Olivine-Respiring Bacteria Isolated from the Rock-Ice Interface in a Lava-Tube Cave, a Mars Analogue Environment

Astrobiology 2011

Popa, Radu Portland State University, Biology Smith, Amy Portland State University, Biology Popa, Rodica Portland State University, Biology Boone, Jane Portland State University, Biology Fisk, Martin Oregon State University, College of Oceanic and Atmospheric Science

This is the authors' pre-print, which is the only version available, as of Nov. 8, 2011. It will be supplemented with the final published version immediately after publication.

Originally published by Mary Ann Liebert, Inc. and can be found at: http://www.liebertonline.com/ast

Citation: Popa, R., Smith, A., Rodica, P., Boone, J., & Fisk, M. (2011). Olivine-Respiring Bacteria Isolated from the Rock-Ice Interface in a Lava-Tube Cave, a Mars Analogue Environment. Astrobiology. Page 1 of 32 Astrobiology

1 2 3 4 5 6 7 1 Olivine-Respiring Bacteria Isolated from the Rock-Ice Interface in a Lava-Tube 8 2 Cave, a Mars Analogue Environment 9 10 3 11 12 4 Popa, Radu; 13 14 5 Smith, R. Amy; 15 16 6 Popa, Rodica; 17 7 Boone, Jane; and 18 For Peer Review 19 8 Fisk, Martin 20 21 9 22 23 10 Abstract 24 25 11 The boundary between ice and basalt on Earth is an analog for some near-surface 26 12 environments of Mars. We investigated neutrophilic iron-oxidizing 27 28 13 microorganisms from the basalt-ice interface in a lava tube from the Oregon 29 30 14 Cascades with perennial ice. One of the isolates (Pseudomonas sp. HerB ) can 31 32 15 use ferrous iron Fe(II) from the igneous mineral olivine as an electron donor and 33 o 34 16 O2 as an electron acceptor. The optimum growth temperature is ~12-14 C, but 35 17 growth also occurs at 5 oC. Bicarbonate is a facultative source of carbon. Growth 36 37 18 of Pseudomonas sp. HerB as a chemolithotrophic iron oxidizer with olivine as 38 39 19 the source of energy is favored in low O 2 conditions ( e.g ., 1.6 % O 2). Most 40 41 20 likely, microbial oxidation of olivine near pH 7 requires low O 2 to offset the 42 43 21 abiotic oxidation of iron. The metabolic capabilities of this bacterium would 44 45 22 allow it to live in near-surface, icy, volcanic environments of Mars in the present 46 23 or recent geological past, and make this type of physiology a prime candidate in 47 48 24 the search for life on Mars. 49 50 25 51 52 26 Introduction 53 54 55 56 57 58 59 60 1

Mary Ann Liebert, Inc., 140 Huguenot Street, New Rochelle, NY 10801 Astrobiology Page 2 of 32

1 2 3 4 5 6 7 27 The present day temperature of Mars’ surface is mostly below the freezing point 8 28 of water, the thin atmosphere leaves the surface exposed to UV radiation, and the 9 10 29 absence of a magnetic field exposes the surface to ionizing radiation. Because of 11 12 30 inhospitable conditions, primary production through photosynthesis is assumed 13 14 31 not to occur. Yet, the shallow subsurface of the Red Planet, where temperatures 15 16 32 are above freezing, could harbor chemolitho-autotrophic microorganisms. In the 17 33 recent geological past, Mars’ surface could have been above freezing because of 18 For Peer Review 19 34 residual geothermal heat, orbital forcing, or greenhouse gas effects (Carr, 1995; 20 21 35 Fogg, 1996; Abramov and Kring, 2005). Liquid water could have existed on 22 23 36 Mars over much of the planet's history, and it may still exist at the rock-ice 24 25 37 interface, in rocks and soil as a result of impact events, and in brines (Travis et 26 27 38 al ., 2003; Clifford et al ., 2010; Fairén, 2010; Samarkin et al ., 2010). Much of 28 39 Mars’ surface is composed of igneous rocks similar to basalt on Earth (Bandfield 29 30 40 et al ., 2000; Edwards et al ., 2008). As in terrestrial basalts, a prominent 31 32 41 component is Fe(II), which is present in the minerals olivine and pyroxene and in 33 34 42 glass (Hoefen et al ., 2003; Edwards et al ., 2008). 35 36 43 The Mars-like terrestrial habitat that we have focused on in this study is the 37 38 44 rock-ice interface from lava tube caves, which occur frequently in basalt flows. 39 45 In this type of habitat on Mars, a film of liquid water can exist at the rock’s 40 41 46 surface, where life would be protected from intense solar irradiation. Yet, 42 43 47 because it is exposed to the atmosphere, this habitat also has the benefit of an 44 45 48 abundant source of energy in the form of redox disequilibrium between the 46 47 49 oxidized surface of Mars and Fe(II)-bearing minerals such as olivine and 48 50 pyroxene. Although iron oxidation can also occur by phototrophy, the most 49 50 51 common process to extract energy from Fe(II) minerals on Earth is with oxidants 51 - 52 52 such as dioxygen (O 2) and nitrate (NO 3 ), (Widdel et al ., 1993; Kappler and 53 54 53 Newman, 2004; Schippers et al ., 2005; Miot et al ., 2009; Newman, 2010). On 55 56 57 58 59 60 2

Mary Ann Liebert, Inc., 140 Huguenot Street, New Rochelle, NY 10801 Page 3 of 32 Astrobiology

1 2 3 4 5 6 - 7 54 Mars, electron acceptors for Fe(II) may include putative superoxides and NO 3 8 55 from rock surfaces and atmospheric O (~8-13 bars). 9 2 10 56 Microbes can influence (trigger or limit) the dissolution of olivine, pyroxene, 11 12 57 or basalt (Santelli et al ., 2001; Welch and Banfield, 2002; Benzerara et al ., 2004; 13 14 58 Josef et al ., 2007; Wu et al ., 2007). Weathering features and chemical signatures 15 16 59 that are indicative of life were reported in olivine from Earth, and similar features 17 60 were also observed in Mars meteorites (Fisk et al ., 2006). We proposed that 18 For Peer Review 19 61 some of these features are produced by neutrophilic iron-oxidizing (nFeO) 20 21 62 microorganisms that use Fe(II) from olivine (Fisk et al ., 2006). Neutrophilic 22 23 63 iron-oxidizing bacteria (nFeOB) are common in freshwater ecosystems (Straub et 24 25 64 al ., 1996; 2004) and marine basalts (Stevens, 1997; Emerson and Moyer, 2002; 26 27 65 Edwards et al ., 2003a,b; Lehman et al ., 2004; Bailey et al ., 2009). The most 28 66 recognized phylotypes belong to the genera Gallionella , Lepthotrix , 29 30 67 Sideroxydans , Marinobacter , Mariprofundus, and Sphaerotilus. Although best 31 32 68 studied in bacteria, this physiotype is also present in some archaea such as 33 34 69 Ferroglobus placidus (Hafenbradl et al ., 1996). Recently, a diverse collection of 35 36 70 α-, γ-, and ζ-Proteobacteria were found that are capable of such activity, although 37 38 71 they are not closely related to any previously known nFeOs (Edwards et al ., 39 72 2004; Emerson and Floyd, 2005; Duckworth et al ., 2009; Wang et al ., 2009). 40 41 73 Even phylogroups that are dominated by heterotrophic species, such as 42 43 74 Pseudomonas or Acidovorax , contain strains that are facultatively or even 44 45 75 obligate nFeOs (Kappler et al ., 2005; Bailey et al ., 2009). In a recent paper, we 46 47 76 reported that bacteria from a basalt subseafloor habitat (Juan de Fuca Ridge) 48 49 77 preferentially colonize olivine above all other igneous minerals and that many 50 78 heterotrophic oligotrophic isolates colonizing basalt minerals and glass are 51 52 79 facultative nFeOs (Smith et al. , 2011). The presence of olivine in basalts led us 53 54 55 56 57 58 59 60 3

Mary Ann Liebert, Inc., 140 Huguenot Street, New Rochelle, NY 10801 Astrobiology Page 4 of 32

1 2 3 4 5 6 7 80 to suspect that nFeOs play an important role in the ecology and biogeochemical 8 81 cycles of basalt-hosted subsurface ecosystems. 9 10 82 Olivine ((Mg,Fe) 2SiO 4) is a class of minerals that has a variable iron to 11 12 83 magnesium ratio. The abundance of iron relative to magnesium 13 14 84 ([Fe/(Fe+Mg)] 100) ranges from 0 % Fe(II) in forsterite to 100 % Fe(II) in 15 16 85 fayalite. Most commonly, olivine contains about 10 % Fe(II). Although olivine 17 86 only contains iron in reduced form (Fe(II)), no strain of nFeO microorganism has 18 For Peer Review 19 87 ever been reported to have the capacity to use this mineral as a source of energy. 20 21 88 Such a finding would be invaluable for the study of olivine bio-weathering; the 22 23 89 identification of biosignatures and microfossils; determination of whether life and 24 25 90 associated microhabitats were, or are, in existence on Mars; and the search for 26 27 91 extraterrestrial life. Here, we report that olivine-oxidizing nFeO bacteria 28 92 (nFeOB) are present in basalt in cold, near surface, aphotic environments such as 29 30 93 caves ( esp. lava tubes) with permanent ice, and we show the olivine-dependent 31 32 94 growth characteristics of one such isolate. The similarity of this environment to 33 34 95 environments on Mars suggests that nFeO microorganisms that live at the basalt- 35 36 96 ice interface could survive on Mars, or may have thrived on Mars in the past 37 38 97 when the temperature, atmospheric pressure, and (possibly) the O 2 partial 39 98 pressure ( PO2) were higher than they are today and appropriate for olivine- 40 41 99 dependent growth of nFeO microorganisms. 42 43 100 44 45 101 Materials and methods 46 47 102 We collected ice and rock fragments from the rock/ice interface in South Ice ο ο 48 103 Cave in the Oregon Cascades (Lat 43 34’ 59’’N, Long 121 04’ 38’’W). South 49 50 104 Ice Cave, a basalt lava tube at an elevation of 1530 m., is the result of an eruption 51 52 105 on the southern flank of Newberry Caldera and contains permanent ice. This 53 54 106 basalt flow contains ~9.0 % iron as FeO, and its mineralogy is primarily 55 56 57 58 59 60 4

Mary Ann Liebert, Inc., 140 Huguenot Street, New Rochelle, NY 10801 Page 5 of 32 Astrobiology

1 2 3 4 5 6 7 107 plagioclase feldspar, pyroxene, and olivine (personal communication Julie 8 108 Donnelly-Nolan). The rock/ice samples were stored in sterile bags and packed 9 10 109 on ice for transportation to the lab. Culture media were inoculated with melted 11 12 110 ice and rock fragments within two days of collection. Our overall strategy for 13 14 111 isolation of a microorganism capable of olivine-dependent growth is summarized 15 16 112 in the flow chart from Fig. 1. 17 113 For enrichments, we used test tubes with 5 mL sterile 0.2 micron-filtered cave 18 For Peer Review 19 114 water and olivine sand with 9 % Fe/(Fe+Mg). The enrichments were incubated at 20 21 115 5oC for about 4 weeks to favor the growth of nFeO microorganisms that are also 22 23 116 psychrophilic or psychrotolerant. The enrichments were inoculated by streaking 24 25 117 on Tryptone Soy Agar (TSA) organotrophic oligotrophic plates. Colonies that 26 27 118 exhibited differing morphologies were picked up, saved in a library, and 28 119 preserved at -80 oC in 50 % glycerol. 29 30 120 The mineral medium used for culturing isolates contained per L: 1 mL trace 31 32 121 minerals solution, 1 mL vitamins mix, 30 mmol phosphate buffer (pH 7), 20 33 34 122 mmol bicarbonate, 30 mmol nitrate, and 100 g olivine. The trace minerals 35 36 123 solution contained: 6.72 mM Na 2EDTA, 5.6 mM H 3BO 3, 1 mM NaCl, 0.54 mM 37 38 124 FeSO 4, 0.5 mM CoCl 2, 0.5 mM NiSO 4, 0.39 mM Na 2MoO 4, 0.15 mM NaSeO 4, 39 125 0.13 mM MnCl 2, 0.13 mM ZnCl 2, and 0.02 mM CuCl 2. The vitamins mix 40 41 126 contained per ml: 5 g p-aminobenzoic acid, 5 g biotin, 5 g cyanocobalamin, 5 42 43 127 g folic acid, 100 g i-inositol, 100 g nicotinic acid, 100 g pyridoxine, 100 g 44 45 128 panthotenic acid, 100 g riboflavin, and 1 g thiamine. The vitamins mix was 46 47 129 added filter sterilized after autoclavation. All chemicals were reagent grade. 48 130 Sand (0.2-0.8 mm grain size) composed of 100 % olivine (Fo91) that contained 8 49 50 131 wt % FeO was provided by Unimin Corporation. Tumbled olivine (~Fo 90 beads 51 52 132 1-3 mm in size, ~24 grains/g) were obtained from a local supplier of minerals and 53 54 133 gems. For most experiments (including enrichments), the olivine was washed 55 56 57 58 59 60 5

Mary Ann Liebert, Inc., 140 Huguenot Street, New Rochelle, NY 10801 Astrobiology Page 6 of 32

1 2 3 4 5 6 7 134 with dH 2O and autoclaved in the culture medium. Throughout this work, we 8 135 used un-inoculated controls and controls that represent media with and without 9 10 136 various chemical modifications. The controls for each experiment (whenever 11 12 137 applicable) are explained in the Results section. 13 14 138 In some experiments, organics-free olivine was used; this was obtained by 15 o 16 139 heating olivine in a furnace at 500 C for 90 min in air. After cooling, the olivine 17 140 showed evidence of surface oxidation (uneven small patches with yellow-rusty 18 For Peer Review 19 141 appearance). Part of the iron oxides were removed by acid dissolution in three 20 21 142 24-hour long washes with occasional stirring at room temperature. The acid 22 23 143 washing solution contained 0.25 ml/L H 2SO 4 and 20 mM Na 2SO 4, pH ~2.5, and 24 25 144 was used in a proportion of 100 ml solution to about 10 g olivine. We compared 26 27 145 the UV spectra of the various washes with the spectra of control unheated olivine 28 146 and calculated the concentration of Fe(III) relative to a standard. Under these 29 30 147 conditions, ferric iron absorbs strongly in the 295-304 nm range, while ferrous 31 32 148 iron absorbs mostly in the 220-250 nm range (Steiner and Lazaroff, 1974). In 33 34 149 this method, 304 nm peaks in solutions containing Fe(II) are used as evidence of 35 36 150 Fe(III). This method allows detection of concentrations of Fe(III) as low as 20 37 38 151 M even in the presence of high concentrations of Fe(II), because the absorbance 39 152 of Fe(III) at 304 nm is ~300 times larger than that of Fe(II). After the acid 40 o 41 153 treatment, the olivine was washed with dH 2O and dried in a 55 C oven. 42 43 154 Macroscopically, the heated olivine retained a yellow-green appearance with 44 45 155 pink-rusty patches. Under a dissecting scope, most oven heated and acid washed 46 47 156 olivine sand particles appeared transparent and colorless, while the similarly 48 157 treated olivine beads appeared pale green and translucent. 49 50 158 For phylogenetic identification, we obtained biomass by growing cells in 51 52 159 liquid tryptone soy broth (TSB) medium in aerobic conditions. Cells were 53 o 54 160 separated by centrifugation (14,000 rpm, 2 C, 5 min.), and genomic DNA 55 56 57 58 59 60 6

Mary Ann Liebert, Inc., 140 Huguenot Street, New Rochelle, NY 10801 Page 7 of 32 Astrobiology

1 2 3 4 5 6 7 161 (gDNA) was extracted with a Qiagen genomic tip kit and quantified with a 8 162 NanoDrop1000 instrument. A fragment of the SSU rRNA gene was amplified by 9 10 163 PCR with the primers 8F (5’- AGAGTTTGATCCTGGCTCAG) and 1492R (5’- 11 12 164 GGTTACCTTGTTACGACTT) (Baker et al ., 2003). We used 20 µL PCR 13 14 165 volumes containing 10 µL Fermentas mix, 0.8 µL of each µM primer, 6.5 µL of 15 16 166 dH 2O and 2 µL of 100 ng/µL gDNA. The PCR conditions were as follows: 17 167 denaturing at 95 oC for 5 min., 40 cycles of 94 oC for 30 sec., 50 oC for 30 sec., 18 For Peer Review 19 168 and 72 oC for 2 min., and final extension at 72 oC for 7 min. The size of the PCR 20 21 169 products was verified by 0.7 % agarose electrophoresis, and the remaining 15 µL 22 23 170 PCR product was cleaned with an UltraClean PCR DNA purification kit 24 25 171 (MoBio). The amplicons were sequenced at the DNA Sequencing Core facility 26 27 172 of Oregon Health and Sciences University with three primers: 8F, 515F (5’- 28 173 GTGCCAGCMGCCGCGGTAA), and 1492R (Baker et al ., 2003) by capillary 29 30 174 electrophoresis on an ABI 3130xl instrument. Duplicate sequences were 31 32 175 manually aligned, and when differences between duplicates were found, we 33 34 176 repeated the PCR and sequencing to compare triplicates for each sequence. The 35 36 177 sequences of each isolate were assembled into contiguous DNA fragments and 37 38 178 blasted in the Ribosomal Database for phylogenetic identification. Sequences 39 179 were imported in MEGA 4 (Tamura et al ., 2007) and aligned versus phylogenetic 40 41 180 relatives. The evolutionary history was inferred by using the Neighbor-Joining 42 43 181 method (Saitou and Nei, 1987). The evolutionary distances (base substitutions 44 45 182 per site) were computed by using the Maximum Composite Likelihood method 46 47 183 (Tamura et al ., 2004). 48 184 To characterize the O preference of the isolates, we inoculated tryptone soy 49 2 50 185 semisolid agar gradient tubes containing 0.15 % agar and 2 mg/L resazurin. The 51 52 186 capacity of the isolates to grow as microaerophilic iron oxidizers was verified in 53 54 187 gradient tubes with semisolid medium (0.15 % agar) and 2 % agar plug 55 56 57 58 59 60 7

Mary Ann Liebert, Inc., 140 Huguenot Street, New Rochelle, NY 10801 Astrobiology Page 8 of 32

1 2 3 4 5 6 7 188 containing 36 mM FeCO 3 or olivine sand as Fe(II) sources (modified after: 8 189 Emerson and Moyer, 1997; Emerson and Floyd, 2005). When growth was seen 9 10 190 in a gradient tube, we repeated the inoculation a couple of times from tubes with 11 12 191 growth into fresh tubes by using a stabbing needle. Because some cells may 13 14 192 grow in FeCO 3 gradient tubes by using the agar or agar contaminants as energy 15 16 193 sources, when necessary, growth by neutrophilic iron oxidation was also verified 17 194 in liquid mineral medium with 5 mM soluble ferrous sulfate, at pH 7 and under 18 For Peer Review 19 195 1.6 % O 2. When testing for nitrate reduction capabilities, we used a medium 20 - 21 196 with 10 mM NO 3 at pH 7 (DIFCO Catalog #226810) in culture tubes containing 22 23 197 an inverted Durham tube to capture N2 gas that may have been produced by 24 25 198 denitrification. After 5 days of incubation, the cultures were examined for 26 27 199 evidence of denitrification and tested for nitrate and nitrite reduction (Leboffe 28 200 and Pierce, 2010). To verify growth by olivine oxidation, we incubated cells in 29 30 201 test tubes with mineral medium with or without olivine. 31 32 202 Growth on TSB medium was monitored by spectrophotometry (Abs600) and 33 34 203 microscopy. Media with olivine sand contain suspended mineral particles, which 35 36 204 make spectrophotometry readings difficult to interpret. Therefore, growth on 37 38 205 olivine-containing media was determined only by microscopy. To study the 39 206 effect of temperature on growth, we analyzed growth at 2 oC, 5 oC, 10 oC, 15 oC, 40 41 207 25 oC, 30 oC, 37 oC, and 40 oC. To test for autotrophic growth in olivine- 42 43 208 containing mineral media, we incubated cells with various concentrations of 44 - 45 209 HCO 3 as the sole source of carbon. Incubations in liquids under microaerophilic 46 47 210 conditions were done in serum bottles sealed with a 1 cm thick butyl stopper and 48 211 purged prior to autoclaving with dinitrogen gas containing 1.6 % O . The O 49 2 2 50 212 concentration in the head space was measured by gas chromatography (SRI 310C 51 52 213 instrument, Molecular sieve column and TCD detector). The gas pressure was 53 54 214 measured with an Omega pressure meter (Omega Engineering, Inc. CT). The 55 56 57 58 59 60 8

Mary Ann Liebert, Inc., 140 Huguenot Street, New Rochelle, NY 10801 Page 9 of 32 Astrobiology

1 2 3 4 5 6 7 215 concentration of O 2 in the liquid phase was derived from a saturation of 236 M 8 216 O in freshwater with air at 760 mmHg and at 30 oC. 9 2 10 217 We also verified whether the growth of one of the olivine-using isolates 11 12 218 (Pseudomonas sp. HerB) may be explained by organic contaminants present on 13 14 219 olivine surfaces. In this experiment, we used 5 ml liquid mineral medium 15 - 16 220 (composition shown above) in Hungate tubes, with 20 mM HCO 3 , 0 mM nitrate 17 221 (as Pseudomonas sp . HerB does not reduce nitrate), pH 7, ~1 g olivine per tube, 18 For Peer Review 19 222 sealed and crimped, purged with 1.6 % O 2, and autoclaved. A volume of diluted 20 21 223 vitamin mixture solution was injected filter sterilized after autoclavation to a 22 23 224 proportion of 1 ml/L. We inoculated washed cell pellets, from serial dilutions 24 25 225 into tubes containing heat-treated vs. non-heat treated olivine and sand vs. beads, 26 27 226 as well as medium without olivine. 28 227 Results 29 30 228 Of 29 aerobic heterotrophs that we isolated from South Ice cave, eleven 31 32 229 strains showed growth in a mineral medium with olivine as the source of energy 33 34 230 (Fig. 2). In these incubations, vitamins were also present and the olivine had not 35 36 231 been heated to remove traces of organics. Hence, alternative physiologies could 37 232 not be excluded (e.g ., oligotrophic organotrophs using vitamins or traces of 38 39 233 organics from olivine surfaces). Seven of these strains were mesophilic γ- 40 41 234 Proteobacteria from the genus Pseudomonas , two strains were cryophilic 42 43 235 Brevundimonads (α-Proteobacteria ), and two strains (also cryophilic) belong 44 45 236 with Acidovorax (β-Proteobacteria ) (Fig. 2). One of these strains, Pseudomonas 46 47 237 sp . HerB, was selected for further work because among all isolates it reached the 48 238 highest density while growing in a mineral medium with 10 % w:v olivine sand, 49 50 - o 3 239 20 mM HCO 3 , 1 mL vitamins mix per L, pH 7, and 30 C. Starting from ~10 51 52 240 cells/ml, this strain reached ~5 10 7 cells/ml in one week. 53 54 55 56 57 58 59 60 9

Mary Ann Liebert, Inc., 140 Huguenot Street, New Rochelle, NY 10801 Astrobiology Page 10 of 32

1 2 3 4 5 6 7 241 Cells of Pseudomonas sp . HerB are aerobic under heterotrophic conditions. 8 242 While on TSA plates and TSB tubes, growth was faster in air than in a 1.6 % O 9 2 10 243 atmosphere. However, in mineral media with olivine sand as the source of 11 12 244 energy and at pH 7, growth was very slow at 21 % O 2, better at ~5 % O 2, and best 13 7 14 245 at ~1.6 % O 2 where cultures reached densities of ~3•10 cells/mL after seven 15 16 246 days of incubation. Figure 3(a) shows the effect of olivine on the growth of 17 247 Pseudomonas sp . HerB in mineral medium (with/without olivine, and 18 For Peer Review 19 - 248 with/without NO 3 ). No growth occurred when olivine was absent, but in the 20 7 - 21 249 presence of olivine the culture reached 2.5•10 cells/mL without NO 3 and 22 7 - - 23 250 3.7•10 cells/mL with NO 3 . The difference between with/without NO 3 was 24 25 251 within one standard deviation (based on triplicates), and thus significant 26 27 252 statistical difference between these treatments could not be confirmed. Verifying 28 253 nitrate-reducing capabilities by using the protocol shown in Smith et al. (2011), 29 30 254 we found that Pseudomonas sp . HerB was not capable of such activity (results 31 32 255 not shown). Regarding O 2 consumption, 10 mL culture of Pseudomonas sp . 33 34 256 HerB used ~180 mol O 2 in 20 days (Fig. 3(b)). 35 36 257 The ability of Pseudomonas sp . HerB to grow as a neutrophilic iron oxidizer 37 38 258 was also seen in gradient tubes with iron carbonate and in liquid mineral medium 39 259 with 5 mM Fe(II) at pH 7 and under 1.6 % O . Growth was also observed during 40 2 41 260 serial inoculation of gradient tubes that contained only inorganic media. We 42 43 261 compared growth on a mineral medium with 10 % w:v olivine sand relative to 44 45 262 growth in the same mineral medium with 5 mM soluble Fe(II) initial 46 - o 47 263 concentration, 20 mM HCO 3 , pH 7, 1.6 % O 2, incubated at 30 C. The extent of 48 264 growth was similar for these two media. The cultures containing olivine reached 49 50 265 ~8•10 6 cells/mL in 10 days. 51 52 266 We verified the growth of Pseudomonas sp . HerB in a mineral medium 53 54 267 containing olivine at six pH values (Fig. 4(a)). No growth was observed at pH 55 56 57 58 59 60 10

Mary Ann Liebert, Inc., 140 Huguenot Street, New Rochelle, NY 10801 Page 11 of 32 Astrobiology

1 2 3 4 5 6 7 268 4.5 and pH 8.5, and the largest cell density (after one week of incubation) was 8 269 seen at pH 7. Fig. 4(b) shows the effect of HCO - on the growth of Pseudomonas 9 3 10 270 sp . HerB in mineral media containing olivine. No growth was observed without 11 - 7 - 12 271 HCO 3 , ~1•10 cells/mL at 10 mM HCO 3 and little variation in cell density above 13 - 14 272 10 mM HCO 3 . In this experiment, we also incubated cells in controls without 15 16 273 olivine and (similar to above) no measurable growth was seen. 17 274 We compared growth rates at different temperatures, using the slopes of the 18 For Peer Review 19 275 exponential growth phases (Fig. 5(a) and (b)). We found the following 20 21 276 temperatures for olivine growth: ~4-5oC minimum, ~12-14 oC optimum, and ~30- 22 o 23 277 31 C maximum (Fig. 5(b)). 24 25 278 To determine whether the olivine surface is a limiting factor in the growth of 26 27 279 Pseudomonas sp . HerB, we compared growth in the presence of olivine sand vs . 28 280 olivine beads. In these experiments, we also compared growth at 5 oC vs. 20 oC 29 30 281 (Fig. 6). We expected to find higher cell density with olivine sand than with 31 32 282 beads and higher cell density at 20 oC relative to 5 oC. Olivine beads with 3 mm 33 2 34 283 diameter have about 120 mm /g, while olivine sand with 0.4 mm particle 35 2 36 284 diameter have about ~7,000 mm /g, ( i.e ., about a 55-fold increase in surface:mass 37 38 285 ratio). After seven days of incubation, we found only about a two-fold increase 39 286 in cell density on sand (4.6•10 7 cells/mL) vs . beads (2.1•10 7 cells/mL), and no 40 41 287 significant differences in cell density between the 5 oC and 20 oC treatments. 42 43 288 Because pseudomonads can metabolize a wide variety of organic molecules, 44 45 289 excess of vitamins in the culture media can represent an additional source of 46 47 290 carbon and energy. Fig. 7 shows the growth of Pseudomonas sp . HerB in mineral 48 291 media with olivine and various concentrations of vitamins. In the olivine- 49 50 292 containing media, good growth (>10 7 cells/mL) was seen in all treatments. In the 51 52 293 olivine-absent media, growth was not observed when the vitamins mix was ≤ 1 53 54 294 mL/L. We also found that Pseudomonas sp. HerB grew in olivine freed of 55 56 57 58 59 60 11

Mary Ann Liebert, Inc., 140 Huguenot Street, New Rochelle, NY 10801 Astrobiology Page 12 of 32

1 2 3 4 5 6 7 295 organics, and that no significant growth differences existed (within +/- 1 SD) 8 296 between heat treated- and non-heat-treated olivine (Fig. 8). 9 10 297 11 12 298 Discussion 13 14 299 nFeOB have been reported to inhabit seawater, freshwater, groundwater, 15 16 300 terrestrial basalts, subseafloor basalt, hydrothermal systems, iron oxyhydroxide 17 301 mats, and the surface of glass and Fe(II)-containing minerals from a wide variety 18 For Peer Review 19 302 of sources (Emerson and Moyer, 2002; Kappler et al ., 2005; Edwards et al ., 20 21 303 2003a;b; Gronstal et al ., 2009; Miot et al ., 2009). Our finding extends the palette 22 23 304 of environments where nFeOB exist to the basalt/ice boundary habitat in a lava- 24 25 305 tube ice cave and to olivine minerals as a source of energy. The properties of this 26 o 27 306 habitat (near 0 C, dark, oligotrophic, circumneutral pH, and at the interface 28 307 between basalt, and ice near an oxidized atmosphere) makes it a terrestrial 29 30 308 analogue for a near-surface aphotic environment on Mars, where life may exist 31 32 309 today and could have thrived in the past when the atmospheric pressure and 33 34 310 surface temperature of Mars were higher than today. 35 36 311 Of eleven strains of putative nFeOB we isolated, we report the olivine- 37 312 dependent growth characteristics of one: Pseudomonas sp . HerB. Regarding the 38 39 313 source of carbon, this microorganism is a heterotroph and facultative autotroph 40 41 314 with the capacity to use CO 2 as a sole source of carbon. Regarding the source of 42 43 315 energy, it is an organotroph and facultative chemolithotroph, capable of 44 45 316 neutrophilic iron oxidation with Fe(II) from olivine as the sole electron donor and 46 47 317 O2 as the electron acceptor. The optimum pH for growth by olivine oxidation 48 318 was ~7, but we did not verify to what extent this optimum was due to competition 49 50 319 with iron autooxidation or to metabolic preference for circumneutral pH. 51 52 320 Regarding temperature preference, Pseudomonas sp . HerB is sub-mesophilic. 53 o 54 321 The optimum growth in TSB medium was about 14-15 C, but slow growth was 55 56 57 58 59 60 12

Mary Ann Liebert, Inc., 140 Huguenot Street, New Rochelle, NY 10801 Page 13 of 32 Astrobiology

1 2 3 4 5 6 o 7 322 seen at temperatures as low as ~5 C. Based on the growth profile, we predict 8 323 that the minimum temperature for growth is ~4 oC. The growth rate vs. 9 10 324 temperature profile is skewed toward higher temperatures (Fig. 5b), a profile that 11 12 325 is difficult to explain with the data at hand. Regarding O 2 tolerance, this strain is 13 14 326 microaerophilic and facultative aerobe, and the growth in olivine-containing 15 16 327 mineral medium is faster at low O 2 concentration (1.6 %) than at higher O 2 17 328 concentrations (5 % and 21 %). The fact that most of our isolates were from the 18 For Peer Review 19 329 genus Pseudomonas is not unexpected. Pseudomonads are versatile and show all 20 21 330 metabolic capabilities presented above. Some strains of Pseudomonas were 22 23 331 shown to be nFeO (Bailey et al ., 2009). Pseudomonads are important denitrifiers 24 25 332 in soil (Chan et al ., 1994; Smil, 2000), albeit Pseudomonas sp . HerB strain is not 26 27 333 a denitrifier and cannot reduce nitrate. We did not study the source of nitrogen 28 334 used by Pseudomonas sp . HerB for assimilation. The pathway for carbon 29 30 335 fixation in Pseudomonas sp . HerB is unknown, though some facultative 31 32 336 autotrophic pseudomonads have already been shown to fix CO 2 by using 33 34 337 RuBisCo (Mahmood et al ., 2009; Morikawa and Imanaka, 1993; Yuliar, 1997). 35 36 338 The mechanism of dissolution of olivine during the activity of Pseudomonas 37 38 339 sp . HerB is unclear. Iron-oxidizing bacteria are known to dissolve a variety of 39 340 Fe(II)-containing minerals, including pyrite, iron monosulfides, magnetite, 40 41 341 siderite, and vivianite at rates usually controlled by the solubility of the phase 42 43 342 (Schippers and Jorgensen, 2002; Kappler and Newman, 2004; Miot et al., 2009). 44 45 343 Organic ligands such as citrate, oxalate, malonate, gallate, salicylate, and 46 47 344 phthalate (some of which are known metabolic byproducts of pseudomonads) 48 49 345 were shown to dissolve basalt (Neaman et al., 2005). To obtain iron, many 50 346 bacteria produce siderophores, which also promote mineral dissolution (Buss et 51 52 347 al., 2007; Luo and Gu, 2011). Pseudomonads are known to produce a wide 53 54 348 diversity of siderophores (Cornelis and Matthijs, 2002), but siderophores 55 56 57 58 59 60 13

Mary Ann Liebert, Inc., 140 Huguenot Street, New Rochelle, NY 10801 Astrobiology Page 14 of 32

1 2 3 4 5 6 7 349 transport iron mostly in Fe(III) form (Martínez et al., 2000), while the iron from 8 350 olivine is valuable as an energy source to Pseudomonas sp . HerB in the Fe(II) 9 10 351 form. If a specialized mechanism to extract Fe(II) from olivine crystals does not 11 12 352 exist, then the growth of the olivine-using Pseudomonas sp . HerB should be 13 14 353 controlled predominantly by the rate of olivine dissolution and by the kinetics of 15 16 354 chemical Fe(II) oxidation (which are probably low). The growth of olivine- 17 355 oxidizing nFeOB is probably favored by low temperature, low O and the 18 For Peer Review 2, 19 - 356 presence of HCO 3 or other iron-binding agents. Low temperature and low O 2 20 21 357 decrease the rate of iron oxidation while increasing the availability of soluble 22 23 358 Fe(II). The role of low temperatures in controlling the growth of nFeOB was 24 25 359 little studied. The fact that nFeOB prefer low O 2 conditions is well known; it is 26 27 360 due to competition between microbial iron oxidation and iron autooxidation 28 361 (Edwards et al ., 2003b). The pH may also play an important role in the olivine- 29 30 362 dependent growth of Pseudomonas sp . HerB. Because final mineral products 31 32 363 vary significantly with the pH, the redox potential ( Eo) of the Fe 3+ /Fe 2+ couple is 33 34 364 pH-dependent, taking more positive values in acidic conditions (Thauer et al ., 35 36 365 1977). Iron oxidation is more exergonic at neutral pH than at acidic pH. 37 2+ + 3+ 38 366 Fe + ½O 2 + 2H → Fe + H 2O Rxn.1 39 367 at pH 2 the Eo of Fe 3+ /Fe 2+ = + 0.77 V and Go = - 8.7 kJ per mol Fe 40 41 2+ 3+ + 368 Fe + ½O 2 + 2H 2O → Fe (OH) 3 + H Rxn.2 42 43 369 at pH 7 the Eo of Fe 3+ /Fe 2+ = + 0.20 V and Go = - 63.7 kJ per mol Fe 44 45 370 According to Rxn. 2 and the iron content of the olivine we have used, 180 mol 46 47 371 of O 2 used by a 10 mL culture of Pseudomonas sp . HerB in 20 days is equivalent 48 49 372 to oxidizing the iron from ~290 mg olivine. 50 373 No direct evidence was ever found of olivine-related microbial activity on 51 52 374 Mars, and we did not analyze secondary minerals produced by Pseudomonas sp . 53 54 375 HerB while growing on olivine. Yet, potential martian habitats that contain 55 56 57 58 59 60 14

Mary Ann Liebert, Inc., 140 Huguenot Street, New Rochelle, NY 10801 Page 15 of 32 Astrobiology

1 2 3 4 5 6 7 376 secondary minerals (such as iddingsite) produced by olivine weathering in the 8 377 presence of water (Swindle et al., 2000) are important candidates to search for 9 10 378 evidence of such microbial activity. 11 12 379 Conclusions 13 14 380 We report for the first time that a strain of nFeOB from the genus 15 16 381 Pseudomonas is able to grow by using the mineral olivine as a source of energy. 17 382 We propose that such microbes are common in nature, and that 18 For Peer Review 19 383 microenvironments that support olivine-dependent growth have to satisfy a 20 21 384 couple of specific requirements. Some of the most important are circumneutral 22 23 385 pH, low P O2 , low temperature, and low organic load. On Earth, such conditions 24 25 386 can be encountered at basalt-ice interfaces where liquid water is also present. 26 27 387 This finding is important for astrobiology because the environmental conditions 28 388 in the recent geological past of Mars (higher pressure and temperature than 29 30 389 today) would have allowed such microbes to thrive near the surface in lava tubes, 31 32 390 under the ice sheet, and in the basalt subsurface where cells are protected from 33 34 391 harmful ionizing radiation and UV radiation, yet still benefit from the oxidants of 35 36 392 Mars’s surface. Orbital and surface observations of Mars have confirmed that 37 393 igneous rocks are exposed over significant areas (Edwards et al ., 2008; Bandfield 38 39 394 et al ., 2000), and that some martian areas are dominated by olivine-bearing rocks 40 41 395 (Hoefen et al ., 2003; Edwards et al ., 2008). In addition, skylights interpreted as 42 43 396 entrances to lava tubes (a physical environment similar to South Ice Cave) have 44 45 397 been observed on the flanks of martian volcanoes (Cushing et al ., 2007). 46 47 398 Subsurface environments and martian caves, which could contain permanent ice 48 399 (Williams et al ., 2010), have been proposed as astrobiology target sites (Boston 49 50 400 et al ., 1992; Boston, 2010; Northup et. al., 2011). 51 52 401 Calculations of autotrophic energy-producing reactions likely to occur on 53 - 54 402 Mars suggest that the oxidation of Fe(II) by O 2 or NO 3 could drive microbial 55 56 57 58 59 60 15

Mary Ann Liebert, Inc., 140 Huguenot Street, New Rochelle, NY 10801 Astrobiology Page 16 of 32

1 2 3 4 5 6 7 403 ecosystems (Jepson et al ., 2007). It has been proposed that the P O2 on Mars is 8 404 sufficient to support microaerophiles (Fisk and Giovannoni, 1999). Applying G 9 10 405 = Go’+ TR ln Q to Rxn.2 (for T ≈ 0 oC), it can be shown that this reaction is 11

12 406 exergonic ( G = -4.2 kJ/mol) even at P O2 = 0.1 mbars. Notably, the PO2 on Mars 13 14 407 (derived from ~7 mbars total pressure and ~0.13 % O 2) is ~ 10 bars (Seiff and 15 16 408 Kirk, 1977). Therefore, the oxidation of olivine and other iron bearing silicates 17 409 by nFeO microorganisms is possible on Mars if the atmospheric pressure 18 For Peer Review 19 410 increases ~10 fold (to about 70 mbar). 20 21 411 A key requirement for Earth-colonizing cellular life (including nFeOB) is the 22 23 412 presence of liquid water. Even the present day subsurface and the sub-ice 24 25 413 conditions on Mars may harbor such microbes because thin films of water exist 26 27 414 in soil, even below freezing (Anderson and Tice, 1973). Low-temperature brines 28 415 (maintaining liquid water at temperatures as low as -20 oC) could have existed 29 30 416 over much of Mars’s history (Fairén, 2010). Multiple lines of evidence indicate 31 32 417 that Mars had liquid water at the surface in the past (Carr, 1995; Head et al ., 33 34 418 2003; Carr and Head, 2010; Warner et al ., 2010). Thus, some areas of the 35 36 419 shallow subsurface of past Mars satisfy two requirements for nFeO-based cellular 37 38 420 life: liquid water and redox energy in the form of olivine Fe(II) in disequilibrium 39 421 with oxidized chemicals from the planet’s surface. In the event of increases in 40 41 422 temperature and pressure on the surface of Mars (such as during terraformation 42 43 423 activities, orbital forcing, or release of greenhouse gas from buried hydrates), 44 45 424 olivine-using nFeO microorganisms would be some of the first colonists and 46 47 425 important primary producers of the newly formed Mars ecosystems. 48 426 49 50 427 Acknowledgements 51 52 428 Funding for this research was provided by NASA Astrobiology grant 53 54 429 NNX08AO22G NCE and The Cave Research Foundation. Unimin provided the 55 56 57 58 59 60 16

Mary Ann Liebert, Inc., 140 Huguenot Street, New Rochelle, NY 10801 Page 17 of 32 Astrobiology

1 2 3 4 5 6 7 430 olivine sand. We thank Gus Frederick for assistance with the field work. Julie 8 431 Donnelly-Nolan provided the chemical and petrographic information for the 9 10 432 South Ice Cave lava flow. We also want to thank the four anonymous reviewers 11 12 433 of this manuscript for helpful suggestions. 13 14 434 15 16 435 The bibliography was modified as specified in: ASTRefExmpls 17 436 18 For Peer Review 19 437 References 20 21 438 Abramov, O., and Kring D.A. (2005) Impact-induced hydrothermal activity on 22 23 439 early Mars. J Geophys Res 110, E12S09, doi:10.1029/2005JE002453. 24 25 440 Anderson, D.M., and Tice A.R. (1973) The unfrozen interfacial phase in frozen 26 27 441 soil water systems. Ecol Stu An 4:107-124. 28 442 Bandfield, J.L., Hamilton, V.E., and Christensen P.R. (2000) A global view of 29 30 443 Martian surface compositions from MGS-TES. Science 287:1626-1630. 31 32 444 Bailey, B., Templeton, A., Staudigel, H., and Tebo, B. (2009) Utilization of 33 34 445 substrate components during basaltic glass colonization by Pseudomonas and 35 36 446 Shewanella isolates. Geomicrobiol J 26:648-656. 37 38 447 Baker, G.C., Smith, J.J., and Cowan, D.A. (2003) Review and re-analysis of 39 448 domain-specific 16S primers. J Microbiol Meth 55:541-555. 40 41 449 Benzerara, K., Barakat, M., Menguy, N., Guyot, F., De Luca, G. Audrain, C., and 42 43 450 Heulin, T. (2004) Experimental colonization and alteration of orthopyroxene 44 45 451 by the pleomorphic bacteria Ramlibacter tataouinensis , Geomicrobiol J 46 47 452 21:341-349. 48 453 Boston, P.J., Ivanov, M., and McKay, C.P. (1992) On the possibility of 49 50 454 chemosynthetic ecosystems in subsurface habitats on Mars. Icarus 95:300- 51 52 455 308. 53 54 55 56 57 58 59 60 17

Mary Ann Liebert, Inc., 140 Huguenot Street, New Rochelle, NY 10801 Astrobiology Page 18 of 32

1 2 3 4 5 6 7 456 Boston, P.J., (2010) Location, location, location! Lava caves on Mars for habitat, 8 457 resources, and the search for life. J Cosmol 12:3957-3979. 9 10 458 Buss, H. L., Luttge, A., and Brantley, S.L. (2007) Etch pit formation on iron 11 12 459 silicate surfaces during siderophore-promoted dissolution. Chem Geol 13 14 460 240:326-342. 15 16 461 Carr, M.H. (1995) Water on Mars. New York, Oxford University Press, 229 pp. 17 462 Carr, M.H., and Head, J.W. (2010) Geologic history of Mars. Earth Planet Sc 18 For Peer Review 19 463 Lett 294:185-203. 20 21 464 Chan, Y.K., Barraquio, W.L., and Knowles, R. (1994) N 2-fixing pseudomonads 22 23 465 and related soil bacteria. FEMS Microbiol Rev 13:95-117. 24 25 466 Clifford, S.M., Lasue, J., Heggy, E., Boisson, J., McGovern, P., and Max, M.D. 26 27 467 (2010) Depth of the Martian cryosphere: Revised estimates and implications 28 468 for the existence and detection of subpermafrost groundwater. J Geophy Res- 29 30 469 Planet 115:E07001. 31 32 470 Cornelis P., and Matthijs, S. (2002) Diversity of siderophore-mediated iron 33 34 471 uptake systems in fluorescent pseudomonads: not only pyoverdines. Environ 35 36 472 Microbiol 4:787-798. 37 38 473 Cushing, G.E., Titus, T.N., Wynne, J.J., and Christensen, P.R., (2007) THEMIS 39 474 observes possible cave skylights on Mars, Geophys Res Lett 34, 40 41 475 doi:10.1029/2007GL030709. 42 43 476 Duckworth, O.W., Holmstrom, S.J.M., Pena, J., and Sposito, G. (2009) 44 45 477 Biogeochemistry of iron oxidation in a circumneutral freshwater habitat 46 47 478 Chem Geol 260:149-158. 48 49 479 Edwards, C.S., Christensen, P.R., and Hamilton, V.E. (2008) Evidence for 50 480 extensive olivine-rich basalt bedrock outcrops in Ganges and Eos chasmas, 51 52 481 Mars. J Geophys Res–Planet 113, DOI: 10.1029/2008JE003091. 53 54 55 56 57 58 59 60 18

Mary Ann Liebert, Inc., 140 Huguenot Street, New Rochelle, NY 10801 Page 19 of 32 Astrobiology

1 2 3 4 5 6 7 482 Edwards, K.J., Rogers, D.R., Wirsen, C.O., and McCollom, T.M. (2003a) 8 483 Isolation and characterization of novel psychrophilic, neutrophilic, Fe- 9 10 484 oxidizing, chemolithoautotrophic alpha- and, gamma-Proteobacteria from the 11 12 485 deep sea. Appl Environ Microb 69:2906-2913. 13 14 486 Edwards, K.J., Bach, W., and Rogers, D.R. (2003b) Geomicrobiology of the 15 16 487 ocean crust: A role for chemoautotrophic Fe-bacteria, Biol Bull 204:180-185. 17 488 Edwards, K.J., Bach, W., McCollom, T.M., and Rogers, D.R. (2004) 18 For Peer Review 19 489 Neutrophilic iron-oxidizing bacteria in the ocean: Their habitats, diversity, 20 21 490 and roles in mineral deposition, rock alteration, and biomass production in the 22 23 491 deep-sea. Geomicrobiol J 21:393-404. 24 25 492 Emerson, D., and Floyd, M.M. (2005) Enrichment and isolation of iron-oxidizing 26 27 493 bacteria at neutral pH. In Environmental Microbiology Book series: Methods 28 494 in Enzymology , 397:112-123. 29 30 495 Emerson, D., and Moyer, C. (1997) Isolation and characterization of novel iron- 31 32 496 oxidizing bacteria that grow at circumneutral pH. Appl Environ Microb 33 34 497 63:4784-4792. 35 36 498 Emerson, D., and Moyer, C.L. (2002) Neutrophilic Fe-oxidizing bacteria are 37 38 499 abundant at the Loihi Seamount hydrothermal vents and play a major role in 39 500 Fe oxide deposition. Appl Environ Microb 68:3085-3093. 40 41 501 Fairén, A.G. (2010) A cold and wet Mars. Icarus 208:165-175. 42 43 502 Felsenstein, J. (1985) Confidence limits on phylogenies: An approach using the 44 45 503 bootstrap. Evolution 39:783-791. 46 47 504 Fisk, M.R., and Giovannoni, S.J. (1999) Sources of nutrients and energy for a 48 49 505 deep biosphere on Mars. J Geophys Res 104:11805-11815. 50 506 Fisk, M.R., Popa, R. Mason, O. Storrie-Lombardi, M. and Vicenzi, E. (2006) 51 52 507 Iron-magnesium silicate bioweathering on Earth (and Mars?). Astrobiology 53 54 508 6:48-68. 55 56 57 58 59 60 19

Mary Ann Liebert, Inc., 140 Huguenot Street, New Rochelle, NY 10801 Astrobiology Page 20 of 32

1 2 3 4 5 6 7 509 Fogg, M.J. (1996) The utility of geothermal energy on Mars. J Brit Inter Soc 8 510 49:403-422 9 10 511 Gronstal, A., Pearson, V., Kappler, A., Dooris, C., Anand, M., Poitrasson, F., 11 12 512 Kee, T.P., and Cockell, C.S. (2009) Laboratory experiments on the 13 14 513 weathering of iron meteorites and carbonaceous chondrites by iron-oxidizing 15 16 514 bacteria, Meteorit Planet Sci 44:233-247. 17 515 Hafenbradl, D., Keller, M., Dirmeier, R., Rachel, R., Roßnagel, P., Burggraf, S., 18 For Peer Review 19 516 Huber, H., and Stetter, K.O. (1996) Ferroglobus placidus gen. nov., sp. nov ., 20 21 517 a novel hyperthermophilic archaeum that oxidizes Fe2+ at neutral pH under 22 23 518 anoxic conditions. Arch Microbiol 166:308-314. 24 25 519 Head, J.W., Mustard, J.F., Kreslavsky, M.A., Milliken, R.E., and Marchant, D.R. 26 27 520 (2003) Recent ice ages on Mars. Nature 426:797-802. 28 521 Hoefen, T.M., Clark, R.N., Bandfield, J.L., Smith, M.D., Pearl, J.C., and 29 30 522 Christensen, P.R. (2003) Discovery of olivine in the Nili Fossae region of 31 32 523 Mars. Science 302:627-630. 33 34 524 Jepson, S.M., Priscu, J.C., Grimm, R.E., and Bullock, M.A. (2007) The potential 35 36 525 for lithoautotrophic life on Mars: application to shallow inerfacial water 37 38 526 environments. Astrobiology 7:342-353. 39 527 Josef, J.A., Fisk, M.R., and Giovanoni, S. (2007) Perodotite dissolution rates in 40 41 528 microbial enrichment cultures. In Proceedings of the Ocean Drilling 42 43 529 Program , 209. Lane 1991., edited by P.B. Kelemen, E. Kikawa, and D.J. 44 45 530 Miller. 46 47 531 Kappler, A., and Newman, D.K. (2004) Formation of Fe(III)-minerals by Fe(II)- 48 49 532 oxidizing photoautotrophic bacteria. Geochim Cosmochim Ac 68:1217-1226. 50 533 Kappler, A., Schink, B. and Newman, D.K. (2005) Fe(III) mineral formation and 51 52 534 cell encrustation by the nitrate-dependent Fe(II)-oxidizer strain BoFeN1. 53 54 535 Geobiology 3:235-245. 55 56 57 58 59 60 20

Mary Ann Liebert, Inc., 140 Huguenot Street, New Rochelle, NY 10801 Page 21 of 32 Astrobiology

1 2 3 4 5 6 7 536 Leboffe, M.J., and Pierce, B.E. (2010) Microbiology laboratory theory and 8 537 application, 3 rd ed. Morton Publishing Co ., Englewood, Colorado. 9 10 538 Lehman, R.M., O'Connell, S.P. Banta, A., Fredrickson, J.K., Reysenbach, A.L., 11 12 539 Kieft, T.L., and Colwell, F.S. (2004) Microbiological comparison of core and 13 14 540 groundwater samples collected from a fractured basalt aquifer with that of 15 16 541 dialysis chambers incubated in situ. Geomicrobiol J 21:169-182. 17 542 Luo, W.S., and Gu, B.H. (2011) Dissolution of uranium-bearing minerals and 18 For Peer Review 19 543 mobilization of uranium by organic ligands in a biologically reduced 20 21 544 sediment. Environ Sci Technol 45:2994-2999. 22 23 545 Mahmood, Q., Zheng, P., Hu, B.L., Jilani, G., Azim, M.R., Wu, D.L., and Liu, 24 25 546 D. (2009) Isolation and characterization of Pseudomonas stutzeri QZ1 from 26 27 547 an anoxic sulfide-oxidizing bioreactor. Anaerobe 15:108-115. 28 548 Martínez J.S., Zhang, G.P., Holt, P.D., Jung, H.T., Carrano, C.J., Haygood, 29 30 549 M.G., and Butler, A. (2000) Self-assembling amphiphilic siderophores from 31 32 550 marine bacteria. Science 287:1245-1247. 33 34 551 Miot, J., Benzerara, K., Morin, G., Kappler, A., Bernard, S., Obst, M., Ferard, C., 35 36 552 Skouri-Panet, F., Guigner, J.M., Posth, N., Galvez, M., Brown, G.E., and 37 38 553 Guyot, F. (2009) Iron biomineralization by anaerobic neutrophilic iron- 39 554 oxidizing bacteria. Geochim Cosmochim Ac 73:696-711. 40 41 555 Morikawa, M., and Imanaka, T. (1993) Isolation of a new mixotrophic bacterium 42 43 556 which can fix CO 2 and assimilate aliphatic and aromatic hydrocarbons 44 45 557 anaerobically. J Ferment Bioeng 76:280-283. 46 47 558 Neaman, A., Chorover, J., and Brantley, S.L., (2005) Implications of the 48 49 559 evolution of organic acid moieties for basalt weathering over geological time. 50 560 Am J Sci 305:147-185. 51 52 561 Newman, D.K. (2010) Feasting on minerals. Science 327:793-794. 53 54 55 56 57 58 59 60 21

Mary Ann Liebert, Inc., 140 Huguenot Street, New Rochelle, NY 10801 Astrobiology Page 22 of 32

1 2 3 4 5 6 7 562 Northup, D.E., Melim, L.A., Spilde, M.N., Hathaway, J.J.M., Garcia, M.G., 8 563 Moya, M., Stone, F.D., Boston, P.J., Dapkevicius, M.L.N.E., and Riquelme, 9 10 564 C. (2011) Lava cave microbial communities within mats and secondary 11 12 565 mineral deposits: Implications for life detection on other planets. 13 14 566 Astrobiology 11:601-618. 15 16 567 Saitou, N., and Nei, M. (1987) The neighbor-joining method: A new method for 17 568 reconstructing phylogenetic trees. Mol Biol Evol 4:406-425. 18 For Peer Review 19 569 Samarkin, V.A., Madigan, M.T. Bowles, M.W., Casciotti, K.L., Priscu, J.C., 20 21 570 Mckay, C.P., and Joye, S.B. (2010) Abiotic nitrous oxide emission from the 22 23 571 hypersaline Don Juan Pond in Antarctica. Nat Geosci 3:341-344. 24 25 572 Santelli, C.M., Welch, S.A., and Banfield, J.F. (2001) The effect of Fe-oxidizing 26 27 573 bacteria on Fe-silicate mineral dissolution rates. Chem Geol 180:99-115. 28 574 Schippers, A., and Jorgensen, B.B. (2002) Biogeochemistry of pyrite and iron 29 30 575 sulfide oxidation in marine sediments. GeochimCosmochim Ac 66:85-92. 31 32 576 Schippers, A., Neretin, L.N., Kallmeyer, J., Ferdelman, T.G., Cragg, B.A., 33 34 577 Parkes, R.J., and Jørgensen, B.B. (2005) Prokaryotic cells of the deep sub- 35 36 578 seafloor biosphere identified as living bacteria. Nature 433:861-864. 37 38 579 Seiff, A., and Kirk, D. (1977) Structure of the atmosphere of Mars in summer at 39 580 mid-latitudes. J Geophys Res 82:4364–4378. 40 41 581 Smil, V. (2000) Cycles of life civilization and the biosphere. Scientific American 42 43 582 Library , New York. 44 45 583 Smith, A.R., Popa, R., Fisk, M.R., Nielsen, M.E., Wheat, C.G., Jannasch, H.W., 46 47 584 Fisher, A.T., Becker, K., Sievert. S.M., Flores, G. (2011) In situ enrichment 48 49 585 of ocean crust microbes on igneous minerals and glasses using an osmotic 50 586 flow-through device. Geochem Geophy Geosy 12,Q06007. 51 52 587 Steiner, M., and Lazaroff, N. (1974) Direct method for continuous determination 53 54 588 of iron oxidation by autotrophic bacteria. Appl Environ Microb 28:872-880. 55 56 57 58 59 60 22

Mary Ann Liebert, Inc., 140 Huguenot Street, New Rochelle, NY 10801 Page 23 of 32 Astrobiology

1 2 3 4 5 6 7 589 Stevens, T. (1997) Lithoautotrophy in the subsurface. FEMS Microbiol Rev 8 590 20:327-337. 9 10 591 Straub, K.L., Benz, M., Schink, B. and Widdel, F. (1996) Anaerobic, nitrate- 11 12 592 dependent microbial oxidation of ferrous iron. Appl Environ Microb 62:1458- 13 14 593 1460. 15 16 594 Straub, K.L., Schonhuber, W.A., Buchholz-Cleven, B.E.E., and Schink, B., 17 595 (2004) Diversity of ferrous iron-oxidizing, nitrate-reducing bacteria and their 18 For Peer Review 19 596 involvement in oxygen-independent iron cycling. Geomicrobiol J 21:371-378. 20 21 597 Swindle T.D., Treiman, A.H., Lindstrom, D.J., Burkland, M.K., Cohen, B.A., 22 23 598 Grier, J.A., Li, B., and Olson, E.K. (2000) Noble gases in iddingsite from the 24 25 599 Lafayette meteorite: Evidence for liquid water on Mars in the last few 26 27 600 hundred million years". Meteorit Planet Sci 35:107-115. 28 601 Tamura, K., Dudley, J., Nei, M., and Kumar, S. (2007) MEGA4: Molecular 29 30 602 Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 31 32 603 24:1596-1599. 33 34 604 Tamura, K., Nei, M., and Kumar, S. (2004) Prospects for inferring very large 35 36 605 phylogenies by using the neighbor-joining method. Proc Natl Acad Sci USA 37 38 606 101:11030-11035. 39 607 Thauer, R.K., Jungermann, K., and Decker, K. (1977) Energy conservation in 40 41 608 chemotrophic anaerobic bacteria. Bacteriol Rev 41:100-180. 42 43 609 Travis, B.J., Rosenberg, N.D., and Cuzzi, J.N. (2003) On the role of widespread 44 45 610 subsurface convection in bringing liquid water close to Mars' surface. J 46 47 611 Geophys Res-Planet 108, doi: 10.1029/2002JE001877. 48 49 612 YULIAR (1997) Autotrophic CO 2 fixation in Pseudomonas sp. Strain HD-1. 50 613 Hayati Journal of Biosciences 4:59-61. 51 52 53 54 55 56 57 58 59 60 23

Mary Ann Liebert, Inc., 140 Huguenot Street, New Rochelle, NY 10801 Astrobiology Page 24 of 32

1 2 3 4 5 6 7 614 Wang, J.J., Muyzer, G., Bodelier, P.L.E., and Laanbroek, H.J. (2009) Diversity 8 615 of iron oxidizers in wetland soils revealed by novel 16S rRNA primers 9 10 616 targeting Gallionella -related bacteria. ISME J 3:715-725. 11 12 617 Warner, N., Gupta, S. Lin, S.Y., Kim, J.R., Muller, J.P., and Morley, J. (2010) 13 14 618 Late Noachian to Hesperian climate change on Mars: evidence of episodic 15 16 619 warming from transient crater lakes near Ares Vallis. J Geophys Res-Planet 17 620 115:E06013. 18 For Peer Review 19 621 Welch S.A., and Banfield, J.F. (2002) Modification of olivine surface 20 21 622 morphology and reactivity by microbial activity during chemical weathering. 22 23 623 Geochim Cosmochim Ac 66:213-221. 24 25 624 Williams, K.E., McKay, C.P., Toon, O.B., and Head, J.W. (2010) Do ice caves 26 27 625 exist on Mars? Icarus 209:358-368. 28 626 Widdel, F., Schnell, S., Heising, S., Ehrenreich, A., Assmus, B., and Schink, B. 29 30 627 (1993) Ferrous iron oxidation by anoxygenic phototrophic bacteria. Nature 31 32 628 362:834-836. 33 34 629 Wu, L.L., Jacobson, A.D., Chen H.C., and Hausner, M. (2007) Characterization 35 36 630 of elemental release during microbe-basalt interactions at T=28 degrees C. 37 38 631 Geochim Cosmochim Ac 71:2224-2239. 39 632 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 24

Mary Ann Liebert, Inc., 140 Huguenot Street, New Rochelle, NY 10801 Page 25 of 32 Astrobiology

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 20 21 22 23 24 25 26 Fig. 1. Flow chart of activities used to isolate, identify, select and characterize a neutrophilic iron-oxidizing 27 microorganism (nFeOM), that is facultative organotroph, psychrotolerant or psychrophilic, using O 2 as an 28 electron acceptor, and capable of growing with bicarbonate as a sole source of carbon and olivine-iron(II) as 29 a sole source of energy. The strain selected for this study is Pseudomonas sp . HerB. 149x83mm (300 x 300 DPI) 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Mary Ann Liebert, Inc., 140 Huguenot Street, New Rochelle, NY 10801 Astrobiology Page 26 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 Fig. 2. Tree indicating the phylogenetic position of 29 aerobic heterotrophic strains, in parentheses, isolated 37 from South Ice Cave. Eleven of these strains, in bold font (7 Pseudomonas , 2 Acidovorax and 2 38 Brevundimonas ) also showed growth when incubated in a mineral medium with olivine as the sole source of 39 reducing power. The sequences of these eleven isolates were submitted to GenBank under the accession numbers: JN399075 through JN399085. The evolutionary history was inferred based on partial 16S rRNA 40 gene sequences using neighbor-joining analysis. Bootstrap percentages above 50 %, based on 500 41 replicates (Felsenstein, 1985) are shown next to the branches. Bar, 5 substitutions per 100 42 nucleotides. The insert image shows cells of Pseudomonas sp . HerB grown in R2A medium seen by phase 43 contrast optical microscopy at 1000x. The same cell shape and size was seen when HerB cells grew in 44 FeCO 3 gradient tubes and in olivine-containing liquid mineral medium. 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Mary Ann Liebert, Inc., 140 Huguenot Street, New Rochelle, NY 10801 Page 27 of 32 Astrobiology

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 Fig. 3. (a) The growth ofFor Pseudomonas Peer sp . HerB with olivineReview as a source of energy. Incubation in Hungate - o 19 tubes with 10 mL medium, 20 mM HCO 3 , 1 mL/L vitamins mix, pH 7, 1.6 % O 2 at 30 C. In this experiment - 20 we compared growth with/without 10 % w:v olivine sand, and with/without 10 mM NO 3 . I = Initial cell 2 - - - 21 density (~7.7•10 cells/mL). A = No olivine, no NO 3 . B = with olivine, no NO 3 . C = No olivine, with NO 3 - 22 . D = with olivine, with NO 3 . Cell counts are based on triplicates and were determined by microscopy after 23 seven days of incubation. Error bars are 1SD from triplicates. (b) Evolution of the O 2 concentration in gas 24 phase during the growth of Pseudomonas sp . HerB in a mineral medium with olivine (subtracted from an un- inoculated control). Incubations were in 140 mL serum bottles with 10 mL mineral medium, 10 % w:v 25 - o olivine sand, 20 mM HCO 3 , 1 mL/L vitamins mix, pH 7, and ~1.1 bar initial pressure at 30 C. The error bars 26 are 1SD based on triplicate readings of one bottle. 27 52x16mm (300 x 300 DPI) 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Mary Ann Liebert, Inc., 140 Huguenot Street, New Rochelle, NY 10801 Astrobiology Page 28 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 Fig. 4. (a) The growth ofFor Pseudomonas Peer sp . HerB in olivine-containingReview mineral media at different pHs. The - 19 media contained 20 mM HCO 3 , 10 % w:v olivine sand and 1 mL/L vitamins mix, and incubation occurred o 20 under 1.6 % O 2 at 30 C for seven days. (b) Growth in the same mineral medium at pH 7 and with various - o 3 21 concentrations of HCO 3 , incubated for 14 days at 20 C. I = Initial cell density (~3.8•10 cells/mL). The 22 error bars are 1SD from triplicates. 23 52x16mm (300 x 300 DPI) 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Mary Ann Liebert, Inc., 140 Huguenot Street, New Rochelle, NY 10801 Page 29 of 32 Astrobiology

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 20 21 22 23 24 25 26 27 Fig. 5. (a) Growth profiles of Pseudomonas sp . HerB in TSB medium at five temperatures (5 oC; 10 oC; 15 oC; 28 25 oC and 30 oC). No growth was seen at 2 oC, 37 oC and 40 oC. The values shown are averages of triplicates 29 and the errors bars equal 1SD. The interrupted lines are hand drawn and help observe the general trend of 30 each set of data. The straight lines are linear regression slopes for the data points situated near and opposite sides of the inflexion point of the polynomial fit, in the part of the curve that represents the 31 exponential growth phase. All cultures started from ~10 3 cells mL -1 and were incubated in 18 mm diameter 32 test tubes with 10 mL medium. (b) The effect of temperature on the growth rate, calculated based on the 33 slope of the exponential phase shown in (a). The error bars from (b) are 1SD of the expected variation in 34 the slope of exponential growth in (a) based on +/-1SD of cell density. 35 52x16mm (300 x 300 DPI) 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Mary Ann Liebert, Inc., 140 Huguenot Street, New Rochelle, NY 10801 Astrobiology Page 30 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 20 21 22 23 24 25 26 27 28 29 Fig. 6. The growth of Pseudomonas sp . HerB in mineral medium with olivine of two particle sizes (olivine o o 30 sand and olivine beads) and at two temperatures (5 C and 20 C). These two olivine samples are different 31 with regard to size (and thus surface area) but are similar in composition. Incubation occurred for seven days in Hungate tubes, 5 mL mineral medium, 10 % w:v olivine, 20 mM HCO -, pH 7, 1.6 % O , and 1 mL/L 32 3 2 vitamins mix. The error bars are 1 SD from triplicates. 33 54x35mm (300 x 300 DPI) 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Mary Ann Liebert, Inc., 140 Huguenot Street, New Rochelle, NY 10801 Page 31 of 32 Astrobiology

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 20 21 22 23 24 25 26 27 28 Fig. 7. Growth of Pseudomonas sp . HerB in mineral medium (with/without olivine) and various abundances 29 - of vitamins mix. Incubation occurred in test tubes with 5 mL mineral medium, 10 mM HCO 3 , with/without 30 20 olivine beads (~840 mg olivine per tube), and at pH 7. All cultures started from ~5.3•10 3 cells/mL. The o 31 graph shows cell densities after 7 days at 1.6 % O 2 and 20 C. 32 52x33mm (300 x 300 DPI) 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Mary Ann Liebert, Inc., 140 Huguenot Street, New Rochelle, NY 10801 Astrobiology Page 32 of 32

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 20 21 22 23 24 25 26 27 Fig. 8. The growth of Pseudomonas sp . HerB in mineral medium with olivine sand and olivine beads after 28 removing traces of organics by heating the crystals at 500 oC. Incubation occurred for 14 days in Hungate - 29 tubes, with 5 mL mineral medium, 10 % w:v olivine, 20 mM HCO 3 , pH 7, 1 ml/L vitamins mix and 1.6 % 30 O2. The treatments shown in the graph are: I = initial cell density; X = no olivine present; A = non heat treated olivine sand; B = heat-treated olivine sand; C = non-heat-treated olivine beads; and D = heat- 31 treated olivine beads. The values shown are averages of triplicates and error bars equal 1 SD. 32 47x28mm (300 x 300 DPI) 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Mary Ann Liebert, Inc., 140 Huguenot Street, New Rochelle, NY 10801