Page 1 of 32 Diabetes
1 The hypothalamic neuropeptide 26RFa acts as an incretin to 2 regulate glucose homeostasis
3
4 Gaëtan Prévost,1,2,3,4 Lydie Jeandel,1,3,4 Arnaud Arabo,3,4 Moïse Coëffier,3,4,5,6 Mariama El 5 Ouahli,1,3,4,7 Marie Picot,1,3,4 David Alexandre,1,3,4 Françoise Gobet,3,4,8 Jérôme Leprince,1,3,4 6 Hind Berrahmoune,2,3,4 Pierre Déchelotte,3,4,5,6 Maria Malagon,9 Caroline Bonner,10 Julie 7 Kerr Conte,10 Fatiha Chigr7 Hervé Lefebvre,1,2,3,4 Youssef Anouar,1,3,4 and Nicolas 8 Chartrel1,3,4
9
10 1INSERM U982, Laboratory of Neuronal and Neuroendocrine Differentiation and 11 Communication, Institute for Research and Innovation in Biomedecine (IRIB), Mont Saint 12 Aignan, France. 13 2Department of Endocrinology, Diabetes and Metabolic Diseases, Institute for Research and 14 Innovation in Biomedecine (IRIB), University Hospital of Rouen, Rouen, France. 15 3Normandy University, Caen, France. 16 4University of Rouen, Rouen, France 17 5INSERM U1073, Institute for Research and Innovation in Biomedecine (IRIB), Rouen, 18 France. 19 6Department of Nutrition, University Hospital of Rouen, Rouen, France. 20 7Biological Engineering Laboratory, Life Sciences, Sultan Moulay Slimane University, Beni 21 Mellal, Morocco. 22 8Department of Pathology, University Hospital of Rouen, Rouen, France. 23 9Department of Cell Biology, Physiology, and Immunology, IMIBIC/Reina Sofia University 24 Hospital, University of Cordoba, Cordoba, Spain. 25 10INSERM U859, Biotherapies of Diabetes, Faculty of Medecine, University of Lille, Lille, 26 France. 27 28 29 Corresponding author: Dr Nicolas Chartrel, INSERM U982, Laboratory of Neuronal and 30 Neuroendocrine Differentiation and Communication, Institute for Research and Innovation in 31 Biomedecine (IRIB), University of Rouen, 76821 Mont Saint Aignan, France. 32 Phone: (33)235 14 6731; Fax: (33)23514 6946 33 e mail address: nicolas.chartrel@univ rouen.fr 34 35 Running title: 26RFa regulates glucose homeostasis 36 Word count: 3997
37 Number of figures: 6 38 Number of tables: 1
1
Diabetes Publish Ahead of Print, published online April 9, 2015 Diabetes Page 2 of 32
1 Abstract 2 26RFa is a hypothalamic neuropeptide that promotes food intake. 26RFa is up regulated in
3 obese animal models and its orexigenic activity is accentuated in rodent fed a high fat diet,
4 suggesting that this neuropeptide might play a role in the development and maintenance of the
5 obese status. As obesity is frequently associated with type 2 diabetes, we investigated whether
6 26RFa may be involved in the regulation of glucose homeostasis. In the present study, we
7 show a moderate positive correlation between plasma 26RFa levels and plasma insulin in
8 diabetic patients. Plasma 26RFa concentration also increases in response to an oral glucose
9 tolerance test. In addition, we found that 26RFa and its receptor GPR103 are present in human
10 pancreatic β cells as well as in the gut. In mice, 26RFa attenuates the hyperglycemia induced
11 by a glucose load, potentiates insulin sensitivity and increases plasma insulin concentrations.
12 Consistent with these data, 26RFa stimulates insulin production by MIN6 insulinoma cells.
13 Finally, we show, using in vivo and in vitro approaches, that a glucose load induces a massive
14 secretion of 26RFa by the small intestine. Altogether, the present data indicate that 26RFa
15 acts as an incretin to regulate glucose homeostasis.
16
17 Key words: 26RFa, incretin, glucose homeostasis, insulin, β cell, pancreatic islet, 18 gastrointestinal tract.
19
2
Page 3 of 32 Diabetes
1 Introduction 2 3 26RFa and its N extended form 43RFa (also referred to as QRFPs), are RFamide peptide
4 discovered in the brain of various vertebrate species and identified as the cognate ligands of
5 the human orphan G protein coupled receptor GPR103 (1 6). Neuroanatomical observations
6 revealed that 26RFa and GPR103 expressing neurons are primarily localized in
7 hypothalamic nuclei involved in the control of feeding behaviour (1, 2, 5, 7). Indeed, i.c.v.
8 administration of 26RFa or 43RFa stimulates food intake (1, 5, 8, 9), and the neuropeptide
9 exerts its orexigenic activity by modulating the NPY/POMC system in the arcuate nucleus
10 (9). Chronic injection of 43RFa induces a significant increase in mice body weight and fat
11 mass which is associated with a hyperphagic behaviour (8), and the orexigenic activities of
12 26RFa and 43RFa are more robust in rodents fed a high fat diet (8, 10). Consistent with these
13 observations, expression of prepro26RFa mRNA is up regulated in the hypothalamus of
14 genetically obese ob/ob and db/db mice, and rodents submitted to a high fat diet (5, 10).
15 Altogether, these observations support the notion that 26RFa could play a role in the
16 development and maintenance of the obese status.
17 Obesity is frequently associated with type II diabetes which is characterized by chronic
18 hyperglycemia induced by impaired insulin secretion and increased insulin resistance (11 13).
19 Accumulating evidence support the peripheral role of neuropeptides controlling feeding
20 behaviour such as neuropeptide Y (NPY), orexins, ghrelin, corticotropin releasing factor
21 (CRF) or apelin, in the regulation of glucose homeostasis (14 18), coining the new concept
22 that hypothalamic neuropeptides may serve as a link between energy and glucose
23 homeostasis, and identifying them therefore as potential therapeutic targets for the treatment
24 of diabetes and obesity (19, 20).
25 In the present study, we have investigated the possible involvement of 26RFa in the
26 regulation of glucose homeostasis. We notably show an increase in plasma 26RFa levels in
3
Diabetes Page 4 of 32
1 diabetic patients, and during an oral glucose tolerance test. We also found that 26RFa
2 attenuates glucose induced hyperglycemia, potentiates insulin sensitivity, increases plasma
3 insulin concentrations, and that a glucose challenge induces a massive secretion of 26RFa by
4 the gut.
5
6 Research Design and Methods
7 Patients
8 161 subjects were recruited in the Department of Endocrinology, Diabetes, and Metabolic
9 Diseases of the University Hospital of Rouen. Patients were divided into four groups
10 according to their weight and glucose tolerance. Obese patients (BMI>30), and type 1 and
11 type 2 diabetic patients (DT1, DT2) were defined according to the ADA criteria. Clinical
12 examination did not reveal any abnormalities. Healthy subjects (HS) underwent standard
13 endocrine tests to exclude any metabolic abnormalities. All of the subjects included in the
14 study gave a written informed consent according to our Ethical Committee instructions.
15
16 Metabolic parameters in human
17 Plasma 26RFa levels were measured using a specific radioimmunoassay (RIA) (21). Blood
18 glucose was measured using a glucose oxidase activity test (LX20 Beckman Coulter,
19 Villepinte, France). HbA1c was analysed by HPLC (G7 HPLC Analyzer, Tosoh, Lyon,
20 France). Plasma hormone levels were measured using the following assays: plasma insulin
21 (Elecys for automated insulin Assay COBAS 6000CE, Roche Diagnostics, Meylan, France),
22 GIP (Elisa assay, Millipore, St Charles, Missouri, USA), and GLP 1 (Elisa Epitope
23 Diagnostics, San Diego, CA USA). Plasma ghrelin was assayed using a commercial kit (#
24 EK 031 30, Phoenix, Belmont, Ca).
4
Page 5 of 32 Diabetes
1 Homeostasis Model Assessment of Insulin Resistance (HOMA IR index) was calculated as
2 the ratio [fasting glucose (mmol L 1) x fasting insulin (µU mL 1)] / 22.5 (22).
3
4 Oral glucose tolerance test in human
5 Nine healthy volunteers recruited for a previous study (23), one patient with gastroparesis,
6 and another one with a total gastrectomy, underwent a 75 g oral glucose tolerance test
7 (OGTT) after a 12 h fasting period. 26RFa, glucose, insulin, GIP, GLP 1 and ghrelin
8 concentrations were measured in fasting blood samples obtained at 0, 30, 60, 120, 150 and
9 180 min after oral glucose loading.
10
11 Immunohistochemical procedure
12 Deparaffinized sections (15 µm thick) of human and mouse tissues were used for
13 immunohistochemistry. All the tissue procurement protocols (for human) were approved by
14 the relevant institutional committees (University of Rouen) and were undertaken under
15 informed consent of each patient and all of the participants. Tissue sections were incubated
16 for 1 h at room temperature with either rabbit polyclonal antibodies against 26RFa (24)
17 diluted 1:400, or GPR103 (#NLS1922; Novus Biologicals, Littletown, CO) diluted 1:100, or
18 EM66 (25) diluted 1:200, or mouse monoclonal antibodies against insulin (Sigma Aldrich,
19 Saint Quentin Fallavier, France) diluted 1:1000. The sections were incubated with a
20 streptavidin biotin peroxydase complex (Dako Corporation, Carpinteria, CA), and the
21 enzymatic activity was revealed with diaminobenzidine. The slices were then counterstained
22 with hematoxylin. Observations were made under a Nikon E 600 light microscope.
23
24 Blood glucose and insulin measurements in mice
25 For i.p. glucose tolerance test and glucose stimulated insulin secretion assay, mice ( male
5
Diabetes Page 6 of 32
1 C57BL/6, 20 23 g) were fasted for 16 h with free access to water and then injected i.p. with
2 glucose (2 g/kg) and 26RFa (500 g/kg) or PBS solution. For measurements of basal
3 glycemia, mice were fed ad libidum and injected i.p. with 26RFa (500 g/kg) or PBS solution.
4 Blood plasma glucose concentrations were measured from tail vein samplings at various times
5 using an AccuChek Performa glucometer (Roche Diagnostic, Saint Egreve, France). Plasma
6 insulin concentrations were determined using an ultrasensitive mouse insulin ELISA kit
7 (Mercodia, Uppsala, Sweden). For insulin tolerance test, mice were fasted for 6 h and injected
8 i.p. with 0.75 units/kg body weight of human insulin (Eli Lilly, Neuilly sur Seine, France)
9 and 26RFa (500 g/kg) or PBS. For i.v. glucose tolerance test, mice were catheterized in the
10 tail vein under anesthesia, 24 h prior to the test. For oral and i.v. glucose tolerance test, mice
11 were fasted for 16 h before the test with free access to water. Plasma samples were obtained
12 from decapitation 30 or 120 min after a 2 g/kg oral glucose load or 3 or 30 min after a 1 g/kg
13 i.v. glucose load and assayed for 26RFa.
14
15 Insulin secretion by MIN6 cells
16 Mouse insulinoma cells (MIN6), a kind gift from Dr J. Miyazaki (26), were grown in DMEM
17 containing 25 mM glucose and supplemented with 15% heat inactivated fetal bovine serum in
18 a humidified atmosphere of 5% CO2, 95% air at 37° C. Before the experiments, the culture
19 medium was removed and MIN6 cells (3x105 cells/well) were preincubated in a Krebs Ringer
20 bicarbonate buffer containing 0.2% BSA and 2.8 mM glucose (low glucose, LG) for 1 h at
21 37° C (period P1) to evaluate basal insulin secretion. The culture medium was then removed
22 and replaced by the same culture medium (LG) or a culture medium with 16.7 mM of glucose
23 (high glucose, HG) added or not with 26RFa and the GLP 1 analogue exenatide (10 6 M each)
24 for 1 h (period P2). Insulin secretion in each well was expressed as the ratio between secretion
25 during the P2 period/secretion during the P1 period.
6
Page 7 of 32 Diabetes
1
2 Quantitative PCR
3 Total RNA from mice various tissues and MIN6 cells was isolated as previously described
4 (27). Relative expression of the 26RFa, GPR103, NPFF2 receptor (NPFF2), insulin receptor
5 (INS R), GLUT 2 and GLUT 4 genes was quantified by real time PCR with appropriate
6 primers (Table I). GAPDH or β actin were used as internal controls for normalization. PCR
7 was carried out using Gene Expression Master Mix 2X assay (Applied Biosystems,
8 Courtaboeuf, France) in an ABI Prism 7900 HT Fast Real time PCR System (Applied
9 Biosystems). The purity of the PCR products was assessed by dissociation curves. The
10 amount of target cDNA was calculated by the comparative threshold (Ct) method and
11 expressed by means of the 2 ∆∆Ct method.
12
13 Small Interfering RNA
14 Mouse Qrfpr Silencer Select Predesigned siRNA (SC 60730) (GPR103 siRNA(m)) and
15 Silencer Negative Control siRNA (SC 37007) were purchased from Santa Cruz
16 Biotechnology (Dallas, TX), and AMAXA cell line nucleofector KIT V was purchased from
17 LonZa (Basel, Switzerland). Mouse insulinoma cells (MIN6) were transfected with 10 µM
18 control or GPR103 small interfering RNAs (siRNAs) using AMAXA cell line nucleofector
19 KIT V, according to the manufacturer's instructions. 48 h after transfection, cells were
20 submitted to Q PCR and insulin secretion experiments. Efficiency of transfection was
21 assessed by RT PCR.
22
23 Expression and secretion of 26RFa by intestine fragments
24 Three consecutive mice samples of duodenum, proximal jejunum and ileum were collected.
25 For each intestinal segment, one sample was immediately frozen in liquid nitrogen for Q PCR
7
Diabetes Page 8 of 32
1 experiments and two samples were mounted in Ussing chambers with an exchange surface of
2 0.07 cm2, as previously described (28). Glucose free DMEM (1 ml) was applied at the apical
3 and serosal sides of the intestinal segments. At the apical side, DMEM supplemented with
4 either glucose 2.8 mM or 16.7 mM was applied. At the serosal side, only DMEM with
5 glucose 3 mM was applied. After 3h at 37°C, media from apical and serosal sides were
6 collected and assayed for 26RFa.
7
8 Statistical analysis
9 Statistical analysis was performed with Statistica (5th version). A student t test or ANOVA for
10 repeated measures were used for comparisons between two groups. A post hoc comparison
11 using Tukey HSD was applied according to ANOVA results. Statistical significance was set
12 up at p < 0.05.
13
14 Results
15 Fasting plasma 26RFa levels in obese and diabetic patients
16 The phenotypic characteristics of the 4 groups of subjects studied are reported in figure 1A.
17 Circulating levels of 26RFa in fasting condition was significantly enhanced in obese patients
18 (466 ± 37 pg/ml) and DT2 subjects (488 ± 48 pg/ml) vs HS (338 ± 42 pg/ml; p<0.05) (Fig.
19 1B). DT1 patients showed plasma 26RFa levels (494 ± 68 pg/ml) similar to those of DT2
20 subjects (Fig. 1B). No correlation was found between plasma 26RFa levels and age, BMI,
21 waist circumference and fasting blood glucose. Conversely, a moderate positive correlation
22 was found between circulating 26RFa and fasting plasma insulin (r=0.37, p=0.0015) (Fig.
23 1C), and the insulin resistance marker HOMA IR (r=0.54, p<0.0001) (Fig. 1D).
24
25 Oral glucose tolerance test in human
8
Page 9 of 32 Diabetes
1 An oral glucose tolerance test (OGTT) with 75 g glucose was performed in 9 healthy
2 volunteers. Blood glucose and insulin as well as GLP 1 and GIP showed a rapid elevation 30
3 min after the glucose load (Fig. 2A, B). By contrast, plasma 26RFa levels were stable during
4 the first 90 min of the test but increased significantly 120 min after the glucose load (p<0.01,
5 Fig. 2A, B). The amplitude of the rises was much higher for GLP 1 (423 ± 57 %) and GIP
6 (887 ± 229 %) than for 26RFa (182 ± 23 %) (Fig. 2B). Ghrelin showed a plasma profile
7 totally different from that of 26RFa with a rapid decline at 30 min and then levels remained
8 stable until the end of the test (Fig. 2B). In the patient with gastroparesis, the 26RFa peak was
9 delayed as compared to the HS group (210 min vs 120 min) (Fig. 2C). Conversely, in the
10 gastrectomized patient, the 26RFa rise occurred earlier than in the healthy volunteers (90 min
11 vs 120 min) (Fig. 2D).
12
13 Localization of 26RFa and GPR103 in the human pancreas and gastrointestinal tract
14 Treatment of human pancreas sections with the 26RFa and GPR103 antibodies revealed that
15 the neuropeptide and its receptor were specifically localized in the endocrine islets and were
16 present within the same islets (Fig. 3A, B). Treatment of consecutive sections with the 26RFa
17 or GPR103 antibodies, and the insulin antibodies revealed that the histological distribution of
18 26RFa and GPR103 like immunoreactivity (LI) was similar to that of insulin (Fig. 3C F).
19 26RFa LI was also investigated in the human gut. In the antral part of the stomach, numerous
20 epithelial cells of the gastric glands were labeled with the 26RFa antibodies (Fig. 3G). In the
21 duodenum, 26RFa LI was detected in most of the enterocytes and goblet cells (Fig. 3H). In
22 the ileum and the colon, the distribution of 26RFa LI was very similar to that observed in the
23 duodenum although the number of 26RFa labeled cells was much lower than in the duodenum
24 (Fig. 3I, J).
25
9
Diabetes Page 10 of 32
1 Effect of 26RFa on glucose homeostasis in mice
2 An IPGTT, performed in mice, revealed that 26RFa significantly attenuated (p<0.01 and
3 p<0.001) the hyperglycemia induced by an i.p. glucose challenge all throughout the duration
4 of the test (Fig. 4A). Concurrently, during an insulin tolerance test, 26RFa significantly
5 potentiated (p<0.05 and p<0.01) insulin induced hypoglycemia between 30 min and 60 min
6 after the insulin challenge (Fig. 4B). By contrast, 26RFa did not affect basal plasma glucose
7 levels during the 90 min period of the test (Fig. 4C). Finally, an acute glucose stimulated
8 insulin secretion test revealed that i.p. injection of 26RFa significantly stimulated (p<0.05 and
9 p<0.001) glucose induced insulin production (Fig. 4D).
10
11 Effect of 26RFa on insulin secretion by MIN6 cells
12 We, then, searched for an eventual direct effect of 26RFa on β cell insulin secretion. For this,
13 we used the mouse insulinoma cell line, MIN6. Q PCR experiments indicated that MIN6 cells
14 expressed both 26RFa and GPR103 mRNA but not NPFF2, the other RFamide receptor that
15 26RFa can bind to, whatever the glucose concentration applied in the culture medium (Fig.
16 5A). GPR103, 26RFa, INS R and GLUT 2 were also expressed in cells transfected with non
17 silencing siRNA (Fig. 5B). Transfection of the cells with siRNA to GPR103 resulted in a total
18 loss of GPR103 expression whereas the expression of the other genes was not altered (Fig.
19 5B). Both 26RFa and exenatide (10 6 M each) induced a highly significant increase of insulin
20 release by siControl cells cultured in a LG medium. Incubation of the cells in a HG medium
21 resulted also in a significant increase of insulin secretion (Fig. 5C). Addition of 26RFa in this
22 latter condition of cell culture did not alter insulin production whereas exenatide strongly
23 stimulated insulin secretion (Fig. 5C). No additive effects of 26RFa and exenatide was
24 observed in both LG and HG condition (Fig. 5C). Invalidation of GPR103 expression resulted
25 in a total loss of 26RFa induced insulin secretion whereas the stimulatory effect of exenatide 10
Page 11 of 32 Diabetes
1 in both LG and HG medium was maintained (Fig. 5D). Addition of 26RFa to exenatide did
2 not significantly alter exenatide induced insulin secretion (Fig. 5D).
3
4 Expression of GPR103 in mice insulin-sensitive tissues
5 Q PCR realized in insulin target tissues revealed that GPR103 mRNA was expressed in the
6 striated muscle, the liver and the adipose tissue, with higher levels in the liver (p<0.001; Fig.
7 5E). Expression of the insulin receptor (INS R) and the glucose transporter GLUT 4 was also
8 investigated in the same tissues. Expression of INS R was significantly higher (p<0.001) in
9 the liver as compared to the muscle and the adipose tissue (Fig. 5E). Expression of GLUT 4
10 was not detected in the liver and was much lower (p<0.001) in the adipose tissue as compared
11 to the muscle (Fig. 5E).
12
13 Effect of glucose on 26RFa secretion by the mouse gastrointestinal tract
14 We finally investigated whether glucose could induce 26RFa release from the gut in mice. As
15 illustrated in figure 6A, 26RFa mRNA was actually expressed in the duodenum, jejunum and
16 ileum of the mouse, with higher levels in the duodenum (p<0.05; Fig. 6A). Concurrently,
17 immunohistochemical experiments revealed the presence of intensely 26RFa labeled cells in
18 the mouse upper and lower intestine (Fig. 6B). In the duodenum, scattered positive cells were
19 found in the epithelium (Fig. 6B1). In the ileum, the localization of clusters of 26RFa positive
20 cells suggested that these cells may correspond to paneth cells (Fig. 6B2). Treatment of
21 consecutive jejunum sections with either the 26RFa antibodies or the EM66 (a fragment of the
22 chromogranin, secretogranin II) antibodies revealed that the two antibodies label the same
23 cells (Fig. 6B3 and 4), indicating that the 26RFa containing cells probably correspond to
24 neuroendocrine cells. Oral administration of glucose induced a highly significant increase
11
Diabetes Page 12 of 32
1 (p<0.001) in plasma 26RFa levels 30 min after the glucose challenge that corresponded to the
2 plasma glucose peak (Fig. 6C). By contrast, i.v. administration of glucose did not significantly
3 alter plasma 26RFa levels all along the test (Fig. 6D). We also used a model of Ussing
4 chambers in which we exposed the luminal (apical) side of intestine fragments to LG or HG
5 concentrations, and we measured 26RFa levels in both the apical and basal sides of the
6 intestine fragments. Duodenal fragments exposed to HG released massive amounts (p<0.01)
7 of 26RFa in the basal chamber as compared to duodenum slices exposed to LG (Fig. 6E). In
8 contrast, we did not observe any alteration of 26RFa flows in jejunum and ileum fragments
9 treated with LG vs HG (Fig. 6E).
10
11 Discussion
12 Incretins are peptides released by the gut after ingestion of glucose or nutrients that act
13 directly on pancreatic β cells to stimulate insulin secretion and lower plasma glucose. Until
14 now, two incretins had been identified, i.e. glucose dependent insulinotropic polypeptide
15 (GIP) and glucagon like peptide 1 (GLP 1) (29). Here, we provide evidence that 26RFa, a
16 neuropeptide of 26 amino acids, initially discovered as an orexigenic molecule in the
17 hypothalamus (1), is produced in abundance in the gut and acts as an incretin hormone.
18 We first investigated plasma 26RFa levels in obese patients with or without type 2
19 diabetes. The two groups show higher concentrations of circulating 26RFa as compared to
20 healthy subjects. This finding is consistent with previous data obtained in obese animal
21 models showing an up regulation of the 26RFa system in genetically obese mice and rats fed
22 a high fat diet (5, 8, 10), and suggests that, in human as in rodents, up regulation of the 26RFa
23 system may play a role in the development and maintenance of the obese status. However,
24 high plasma 26RFa levels were also detected in patients with type 1 diabetes that were not
25 obese. Correlation analysis revealed a moderate, but significant, positive correlation between
12
Page 13 of 32 Diabetes
1 plasma 26RFa and plasma insulin, and the insulin resistance marker HOMA IR. Altogether,
2 these observations suggested a possible link between the 26RFa system and glucose
3 homeostasis. We thus examined the evolution of plasma 26RFa levels during an OGTT in
4 healthy subjects. Our data reveal a significant increase in plasma 26RFa during the test,
5 indicating that an oral glucose load influences the concentrations of circulating 26RFa.
6 Comparison of the plasma 26RFa profile with those of GIP and GLP 1 during the OGTT
7 reveals that the 26RFa response to glucose challenge is delayed as compared to those of the
8 two incretins, and that the amplitude of the 26RFa peak is much lower than those of GIP and
9 GLP 1. This suggests that the mechanism of action of 26RFa to regulate glucose homeostasis
10 is different from those of GIP and GLP 1 in human.
11 Immunohistochemical examination of human pancreatic slices indicates that 26RFa and its
12 receptor are present in endocrine islets but virtually absent in the exocrine pancreas. Our data
13 also show that 26RFa and GPR103 are expressed by the insulin producing β cells, suggesting
14 an effect of the neuropeptide on β cell activity. Consistent with this hypothesis, a recent study
15 reports that 26RFa and GPR103 are expressed in the pancreatic islets, and that 26RFa and its
16 N extended form, 43RFa, prevent β cell death and apoptosis (30). The present study shows
17 that 26RFa and its receptor are present in the same pancreatic islets, indicating that 26RFa
18 may regulate β cell activity via an autocrine mechanism.
19 26RFa is a neuropeptide initially known to be produced by hypothalamic neurons (1, 4, 5)
20 that cannot be responsible for the robust concentrations of the peptide detected in the blood
21 (present data, 22). The observation that oral glucose load results in an increase of plasma
22 26RFa, as observed for incretins, suggested that the gastrointestinal tract may produce 26RFa.
23 Indeed, our immunohistochemical investigations reveal that 26RFa is produced in abundance
24 in the stomach and small intestine and in lower amounts in the colon, indicating that the gut is
25 probably an important source of circulating 26RFa.
13
Diabetes Page 14 of 32
1 We thus carried out several experiments in mice which revealed first that i.p.
2 administration of 26RFa during a glucose tolerance test significantly attenuates glucose
3 induced hyperglycemia. In contrast, the neuropeptide does not affect glucose basal levels,
4 suggesting that 26RFa exerts rather an anti hyperglycemic effect than a hypoglycemic effect.
5 Concurrently, we show that 26RFa enhances insulin sensitivity during an insulin tolerance
6 test, and increases insulin production during an acute glucose stimulated insulin secretion test,
7 indicating that the anti hyperglycemic action of the neuropeptide is probably the result of both
8 increased insulin sensitivity in target tissues and stimulation of insulin production. In
9 agreement with this latter hypothesis, we found that 26RFa stimulates insulin secretion by the
10 MIN6 mouse insulinoma cell line which expresses GPR103, and that invalidation of GPR103
11 totally abolishes 26RFa induced insulin release. In addition, we show that NPFF2, the other
12 RFamide receptor that 26RFa and 43RFa can bind to (6), is not expressed by MIN6 cells.
13 Altogether, these findings indicate that 26RFa is able to stimulate insulin release by insulin
14 secreting cells via the activation of GPR103. Consistent with this finding, it has been recently
15 reported that 43RFa, the N extended form of 26RFa, stimulates insulin secretion by human
16 pancreatic islets and INS 1E β cells, and that this effect is exerted via GPR103 (30). However,
17 in the same study, the authors report that 26RFa inhibits insulin secretion via a distinct
18 signaling pathway than GPR103, an observation previously made in rat perfused pancreas
19 (31), and suggest that NPFF2 may mediate the insulinostatic activity of 26RFa. Here, we
20 show that MIN6 cells do not express NPFF2 that might explain the discrepancy between our
21 data and those found in INS 1 cells. However, at present, it is not known whether INS 1 cells
22 or human pancreatic islets express NPFF2 and the effects of activation of NPFF2 on insulin
23 secretion remain unknown as well.
24 The increased insulin sensitivity induced by 26RFa led us to investigate the expression of
25 the 26RFa receptor in insulin target tissues. We found that GPR103 is co expressed with the
14
Page 15 of 32 Diabetes
1 insulin receptor and the glucose transporter, GLUT 4, in the muscle, liver and adipose tissue,
2 with a higher expression in the liver, suggesting that 26RFa may play a role in glucose uptake,
3 a hypothesis that awaits further study. Interestingly, in a previous study, GPR103 has also
4 been detected in epididymal fat pads and shown to be elevated by 16 fold in high fat mice
5 (32). In addition, these authors showed, using 3T3 L1 adipocyte cells, that 26RFa elicits a
6 dose dependent increase in fatty acid uptake and increases the expression of genes involved
7 in lipid uptake as well as triglyceride accumulation (32).
8 One main feature of incretins is to be released by the gut under an oral glucose challenge
9 (33). We thus investigated the possibility that 26RFa may be released by the gut after glucose
10 ingestion in mice. We confirmed the presence of 26RFa in the gut, with a higher expression of
11 the neuropeptide in the duodenum as previously observed in human (present study). We found
12 that an oral glucose load results in a massive increase in plasma 26RFa levels 30 min after
13 glucose ingestion and that, conversely, i.v. administration of glucose does not affect plasma
14 26RFa. Consistent with this finding, we show that application of high glucose concentrations
15 at the apical side of duodenal fragments induces an important release of 26RFa at the serosal
16 side of the duodenal slices, indicating that glucose ingestion induces an important secretion of
17 26RFa from the duodenum to the blood. Supporting this view, we show that, in a human
18 patient with delayed gastric emptying, the rise in plasma 26RFa levels during an OGTT is
19 delayed by 90 min as compared to healthy subjects. Conversely, in a patient who underwent a
20 total gastrectomy, the 26RFa peak occurs earlier at 90 min.
21 The present study provides evidence that 26RFa meets the criteria of an incretin hormone.
22 However, 26RFa also shows differences with GIP and GLP 1. For instance, during an OGTT
23 in human, the 26RFa response to the oral glucose load is delayed as compared to the GIP and
24 GLP 1 peaks that overlap with those of glucose and insulin. At present, the physiological
25 relevance of this delayed 26RFa response in human remains unclear. One hypothesis could be
15
Diabetes Page 16 of 32
1 that the aim of the delayed 26RFa increase is to sustain the GIP and GLP 1 insulinotropic
2 action that, however, deserves further investigation.
3 In conclusion, we report for the first time that obesity and diabetes in human are associated
4 with elevated plasma levels of the orexigenic neuropeptide 26RFa. We also show that 26RFa
5 produced by the gut is released in the blood after a glucose challenge and reduces glucose
6 induced hyperglycemia via, at least in part, a direct stimulatory effect on insulin secretion by
7 pancreatic β cells. Taken together, these findings strongly suggest that 26RFa is a novel
8 incretin that regulates glucose homeostasis.
9
10 Acknowledgments. We are indebted to H. Lemonnier for technical assistance.
11
12 Fundings. This work was supported by INSERM (U982), the University of Rouen, the
13 Institute for Research and Innovation in Biomedecine (IRIB), the Plateforme Régionale de
14 Recherche en Imagerie Cellulaire de Haute Normandie (PRIMACEN) and the Conseil
15 Régional de Haute Normandie.
16
17 Conflict of interest statement. The authors declare that there is no conflict of
18 interest that could be perceived as prejudicing the impartiality of the research reported.
19
20 Author Contributions. G.P., H.L., Y.A. and N.C. contributed to the study design
21 and interpretation and wrote the manuscript. L.J., A.A., M.C., and J.L. contributed to the in
22 vivo experiments on mice. L.J., M.O., M.M., C.B. and J. KC. Contributed to the in vitro
23 experiments on cell lines. M.P. and F.G. contributed to the immunohistochemical
16
Page 17 of 32 Diabetes
1 experiments. G.P., H.B. and H.L. contributed to the recruitment of the human cohort and to
2 the studies on this cohort. G.P., F.C., P.D. and H.L. critically revised the manuscript and
3 helped to the analysis of the data, and with the discussion. N.C. is the guarantor of this work
4 and, as such, had full access to all the data in the study and takes responsibility for the
5 integrity of the data and the accuracy of the data analysis.
6 7 References 8 9 1. Chartrel N, et al. Identification of 26RFa, a hypothalamic neuropeptide of the RFamide
10 peptide family with orexigenic activity. Proc Natl Acad Sci USA 2003;100:15247 15252.
11 2. Fukusumi S, et al. A new peptidic ligand and its receptor regulating adrenal function in
12 rats. J Biol Chem 2003;278:46387 46395.
13 3. Jiang Y, et al. Identification and characterization of a novel RF amide peptide ligand for
14 orphan G protein coupled receptor SP9155. J Biol Chem 2003;278:27652 27657.
15 4. Bruzzone F, et al. Anatomical distribution and biochemical characterization of the novel
16 RFamide peptide, 26RFa, in the human hypothalamus and spinal cord. J Neurochem
17 2006;99:616 627.
18 5. Takayasu S, et al. A neuropeptide ligand of the G protein coupled receptor GPR103
19 regulates feeding, behavioral arousal, and blood pressure in mice. Proc Natl Acad Sci USA
20 2006;103:7438 7443.
21 6. Chartrel N, et al. The RFamide neuropeptide 26RFa and its role in the control of
22 neuroendrine functions. Front Neuroendocrinol 2011;32:387 397.
23 7. Bruzzone F, et al. Distribution of 26RFa binding sites and GPR103 mRNA in the central
24 nervous system of the rat. J Comp Neurol 2007;503:573 591.
25 8. Moriya R, et al. RFamide peptide QRFP43 causes obesity with hyperphagia and reduced
26 thermogenesis in mice. Endocrinology 2006;147:2916 2922.
17
Diabetes Page 18 of 32
1 9. Lectez B, et al. The orexigenic activity of the hypothalamic neuropeptide 26RFa is
2 mediated by the neuropeptide Y and proopiomelanocortin neurons of the arcuate nucleus.
3 Endocrinology 2009;150:2342 2350.
4 10. Primeaux SD, et al. Central administration of the RFamide peptides, QRFP 26 and QRFP
5 43, increases high fat food intake in rats. Peptides 2008;29:1994 2000.
6 11. Kahn SE. The relative contribution of insulin resistance and β cell dysfunction to the
7 pathophysiology of type 2 diabetes. Diabetologia 2003;46:3 19.
8 12. Prentki M, Nolan CJ. Islet β cell failure in type 2 diabetes. J Clin Invest 2006;116:1802
9 1812.
10 13. Ferrannini E, Mari A. β Cell function in type 2 diabetes. Metabolism 2014;63:1217 1227.
11 14. Imai Yet al. Insulin secretion is increased in pancreatic islets of neuropeptide Y deficient
12 mice. Endocrinology 2007;148:5716 5723.
13 15. Ouedraogo R, Näslund E, Kirchgessner. Glucose regulates the release of orexin A from the
14 endocrine pancreas. Diabetes 2003;52:111 117.
15 16. Verhulst PJ, Depoortere I. Ghrelin’s second life: from appetite stimulator to glucose
16 regulator. World J Gastroenterol 2012;18:3183 3195.
17 17. Huising MO, et al. CRFR1 is expressed on pancreatic β cells, promotes β cell proliferation,
18 and potentiates insulin secretion in a glucose dependent manner. Proc Natl Acad Sci USA
19 2010;107:912 917.
20 18. Yue P, et al. Apelin is necessary for the maintenance of insulin sensitivity. Am J Physiol
21 Endocrinol Metab 2010;298:E1161 E1169.
22 19. Prodi E, Obici S. The brain as a molecular target for diabetic therapy. Endocrinology
23 2006;147:2664 2669.
24 20. Schwartz MW, et al. Cooperation between brain and islet in glucose homeostasis and
25 diabetes. Nature 2013;503:59 66.
18
Page 19 of 32 Diabetes
1 21. Galusca B, et al. Plasma levels of the orexigenic neuropeptide 26RFa in two populations
2 with low body weight: constitutional thinness and anorexia nervosa. Influence of
3 bingeing/purging episodes. J Clin Endocrinol Metab 2012;97:2012 2018.
4 22. Matthiews DR, et al. Homeostasis model assessment: insulin resistance and beta cell
5 function from fasting plasma glucose and insulin concentrations in man. Diabetologia
6 1985;28:412 419.
7 23. Prévost G, et al. Glucose induced incretin hormone release and insulin sensitivity are
8 impaired in patients with idiopathic gastroparesis: results from a pilot descriptive study.
9 Neurogastroenterol Motil 2013;25:694 699.
10 24. Alonzeau J, et al. The neuropeptide 26RFa is expressed in human prostate cancer and
11 stimulates the neuroendocrine differentiation and the migration of androgeno independent
12 prostate cancer cells. Eur J Cancer 2013;49:511 519.
13 25. Anouar Y, et al. Identification of a novel secretogranin II derived peptide (SgII(187 252))
14 in adult and fetal human adrenal glands using antibodies raised against the human
15 recombinant peptide. J Clin Endocrinol Metab 1998;83: 2944 2951.
16 26. Miyazaki J, et al. Establishment of a pancreatic β cell line that retains glucose inducible
17 insulin secretion: special reference to expression of glucose transporter isoforms.
18 Endocrinology 1990;127:126 132.
19 27. Prévost G, et al. The PACAP regulated gene selenoprotein T is abundantly expressed in
20 mouse and human β cells and its targeted inactivation impairs glucose tolerance.
21 Endocrinology 2013;154:3796 3806.
22 28. Jésus P, et al. Alteration of intestinal barrier function during activity based anorexia in
23 mice. Clin Nutr 2013;S0261 5614:310 315.
24 29. Seino Y, Fukushima M, Yabe D. GIP and GLP 1, the two incretin hormones : Similarities
25 and differences. J Diabetes Invest 2010;1:8 23.
19
Diabetes Page 20 of 32
1 30. Granata R, et al. RFamide peptides 43RFa and 26RFa both promote survival of pancreatic
2 β cells and human pancreatic islets but exert opposite effects on insulin secretion. Diabetes
3 2014;63:2380 2393.
4 31. Egido EM, et al. 26RFa, a novel orexigenic neuropeptide, inhibits insulin secretion in the
5 rat pancreas. Peptides 2007;28:725 730.
6 32. Mulumba M, et al. GPR103b functions in the peripheral regulation of adipogenesis. Mol
7 Endocrinol 2010;24:1615 1625.
8 33. Campbell JE, Drucker DJ. Pharmacology, physiology, and mechanisms of incretin hormone
9 action. Cell Metab 2013;17:819 837.
10
11
20
Page 21 of 32 Diabetes
1 Figure Legends
2
3 Figure 1. Evolution of plasma 26RFa concentrations in obese and diabetic patients. (A)
4 Phenotypes of the patients included in the study. (B) Plasma 26RFa levels were measured,
5 using a specific radioimmunossay for human 26RFa, in the four groups of patients after an
6 overnight fasting. Obese patients without or with type 2 diabetes show a significant increase
7 in plasma 26RFa concentrations (p<0.05) as compared to HS. Type 1 diabetic patients also
8 show an increase in circulating 26RFa that does not reach the level of significativity
9 (p=0.057). Data represent means ± SEM of 5 independent experiments. *, p<0.05. (C and D)
10 Correlation analysis revealed that plasma 26RFa is positively correlated with fasting insulin
11 (r=0.37, p=0.0015) (C) and the insulin resistance marker HOMA IR (r=0.54, p<0.0001) (D).
12
13 Figure 2. Plasma 26RFa profile during an oral glucose tolerance test in human. (A) Plasma
14 glucose, insulin and 26RFa levels were measured in 9 healthy volunteers during 180 min after
15 a 75 g glucose load, with samplings every 30 min. As expected, a peak of plasma glucose and
16 insulin occurs 30 min after the glucose load. In contrast, plasma 26RFa levels remain stable
17 during the first 90 min of the test, but increase dramatically at 120 min and then decrease
18 slowly until the end of the experiment. **, p<0.01. (B) Comparison of the plasma 26RFa
19 profile during the OGTT with those of the two incretins glucagon like peptide 1 (GLP 1) and
20 glucose dependent insulinotropic polypeptide (GIP), and with that of the other orexigenic
21 neuropeptide ghrelin. A quick rise of GLP 1 and GIP is observed 30 min after the glucose
22 load, similar to those of glucose and insulin, in contrast to 26RFa that peaks only at 120 min.
23 Ghrelin levels decreased at 30 min and then remained stable until the end of the test. (C)
24 Plasma glucose, insulin and 26RFa levels were measured every 30 min during 300 min in a
25 patient with gastroparesis. Plasma glucose rises at 30 min whereas the insulin peak occurs 90
21
Diabetes Page 22 of 32
1 min after the glucose load. Plasma 26RFa levels increase only 210 min after the glucose
2 challenge. (D) Plasma glucose, insulin and 26RFa levels were measured during 180 min, with
3 samplings every 30 min, in a subject who underwent a total gastrectomy. Plasma glucose and
4 insulin levels increase at 60 min after the glucose load. The increase in plasma 26RFa occurs
5 90 min after the glucose challenge. Data represent the values of a single patient for (C) and
6 (D).
7
8 Figure 3. Immunohistochemical distribution of 26RFa and its receptor, GPR103, in the
9 human pancreas and gastrointestinal tract. (A-B) Photomicrographs of pancreas sections
10 showing that 26RFa and its receptor are specifically localized in the endocrine islets and are
11 present within the same islets. (C- F) Photomicrographs of pancreas consecutive sections
12 treated with 26RFa or GPR103, and insulin antibodies revealing that the distribution of 26RFa
13 and its receptor are similar to that of insulin. (G) Photomicrographs of the antral part of the
14 stomach showing that numerous epithelial cells of the gastric glands are labeled with the
15 26RFa antibodies. (H) Photomicrographs of the duodenum showing that numerous
16 enterocytes and goblet cells of the villosities are labeled with the 26RFa antibodies. (I and J)
17 Photomicrographs of ileum (I) and colon (J) slices showing that the distribution of 26RFa is
18 very similar to that observed in the duodenum with the exception that the number of
19 immunoreactive cells is much lower than in the duodenum (arrows). Scale bars: (A F and H),
20 50 µm; (G), 200 µm; (I, J), 25 µm.
21
22 Figure 4. Effects of 26RFa on plasma glucose and insulin levels in mice. (A) Effect of
23 intraperitoneal (i.p.) administration of 26RFa (500 µg/kg) during a glucose tolerance test.
24 26RFa significantly attenuates the hyperglycemia induced by the i.p. injection of glucose (2
25 g/kg) throughout the duration of the test. (B) Effect of i.p. administration of 26RFa (500
22
Page 23 of 32 Diabetes
1 µg/kg) during an insulin tolerance test. 26RFa significantly potentiates insulin induced
2 hypoglycemia between 30 and 60 min after the i.p. insulin load (0.75 Units/kg). (C) Effect of
3 i.p. administration of 26RFa (500 µg/kg) on basal plasma glucose levels. 26RFa does not alter
4 basal plasma glucose during the 90 min following its injection. (D) Effect of i.p.
5 administration of 26RFa (500 µg/kg) during an acute glucose stimulated insulin secretion test.
6 26RFa significantly stimulates glucose induced insulin production 15 and 30 min following
7 the glucose load (2 g/kg). Data represent means ± SEM of 3 independent experiments
8 (n=7/experiment). *, p<0.05; **, p<0.01; ***, p<0.001.
9
10 Figure 5. Effect and expression of 26RFa on the mouse insulinoma cell line MIN6. (A, B)
11 Expression of 26RFa, GPR103, NPFF2, INS R and GLUT 2 mRNA was determined in native
12 MIN6 cells (A), and in cells tranfected with nonsilencing siRNA (siControl) or transfected
13 with siRNA to GPR103 (siGPR103) (B) by quantitative polymerase chain reaction and
14 adjusted to the signal intensity of β actin. Both 26RFa and GPR103 are expressed in native
15 MIN6 cells grown in DMEN + 25 mM of glucose whereas NPFF2 mRNA is not detected (A).
16 Incubation of the cells in a Krebs Ringer medium complemented with glucose 2.8 mM for
17 insulin secretion experiments does not modify this expression profile (A). GPR103, 26RFa,
18 INS R and GLUT 2 are also expressed in cells transfected with non silencing siRNA (B).
19 Transfection of the cells with siRNA to GPR103 results in a total loss of GPR103 expression
20 whereas the expression of the other genes is not altered (B). (C, D) Secretion of insulin by
21 siControl or siGPR103 MIN6 cells incubated with a low glucose (LG) or a high glucose (HG)
22 medium in the presence or absence of 26RFa (10 6 M) or the GLP 1 analogue exenatide (E,
23 10 6 M). In LG conditions, both 26RFa and exenatide induce a highly significant increase of
24 insulin release by siControl cells (C). In HG condition, 26RFa does not alter insulin release
25 whereas exenatide strongly stimulates insulin secretion (C). No additive effects of 26RFa and
23
Diabetes Page 24 of 32
1 exenatide are observed in both LG and HG condition (C). Invalidation of GPR103 expression
2 results in a total loss of 26RFa induced insulin secretion whereas the positive effect of
3 exenatide is not affected (D). Addition of 26RFa to exenatide did not significantly alter
4 exenatide induced insulin secretion in both LG and HG conditions (D). Insulin mean basal
5 level/ well was 88±2 µU/ml. (E) Expression of GPR103, INS R and GLUT 4 mRNA was
6 determined by quantitative polymerase chain reaction and adjusted to the signal intensity of
7 GAPDH in the muscle, the liver and the adipose tissue. GPR103 mRNA is expressed in the
8 three tissues with higher levels detected in the liver. Expression of INS R is significantly
9 higher in the liver as compared to the muscle and the adipose tissue. Expression of GLUT 4 is
10 not detected in the liver and is much lower in the adipose tissue as compared to the muscle.
11 Data represent means ± SEM of 3 independent experiments (n=5 per experiment). **, p<0.01;
12 ***, p<0.001; ns, non significant.
13
14 Figure 6. Expression and secretion of 26RFa by the gastrointestinal tract in mice. (A)
15 Expression of 26RFa mRNA was determined by quantitative polymerase chain reaction and
16 adjusted to the signal intensity of GAPDH in duodenal, jejunum and ileum segments. 26RFa
17 mRNA is expressed in the three regions of the mouse gastrointestinal tract with higher levels
18 in the duodenum (n=6). (B) Immunohistochemical distribution of 26RFa in the mouse
19 intestine. Intensely immunoreactive cells are found in the epithelium of the duodenum (1,
20 arrows) and the ileum (2). In the ileum, 26RFa positive cells are mostly found at the basis of
21 the villosities and might thus correspond to Paneth cells (2, arrows). Treatment of consecutive
22 jejunal sections with either the 26RFa (3) or the EM66 antibodies (4), which is a marker of
23 neuroendocrine cells, indicates that the same cells are labeled by the two antibodies (3, 4,
24 arrows). (C, D) Evolution of plasma 26RFa levels during an oral (C) and an intravenous (iv)
25 (D) glucose tolerance test. A highly significant increase in plasma 26RFa concentration is
24
Page 25 of 32 Diabetes
1 observed 30 min after the oral administration of glucose that corresponds to the plasma
2 glucose peak (C). Conversely, no significant alteration of plasma 26RFa levels is detected
3 after iv administration of glucose (D) (n=10 for each time point). (E) Secretion of 26RFa from
4 duodenal, jejunal and ileal segments was evaluated in low glucose (LG, 2.8 mM) or high
5 glucose (HG, 16.7 mM) conditions using a Ussing chambers model (n=8). Duodenal
6 fragments exposed to HG concentrations at their apical pole release massive amounts of
7 26RFa in the basal chamber as compared to duodenal slices exposed to LG concentrations. In
8 contrast, the 26RFa flow towards the basal compartment is not altered in the jejunum and the
9 ileum in HG conditions vs LG conditions. Data represent means ± SEM of 3 independent
10 experiments. *, p<0.05; **, p<0.01; ***, p<0.001; ns, non significant.
11
25
Diabetes Page 26 of 32
Table I. Sequences of the primers used for the Q-PCR experiments
Forward primer Reverse primer Mouse β-actin AGGTCATCACTATTGGCAACGA CACAGGATTCCATACCCAAGAAG Mouse 26RFa GAAGGGGACCCACAGACATC GTCTTGCCTCCCTAGACGGAA Mouse GPR103 CACTGTTGTGACGGAAAT CCTTCGGGTAGTGTACTGCC Mouse INS-R ATGGGCTTCGGGAGAGGAT GGATGTCCATACCAGGGCAC Mouse GLUT-2 CCCTGTTCCTAACCGGGATG GGCGAATTTATCCAGCAGCAC Mouse GLUT-4 GTGACTGGAACACTGGTCCTA CCAGCCACGTTGCATTGTAG Mouse NPFF2 ATCTGGAGTGGCAATGATACACA TCCCACCATGCACAAGACAAA Mouse GAPDH TCCGGACGCACCCTCAT CGGTTGACCTCCAGGAAATC PageA 27 of 32 Diabetes All HS Obese DT1 DT2
n (male/female) 161(49/112) 37 (10/27) 52 (7/45) 19 (9/10) 53 (23/30)
Age (yr) 47.6 ± 1.1 45.8 ± 2.8 42.8 ± 1.6 45.9 ± 2.9 54.1 ± 1.6
Body Weight (kg) 95.3 ± 2.1 66.9 ± 2.3 116.1 ± 2.7 73.9 ± 2.9 98.7 ± 2.9
BMI(Kg/m2) 34.6 ± 0.8 23.7 ± 1.6 42.8 ± 0.8 25.5 ± 0.8 35.7 ± 1.1
Waist circumference (cm) 116 ± 1.3 90 ±1.6 124 ± 1.6 94 ± 2.4 114 ± 2.1
Glycemia (mmol/L) 5.9 ± 0.1 4.8 ± 0.14 5.1 ± 0.1 7.2 ± 0.5 7.3 ± 0.3
Fasting insulin (pmol/L) 147.9 ± 8.7 39.0 ± 3.1 157.9 ± 16.1 142.0 ±11.5
HbA1c 7.1 ± 0.1 5.3 ± 0.1 5.6 ± 0.1 9.4 ± 0.3 7.7 ± 0.3
diabetes duration (yr) 18.1 ± 2.7 6.9 ± 0.9
HS, Healthy subjects; Obese, Obese patients; DT1, patients with type 1 diabetes; DT2, Obese subjects with type 2 diabetes B P=0.057
600 * /ml) /ml)
pg 400
200 Plasma Plasma 26RFa (
0 HS Obese DT2 DT1 C D
600 40 R=0.37 R=0.54 P=0.0015 P<0.0001 /l) 450 30
IR 300 20 HOMA- 150 10 Plasma insulin Plasma insulin (pmol
0 0 0 500 1000 1500 2000 0 500 1000 1500 2000
Plasma 26RFa (pg/ml) Plasma 26RFa (pg/ml)
Figure 1 Diabetes Page 28 of 32
A B
) 26RFa
300 Glucose 700 300 1400 PlasmaGLP Insulin Ghrelin ** level 250 26RFa 600 250 GLP-1 1200
Plasma26RFa ( GIP
500 1000
- 1 and GIP (% basal basal (% GIP and 1 200 (%basal 200 400 800
/l) and /l) glucose (mg/dl) 150 150 ghrelin
300 600
pg
pmol ( 100 /ml) 100
200 400 insulin
50 100 50 200 level
) Plasma 26RFa and 26RFa Plasma
Plasma Plasma 0 0 0 0 0 30 60 90 120 150 180 0 30 60 90 120 150 180 Time (min) Time (min) C D Glucose 700 Glucose 700 Insulin Insulin
500 26RFa 600 500 26RFa 600
Plasma26RFa ( Plasma26RFa ( 500 500 400 400
400 400 /l) and /l) glucose (mg/dl) 300 and /l) glucose (mg/dl) 300
300 300
pg pg
pmol pmol
( ( /ml) 200 /ml) 200
200 200 insulin
100 100 insulin 100 100 Plasma Plasma 0 0 Plasma 0 0 0 60 120 180 240 300 0 30 60 90 120 150 180 Time (min) Time (min)
Figure 2
Figure 2 Page 29 of 32 Diabetes A B
Pancreas Pancreas 26RFa GPR103
C D
Pancreas Pancreas 26RFa Insulin
E F
Pancreas Pancreas GPR103 Insulin
G H
26RFa 26RFa Stomach Duodenum (antrum)
I J
26RFa 26RFa Ileum Colon
Figure 3 Diabetes Page 30 of 32
A B 5
4 100
3 *** 2 *** 50
Glucose Glucose (g/l) ** ** * 1 Glucose (%T0) * ** 0 0 0 7 15 30 60 120 0 15 30 45 60 90 Time (min) Time (min) Control 26RFa (500 µg/kg) C D *** 2 0.3 *
0.2 1.5
Glucose Glucose (g/l) 0.1 Insulin Insulin (µg/l)
1 0 0 15 30 60 90 0 15 30 Time (min) Time (min)
Figure 4 Page 31 of 32 Diabetes A B ns ns ns ns 1.5 1.5 ns
1.0 1.0
0.5 0.5 mRNA mRNA levels (arbitrary units) mRNA mRNA levels (arbitrary units) 0 0 26RFa GPR103 NPFF2 GPR103 26RFa INS-R GLUT-2
Glucose (2.8 mM) siControl Glucose (25 mM) siGPR103
C D
siControl siGPR103 ** ns 20 ** ns 10.0 *** 15 7.5 ns ** ** ns 10 ns 5.0 ** ns 5 *** 2.5 ns Insulin Insulin secretion index Insulin Insulin secretion index (Test period/basal level) (Test period/basal level) 0 0
LG LG HG HG LG+E LG+E LG+E HG+E HG+E HG+E LG+26RFa LG+26RFa LG+26RFa HG+26RFa HG+26RFa HG+26RFa LG+26RFa+E LG+26RFa+E LG+26RFa+E HG+26RFa+E HG+26RFa+E HG+26RFa+E
E
*** *** *** *** *** 15 3.5 1.25 3 1 10 2 mRNA mRNA levels
mRNA mRNA levels 0.5 5 4
R 1 (arbitrary units) (arbitrary units) (arbitrary units) INS-
GPR103 mRNA GPR103mRNA levels 0 0 0 GLUT-
Muscle Liver Adipose tissue
Figure 5 A DiabetesB Page 32 of 32 2 * * 1 2 1.5
1
(arbitrary units) 0.5 26RFa mRNA 26RFa mRNA levels 3 4 0 Duodenum Jejunum Ileum
C D *** *** 2.5 2.5 ns ns 2.0 4 2.0 4 Plasma glucose (g/l) (g/l) glucosePlasma /ml) /ml) Plasma glucose (g/l) (g/l) glucosePlasma /ml) ng /ml) ng 1.5 3 1.5 3
1.0 2 1.0 2 Plasma Plasma 26RFa ( 0.5 1 Plasma 26RFa ( 0.5 1
0 0 0 0 0 30 120 Plasma 26RFa 0 3 30 Time (min) Plasma glucose Time (min)
E ** ns 300
ns 200 Duodenum Jejunum 100 Ileum (% apical compartment)
26RFa in the 26RFa the in basal compartment 0 LG HG LG HG LG HG Figure 6