Variation in FCN1 Affects Biosynthesis of Ficolin-1 and Is Associated With

ORIGINAL ARTICLE Variation in FCN1 affects biosynthesis of ﬁcolin-1 and is associated with outcome of systemic inﬂammation

L Munthe-Fog1, T Hummelshoj1, C Honore´ 1, ME Moller1, MO Skjoedt1, I Palsgaard1, N Borregaard2, HO Madsen1 and P Garred1

Ficolin-1 is a recognition molecule of the lectin complement pathway. The ficolin-1 gene FCN1 is polymorphic, but the functional and clinical consequences are unknown.The concentration of ficolin-1 in plasma and FCN1 polymorphisms in positions À 1981 (rs2989727), À 791 (rs28909068), À 542 (rs10120023), À 271 (rs28909976), À 144 (rs10117466) and þ 7918 (rs1071583) were determined in 100 healthy individuals. FCN1 expression by isolated monocytes and granulocytes and ficolin-1 levels in monocyte culture supernatants were assessed in 21 FCN1-genotyped individuals. FCN1 polymorphisms were determined in a cohort of 251 patients with systemic inflammation. High ficolin-1 plasma levels were significantly associated with the minor alleles in position À 542 and À 144. These alleles were also significantly associated with high FCN1 mRNA expression. The level of ficolin-1 in culture supernatants was significantly higher in individuals homozygous for the minor alleles at positions À 542 and À 144. Homozygosity for these alleles was significantly associated with fatal outcome in patients with systemic inflammation. None of the other investigated polymorphisms were associated with FCN1 and ficolin-1 expression, concentration or disease outcome. Functional polymorphic sites in the promoter region of FCN1 regulate both the expression and synthesis of ficolin-1 and are associated with outcome in severe inflammation.

Genes and Immunity (2012) 13, 515–522; doi:10.1038/gene.2012.27; published online 7 June 2012 Keywords: Ficolin-1; FCN1; complement lectin pathway; monocyte; inﬂammation; innate immunity

INTRODUCTION responsible for ligand recognition.3–5 Although the ficolins share An emerging role of the ficolins in innate immune defence has a common preference for acetylated compounds, each ficolin recently been appreciated.1 Three ficolins, ficolin-1, -2 and -3 (also displays distinct ligand specificities. Ficolin-2 binds to a wide range known as M-, L- and H-ficolin) have been identified in humans. of pathogens, such as bacteria, fungi and viruses, whereas only a 1 These are encoded by the FCN1, FCN2 and FCN3 genes, few bacterial ligands have been identified for ficolin-3. Both 6–8 respectively. Polymorphisms in the FCN2 and FCN3 genes are ficolin-2 and -3 have been shown to bind to apoptotic cells. 9 known to influence synthesis, function and structure of the Ficolin-1 has a preference for sialic acid and binds to sialic- corresponding proteins and disease associations have been acid-containing structures present on living monocytes and 10 described, but the influence of FCN1 polymorphisms are largely granulocytes. unknown.2 A highly conserved cysteine residue in the collagen-like domain FCN1 and FCN2 are genes located on chromosome 9 and FCN3 enables all three ficolins to form complexes with the mannose- is sequestered on chromosome 1. All the three FCN genes have a binding lectin/ficolin-associated serine proteases named MASPs similar locus organization encoding a short N-terminal cysteine and hence to activate the complement cascade through the lectin region, followed by a collagen-like domain and a linker region, pathway.1 However, the potential to activate complement differs which is further connected to a C-terminal fibrinogen-like domain. among the ficolins, ficolin-3 being the most potent, ficolin-2 FCN2 and FCN3 contain eight exons, whereas FCN1 has an intermediate and ficolin-1 displaying least complement activation additional exon in the collagen-like domain encoding four extra potential.11 Gly–Xaa–Yaa repeats.2 The ficolin polypeptide chains consist of Each FCN gene exhibits a unique expression profile.11 FCN2 299–326 amino acids. Ficolin-1 and -2 are highly homologous expression is limited to hepatocytes and is secreted to the blood molecules (80%), whereas the degree of homology with ficolin-3 is stream.12–14 FCN3 is expressed both in the liver and lungs, but the lower (48%). The similar locus organization of the FCN genes is FCN3 expression in the alveolar tissue exceeds the hepatic reflected in the structure of the corresponding proteins. The expression.11 In accordance, ficolin-3 is found in plasma and proteins are assembled from 4–6 subunits, each subunit consisting bronchoalveolar lavage fluid.15 Lower FCN3 expression is found in of three identical polypeptides. Disulfide bonding further heart, kidney, spleen, pancreas and placenta.11 assembles these subunits into the characteristic higher FCN1 is predominantly expressed by cells derived from the oligomeric forms that resemble a bouquet.3 The C-terminal end myeloid lineage in the bone marrow and is found in the peripheral of the molecule, the globular fibrinogen-like domain, is circulation in monocytes and granulocytes, but not in cells of

1Laboratory of Molecular Medicine, Department of Clinical Immunology, Section 7631, Rigshospitalet, Faculty of Health Sciences, University Hospital of Copenhagen, Copenhagen, Denmark and 2The Granulocyte Research Laboratory, Department of Haematology, Rigshospitalet, Faculty of Health Sciences, University Hospital of Copenhagen, Copenhagen, Denmark. Correspondence: Dr P Garred, Laboratory of Molecular Medicine, Department of Clinical Immunology, Section 7631, Rigshospitalet, Faculty of Health Sciences, University Hospital of Copenhagen, 2100 Copenhagen, Denmark. Email: [email protected] Received 31 January 2012; revised 12 April 2012; accepted 4 May 2012; published online 7 June 2012 FCN1 expression and disease L Munthe-Fog et al 516 lymphoid origin.16–19 In addition, ficolin-1 may be expressed in the lungs.20 Both neutrophils and monocytes secrete ficolin-1 to the surroundings where it may have a role in local immune defence.10,17,18,21 The FCN1 gene is well conserved between invertebrates, mouse and human, suggesting crucial and fundamental roles of ficolin-1.2,22 Several polymorphisms have been described both in the promoter and coding region when the FCN1 gene has been thoroughly sequenced.13,23 To date, no or only limited information exists whether variations in FCN1 influence the expression, the synthesis or plasma level of ficolin-1 and whether such may be of clinical importance. We therefore wanted to determine the genetic impact of the FCN1 polymorphisms described in Caucasians on the FCN1 gene expression, ficolin-1 synthesis and Figure 1. Serial dilution of EDTA plasma (–) and EDTA plasma plasma level of ficolin-1. Furthermore, based on the putative role depleted for ficolin-2 (---) analyzed by ficolin-2 ELISA (a) and ficolin-1 ELISA (b). As ficolin-2 was removed from plasma, as shown in panel of ficolin-1 in host defence and inflammation, we hypothesized a, no difference in the ficolin-1 signal was observed (b). Hence, that functional FCN1 variant alleles may have an impact on ficolin-2 did not contribute to the obtained optical density values in outcome in patients with systemic inflammatory response the ficolin-1 ELISA. syndrome (SIRS) and sepsis.

RESULTS Establishing a ficolin-1-specific enzyme-linked immunosorbent assay (ELISA) The specificity of the ficolin-1 ELISA was assessed by determining the ficolin-1 level in EDTA plasma samples before and after the removal of ficolin-2. No reduction was observed in the optical density values obtained in the ficolin-1 ELISAs (Figure 1). Similarly, adding recombinant ficolin (rficolin)-2 to the depleted plasma samples did not change the read-out of the ficolin-1 ELISA. Thus, the ficolin-1 ELISA demonstrated no cross-reactivity with ficolin-2. Figure 2. Ficolin-1 EDTA plasma levels in 100 Danish blood donors. The concentration ranged 0.01–1.89 mgmlÀ 1 with a median À 1 Plasma levels of ficolin-1 concentration of 0.30 mgml . The concentration of ficolin-1 ranged 0.01–1.89 mgmlÀ 1 with a median concentration of 0.3 mgmlÀ 1 determined in 100 Danish blood donors (Figure 2). No correlation was observed with gender, À 271 (rs28909976), À 144 (rs10117466) and þ 7918 (rs1071583) age or with the levels of ficolin-2 (data not shown). It has been (Table 1). All the polymorphisms adhered to the Hardy–Weinberg expectations and the allele frequencies obtained were in good shown that neutrophils might be the primary source of ficolin-1 13,23 in the blood,21 thus we determined the level of neutrophil agreement with the allele frequencies observed before. As gelatinase-associated lipocalin (NGAL) and gelatinase, which previously reported, the promoter polymorphism at position 24,25 À 1981 and the polymorphism in position þ 7918 in exon 9 were reflects the pool of circulating neutrophils. No correlation 2 26 was observed with either NGAL or gelatinase (data not shown). near complete linkage disequilibrium (r ¼ 0.98, Po0.0001); the major allele from both polymorphisms segregated together in all individuals apart from one (Figure 3). Further, linkage disequili- Validation of the ficolin-1 plasma concentration brium, although to a lesser degree (r2 ¼ 0.71, Po0.001), was To ensure the validity of the newly established ficolin-1 ELISA, the observed for À 542 with À 144. Linkage disequilibrium between ficolin-1 concentration was determined in plasma samples from 21 any of the other polymorphisms was not observed. additional donors and the levels were compared with the concentrations obtained with a commercially available ficolin-1 ELISA kit (E90786Hu; Uscn Life Science Inc, Whhan, China). The FCN1 variation associated with the ficolin-1 plasma level median ficolin-1 concentration observed with the newly estab- We investigated the association of the FCN1 polymorphisms with lished ELISA in the 21 additional donors was 0.37 mgmlÀ 1 the ficolin-1 plasma concentration in the 100 blood donors. Two of compared with 0.27 mgmlÀ 1 in the purchased ELISA kit. Moreover, the polymorphisms in the promoter, FCN1 À 542 and À 144, were the ficolin-1 concentrations correlated significantly between the significantly associated with the level of ficolin-1 in EDTA plasma two methods (Spearman’s r ¼ 0.7532, P 0.0001) (data not o (P ¼ 0.0021 and 0.0057 (Kruskal–Wallis), respectively) (Figures 4a shown). When the samples were depleted for ficolin-2 as and b). Homozygosity for the minor allele in both FCN1 À 542 and described in our original report showing ficolin-1 in plasma,10 À 144, A/A and A/A, respectively, was associated with high levels which involved prolonged incubation of anti-ficolin-2 antibodies of ficolin-1. The level of ficolin-1 was higher in individuals with protein A beads, we observed a median concentration of homozygous for the major allele in both positions, for example, 0.09 mgmlÀ 1 using our new in-house assay and 0.07 mgmlÀ 1 for the haplotype À 542 A and À 144 A (n ¼ 36) when compared with the commercial assay (data not shown). those homozygous for the minor allele GC at both positions (n ¼ 11) (P ¼ 0.066 (Mann–Whitney)) (Figure 4c). In addition, Genotyping of the FCN1 association of ficolin-1 level with the low frequent polymorphism To establish whether polymorphisms in the FCN1 gene influences FCN1-791 (minor allele frequency pB ¼ 0.045) was observed (data the level of synthesis of ficolin-1, we genotyped 100 blood not shown). No significant association was seen with any of donors for the known polymorphisms at positions: FCN1 the other polymorphisms (FCN1 À 1981, À 271 and þ 7918, À 1981 (rs2989727), À 791 (rs28909068), À 542 (rs10120023), P40.1289) (data not shown).

Genes and Immunity (2012) 515 – 522 & 2012 Macmillan Publishers Limited FCN1 expression and disease L Munthe-Fog et al 517 Table 1. Polymorphisms and allele frequencies

Polymorphisma dbSNP ID Region Allele Blood donors SIRS/sepsis (A4B) n AA AB BB pB n AA AB BB pB (%) (%) (%) (%) (%) (%)

À 1981 rs2989727 Promoter A4G 100 39 42 19 0.400 238 43 42 15 0.360 À 791 rs28909068 Promoter A4G 100 92 7 1 0.045 251 86 14 0 0.070 À 542 rs10120023 Promoter G4A 100 45 43 12 0.335 251 59 31 10 0.250 À 271 rs28909976 Promoter 4insT 100 42 40 18 0.380 251 40 41 19 0.390 À 144 rs10117466 Promoter C4A 100 40 49 11 0.355 251 42 49 9 0.340 þ 7918 rs1071583 Exon 9 G4A 100 40 42 18 0.390 238 44 43 12 0.340 The genotype distribution in the blood donors all signiﬁcantly adhered to the Hardy–Weinberg expectations. aPosition relative to the ﬁrst ATG site.

(that is, A/A and A/A at both positions) at positions À 542 and À 144, respectively. From these individuals, monocytes were isolated and cultured for 2 days. The supernatant was harvested by adding EDTA to the culture and the amount of membrane released ficolin-1, and the secreted ficolin-1 was determined using the ficolin-1-specific ELISA. The level of ficolin-1 released to the culture supernatant was significantly associated with the À 542 and À 144 genotypes, as monocytes from individuals with the AA haplotype released significantly more ficolin-1 to the media compared with the release from monocytes isolated from individuals with the GC haplotype (P ¼ 0.0057 (Mann–Whitney)) (Figure 6).

Genotype distribution in patients with SIRS/sepsis Out of 251 patients with SIRS who were enrolled in this study, 64 patients had SIRS without infection, 26 fulfilled the criteria for sepsis, 94 for severe sepsis and 63 for septic shock. All the polymorphisms adhered to the Hardy–Weinberg expectations 2 Figure 3. Schematic illustration of FCN1, positions of the six except for FCN1 À 542 that deviated slightly (w ¼ 7.56, Po0.01). genotyped polymorphisms and linkage disequilibrium pattern (r2 The allele distribution of these two polymorphisms, À 791 and in percent) in 100 Caucasian blood donors. Bold numbers indicate À 542, in patients with SIRS/sepsis diverged significantly from the 2 Po0.0001. allele distribution in blood donors (w ¼ 8.42, P ¼ 0.004 and w2 ¼ 7.00, P ¼ 0.008, respectively) (Table 1). No dissimilarity in the allele frequency for À 1981, À 271, À 144 and þ 7918 was FCN1 expression in monocytes and granulocytes observed when comparing the SIRS/sepsis patients with the blood To assess the FCN1 expression, we isolated monocytes and donors nor was there any significant difference observed when granulocytes from the blood donors and extracted mRNA from comparing patients with SIRS, sepsis, severe sepsis and septic the cells. The promoter polymorphisms in positions À 542 and shock (P40.122). However, homozygosity for the minor FCN1 À 144 were significantly associated with the level of FCN1 À 542 A and À 144 A alleles was significantly associated with fatal expression in monocytes (P ¼ 0.0275 and 0.0131 (Kruskal–Wallis), outcome compared with patients heterozygous or homozygous respectively) (Figures 5a and b) and granulocytes (P ¼ 0.0003 and for the major alleles (G or C, respectively) (log rank: P ¼ 0.0395 and 0.0234 (Kruskal–Wallis), respectively) (Figure 5d and e). Homo- 0.0008, respectively) (Figures 7a and b) at the 360 days follow-up zygosity for the minor allele in both FCN1 À 542 and À 144, A/A period. Further, the significant association persisted when and A/A, respectively, leads to higher expression of FCN1 in assessing individual homozygous haplotype À 542 and À 144 monocytes and granulocytes as observed in plasma. When GC or AA (log rank: P ¼ 0.0024) (Figure 7c). Cox regression analysis assessing the combined haplotype, homozygosity for the minor showed that the increased mortality rate of the minor alleles was alleles at both positions leads to higher expression of FCN1 in both independent of sex and gender (P ¼ 0.0254, 0.0019 and 0.0066, monocytes and granulocytes when compared with the GC respectively). No association with fatal outcome was observed for haplotype (P ¼ 0.033 and 0.0188 (Mann–Whitney), respectively) the other polymorphisms at positions FCN1 À 1981, À 791, À 271 (Figure 5c and f). No significant association between the FCN1 and þ 7918 (P40.2325). Plasma was not eligible for this part of expression and polymorphisms at positions; À 1981, À 791, À 271 the study. and þ 7918 was observed (P40.0898) (data not shown). Prediction of putative transcription-factor-binding sites The impact of genetic variation on ficolin-1 synthesis in As both FCN1 À 542 and À 144 influences the level of the gene monocytes expression and synthesis of ficolin-1, we investigated the adjacent To investigate the influence of FCN1 polymorphisms on ficolin-1 sequences for known transcription-factor-binding motifs. Short release from monocytes, 53 staff members were screened for sequences (21 base pair) containing the polymorphisms were homozygosity on positions FCN À 542 and À 144. We attained 21 uploaded to Transcription Element Search System, a web tool for individuals distributed as followed: 16 individuals that were predicting transcription-factor-binding sites (www.cbil.upenn.edu/ homozygous for the haplotype GC (that is, G/G and C/C at both cgi-bin/tess/tess). The search revealed that the FCN1 À 542 A allele positions) and 5 individuals with the homozygote haplotype AA is located within the theoretically binding motif (AAATG) for YY1.

& 2012 Macmillan Publishers Limited Genes and Immunity (2012) 515 – 522 FCN1 expression and disease L Munthe-Fog et al 518

Figure 4. The level of ficolin-1 in EDTA plasma was significantly associated with the FCN1 À 542 (a) and À 144 (b) and their combined haplotype (c). The major allele in both positions, G and C, and the GC haplotype resulted in significant lower levels of ficolin-1 when compared with the ficolin-1 level in individuals homozygous for the minor allele. The statistics used for assessing the haplotypes were based on individual homozygous on both positions (number of individuals homozygous on both positions GC ¼ 36 and AA ¼ 11).

Figure 5. Real-time quantitative PCR of FCN1 expression in monocytes (upper panel) and granulocytes (lower panel) stratiﬁed according to the genotypes and haplotypes. The FCN1 expression in both monocytes and granulocytes was signiﬁcantly associated with FCN1 À 542 (a, d) and À 144 (b, e) and the combined haplotypes (c, f). The GC haplotype results in low gene expression, whereas the AA haplotype gives rise to higher levels of gene expression. The statistics used for assessing the haplotypes were based on individuals homozygous on both positions (number of individuals homozygous on both positions GC ¼ 36 and AA ¼ 11). Glyceraldehyde-3-phosphate-dehydrogenase was used as an internal standard.

YY1 is a transcription factor known to bind to core elements in the 0.06 mgmlÀ 1 in a small study comprising eight normal individuals promoter for the gene encoding granulocyte/macrophage colony- using an assay where ficolin-2 had to be depleted prior to the stimulating factor (GM-CSF), enhancing the gene expression.27 analysis due to a cross-reactive capture antibody.10 Using the same procedure, we depleted samples for ficolin-2 prior to ficolin- 1 assessment in both the new ficolin-1 assay and the commercial DISCUSSION one. We observed that the concentration of ficolin-1 was In this study, we established a specific quantitative ficolin-1 ELISA. approximately four-fold decreased compared with native plasma The normal range of ficolin-1 in EDTA plasma was found to be compatible with the concentrations observed in our original 0.01–1.89 mgmlÀ 1 with a median ficolin-1 concentration of article.10 However, when we depleted ficolin-2 using a modified 0.30 mgmlÀ 1. To validate the results, we correlated the ficolin-1 technique as reported here, no decrease was observed. Thus, the concentration in the new assay with the concentration measured concentrations of ficolin-1 described in the original report10 in a commercially available assay. The ficolin-1 levels measured in appears to be too low as some ficolin-1 may have been lost during both assays were almost identical and a highly significant the sample handling. It has recently been reported that the correlation was observed. Thus, it appears that the plasma median ficolin-1 concentration in serum in another group of ficolin-1 levels measured in the new assay are reliable. We healthy donors was 1.07 mgmlÀ 1 with a range 0.28–4.05 mgmlÀ 1 previously reported the median ficolin-1 concentration to be using a different assay.28 However, ficolin-1 may leak from

Genes and Immunity (2012) 515 – 522 & 2012 Macmillan Publishers Limited FCN1 expression and disease L Munthe-Fog et al 519 discrepancy between the obtained ficolin-1 measurements; thus, the actual free plasma concentration or fraction is difficult to ascertain at present. The plasma concentrations we observed were validated in two independent assays giving support to the view that the free ficolin-1 concentration in plasma is much lower than the levels observed for ficolin-2 and -3.14,30 Nevertheless, no internationally established standard of ficolin-1 exists that could be used to clarify the differences between the various studies, which therefore are urgently needed. It has been shown that the ficolin-1 plasma concentration may reflect the granulocyte count in the circulation in children with various forms of cancers.31 We did not measure the granulocyte count in our donors, but in order to circumvent this, we used the Figure 6. The ficolin-1 release from monocytes stratified according plasma concentration of NGAL and gelatinase as surrogate to the haplotypes. Isolated monocytes, from 21 genotyped staff markers for the granulocyte count, but found no correlation members, were cultivated for 2 days. The supernatant were harvested by adding EDTA to the media. Monocytes isolated from with the ficolin-1 concentration. The plasma concentration of NGAL and gelatinase has previously been shown to closely mirror individuals homozygous for the GC haplotype (n ¼ 16) released 24,25 significantly less ficolin-1 to the media than those homozygous for the granulocyte count in healthy adults. Thus, the inter- the AA haplotype (n ¼ 5). individual fluctuation in ficolin-1 concentrations in normal individuals may not within certain limits be dependent on the actual granulocyte count. We used the ficolin-1 assay to establish whether polymorphisms in the FCN1 gene could explain the variation in the plasma concentration of ficolin-1. Our results show that the major alleles of the two FCN1 polymorphisms at position À 542 (rs10120023) and À 144 (rs10117466) were significantly associated with low ficolin-1 levels, whereas the presence of the minor allele in both position was associated with high ficolin-1 concentration. These alleles are present in strong linkage disequilibrium (r2 ¼ 0.71) in healthy individuals. In another group of individuals, we determined the amount of ficolin-1 secreted and surface- released ficolin-1 in monocyte cultures harvested after 2 days and found the same association between the protein released and FCN1 polymorphisms as in plasma. Moreover, the FCN1 mRNA expression level was also associated with the same polymorphic variants. Only in the monocytes, a gene–dose-dependent association was observed, whereas this was not clearly apparent with the ficolin-1 plasma concentration and FCN1 expression profile from the granulocytes. The reason for this is unknown, but could indicate that different regulatory factors are dependent on the actual site of expression and synthesis. Taken together, these results show that the variation of ficolin-1 expression, synthesis and levels are associated with variation in the promoter region of FCN1. We cannot state firmly based on these observations that these polymorphisms are causal for the difference in the observed expression and synthesis of FCN1 and ficolin-1, respectively. They may be tagging polymorphisms in strong linkage disequilibrium with causal cis-acting variations. However, it is of notable interest that when we used in silico analysis we found that the minor À 542 allele was predicted to lie within the YY1 transcription-factor-binding site. Several YY1-binding sites have been identified in the promoter to the gene encoding GM-CSF, and YY1 has been shown to enhance gene expression.27 If this is true, the À 542 minor allele may facilitate YY1 binding, causing amplified gene expression. Similarly, the À 144 minor allele may discriminate binding to other unknown transcription factors. Thus, they may be considered as gain of function polymorphisms. It should be Figure 7. Influence of FCN1 genotypes on the 360-day survival noted that both of these polymorphisms are relatively rare in (time). In both positions À 542 (a) and À 144 (b), the minor allele Sub Saharan Africans and the Japanese population supporting was significantly associated with a fatal outcome (P ¼ 0.0395 and such a notion that they have gained momentum in the 0.0008, respectively), as was the combined haplotype for homo- Caucasian population due to selective advantages that have zygous individuals (GC ¼ 97 and AA ¼ 20), P ¼ 0.0024) (c). The increased the frequency.23 None of the other investigated increased risk was abolished by having one major allele only. polymorphisms were associated with significant FCN1 expression and ficolin-1 synthesis except that the low frequent damaged cells and has been shown to be released from the polymorphism at position À 791 (rs28909068) (minor allele monocytes and granulocytes in the presence of calcium chelators frequency pB ¼ 0.045) was weakly associated with the ficolin-1 like EDTA.19,29 These observations may account for the plasma level.

& 2012 Macmillan Publishers Limited Genes and Immunity (2012) 515 – 522 FCN1 expression and disease L Munthe-Fog et al 520 The primary ligand of ficolin-1 has been shown to be sialic acid, admitted to the academic, multidisciplinary intensive care unit at Glostrup which is present on different pathogens such as capsulated group University Hospital, in Copenhagen, Denmark, were eligible. The clinical B Streptococci.9,29 Nevertheless, the role of ficolin-1 in innate data have been described in detail.33,36 The study was prospective with a Mendelian randomization design. All the patients met the criteria for SIRS, immunity is an enigma because ficolin-1 is tethered to sialic acid 37 on living cell cells via its fibrinogen-like pattern recognition sepsis, severe sepsis or septic shock as outlined by Bone et al. domain.19 Sialic acid is typically present on the surface of normal cells.29 Moreover, ficolin-1 may to some degree activate the Sample preparation complement system via the lectin pathway.11,18,32 Thus, ficolin-1 Samples for plasma preparation were processed within 3 h and stored at appears to have the capacity to recognize both foreign and self À 80 1C. Separate glasses were used for cell isolation, DNA isolation and structures and mediate complement activation. plasma preparation. This puzzle stimulated us to investigate whether the FCN1 polymorphisms could be associated with development of the SIRS Ethics and sepsis as well as outcome. Our results show that the FCN1 The study was approved by the local ethics committee (record number polymorphisms could not be used as predictive markers for KA 96097). development of SIRS and sepsis in this well-defined historical 33 cohort of patients admitted to an intense care unit, but the rficolins frequency of the alleles at position À 791 and À 542 deviated rficolin-1 was produced as previously described for ficolin-2.3 Briefly, the slightly between patients and controls. Nevertheless, a robust FCN1 gene was amplified from liver cDNA and tagged-C-terminal with a significant association was observed between the À 542 and penta-His. This construct was cloned into an expression vector and À 144 minor alleles, as well as the minor À 542/ À 144 haplotype transfected into a Chinese hamster ovary cell line, DG44. Subsequently, and decreased survival, whereas no association was observed for ficolin-1 was purified from the cell supernatant on a Ni-NTA column the other investigated alleles. The association was independent of (Qiagen Nordic, West Sussex, UK). Using the same procedure, rficolin-2 was possible confounding factors such as age and gender. Previously also produced and used as specificity control. polymorphisms in the gene encoding mannose-binding lectin (MBL2) have been investigated in this cohort.33 Thus, we Generation of monoclonal anti-ficolin-1 antibodies investigated whether a synergistic effect between the MBL2 and Female NMRIxBalb/c F1-mice were immunized subcutaneously with 25 mg FCN1 systems might be apparent. However, no such interaction of rficolin-1 adsorbed to Al(OH)3 and mixed in 1:1 ratio with Freund’s was observed (data not shown). These observations clearly incomplete adjuvant. After three immunizations with 2-weeks interval, the designate ficolin-1 as an important molecule of innate immune mice received an intravenous injection with 25 mg of antigen administered defence and that variation in the FCN1 gene may contribute to the with adrenalin. After 4 days, the spleen was isolated and a single-cell suspension of spleen cells was prepared. Fusion was performed essentially inter-individual reaction to severe inflammation. The fact that the 38 FCN1 risk alleles are associated with increased synthesis of ficolin-1 as described by Reading. Ten days after fusion, supernatants from wells with cell growth were analyzed in ELISA with wells coated with rficolin-1. is challenging and suggests a dual role of the molecule conferring Positive wells were cloned by dilution. The clones were analyzed with both advantages and disadvantages in host defence. In this respect to cross-reactivity of the highly homologous ficolin-2 as previously regard, it is interesting that excessive activation of complement, described.14 Out of 20 positive clones, 4 clones did not also react with which takes place in SIRS and sepsis, has been shown to be rficolin-2 coated in ELISA wells. One of these clones, FCN165, was chosen associated with fatal outcome.34 Moreover, genetic-dependent to be used as capture antibody in a quantitative ficolin-1-specific ELISA. complement deficiency and depletion have been shown to be The antibody produced by the FCN165 clone was of the isotype IgG1 beneficial in animal models of complement-dependent inflamma- (IsoQuick kit, ISOQ25; Sigma Aldrich, Broendby, Denmark). tion.35 It may be assumed that ficolin-1 has both a direct antimicrobial role and a modulating effect on the inflammatory Ficolin-1-specific ELISA response, which in the case of severe inflammation may be a The ficolin-1-specific monoclonal antibody (FCN165) was coated at 1 mgmlÀ 1 disadvantage. Nevertheless, an observation made in a single in microtiter wells in phosphate-buffered saline (PBS) overnight at 4 1C. EDTA centre study should be interpreted with caution. Thus, to establish plasma samples (diluted 1:10) or culture supernatant (in a two-fold dilution the full effect ficolin-1 may have on severe inflammation, these serie) in PBS-T (PBS with 0.05% Tween-20 (15797-1; VWR International, Herlev, findings need to be replicated in other populations, as well as in Denmark)) containing 5 mM EDTA were incubated 3 h shaking followed by incubation overnight with rabbit-poly-clonal anti-human ficolin-1 (HP9039; settings with different microbial regimens and clinical surveillance À 1 regimes. Hycult Biotech) at a final concentration of 2 mgml diluted in PBS-T. Anti- rabbit-horseradish peroxidase (NA09340V, GE antibodies (GE Healthcare, In conclusion, we have shown that expression and synthesis Little Chalfont, UK)) was added and incubated for 2 h. Finally, the plated were of ficolin-1 is clearly associated with two polymorphisms in the developed with a substrate solution (3 o-phenylenediamine tablets in 12 ml promoter region of FCN1. The same polymorphisms were dH2O and 5 mlH2O3) and stopped by adding 50 ml1MH2SO4 and read at associated with decreased survival in a cohort of patient with optical density 490 nm. A serial dilution of supernatant from cultivated SIRS and sepsis. These results strongly suggest that ficolin-1 is an monocytes was used as calibrator. The concentration of the calibrator was important molecule in innate immune defence and may have a established by analysing dilutions of the culture supernatant in parallel with a central role in the effector functions mediated by granulocytes serial dilution of known concentrations of rficolin-1. and monocytes. In order to correlate the concentration in the new assay with an established assay, we purchased a commercial ficolin-1 ELISA kit (E90786Hu, Uscn Life Science Inc) and tested additional EDTA samples from 21 healthy donors. The commercial assay was used according to the MATERIALS AND METHODS manufacturer’s guidelines. Donor samples Peripheral venous blood samples drawn in EDTA-containing glass were Depletion of ficolin-2 in plasma samples obtained with informed consent from 121 unrelated adult Danish blood donors. Additionally, 53 blood heparin plasma samples were collected A total of 10 mg of the monoclonal anti-ficolin-2 FCN219 antibody was from unrelated healthy staff members. absorbed to 100 ml protein A sepharose beads (GE17-5138-02) overnight at 4 1C. The beads were washed trice in PBS-T and added to EDTA plasma samples diluted 1:10 in PBS-T in a total volume of 1 ml. Following sample Patients incubation for 3 h head-over-head, the beads were pelleted by centrifuga- From a previously well-described cohort of 271 patients, DNA from tion. Aliquots of the depleted samples were spiked with up to 1 mgmlÀ 1 251 patients unrelated Danes of Caucasian descent (range: 18–88 years) rficolin-2 and all aliquots were analyzed both in the ficolin-2 and -1 ELISA.

Genes and Immunity (2012) 515 – 522 & 2012 Macmillan Publishers Limited FCN1 expression and disease L Munthe-Fog et al 521 Table 2. Sequencing primers

Polymorphism Forward primer (50–30) Reverse primer (50–30)

À 791A4G CACACACAGTCGTCGAGAG CCTGAGGCCATGTTCCTAC À 542G4A GTCCACAGCGTGGCCTG GTCATCAGGCACTTATCATGG À 271insT and À 144C4A GCTGGGGAATGGAAAGGGG CTTGTGCCACAGTTTCTCAAC

Forward primers contain a 50 T7 sequence (5’-TAATACGACTCACTATAGGG-3’). The T7 sequencing primer was biotinylated at the 50-end.

Table 3. Minor groove binder (MGB)-TaqMan primer and probes

Polymorphism Forward primer (50–30) Reverse primer (50–30) Reporter (VIC/50–30) Reporter (FAM/50-30)

À 791A4G GCTACCATCTGACTCTCGTTAGTGA CACGCTGTGGACACTTTGTG TTTTAGAACGTATAGAAATAG AACGTACAGAAATAG À 542G4A ACTTCAATTTCTCCAGCTGTAACTTTCA ACTATTTCCATCATATCATCTTGCACCAG CTCCACCGAATGGG TCCACCAAATGGG À 2714insT TGTTCTCCTTAAGCCACAAGCA AGAGCTCCTGAGACTCCTCTG CTGGAAAGCATCGGCTT CTGGAAAGCTCGGCTT À 144C4A GGAGCCTAGTGGAAGGAAACAT CCTATGGGCTGCTTAGTTGCA CCTTTGAGATGACCTCATAC TTTGAGATGACATCATAC

In addition, we depleted and tested 21 EDTA samples for ficolin-2 Allelic discrimination using TaqMan genotyping assay 10 according to the method described by Honore´ et al. To each allele-specific reaction, 12.5 ml TaqMan Universal PCR Master Mix, 0.63 ml40Â TaqMan genotyping assay (C_2674032_10 (FCN1-1981)or Ficolin-2, NGAL and gelatinase ELISA C_1819018_1 (FCN1 þ 7918) (Applied Biosystem) and 20 ng genomic DNA diluted in 11.9 mldH O was added on a Termofast 96-wells 0.2 ml PCR plate Measurement of ficolin-2, NGAL and gelatinase was conducted as 2 14,24,25 (ABgene), which was heat sealed using Optical Caps (ABgene Thermo described. Briefly, EDTA plasma samples were applied to microtiter Scientific, Soeborg, Denmark). On each plate (running 44 samples), four wells coated with either anti-ficolin-2 antibody, rabbit-anti-NGAL or rabbit- controls were added; two no-template controls and two allelic controls anti-gelatinase, respectively. Following incubation, the wells were washed, containing either A or B allele. PCR was performed under the following and bound ficolin-2, NGAL or gelatinase was detected using biotinylated conditions: 10 min at 95 1C, 40 Â (15 s at 92 1C and 1 min at 60 1C). Results anti-ficolin-2 antibody, anti-NGAL or anti-gelatinase, respectively, and were analyzed on ABI PRISM 7700 Sequence Detector machine with the subsequently with horseradish peroxidase-conjugated streptavidin. The SDS software v1.9 (Applied Biosystem), using the allele discrimination plate plates were developed with substrate solution and the optical density read function to detect the end-point fluorescence in each well. value was determined at 490 nm. Allelic discrimination using minor groove binder probe assay Isolation of monocytes and granulocytes The patients were genotyped using TaqMan MGB probe assay (TaqMan Monocytes and granulocytes were isolated using EasySep (cat. no 18088 MGB assay, Applied Biosystems). To each allele-specific reaction (for primer and 18083, respectively; StemCell Technologies, Grenoble, France) on the and probe sequences see Table 3), 12.5 ml TaqMan Universal PCR Master RoboSep machine (cat. no 20000; StemCell Technologies). From the dry Mix, 0.6 ml40Â Custom Assay Mix and 20 ng genomic DNA diluted in cells, mRNA was obtained using the KingFisher technology (Thermo 11.9 mldH2O was added on a termofast 96-well 0.2 ml PCR plate that was Scientific, Soeborg, Denmark). Monocytes for cultivation were isolated sealed using optical caps (ABgene). Four controls were added on each from blood collected in heparin glasses obtained from staff members. The plate (running 44 samples): two no-template controls and two allelic monocytes were resuspended in 1 ml AIM-V (Invitrogen, Naerum, controls containing DNA with either A or B allele. PCR was performed Denmark) þ 10% fetal bovine serum containing l-glutamine, streptomycin under the following conditions: 10 min at 95 1C, 40 Â (15 s at 92 1C and sulphate, gentamicin sulphate (Invitrogen) and cultured in a concentration 6 1 min at 60 1C). Results were analyzed on ABI PRISM 7700 Sequence of 2 Â 10 cells per well in a total volume of 250 ml. The supernatant was Detection platform using the SDS software v1.9 (Applied Biosystem). harvested on day 2 by adding 10 mM EDTA to the wells 10 min prior to centrifugation. Identification of polymorphisms DNA preparation All the polymorphisms are registered in the NCBI’s dbSNP database by the accession numbers (rs) given in Table 1. Genomic DNA was prepared from each blood sample by automated DNA purification (Maxwell 16 System, AS1010; Promega, Stockholm, Sweden) according to the manufacturer’s guidelines. Real-time quantitative PCR FCN1 expression was determined using (Hs00157572_m1, Applied Bio- Sequencing systems) and glyceraldehyde-3-phosphate-dehydrogenase (Hs99999905_m1, Applied Biosystems) was used as an internal standard. In 20 ml volume, 0 Each sequence was PCR amplified using a single primer set with a 5 -T7 cDNA was added to TaqMan universal PCR master mix (Applied sequence (5’-TAATACGACTCACTATAGGG-3’) (Table 2). PCR amplifications Biosystems) containing TaqMan gene expression assay and amplification B were carried out in 12 ml volumes containing: 20 ng genomic DNA, (2 min at 50 1C, 10 min at 95 1C and 50 Â (15 s at 95 1C and 1 min at 60 1C)) 0.25 mM of each primer, 2.5 mM MgCl2, 0.2 mM dNTP, 50 mM KCl, 10 mM was conducted on ABI Prism 7700 sequence detector (Applied Biosystem). Tris–HCl, pH 8.4 and 0.4 U of Platinum Taq DNA polymerase (Invitrogen). Relative mRNA values were calculated using following formula: The PCR reactions were performed at the following cycling parameters: 1/(2DCt) Â 1000. 2 min at 94 1C, 35 Â (30 s at 94 1C, 60 s at 58 1C and 60 s at 72 1C) and 5 min at 72 1C. The PCR product was Sanger-sequenced using a biotinylated T7 primer (0.25 mM) with the ABI BigDye cycle sequencing terminator kit Statistical methods (Applied Biosystems, Naerum, Denmark). Sequence reactions were vacuum Hardy–Weinberg was analyzed using simple gene counting and the purified using Streptavidin Sepharose High Performance beads (17-5113- Chi-square test with Yates’ correction. The inferred haplotypes and LD, 01; GE Healthcare) and sequence analysis was performed on an ABI Prism expressed as r2 were estimated using the SNPAlyze program version 4.0 3100 Genetic Analyser (Applied Biosystems). The resulting DNA sequences (Dynacom, Yokohama, Japan) and the software platform SHEsis 39 Non- were aligned using BioEdit software (Ibis Biosciences, Carlsbad, CA, USA) parametric Kruskall–Wallis or Mann–Whitney for unpaired group compar- and DNA polymorphisms were confirmed visually from sequence ison was used to assess the genotypic impact on ficolin-1 levels and FCN1 electropherograms. expression, and Spearman’s rank was used when correlating plasma and

& 2012 Macmillan Publishers Limited Genes and Immunity (2012) 515 – 522 FCN1 expression and disease L Munthe-Fog et al 522 expression levels. Survival was estimated using the log-rank test and Cox 17 Teh C, Le Y, Lee SH, Lu J. M-ficolin is expressed on monocytes and is a lectin regression analyses to adjust for confounders and it was visualized with binding to N-acetyl-D-glucosamine and mediates monocyte adhesion and Kaplan–Meier curves. phagocytosis of Escherichia coli. Immunology 2000; 101: 225–232. 18 Liu Y, Endo Y, Iwaki D, Nakata M, Matsushita M, Wada I et al. Human M-ficolin is a secretory protein that activates the lectin complement pathway. J Immunol 2005; CONFLICT OF INTEREST 175: 3150–3156. 19 Honore C, Rørvig S, Hummelshøj T, Skjoedt MO, Borregaard N, Garred P et al. The authors declare no conflict of interest. Tethering of Ficolin-1 to cell surfaces through recognition of sialic acid by the fibrinogen-like domain. J Leukoc Biol 2010; 88: 145–158. 20 Endo Y, Sato Y, Matsushita M, Fujita T. Cloning and characterization of the human ACKNOWLEDGEMENTS lectin P35 gene and its related gene. Genomics 1996; 36: 515–521. We thank Ms Vibeke Witved and Sandra Færch for excellent technical assistance. This 21 Rorvig S, Honore C, Larsson LI, Ohlsson S, Pedersen CC, Jacobsen LC et al. Ficolin-1 work was supported by Rigshospitalet, The Novo Nordisk Research Foundation, Sven is present in a highly mobilizable subset of human neutrophil granules and Andersen Research Foundation and the Capital Region of Denmark. associates with the cell surface after stimulation with fMLP. J Leukoc Biol 2009; 86: 1439–1449. 22 Kakinuma Y, Endo Y, Takahashi M, Nakata M, Matsushita M, Takenoshita S et al. Molecular cloning and characterization of novel ficolins from Xenopus laevis. REFERENCES Immunogenetics 2003; 55: 29–37. 1 Endo Y, Matsushita M, Fujita T. The role of ficolins in the lectin pathway of innate 23 Hummelshoj T, Munthe-Fog L, Madsen HO, Garred P. Functional SNPs in the immunity. Int J Biochem Cell Biol 2011; 43: 705–712. human ficolin (FCN) genes reveal distinct geographical patterns. Mol Immunol 2 Garred P, Honore´ C, Ma YJ, Rørvig S, Cowland J, Borregaard N et al. The genetics of 2008; 45: 2508–2520. ficolins. J Innate Immun 2010; 2: 3–16. 24 Kjeldsen L, Bjerrum OW, Hovgaard D, Johnsen AH, Sehested M, Borregaard N et al. 3 Hummelshoj T, Thielens NM, Madsen HO, Arlaud GJ, Sim RB, Garred P et al. Human neutrophil gelatinase: a marker for circulating blood neutrophils. Molecular organization of human Ficolin-2. Mol Immunol 2007; 44: 401–411. Purification and quantitation by enzyme linked immunosorbent assay. Eur J 4 Sugimoto R, Yae Y, Akaiwa M, Kitajima S, Shibata Y, Sato H et al. Cloning and Haematol 1992; 49: 180–191. characterization of the Hakata antigen, a member of the ficolin/opsonin p35 25 Kjeldsen L, Koch C, Arnljots K, Borregaard N. Characterization of two ELISAs for lectin family. J Biol Chem 1998; 273: 20721–20727. NGAL, a newly described lipocalin in human neutrophils. J Immunol Methods 5 Ohashi T, Erickson HP. Oligomeric structure and tissue distribution of ficolins from 1996; 198: 155–164. mouse, pig and human. Arch Biochem Biophys 1998; 360: 223–232. 26 Vander Cruyssen B. et al. Polymorphisms in the ficolin 1 gene (FCN1) are 6 Kuraya M, Ming Z, Liu X, Matsushita M, Fujita T. Specific binding of L-ficolin and associated with susceptibility to the development of rheumatoid arthritis. H-ficolin to apoptotic cells leads to complement activation. Immunobiology 2005; Rheumatology (Oxford) 2007; 46: 1792–1795. 209: 689–697. 27 Ye J, Young HA, Ortaldo JR, Ghosh P. Identification of a DNA binding site for the 7 Jensen ML, Honore´ C, Hummelshøj T, Hansen BE, Madsen HO, Garred P et al. nuclear factor YY1 in the human GM-CSF core promoter. Nucleic Acids Res 1994; Ficolin-2 recognizes DNA and participates in the clearance of dying host cells. Mol 22: 5672–5678. Immunol 2007; 44: 856–865. 28 Wittenborn T, Thiel S, Jensen L, Nielsen HJ, Jensenius JC. Characteristics and 8 Honore C, Hummelshoj T, Hansen BE, Madsen HO, Eggleton P, Garred P et al. The biological variations of M-ficolin, a pattern recognition molecule, in plasma. innate immune component ficolin 3 (Hakata antigen) mediates the clearance of J Innate Immun 2010; 2: 167–180. late apoptotic cells. Arthritis Rheum 2007; 56: 1598–1607. 29 Kjaer TR, Hansen AG, Sørensen UB, Nielsen O, Thiel S, Jensenius JC et al. Inves- 9 Gout E, Garlatti V, Smith DF, Lacroix M, Dumestre-Pe´rard C, Lunardi T et al. Car- tigations on the pattern recognition molecule M-ficolin: quantitative aspects of bohydrate recognition properties of human ficolins: glycan array screening bacterial binding and leukocyte association. J Leukoc Biol 2011; 90: 425–437. reveals the sialic acid binding specificity of M-ficolin. J Biol Chem 2010; 285: 30 Munthe-Fog L, Hummelshøj T, Ma YJ, Hansen BE, Koch C, Madsen HO et al. 6612–6622. Characterization of a polymorphism in the coding sequence of FCN3 resulting in a 10 Honore C., Rørvig S, Munthe-Fog L, Hummelshøj T, Madsen HO, Borregaard N ficolin-3 (Hakata antigen) deficiency state. Mol Immunol 2008; 45: 2660–2666. et al. The innate pattern recognition molecule Ficolin-1 is secreted by monocytes/ 31 Schlapbach LJ, Thiel S, Aebi C, Hirt A, Leibundgut K, Jensenius JC et al. M-ficolin in macrophages and is circulating in human plasma. Mol Immunol 2008; 45: children with cancer. Immunobiology 2011; 216: 633–638. 2782–2789. 32 Frederiksen PD, Thiel S, Larsen CB, Jensenius JC. M-ficolin, an innate immune 11 Hummelshoj T, Fog LM, Madsen HO, Sim RB, Garred P. Comparative study of the defence molecule, binds patterns of acetyl groups and activates complement. human ficolins reveals unique features of Ficolin-3 (Hakata antigen). Mol Immunol Scand J Immunol 2005; 62: 462–473. 2008; 45: 1623–1632. 33 Garred P, Strom J, Quist L, Taaning E, Madsen HO. Association of mannose- 12 Kilpatrick DC, Fujita T, Matsushita M. P35, an opsonic lectin of the ficolin family, binding lectin polymorphisms with sepsis and fatal outcome, in patients with in human blood from neonates, normal adults, and recurrent miscarriage systemic inflammatory response syndrome. J Infect Dis 2003; 188: 1394–1403. patients. Immunol Lett 1999; 67: 109–112. 34 Kirschfink M. Controlling the complement system in inflammation. Immuno- 13 Hummelshoj T, Munthe-Fog L, Madsen HO, Fujita T, Matsushita M, Garred P et al. pharmacology 1997; 38: 51–62. Polymorphisms in the FCN2 gene determine serum variation and function of 35 Ward PA, Gao H. Sepsis, complement and the dysregulated inflammatory Ficolin-2. Hum Mol Genet 2005; 14: 1651–1658. response. J Cell Mol Med 2009; 13: 4154–4160. 14 Munthe-Fog L, Hummelshøj T, Hansen BE, Koch C, Madsen HO, Skjødt K et al. The 36 Kornblit B, Munthe-Fog L, Madsen HO, Strøm J, Vindeløv L, Garred P et al. impact of FCN2 polymorphisms and haplotypes on the Ficolin-2 serum levels. Association of HMGB1 polymorphisms with outcome in patients with systemic Scand J Immunol 2007; 65: 383–392. inflammatory response syndrome. Crit Care 2008; 12: R83. 15 Akaiwa M, Yae Y, Sugimoto R, Suzuki SO, Iwaki T, Izuhara K et al. Hakata antigen, a 37 Bone RC. Toward an epidemiology and natural history of SIRS (systemic inflam- new member of the ficolin/opsonin p35 family, is a novel human lectin secreted matory response syndrome). JAMA 1992; 268: 3452–3455. into bronchus/alveolus and bile. J Histochem Cytochem 1999; 47: 777–786. 38 Reading CL. Theory and methods for immunization in culture and monoclonal 16 Lu J, Le Y, Kon OL, Chan J, Lee SH. Biosynthesis of human ficolin, an Escherichia antibody production. J Immunol Methods 1982; 53: 261–291. coli-binding protein, by monocytes: comparison with the synthesis of two 39 Shi YY, He L. SHEsis, a powerful software platform for analyses of linkage dis- macrophage-specific proteins, C1q and the mannose receptor. Immunology 1996; equilibrium, haplotype construction, and genetic association at polymorphism 89: 289–294. loci. Cell Res 2005; 15: 97–98.

Genes and Immunity (2012) 515 – 522 & 2012 Macmillan Publishers Limited