 20: 4 pp. of Citrus aurantium (sour orange) infected by Phoma tra- Ruggieri G., 1937. Ricerche sull’affinità d’innesto del limone cheiphila. Functional Plant Biology 34: 720-729. “Monachello” con altri Citrus. Bollettino della Regia Raimondo F., Nardini A., Salleo S., Cacciola S.O., Lo Gullo Stazione di Patologia Vegatale 17: 79-86. M.A., 2010. A tracheomycosis as a tool for studying the Ruggieri G., 1937a. Indagini sulla varieta di Limone impact of stem xylem dysfunction on leaf water status and ‘Monachello’. Bollettino della Regia Stazione di Patologia gas exchange in Citrus aurantium L. Trees 24: 327-333. Vegetale, 17: 293- 304. Reforgiato Recupero G., 1979. Osservazioni sulla suscettibili- Ruggieri G., 1938. Aspetti e miglioramenti del limone ta al mal secco di semenzali di alcuni Citrus e generi affini. “Monachello”. Giornale di Agricoltura Domen. 19: 2 pp . Atti del “II Seminario di Studio sul Miglioramento Genetico del Limone” Giovinazzo, Italy: 81-86. Ruggieri G., 1940. Relazione sull’attività del “Posto di osser- vazione sul ‘mal secco’ degli Agrumi nel 1940”. Bollettino Reforgiato Recupero G., 1992. Criteri di scelta dei portinnesti 001_JPPInvitedReview_523 15-11-2011 17:35 Pagina 558

558 Mal secco disease of citrus Journal of Plant Pathology (2011), 93 (3), 523-560

della Regia Stazione di Patologia Vegetale 20: 303-329. Ryan R.P., Germaine K., Franks A., Ryan D.J., Dowling D.N.. Ruggieri G., 1940a. I portinnesti degli agrumi in relazione alIa 2008. Bacterial endophytes: recent developments and ap- resistenza alle malattie, all’adattamento alle condizioni am- plications. FEMS Microbiology Letters 278: 1-9. bientali, all’affinità d’innesto ed alle reciproche influenze Salerno M., 1959. Su alcuni gravi danni in piante di Limone, con le forme orticole. Nuovi Annali dell’Agricoltura 1: 27- con l’intervento di Fusarium lateritium Nees (Gibberella 28. baccata (Wallr.) Sacc.). Tecnica Agricola, Catania 11: 464- Ruggieri G., 1942. Relazione sull’attività del “Posto di Osser- 474. vazioni sul mal secco degli Agrumi” nel 1941-42. Bollettino Salerno M., 1964. Ricerche sul “Mal secco” degli Agrumi della Regia Stazione di Patologia Vegetale 22: 63-86. (Deuterophoma tracheiphila Petri). I.- Influenza della tem- Ruggieri G., 1946. Possibili casi di tracheoverticilliosi degli peratura sulla crescita del fungo e sulla produzione dei pic- agrumi. L’Italia Agricola 83: 475-476. noconidi. Rivista di Patologia Vegetale 4: 289-299. Ruggieri G., 1948. Fattori che condizionano e contribuiscono Salerno M., Cartia G., 1965. Ricerche sul “Mal secco” degli allo sviluppo del “mal secco” degli Agrumi e metodi di lot- Agrumi (Deuterophoma tracheiphila Petri). III.- Prove “in ta contro il medesimo. Annali della Sperimentazione vitro” e “in vivo” sull’efficacia di alcuni anticrittogamici. Agraria 2: 255-305. Rivista di Patologia Vegetale 1: 71-82. Ruggieri G., 1949. L’attuale problema del “mal secco” degli Salerno M., Perrotta G., 1966. Ricerche sul “Mal secco” degli Agrumi nelle sue immediate finalità pratiche. Annali della Agrumi (Deuterophoma tracheiphila Petri). V - Virulenza e Sperimentazione Agraria 3: 17-32. caratteri colturali del fungo in Sicilia. Rivista di Patologia Vegetale 2: 303-312. Ruggieri G., 1950. L’Odierna Profilassi: Lotta Contro il “Mal Secco” e la Ricostituzione degli Agrumeti Deperiti. Ti- Salerno M., Cartia G., 1967. Ricerche sul “Mal secco” degli pografia G. Mori & F., Palermo, Italy. Agrumi (Deuterophoma tracheiphila Petri). VII.- Prove di campo sull’efficacia di alcuni anticrittogamici. Tecnica Ruggieri G., 1953. Periodicità nelle infezioni di “mal secco” e Agricola, Catania 19: 168-175. fondamentali orientamenti di lotta. Giornale di Agricoltura 34: 1-8 pp. Salerno M., Catara A., 1967. Ricerche sul “mal secco” degli Agrumi (Deuterophoma tracheiphila Petri). IV. Comporta- Ruggieri G., 1953a. La lotta contro il “mal secco” degli Agru- mento parassitario del fungo in ospiti diversi dagli Agrumi. mi. Giornale di Agricoltura 30: 1-7 pp. Tecnica Agricola, Catania 19: 290-297. Ruggieri G., 1953b. Portinnesti resistenti al “mal secco”. Salerno M., Pacetto M., Catara A., 1967. Ricerche sul com- Giornale di Agricoltura 44: 1-7. portamento di Citrus Volkameriana Pasq. alle infezioni di Ruggieri G., 1954. Nuovi aspetti della lotta contro il “mal sec- Deuterophoma tracheiphila Petri e osservazioni sulla co” degli Agrumi. Informatore Fitopatologico 4: 244-246. suscettibilità ad altre malattie. Tecnica Agricola, Catania 19: Ruggieri G., 1956. “Mal secco” degli agrumi e attuali mezzi di 228-237. lotta. Rivista di Agrumicoltura 1: 201-206. Salerno M., Somma V., Evola C., 1970. Influenza di alcune vi- Russo F., Torrisi M., 1952. Problemi ed obiettivi di genetica rosi sul decorso del “Mal secco” degli Agrumi e primi agrumaria. Parte I. Selezione degli ibridi, degli embrioni risultati relativi al contenuto fenolico delle tesi a confronto. nucellari, dei triploidi e provocazione artificiale di mu- Phytopathologia Mediterranea 9: 22-28. tazioni. Annali della Sperimentazione Agraria 7: 883-906. Salerno M., Evola C., Somma V., 1971. Influenza di alcune vi- Russo F., 1956. Un nuovo promettente portinnesto per il rosi sul contenuto fenolico di foglie e radici di semenzali di Limone. Citrus volkameriana Pasq., altamente resistente al- Arancio amaro. Phytopathologia Mediterranea 10: 181-187. la Deuterophoma tracheiphila Petri e alle Phytophthorae. Salerno M., Evola C., Somma V., 1971a. Modificazioni del Rivista di Agrumicoltura 1: 207-223. metabilismo fenolico e “Mal secco” degli Agrumi in se- Russo F., 1977. Il miglioramento genetico per la resistenza al menzali di Arancio amaro con precedenti infezioni da mal secco del limone in Italia. Annali Istituto Sperimentale virus. Phytopathologia Mediterranea 10: 195-201. di Agrumicoltura di Acireale 9-10: 231-243. Salerno M., Somma V., 1971. Osservazioni sulla sistemicità Russo F., 1985. Portinnesti e propagazione. In: Spina P. (ed.). del Benomyl in semenzali di Arancio amaro e risultati di Trattato di Agrumicoltura. Vol. 1, pp. 221-289. Edagricole, lotta contro il “Mal secco” degli Agrumi. Phytopatologia Bologna, Italy. Mediterranea 10: 99-106. Russo F., 1990. Stato attuale del miglioramento genetico degli Salerno M., Cutuli G., 1976. “Mal secco” disease of Citrus: agrumi. Frutticoltura 52: 33-40. research trends in Italy. Poljoprivredna Znanstvena Smotra Russo M., 2008. Valutazione quantitativa di aspetti epidemio- 39: 281-286. logici e patogenetici di Phoma tracheiphila mediante qPCR. Salerno M., Cutuli G., Somma V., 1976. Mal secco degli Agru- Ph.D. Thesis. University of Catania, Italy. mi in Italia. Brevi richiami al passato, l’attuale attività di Russo M., La Malfa S., Abbate C., Gentile A., Cirvilleri G., ricerca, orientamenti per il futuro. L’Italia Agricola, 113: Catara A., 2009. Transgenic endochitinase Troyer citrange 96-103. shows higher chitinase and glucanase activity and reduced Salerno M., Cutuli G., 1977. Control of citrus mal secco in colonization by fungi. Journal of Plant Pathology 91: S4.86. Italy today. Proceeding of the 2nd International Citrus Con- Russo M., Grasso F.M., Bella P., Licciardello G., Catara A., gress, Orlando, USA: 1001-1003. Catara V., 2011. Molecular diagnostic tools for the detec- Salerno M., Perrotta G., 1978. Lo stato della lotta chimica tion and characterization of Phoma tracheiphila. Acta Hor- contro il Mal secco degli Agrumi. Tecnica Agricola, Catania ticolturae 892: 207-214. 30: 307-316. 001_JPPInvitedReview_523 15-11-2011 17:35 Pagina 559

Journal of Plant Pathology (2011), 93 (3), 523-560 Nigro et al. 559

Salerno M., Cutuli G., 1992. Guida Illustrata di Patologia Solel Z., Sandler D., Dinoor A., 1979. Mobility and persist- degli Agrumi. Edagricole, Bologna, Italy. ence of Carbendazim and Thiabendazole applied to soil Samoladas T.K., 1977. Breeding lemon for resistance to frost via drip irrigation. Phytopathology 69: 1273-1277. and mal secco. Byull. Vses. Ordena Lenina i Ordena Drugh- Solel Z., Mogilner N., Gafny R., Bar-Joseph M., 1995. In- by Naradon. Inst. Rasteni Imeni N.I. Vavilova 68: 10-15. duced tolerance to mal secco disease in Etrog citron and Sarejanni J.A., 1935. “Mal secco” in Greece. Annales de l’In- Rangpur lime by infection with the citrus exocortis viroid. stitut Phytopathologique Benaki 1: 61-66. Plant disease 79: 60-62. Sarejanni J.A., 1939. Catalogue commente des champignons Somma V., Favaloro M. Sorce G., 1969. Ricerche sul “Mal rencontres sur le plantes cultivees en Grece. Annales de secco” degli Agrumi (Deuterophoma tracheiphila Petri). l’Institut Phytopathologique Benaki 3: 41-66. VIII. Ulteriori prove di campo sull’efficacia di alcuni anti- Savastano L., 1923. Delle epidemie italiane del mal secco negli crittogamici. Notiziario sulle Malattie delle Piante 80-81: Agrumeti, Noccioleti, Ficheti, Noceti e Gelseti. Studio di 77-83. clinica arborea. Annali della Stazione Sperimentale di Agru- Somma V., Sammarco G., 1971. Inefficacia di due antibiotici micoltura e Frutticoltura 7: 89-176. contro il mal secco degli Agrumi e primi risultati sull’attiv- Savastano L., 1925. La cura del “mal secco” negli alberi frut- ità di due nuovi fungicidi sistemici. Atti Giornate Fitopato- tiferi. Bollettino della Stazione Sperimentale di Agrumi- logiche 1971, Venezia-Udine, Italy: 241-245. coltura e Frutticoltura 51: 15 pp. Somma V., Salerno M., 1973. L’influenza del Tween 20 sulla Savastano L., Fawcett H.S., 1930. Ricerche sperimentali sul sistemicità e sull’efficacia del Benomyl contro il Mal secco decorso patologico del mal secco nel limone. Bollettino del- degli Agrumi. Atti Giornate Fitopatologiche 1973, Bologna, la Stazione Sperimentale di Frutticoltura e Agrumicoltura Italy: 425-428. 11: 37 pp. Somma V., Salerno M., Sammarco G., 1974. Prove di campo Scaramuzzi G., Salerno M., Catara A., 1964. Ricerche sul sull’efficacia del Benomyl contro il mal secco degli Agrumi. “Mal secco” degli Agrumi (Deuterophoma trecheiphila Phytopathologia Mediterranea 13: 143-146. Petri). II - Influenza delle basse temperature sul decorso Somma V., Cutuli G., Li Destri Nicosia O., Salerno M., 1978. della malattia. Rivista di Patologia Vegetale 4: 319-327. Accumulo e persistenza del Benomyl e del Metil-Tiofanate Schneider D.J., Collmer A., 2010. Studying plant-pathogen in organi vegetativi e frutti di piante di limone trattate alIa interactions in the genomics era: beyond molecular Koch’s chioma. Atti Giornate Fitopatologiche 1978, Catania- postulates to systems biology. Annual Review of Phy- Acireale, Italy: 51-57. topathology 48: 457-479. Somma V., Cutuli G., Salerno M., 1979. Ricerche sul saggio Scrivani P., 1954. Patogenesi, riproduzione sperimentale del della resistenza al mal secco di giovani limoni innestati. At- ‘mal secco’ da Deuterophoma tracheiphila Petri e ricerche ti del “II Seminario di Studio sul Miglioramento Genetico sulla formazione di metaboliti tossici in coltura. Phy- del Limone”, Giovinazzo, Italy: 71-80. topathologische Zeitschrift 22: 83-108. Somma V., Scarito G., Laviola C., 1981. Research on the epi- Sesto F., Grimaldi V., Pennisi A.M., 1990. Sensitivity of differ- derniology of ‘mal-secco’ disease of citrus: preliminary re- ent citrus and non citrus species protoplasts towards “Mal sults on the role of leaf infection. Procedings 4th Interna- secco” toxins. Advances in Horticultural Sciences 4: 97-102. tional Citrus Congress, Tokyo, Japan: 353-354. Shumakova A.A., Grube M.M., 1957. The role of Epicoccum Somma V., Scarito G., 1986. Three years of observations on granulatum Penzig in the disease Citrus withering. Report the periodicity of Phoma tracheiphila (Petri) Kantschaveli of Lenin Academy of Agricultural Science 22: 33-92. et Gikashvili infections in Sicily. Phytopathologia Mediter- Shumakova A.A., 1964. Characteristics of the appearence of ranea 25: 103-106. “mal secco” withering of lemons and their causes. Trudy Spina P., 1975. Materiale di propagazione. Tecnica Agricola, Nauchno-Issledovatel’skogo. Instituta Zashchity Rastenii Catania 3: 177-180. Gruzinskoi SSR 21: 25-40. Starrantino A., Russo F., 1977. Coltura ‘in vitro’ di nucelle iso- Sinitsyna N.V., 1953. Early diagnosis of the disease of drying late da frutticini di limone irraggiati con CO60. Tentativi up of Citrus - mal secco (Deuterophoma tracheiphila). per ottenere semenzali nucellari resistenti al ‘mal secco’. Dostigh. Nauki pired. Opyta sel’khoz 4: 35-36. Annali dell’Istituto Sperimentale per l’Agrumicoltura 9-10: Solel Z., Pinkas J., Loebenstein G., 1972. Evaluation of sys- 209-211. temic fungicides and mineral oil adjuvants for the control Stepanov K.M., 1950. On the sources of the initial infection of mal secco disease of lemon plants. Phytopathology 62: of Citrus wilt (“mal secco”). Report of the Lenin Academy 1007-1013. of Agricultural Science 15: 39-44. Solel Z., Oren Y., 1975. Outbreak of mal secco disease in Is- Stepanov K.M., Shaluishkina V.I., 1952. Lemon fruit and rael on normally tolerant citrus cultivars. Plant Disease Re- seeds source of initial infectious desiccation (‘mal secco’). porter 59: 945-946. Microbiology 21: 48-51. Solel Z., 1976. Epidemiology of mal secco disease of lemons. Surico G., Iacobellis N.S, 1980. Produzione di fitotossine di Phytopathologische Zeitschrift 85: 90-92. Phoma tracheiphila (Petri) Kanc. et Ghik. Influenza delle Solel Z., 1977. Control of mal secco disease of lemons. Pro- condizioni colturali e ricerca di idonei saggi biologici. Phy- ceedings of the 2nd International Citrus Congress, Orlando, topathologia Mediterranea 19: 173-174. USA: 928-930. Surico G., De Cicco V., Iacobellis N., 1981. Osservazioni sulla Solel Z., Spiegel-Roy P., 1978. Methodology of selection of patogenicità di Phoma tracheiphila (Petri) Kanc. et Ghik. lemon clones for tolerance to Mal secco (Phoma tracheiphi- in relazione alla produzione ‘in vitro’ di metaboliti fitoto- la). Phytoparasitica 6: 129-134. ssici. Phytopathologia Mediterranea 20: 17-22. 001_JPPInvitedReview_523 15-11-2011 17:35 Pagina 560

560 Mal secco disease of citrus Journal of Plant Pathology (2011), 93 (3), 523-560

Talon M., Gmitter Jr. F.G., 2008. Citrus Genomics. Interna- Traversa E., Ippolito A., Salerno M., 1991. Indagini epidemio- tional Journal of Plant Genomics. doi:10.1155/2008/ logiche sul mal secco degli agrumi (Phoma tracheiphila). 528361. Fattori che influenzano il passaggio del patogeno dalle Terranova G., Cutuli G., 1975. Lo stato fitosanitario del berg- foglie ai rami. Phytopathologia Mediterranea 30: 59-63. amotto in Calabria. Annali dell’Istituto Sperimentale per Traversa E., Ippolito A., De Cicco V., 1992. Failure to evalu- l’Agrumicoltura 7-8: 175-189. ate lemon resistance against mal secco disease using cul- Thanassoulopoulos C.C., 1969. Some preliminary investiga- ture filtrate of the pathogen. Proceedings of the 7th Interna- tions of the possible control of Mal secco disease of Citrus tional Citrus Congress, Acireale, Italy: 881-883. with the systemic chemical benlate. Proceedings of the 2nd Traversa E., Lima G., 1993. Root infections by Phoma tra- Congress of the Mediterranean Phytopathological Union, cheiphila induced by infected lemon leaves. La Difesa delle Avignon-Antibes, France: 244-250. Piante 16: 35-39. Thanassoulopoulos C.C., 1977. Some hints on the control of Tsiklauri M.S., 1972. Changes in some biochemical indicators mal secco disease in lemon. Phytopathologia Mediterranea in citrus leaves of different varieties during infection by 17: 77. Phoma tracheiphila. Trudy Nauchno-Issledovatel’skogo. In- Thanassoulopoulos C.C., 1983. Introduction and develop- stituta Zashchity Rastenii Gruzinskoi SSR 24: 312-314. ment of integrated management system in the control of Tusa N., Grosser J.W., Gmitter F.G. Jr., Louzada E.S., 1992. mal secco disease of lemon (Phoma tracheiphila ). Proceed- Production of tetraploid somatic hybrid breeding parents ings of the 9th Interbalcanic Conference of Plant Protection, for use in lemon cultivar improvement. HortScience 27: Athens, Greece: 28. 445-447. Thanassoulopoulos C.C., 1986. Epidemiological aspects of Tusa N., Del Bosco S.F., Nigro F., Ippolito A., 2000. Response Mal secco disease of lemons. In: Cavalloro R., Di Martino of cybrids and a somatic hybrid of lemon to Phoma tra- E. (eds). Integrated Pest Control in Citrus Groves, pp. cheiphila infections. HortScience 35: 125-127. 249-255. Balkema A.A., Rotterdam, The Netherlands. Tuttobene R.,1994. Monitoring of Phoma tracheiphila inocu- Thanassoulopoulos C.C., 1991. ‘Ermioni’, a new lemon culti- lum. La Difesa delle Piante 17: 69-74. var resistant to Mal Secco Disease (Phoma tracheiphila). Tuzcu O., Cinar A., Kaplankiran M., Erkilic A., Yesiloglu T., Journal of Phytopathology 131: 234-242. 1989. Resistance of some Citrus species and hybrids to mal Thanassoulopoulos C.C., Kitsos G.T., 1979. Some hints on secco (Phoma tracheiphila Kanc. et Ghik.) disease. Fruits the control of “mal secco” disease in lemons. Agricultural 44: 139-148. Research 3: 122-126. Uturgauri A.I., Daneliya B.K., Mkervali V.G., Kontridze A.N., Thanassoulopoulos C.C., Manos B.D., 1992. Current status 1973. The effect on photosynthesis of substances intro- prognosis and loss assessment of Mal secco (Phoma tra- duced into the lemon tree. Subtropicheskie Kul’tury 1: 65- cheiphila) of citrus in Greece. Proceedings of the 7th Inter- 68. national Citrus Congress, Acireale, Italy: 869-872. Uzun A., Gulsen O., Kafa G., Seday U., 2008. ‘Alata’, Tirrò A., Granata G., 1978. Prove di lotta contro il mal secco ‘Gulsen’, and ‘Uzun’ seedless lemons and ‘Eylul’ early-ma- degli agrumi con fungicidi sistemici. II. Applicazione me- turing lemon. HortScience 43: 1920-1921. diante pennellature al tronco ed alla porzione basale dei Wood H.A., Bozarth R.F., 1972. Properties of virus-like parti- rami principali. Atti Giornate Fitopatologiche 1978, Cata- cles of Penicillium crysogenum: one double stranded RNA nia-Acireale, Italy: 423-430. molecule per particle. Virology 47: 604-609. Tokhadze Z.B., 1971.Water balance in relation to resistance to Zucker W.V., Catara A., 1985. Osservazioni al microscopio frost and mal secco in different varieties and species of cit- elettronico a scansione sulla penetrazione fogliare di P. tra- rus fruits. Subtropicheskie Kul’tury 6: 91-94. cheiphila. Informatore Fitopatologico 35 (4): 33-35.