DOCSLIB.ORG

Supplementary Table 1: Primers Used for Real Time RT-PCR the Sequences of the Real Time RT-PCR Primers Used to Derive the Data of Fig

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary Table 1: Primers Used for Real Time RT-PCR the Sequences of the Real Time RT-PCR Primers Used to Derive the Data of Fig B2M forward: gatgagtatgcctgccgtgtg B2M reverse: caatccaaatgcggcatct EGR1 forward: agccctacgagcacctgac EGR1 reverse: tgggttggtcatgctcacta NAB2 forward: acatcctgcagcagacactg, NAB2 reverse: ctccactttcacgctgctc. JUN B forward: tggaacagcccttctaccac JUN B reverse: gaagaggcgagcttgagaga JUN D forward: gccctggaggatttacacaa JUN D reverse: ctcaggttcgcgtagacagg CXCL14 forward: aagctggaaatgaagccaaa CXCL14 reverse: ttccaggcgttgtaccactt TIMP1 forward: aattccgacctcgtcatcag TIMP1 reverse: gttgtgggacctgtggaagt TIMP3 forward: ctgacaggtcgcgtctatga TIMP3 reverse: agtcacaaagcaaggcaggt VEGFR1 forward: tgctcagctgtctgcttctc VEGFR1 reverse: ccatttcaggcaaagaccat VEGFR2 forward:cagcatcaccagtagccaga VEGFR2 revers: ccaagaactccatgccctta uPA forward: tgaggtggaaaacctcatcc; uPA reverse: ggcaggcagatggtctgtat, KIP-2 forward: caggagcctctcgctgac KIP-2 reverse: cttctcaggcgctgatctct GADD45 forward: tgcgagaacgacatcaacat GADD45 reverse: tcccggcaaaaacaaataag TGF-b1 forward: ccctggacaccaactatt, TGF-b1 reverse: gtccaggctccaaatgtagg; DUSP2 forward: ccactgccgtgtacttcctg DUSP2 reverse: ggtagggcaagatctccaca SIVA forward: gtccattgcctgttcctcat SIVA reverse: atgtcactgcagtccacgag DEDD2 forward: gcagtcaagcagttctgcaa DEDD2 reverse: cacaggtcactttgccttca APOE forward: ggtcgcttttgggattacct APOE reverse: ttcctccagttccgatttgt Supplementary Table 1: Primers used for real time RT-PCR The sequences of the real time RT-PCR primers used to derive the data of Fig. 1 and to confirm the microarray data of Tab. 1 of the manuscript are shown. Supplementary Table 2: Genes upregulated by EGR-1 over 25 fold 24 h post-infection (67 genes) UniGene Entrez Gene Gene Symbol Entrez Definition EGR1 16 h CV16h EGR1 24 h CV24h EGR1 48 h CV 48h Hs.172928 1277 COL1A1 collagen, type I, alpha 1 6,5 0 9,4 0,3 12,3 -0,6 Hs.311193 199800 LOC199800 hypothetical protein LOC199800 8,7 0,2 9,2 0,2 9,3 0,1 Hs.398636 3040 HBA2 hemoglobin, alpha 2 7,8 0 9,1 0,2 10,7 -0,1 Hs.114948 9244 CRLF1 cytokine receptor-like factor 1 7,3 -0,3 8,9 0,3 8,3 -0,4 Hs.51483 196410 MGC17301 hypothetical protein MGC17301 9,1 2,4 8,8 2,1 8,7 2,6 Hs.233533 283869 PPL8 similar to prepro-Neuropeptide W polypeptide 8,7 0,4 8,7 0,1 8,1 0,2 Hs.110675 348 APOE apolipoprotein E 7,4 -0,2 8,5 0 9,8 -0,3 Hs.208229 84634 GPR54 G protein-coupled receptor 54 7,9 -0,9 8,1 -0,8 8,4 0,2 Hs.24395 9547 CXCL14 chemokine (C-X-C motif) ligand 14 3,8 0 8 0,2 11,9 0,2 Hs.21380 --- --- CDNA FLJ46882 fis, clone UTERU3015844 7,3 -0,2 8 -0,1 8 0,8 Hs.149997 2307 FKHL18 forkhead-like 18 (Drosophila) 7,8 2,2 7,8 3,8 7,1 3,2 Hs.40888 23237 ARC activity-regulated cytoskeleton-associated protein 7,3 -0,3 7,8 0,5 8,8 -0,4 Hs.249200 9965 FGF19 fibroblast growth factor 19 3,7 -0,3 7,3 0,3 9,8 0 Hs.276770 1043 CDW52 CDW52 antigen (CAMPATH-1 antigen) 6 -0,9 7,3 -0,8 8,6 -0,4 Hs.212584 57214 KIAA1199 KIAA1199 protein 6,9 2,7 7,1 3,7 7 4,8 Hs.31403 --- --- Transcribed sequences 5,6 -0,2 7,1 -0,1 7,8 0,2 Hs.44865 51176 LEF1 lymphoid enhancer-binding factor 1 6,1 0,5 6,9 -1,4 7,1 -1,6 Hs.1420 2261 FGFR3 fibroblast growth factor receptor 3 (achondroplasia, thanatophoric dwarfism) 6,4 -0,2 6,9 0,2 6,1 4 Hs.355618 388889 --- CDNA FLJ45323 fis, clone BRHIP3006390 6,4 0,3 6,9 0,2 6 0,3 Hs.348037 94274 PPP1R14A protein phosphatase 1, regulatory (inhibitor) subunit 14A 5,3 0,4 6,8 2,5 8 2,5 Hs.125293 221002 RASGEF1A RasGEF domain family, member 1A 5 3,7 6,6 0,7 8,5 3,3 Hs.152812 --- --- Transcribed sequences 6,4 -1 6,4 -0,2 6,1 0,7 Hs.183650 1382 CRABP2 cellular retinoic acid binding protein 2 5,2 -0,3 6,4 0,3 7,5 0,5 Hs.107513 139818 DOCK11 dedicator of cytokinesis 11 5,5 0,6 6,4 1,2 6,2 1,7 Hs.436584 114990 LOC114990 hypothetical protein BC013767 6,1 0,1 6,3 1,9 5,9 1,8 Hs.128316 10458 BAIAP2 BAI1-associated protein 2 5 0 6,2 -0,1 6,8 -0,3 Hs.259768 107 ADCY1 adenylate cyclase 1 (brain) 6,3 0 6,1 0,2 6,3 0,1 Hs.64056 5058 PAK1 p21/Cdc42/Rac1-activated kinase 1 (STE20 homolog, yeast) 5,2 2,1 6,1 2,9 6,4 1,8 Hs.1183 1844 DUSP2 dual specificity phosphatase 2 4,3 0 6 0 5,8 -0,4 Hs.97220 1101 CHAD chondroadherin 2,9 0 6 0,3 8,2 -0,2 Hs.132753 26232 FBXO2 F-box only protein 2 4,2 0,3 5,8 0,4 7,3 0,3 twist homolog 1 (acrocephalosyndactyly 3; Saethre-Chotzen syndrome) Hs.66744 7291 TWIST1 (Drosophila) 6,9 2,7 5,8 2,6 6,1 2,5 Hs.369063 7546 ZIC2 Zic family member 2 (odd-paired homolog, Drosophila) 0,3 2,1 5,7 0,6 9,2 3,1 UniGene ID Entrez Gene Gene Symbol Entrez Definition EGR1 16 h CV16h EGR1 24 h CV24h EGR1 48 h CV 48h Hs.100217 752 FMNL1 formin-like 1 4,7 -0,3 5,7 0 7 -0,1 Hs.415762 8581 LY6D lymphocyte antigen 6 complex, locus D 2,2 -0,1 5,6 0,4 9,2 -0,3 collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dysplasia, Hs.408182 1280 COL2A1 congenital) 0,6 0,1 5,6 0,3 9,9 -0,2 Hs.63348 11117 EMILIN1 elastin microfibril interfacer 1 5,3 0,3 5,6 0,2 6,4 2,9 Hs.287370 8074 FGF23 fibroblast growth factor 23 5,3 -0,1 5,6 0,2 4,7 -0,2 Hs.374836 118788 PIK3AP1 phosphoinositide-3-kinase adaptor protein 1 5 0,6 5,5 -0,5 4,8 0,4 Hs.102572 --- --- Transcribed sequences 0,2 1,9 5,5 2,9 4,9 -0,2 Hs.29725 79667 FLJ13197 hypothetical protein FLJ13197 5 2,4 5,5 0,3 5,1 4,1 Hs.246046 83758 RBP5 retinol binding protein 5, cellular 5,1 0,1 5,5 0,3 5,4 1,2 Hs.27788 118738 ZNF488 zinc finger protein 488 4,4 0,1 5,4 0,2 5,1 0,2 Hs.72918 6346 CCL1 chemokine (C-C motif) ligand 1 3,5 -0,1 5,4 0,1 6,5 -0,3 Hs.436132 1759 DNM1 dynamin 1 4,2 2,5 5,3 2,1 5,6 3,2 Hs.24743 54845 FLJ20171 hypothetical protein FLJ20171 4,2 0,5 5,3 3,4 8,8 1,2 Hs.242014 119467 MGC32871 hypothetical protein MGC32871 3,7 0,4 5,3 0 5,2 2,3 Hs.221974 6616 SNAP25 synaptosomal-associated protein, 25kDa 4 0,2 5,3 3,4 6,8 3,1 Hs.28391 --- --- CDNA FLJ37384 fis, clone BRAMY2026347 3,5 0,4 5,2 -0,1 7,4 0,4 --- 150271 LOC150271 hypothetical protein LOC150271 4,9 -0,2 5,2 -0,5 5,3 0,3 Hs.134194 1747 DLX3 distal-less homeo box 3 4,6 0,3 5,2 0,1 6,7 0,4 Hs.80618 57690 KIAA1582 KIAA1582 protein 5,1 0,1 5,2 2,7 4,8 0,5 Hs.46531 5239 PGM5 phosphoglucomutase 5 4,1 0,3 5,2 0,6 5,7 0,9 Hs.79404 27065 D4S234E DNA segment on chromosome 4 (unique) 234 expressed sequence 4,5 0,1 5,2 0,3 4,3 0,1 Hs.524403 --- --- Transcribed sequence with weak similarity to protein sp:P39188 (H.sapiens) 5,1 0,2 5,2 0 5,5 0,1 Hs.333383 8547 FCN3 ficolin (collagen/fibrinogen domain containing) 3 (Hakata antigen) 4,6 1,7 5,1 0,5 4,4 1,6 Hs.257511 54852 MPRG membrane progestin receptor gamma 4,7 2 5,1 0,1 4,8 3,7 Hs.28391 --- --- CDNA FLJ37384 fis, clone BRAMY2026347 4,2 0,5 5,1 3,3 7,3 1,1 Hs.184640 745 C11orf9 chromosome 11 open reading frame 9 4,5 1 5,1 1,3 6,7 2,2 --- 29034 PRO0132 PRO0132 protein 0,1 0,1 5,1 2,7 -0,1 0 Hs.125504 92270 LOC92270 hypothetical protein LOC92270 5,2 -0,1 5,1 0,2 4,1 3,7 Hs.445574 --- --- Transcribed sequence with weak similarity to protein pir:I37984 (H.sapiens) 5,5 0,4 5,1 0,4 4,6 0,4 Hs.135121 79827 ASAM adipocyte-specific adhesion molecule 4,2 0,4 5,1 0,4 3,8 0 Hs.441202 2675 GFRA2 GDNF family receptor alpha 2 3,8 0,2 5,1 0,6 7,6 0 Hs.86092 85366 MYLK2 myosin light chain kinase 2, skeletal muscle 4,9 0,1 5,1 0,4 4,6 0,2 Hs.98381 167681 C6orf158 chromosome 6 open reading frame 158 3,6 3,5 5,1 0,8 3,5 2,8 Hs.374579 201501 --- CDNA FLJ37907 fis, clone COLON2009337 3,1 0 5,1 -0,1 4,6 0 Supplementary Table 2: Genes most highly upregulated by sustained EGR-1 24 h post-infection Total RNA was isolated from HUVEC following infection with either EGR-1 expressing adenoviruses (EGR-1) or empty control viruses (CV) at 16 h, 24 h and 48 h. The RNA samples were subjected to microarray analysis using the Affymetrix U133 GeneChip-set.
Load more

Recommended publications
  • FBXO2 Antibody Cat
    FBXO2 Antibody Cat. No.: 55-088 FBXO2 Antibody Western blot analysis in mouse brain tissue and HepG2,293 cell line lysates (35ug/lane). Specifications HOST SPECIES: Rabbit SPECIES REACTIVITY: Human, Mouse This FBXO2 antibody is generated from rabbits immunized with a KLH conjugated IMMUNOGEN: synthetic peptide between 244-271 amino acids from the C-terminal region of human FBXO2. TESTED APPLICATIONS: Flow, WB For FACS starting dilution is: 1:10~50 APPLICATIONS: For WB starting dilution is: 1:1000 PREDICTED MOLECULAR 33 kDa WEIGHT: September 24, 2021 1 https://www.prosci-inc.com/fbxo2-antibody-55-088.html Properties This antibody is purified through a protein A column, followed by peptide affinity PURIFICATION: purification. CLONALITY: Polyclonal ISOTYPE: Rabbit Ig CONJUGATE: Unconjugated PHYSICAL STATE: Liquid BUFFER: Supplied in PBS with 0.09% (W/V) sodium azide. CONCENTRATION: batch dependent Store at 4˚C for three months and -20˚C, stable for up to one year. As with all antibodies STORAGE CONDITIONS: care should be taken to avoid repeated freeze thaw cycles. Antibodies should not be exposed to prolonged high temperatures. Additional Info OFFICIAL SYMBOL: FBXO2 ALTERNATE NAMES: F-box only protein 2, FBXO2, FBX2 ACCESSION NO.: Q9UK22 PROTEIN GI NO.: 51338836 GENE ID: 26232 USER NOTE: Optimal dilutions for each application to be determined by the researcher. Background and References This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination.
    [Show full text]
  • Variation in FCN1 Affects Biosynthesis of Ficolin-1 and Is Associated With
    Genes and Immunity (2012) 13, 515–522 & 2012 Macmillan Publishers Limited All rights reserved 1466-4879/12 www.nature.com/gene ORIGINAL ARTICLE Variation in FCN1 affects biosynthesis of ficolin-1 and is associated with outcome of systemic inflammation L Munthe-Fog1, T Hummelshoj1, C Honore´ 1, ME Moller1, MO Skjoedt1, I Palsgaard1, N Borregaard2, HO Madsen1 and P Garred1 Ficolin-1 is a recognition molecule of the lectin complement pathway. The ficolin-1 gene FCN1 is polymorphic, but the functional and clinical consequences are unknown.The concentration of ficolin-1 in plasma and FCN1 polymorphisms in positions À 1981 (rs2989727), À 791 (rs28909068), À 542 (rs10120023), À 271 (rs28909976), À 144 (rs10117466) and þ 7918 (rs1071583) were determined in 100 healthy individuals. FCN1 expression by isolated monocytes and granulocytes and ficolin-1 levels in monocyte culture supernatants were assessed in 21 FCN1-genotyped individuals. FCN1 polymorphisms were determined in a cohort of 251 patients with systemic inflammation. High ficolin-1 plasma levels were significantly associated with the minor alleles in position À 542 and À 144. These alleles were also significantly associated with high FCN1 mRNA expression. The level of ficolin-1 in culture supernatants was significantly higher in individuals homozygous for the minor alleles at positions À 542 and À 144. Homozygosity for these alleles was significantly associated with fatal outcome in patients with systemic inflammation. None of the other investigated polymorphisms were associated with FCN1 and ficolin-1 expression, concentration or disease outcome. Functional polymorphic sites in the promoter region of FCN1 regulate both the expression and synthesis of ficolin-1 and are associated with outcome in severe inflammation.
    [Show full text]
  • Chromosomal Aberrations in Head and Neck Squamous Cell Carcinomas in Norwegian and Sudanese Populations by Array Comparative Genomic Hybridization
    825-843 12/9/08 15:31 Page 825 ONCOLOGY REPORTS 20: 825-843, 2008 825 Chromosomal aberrations in head and neck squamous cell carcinomas in Norwegian and Sudanese populations by array comparative genomic hybridization ERIC ROMAN1,2, LEONARDO A. MEZA-ZEPEDA3, STINE H. KRESSE3, OLA MYKLEBOST3,4, ENDRE N. VASSTRAND2 and SALAH O. IBRAHIM1,2 1Department of Biomedicine, Faculty of Medicine and Dentistry, University of Bergen, Jonas Lies vei 91; 2Department of Oral Sciences - Periodontology, Faculty of Medicine and Dentistry, University of Bergen, Årstadveien 17, 5009 Bergen; 3Department of Tumor Biology, Institute for Cancer Research, Rikshospitalet-Radiumhospitalet Medical Center, Montebello, 0310 Oslo; 4Department of Molecular Biosciences, University of Oslo, Blindernveien 31, 0371 Oslo, Norway Received January 30, 2008; Accepted April 29, 2008 DOI: 10.3892/or_00000080 Abstract. We used microarray-based comparative genomic logical parameters showed little correlation, suggesting an hybridization to explore genome-wide profiles of chromosomal occurrence of gains/losses regardless of ethnic differences and aberrations in 26 samples of head and neck cancers compared clinicopathological status between the patients from the two to their pair-wise normal controls. The samples were obtained countries. Our findings indicate the existence of common from Sudanese (n=11) and Norwegian (n=15) patients. The gene-specific amplifications/deletions in these tumors, findings were correlated with clinicopathological variables. regardless of the source of the samples or attributed We identified the amplification of 41 common chromosomal carcinogenic risk factors. regions (harboring 149 candidate genes) and the deletion of 22 (28 candidate genes). Predominant chromosomal alterations Introduction that were observed included high-level amplification at 1q21 (harboring the S100A gene family) and 11q22 (including Head and neck squamous cell carcinoma (HNSCC), including several MMP family members).
    [Show full text]
  • SPP1 and AGER As Potential Prognostic Biomarkers for Lung Adenocarcinoma
    7028 ONCOLOGY LETTERS 15: 7028-7036, 2018 SPP1 and AGER as potential prognostic biomarkers for lung adenocarcinoma WEIGUO ZHANG, JUNLI FAN, QIANG CHEN, CAIPENG LEI, BIN QIAO and QIN LIU Henan Key Laboratory of Cancer Epigenetics, Department of Oncology Surgery, Cancer Institute and College of Clinical Medicine, The First Affiliated Hospital of Henan University of Science and Technology, Luoyang, Henan 471003, P.R. China Received August 11, 2017; Accepted January 5, 2018 DOI: 10.3892/ol.2018.8235 Abstract. Overdue treatment and prognostic evaluation lead Introduction to low survival rates in patients with lung adenocarcinoma (LUAD). To date, effective biomarkers for prognosis are still Lung adenocarcinoma (LUAD) is one of the three major required. The aim of the present study was to screen differen- histopathological subtypes along with squamous cell carci- tially expressed genes (DEGs) as biomarkers for prognostic noma (SqCLC) and large cell carcinoma (1). Currently, LUAD evaluation of LUAD. DEGs in tumor and normal samples has become the most common lung cancer with increasing were identified and analyzed for Kyoto Encyclopedia of Genes morbidity. This uptrend of incidence may be due to increasing and Genomes/Gene Ontology functional enrichments. The smoking rate and air pollution (2). Furthermore, LUAD is common genes that are up and downregulated were selected diagnosed at late stages (stage III and IV), when the cancer for prognostic analysis using RNAseq data in The Cancer has spread to nearby tissues and metastasis has occurred (3). Genome Atlas. Differential expression analysis was performed As well as overdue diagnosis that leads to delayed treatment, with 164 samples in GSE10072 and GSE7670 datasets.
    [Show full text]
  • Protein Interaction Network of Alternatively Spliced Isoforms from Brain Links Genetic Risk Factors for Autism
    ARTICLE Received 24 Aug 2013 | Accepted 14 Mar 2014 | Published 11 Apr 2014 DOI: 10.1038/ncomms4650 OPEN Protein interaction network of alternatively spliced isoforms from brain links genetic risk factors for autism Roser Corominas1,*, Xinping Yang2,3,*, Guan Ning Lin1,*, Shuli Kang1,*, Yun Shen2,3, Lila Ghamsari2,3,w, Martin Broly2,3, Maria Rodriguez2,3, Stanley Tam2,3, Shelly A. Trigg2,3,w, Changyu Fan2,3, Song Yi2,3, Murat Tasan4, Irma Lemmens5, Xingyan Kuang6, Nan Zhao6, Dheeraj Malhotra7, Jacob J. Michaelson7,w, Vladimir Vacic8, Michael A. Calderwood2,3, Frederick P. Roth2,3,4, Jan Tavernier5, Steve Horvath9, Kourosh Salehi-Ashtiani2,3,w, Dmitry Korkin6, Jonathan Sebat7, David E. Hill2,3, Tong Hao2,3, Marc Vidal2,3 & Lilia M. Iakoucheva1 Increased risk for autism spectrum disorders (ASD) is attributed to hundreds of genetic loci. The convergence of ASD variants have been investigated using various approaches, including protein interactions extracted from the published literature. However, these datasets are frequently incomplete, carry biases and are limited to interactions of a single splicing isoform, which may not be expressed in the disease-relevant tissue. Here we introduce a new interactome mapping approach by experimentally identifying interactions between brain-expressed alternatively spliced variants of ASD risk factors. The Autism Spliceform Interaction Network reveals that almost half of the detected interactions and about 30% of the newly identified interacting partners represent contribution from splicing variants, emphasizing the importance of isoform networks. Isoform interactions greatly contribute to establishing direct physical connections between proteins from the de novo autism CNVs. Our findings demonstrate the critical role of spliceform networks for translating genetic knowledge into a better understanding of human diseases.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • The Effect of Galactose on the Expression of Genes Regulated by Rrp6p
    The Review: A Journal of Undergraduate Student Research Volume 18 Article 1 2017 The Effect of Galactose on the Expression of Genes Regulated by Rrp6p Mary Megan Pelkowski Saint John Fisher College, [email protected] Kevin Callahan Saint John Fisher College, [email protected] Follow this and additional works at: https://fisherpub.sjfc.edu/ur Part of the Biochemistry Commons, and the Molecular Genetics Commons How has open access to Fisher Digital Publications benefited ou?y Recommended Citation Pelkowski, Mary Megan and Callahan, Kevin. "The Effect of Galactose on the Expression of Genes Regulated by Rrp6p." The Review: A Journal of Undergraduate Student Research 18 (2017): -. Web. [date of access]. <https://fisherpub.sjfc.edu/ur/vol18/iss1/1>. This document is posted at https://fisherpub.sjfc.edu/ur/vol18/iss1/1 and is brought to you for free and open access by Fisher Digital Publications at St. John Fisher College. For more information, please contact [email protected]. The Effect of Galactose on the Expression of Genes Regulated by Rrp6p Abstract Gene expression is a multi-faceted phenomenon, governed not only by the sequence of nucleotides, but also by the extent to which a particular gene gets transcribed, how the transcript is processed, and whether or not the transcript ever makes it out of the nucleus. Rrp6p is a 5’-3’ exonuclease that can function independently and as part of the nuclear exosome in Saccharomyces cerevisiae (Portin, 2014). It degrades various types of aberrant RNA species including small nuclear RNAs, small nucleolar RNAs, telomerase RNA, unspliced RNAs, and RNAs that have not been properly packaged for export (Butler & Mitchell, 2010).
    [Show full text]
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]
  • RET Gene Fusions in Malignancies of the Thyroid and Other Tissues
    G C A T T A C G G C A T genes Review RET Gene Fusions in Malignancies of the Thyroid and Other Tissues Massimo Santoro 1,*, Marialuisa Moccia 1, Giorgia Federico 1 and Francesca Carlomagno 1,2 1 Department of Molecular Medicine and Medical Biotechnology, University of Naples “Federico II”, 80131 Naples, Italy; [email protected] (M.M.); [email protected] (G.F.); [email protected] (F.C.) 2 Institute of Endocrinology and Experimental Oncology of the CNR, 80131 Naples, Italy * Correspondence: [email protected] Received: 10 March 2020; Accepted: 12 April 2020; Published: 15 April 2020 Abstract: Following the identification of the BCR-ABL1 (Breakpoint Cluster Region-ABelson murine Leukemia) fusion in chronic myelogenous leukemia, gene fusions generating chimeric oncoproteins have been recognized as common genomic structural variations in human malignancies. This is, in particular, a frequent mechanism in the oncogenic conversion of protein kinases. Gene fusion was the first mechanism identified for the oncogenic activation of the receptor tyrosine kinase RET (REarranged during Transfection), initially discovered in papillary thyroid carcinoma (PTC). More recently, the advent of highly sensitive massive parallel (next generation sequencing, NGS) sequencing of tumor DNA or cell-free (cfDNA) circulating tumor DNA, allowed for the detection of RET fusions in many other solid and hematopoietic malignancies. This review summarizes the role of RET fusions in the pathogenesis of human cancer. Keywords: kinase; tyrosine kinase inhibitor; targeted therapy; thyroid cancer 1. The RET Receptor RET (REarranged during Transfection) was initially isolated as a rearranged oncoprotein upon the transfection of a human lymphoma DNA [1].
    [Show full text]
  • Rabbit Anti-NAB2/FITC Conjugated Antibody
    SunLong Biotech Co.,LTD Tel: 0086-571- 56623320 Fax:0086-571- 56623318 E-mail:[email protected] www.sunlongbiotech.com Rabbit Anti-NAB2/FITC Conjugated antibody SL11299R-FITC Product Name: Anti-NAB2/FITC Chinese Name: FITC标记的EGR1Binding protein2抗体 EGR 1 binding protein 2; EGR-1-binding protein 2; EGR1 binding protein 2; MADER; Melanoma associated delayed early response protein; Melanoma-associated delayed Alias: early response protein; MGC75085; Nab 2; nab2; NAB2_HUMAN; NGFI A binding protein 2 (EGR1 binding protein 2); NGFI A binding protein 2; NGFI-A-binding protein 2; Protein MADER. Organism Species: Rabbit Clonality: Polyclonal React Species: Human,Mouse,Rat,Dog,Pig,Cow,Horse,Rabbit,Sheep, ICC=1:50-200IF=1:50-200 Applications: not yet tested in other applications. optimal dilutions/concentrations should be determined by the end user. Molecular weight: 57kDa Form: Lyophilized or Liquid Concentration: 1mg/ml immunogen: KLH conjugated synthetic peptide derived from human MCM5 Lsotype: IgGwww.sunlongbiotech.com Purification: affinity purified by Protein A Storage Buffer: 0.01M TBS(pH7.4) with 1% BSA, 0.03% Proclin300 and 50% Glycerol. Store at -20 °C for one year. Avoid repeated freeze/thaw cycles. The lyophilized antibody is stable at room temperature for at least one month and for greater than a year Storage: when kept at -20°C. When reconstituted in sterile pH 7.4 0.01M PBS or diluent of antibody the antibody is stable for at least two weeks at 2-4 °C. background: Transcriptional control is in part regulated by interactions between DNA-bound transcription factors, such as Egr-1/NGFI-A, and coregulatory proteins, such as NAB Product Detail: (for NGFI-A-binding proteins).
    [Show full text]
  • Greg's Awesome Thesis
    Analysis of alignment error and sitewise constraint in mammalian comparative genomics Gregory Jordan European Bioinformatics Institute University of Cambridge A dissertation submitted for the degree of Doctor of Philosophy November 30, 2011 To my parents, who kept us thinking and playing This dissertation is the result of my own work and includes nothing which is the out- come of work done in collaboration except where specifically indicated in the text and acknowledgements. This dissertation is not substantially the same as any I have submitted for a degree, diploma or other qualification at any other university, and no part has already been, or is currently being submitted for any degree, diploma or other qualification. This dissertation does not exceed the specified length limit of 60,000 words as defined by the Biology Degree Committee. November 30, 2011 Gregory Jordan ii Analysis of alignment error and sitewise constraint in mammalian comparative genomics Summary Gregory Jordan November 30, 2011 Darwin College Insight into the evolution of protein-coding genes can be gained from the use of phylogenetic codon models. Recently sequenced mammalian genomes and powerful analysis methods developed over the past decade provide the potential to globally measure the impact of natural selection on pro- tein sequences at a fine scale. The detection of positive selection in particular is of great interest, with relevance to the study of host-parasite conflicts, immune system evolution and adaptive dif- ferences between species. This thesis examines the performance of methods for detecting positive selection first with a series of simulation experiments, and then with two empirical studies in mammals and primates.
    [Show full text]
  • Genome-Wide Association Study Identifies NRG1 As a Susceptibility Locus for Hirschsprung’S Disease
    Genome-wide association study identifies NRG1 as a susceptibility locus for Hirschsprung’s disease Maria-Merce` Garcia-Barceloa,b,1, Clara Sze-man Tangc,1, Elly Sau-wai Ngana,b, Vincent Chi-hang Luia,b, Yan Chena, Man-ting Soa, Thomas Yuk-yu Leona, Xiao-ping Miaoa,d, Cathy Ka-yee Shuma, Feng-qin Liua, Ming-yiu Yeungc, Zhen-wei Yuane, Wei-hong Guof, Lei Liuc, Xiao-bing Sung, Liu-ming Huangh, Jin-fa Toui, You-qiang Songj, Danny Chanj, Kenneth M. C. Cheungk, Kenneth Kak-yuen Wonga, Stacey S. Chernyc,l,2, Pak-chung Shamb,c,2, and Paul Kwong-hang Tama,b,2 Departments of aSurgery, cDepartment of Psychiatry, lGenome Research Centre, bCentre for Reproduction, Development, and Growth, Departments of jBiochemistry and kOrthopaedics and Traumatology of the Li Ka Shing Faculty of Medicine, University of Hong Kong; eDepartment of Paediatric Surgery, Shengjing Hospital, China Medical University, Shenyang, China; fDepartment of Surgery, Beijing Children’s Hospital, Beijing, China; dDepartment of Surgery, Shenzhen Children’s Hospital, Shenzhen, China; gDepartment of Pediatric Surgery, Shandong Medical University, Shandong, China; hDepartment of Surgery, Beijing University, Beijing, China; and iDepartment of Surgery, Zhejiang Children’s Hospital, Zhejiang, China Communicated by Lap-Chee Tsui, University of Hong Kong, Hong Kong SAR, People’s Republic of China, September 30, 2008 (received for review June 24, 2008) Hirschsprung’s disease (HSCR), or aganglionic megacolon, is a the length of the aganglionic segment in the proband and the congenital disorder characterized by the absence of enteric ganglia gender of the sibling. in variable portions of the distal intestine.
    [Show full text]