DOCSLIB.ORG

Glucose Tolerance in Obese Men Is Associated with Dysregulation of Some Angiogenesis-Related Gene Expressions in Subcutaneous Adipose Tissue O.H

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Glucose Tolerance in Obese Men Is Associated with Dysregulation of Some Angiogenesis-Related Gene Expressions in Subcutaneous Adipose Tissue O.H УДК 577.112:616 Glucose tolerance in obese men is associated with dysregulation of some angiogenesis-related gene expressions in subcutaneous adipose tissue O.H. Minchenko1, Y.M. Bashta1, D.O. Minchenko1,2, O.O. Ratushna1 1Palladin Institute of Biochemistry National Academy of Sciences of Ukraine, Kyiv; 2Bogomolets National Medical University, Kyiv; E-mail: [email protected] Obesity and its metabolic complications are one of the most profound public health problems and result from interactions between genes and environmental. The development of obesity is tightly connected with dysregulation of intrinsic gene expression mechanisms controlling majority of metabolic processes, which are essential for regulation many physiological functions, including insulin sensitivity, cellular prolifera- tion and angiogenesis. Our objective was to evaluate if expression of angiogenesis related genes VEGF-A, CYR61, PDGFC, FGF1, FGF2, FGFR2, FGFRL1, E2F8, BAI2, HIF1A, and EPAS1 at mRNA level in adipose tissue could participate in the development of obesity and metabolic complications. We have shown that expression level of VEGF-A, PDGFC, FGF2, and FGFRL1 genes is decreased in adipose tissue of obese men with normal glucose tolerance (NGT) versus a group of control subjects. At the same time, in this group of obese individuals a significant up-regulation of CYR61, FGF1, FGFR2, E2F8, BAI2, and HIF1A gene expressions was observed. Impaired glucose tolerance (IGT) in obese patients associates with down-regulation of CYR61 and FGFR2 mRNA and up-regulations of E2F8, FGF1, FGF2, VEGF-A and its splice variant 189 mRNA expressions in adipose tissue versus obese (NGT) individuals. Thus, our data demonstrate that the expression of almost all studied genes is affected in subcutaneous adipose tissue of obese individuals with NGT and that glucose intolerance is associated with gene-specific changes in the expression of E2F8, FGF1, FGF2, VEGF-A, CYR61 and FGFR2 mRNAs. The data presented here provides evidence that VEGF-A, CYR61, PDGFC, FGF1, FGF2, FGFR2, FGFRL1, E2F8, BAI2, and HIF1A genes are possibly involved in the development of obesity and its complications. Key words: mRNA expression, VEGF-A, CYR61, FGF1, FGF2, FGFR2, E2F8, HIF1A, adipose tissue, obesity, men INTRODUCTION clock because biological rhythms are an integral component of essentially all aspects of life and Accumulating evidence raises the hypothesis regulate many physiological functions, includ- that development of obesity and its metabolic ing insulin sensitivity and cellular proliferation complications is tightly associated with dys- regulation of mechanisms controlling majority [4-7]. Molecular and cellular studies have de- of metabolic processes, especially in adipose monstrated relationships between the dysfunc- tissue, which is at the center of metabolic syn- tion of circadian clocks and the development of drome in obese individuals [1-3]. Obesity and obesity and metabolic abnormalities, including its metabolic complications are one of the most type 2 diabetes [8]. At the same time, metabolic profound public health problems and result from processes feed-back into the circadian clock, interactions between genes and environmen- affecting clock gene expression and timing of tal. There is data that development of obesity behavior [9]. is connected with dysregulation of numerous The growing adipose tissue is associated gene expressions mainly through biological with cell proliferation and angiogenesis like © O.H.Minchenko, Y.M.Bashta, D.O. Minchenko, O.O. Ratushna 12 ISSN 0201-8489 Фізіол. журн., 2016, Т. 62, № 2 O.H.Minchenko, Y.M.Bashta, D.O. Minchenko, O.O. Ratushna other growing tissues including tumors [10-12]. but FGFRL1 (fibroblast growth factor receptor- It is well known that angiogenesis is mediated by like 1) protein expression was lower in bladder numerous factors, but substantial evidence accu- tumors compared to normal tissue. Furthermore, mulating over the last decade has established the a marked difference between FGFRL1 and the fundamental role of vascular endothelial growth other family members is its lack of a cytoplasmic factor (VEGF) as a key regulator of normal and tyrosine kinase domain and potentially inhibit abnormal angiogenesis evidence especially in signaling. tumors [13-15]. Importantly, VEGF is released There is also data that transcription factor by tumor cells and induces neovascularization E2F8 creates complexes with other members in the majority of human tumors. Furthermore, of E2F family of transcription factors and co- VEGF is implicated in intraocular neovasculari- ordinates various cellular functions through the zation associated with diabetic retinopathy [16]. regulation of the expression of target genes, In addition, there are factors, such as connective thereby regulating cell cycle, apoptosis, and an- tissue growth factor (CTGF), which can bind giogenesis, including transcriptional activation VEGF and inhibits VEGF-induced angiogenesis of VEGFA in cooperation with HIF1 [26-28]. [17]. Moreover, downregulation of CTGF by the There is data [29] that metabolic reprogramming miR-17-92 microRNA enhances neovasculariza- of cancer cells without tumor suppressor LKB1 tion [17]. is realized through HIF1 [29]. Furthermore, an An important role in the control of angiogene- important role in metabolic integration plays sis also play cysteine-rich angiogenic inducer 61 the unfolded protein response/endoplasmic (CYR61), brain-specific angiogenesis inhibi- reticulum stress, which activates a complex set tor 2 (BAI2), platelet derived growth factor C of signaling pathways and links obesity with (PDGFC), fibroblast growth factors and their insulin action and contributes to the expression receptors, and some transcription factors like profile of many regulatory genes resulting in hypoxia inducible factor 1a (HIF1A), endo- peripheral insulin resistance and diabetic com- thelial PAS domain protein 1 (EPAS1/HIF2A), plications, acting by inhibiting insulin receptor and E2F8 (transcription factor of E2F family) signaling [30–33]. [18-25]. Thus, CYR61 and PDGFC play an However, detailed molecular mechanisms of important role in proliferation and angiogene- the involvement of angiogenesis-related genes in sis [18, 20]. Fibroblast growth factor proteins the development of obesity and its complications (FGF1 and FGF2), which also known as acidic are not clear yet and remain to be determined. and basic fibroblast growth hormones, are The aim of this study was to investigate the mitogenic signaling molecules that have roles expression of genes encoded key angiogenesis- in angiogenesis and function as a modifier of related factors in subcutaneous adipose tissue of endothelial cell migration and proliferation, but obese men with normal and impairment glucose FGF2 mainly induces lymphangiogenesis [21- tolerance for evaluation of possible significance 23]. Moreover, FGF1 is required for adaptive these genes in the development of obesity and its adipose remodeling and metabolic homeostasis complications, particularly glucose intolerance. and FGF2 prevents cancer cells from endoplas- mic reticulum stress-mediated apoptosis [21, METHODS 23]. Biological effect of the fibroblast growth factors is realized through the fibroblast growth The 18 adult males participated in the study. factor receptors, some of which are related They were divided into three equal groups: to VEGF signaling pathway [24, 25]. Thus, 6 lean healthy controls, 6 obese with normal FGFR2 (fibroblast growth factor receptor 2) glucose tolerance (NGT), and 6 obese with interacts predominantly with FGF1 and FGF2, impaired glucose tolerance (IGT). Clinical cha- ISSN 0201-8489 Фізіол. журн., 2016, Т. 62, № 2 13 Glucose tolerance in obese men is associated with dysregulation of some angiogenesis-related gene expressions racteristics of the study participants are shown in we used next forward and reverse primers: Table 1. All participants gave written informed 5’– CCACCACAGCAAATATCGTF –3’ and consent and the studies were approved by the 5’– CTTTGGCCTCAGGTAATCCA –3’, cor- local research ethics committees of Institute of respondingly. The nucleotide sequences of these Experimental Endocrinology Slovak Academy primers correspond to sequences 596 – 615 and of Sciences. 805 – 786 of human E2F8 cDNA (GenBank RNA was extracted from subcutaneous accession number NM_024680). The size of adipose tissue samples using RNasy Lipid Tis- amplified fragment is 210 bp. The amplification sue Mini Kit (QIAGEN, Germany) according of EPAS1 (endothelial PAS domain protein 1), to manufacturer’s protocol. The RNA pellets also known as hypoxia-inducible factor 2alpha were washed with 75 % ethanol and dissolved (HIF-2a), cDNA for real time RCR analysis was in nuclease-free water. For additional purifica- performed using two oligonucleotides primers: tion RNA samples were re-precipitated with forward – 5’– AAGCCTTGGAGGGTTTCATT 95 % ethanol and re-dissolved again in nuclease- –3’ and reverse – 5’– TCATGAAGAAGTCCC- free water. QuaniTect Reverse Transcription GCTCT –3’. The nucleotide sequences of these Kit (QIAGEN, Germany) was used for cDNA primers correspond to sequences 788 – 807 and synthesis according to manufacturer protocol. 1021 – 1002 of human EPAS1 cDNA (GenBank The expression levels of VEGF-A, CYR61, accession number NM_001430). The size of am- PDGFC, FGF1, FGF2, FGFR2, FGFRL1, E2F8, plified fragment is 234 bp. For amplification of BAI2, HIF1A, and EPAS1 genes were measured FGF1 (fibroblast growth factor 1) cDNA we used in subcutaneous
Load more

Recommended publications
  • Role and Regulation of Pdgfra Signaling in Liver Development and Regeneration
    The American Journal of Pathology, Vol. 182, No. 5, May 2013 ajp.amjpathol.org GROWTH FACTORS, CYTOKINES, AND CELL CYCLE MOLECULES Role and Regulation of PDGFRa Signaling in Liver Development and Regeneration Prince K. Awuah,* Kari N. Nejak-Bowen,* and Satdarshan P.S. Monga*y From the Division of Experimental Pathology,* Department of Pathology, and the Department of Medicine,y University of Pittsburgh, Pittsburgh, Pennsylvania Accepted for publication January 22, 2013. Aberrant platelet-derived growth factor receptor-a (PDGFRa) signaling is evident in a subset of hepato- cellular cancers (HCCs). However, its role and regulation in hepatic physiology remains elusive. In the Address correspondence to a fi Satdarshan P.S. Monga, M.D., current study, we examined PDGFR signaling in liver development and regeneration. We identi ed a a Divisions of Experimental notable PDGFR activation in hepatic morphogenesis that, when interrupted by PDGFR -blocking anti- Pathology, Pathology and body, led to decreased hepatoblast proliferation and survival in embryonic liver cultures. We also identified Medicine, University of Pitts- temporal PDGFRa overexpression, which is regulated by epidermal growth factor (EGF) and tumor necrosis burgh School of Medicine, 200 factor a, and its activation at 3 to 24 hours after partial hepatectomy. Through generation of hepatocyte- Lothrop St., S-422 BST, Pitts- specific PDGFRA knockout (KO) mice that lack an overt phenotype, we show that absent PDGFRa burgh, PA 15261. E-mail: compromises extracelluar signal-regulated kinases and AKT activation 3 hours after partial hepatectomy, [email protected]. which, however, is alleviated by temporal compensatory increases in the EGF receptor (EGFR) and the hepatocyte growth factor receptor (Met) expression and activation along with rebound activation of extracellular signal-regulated kinases and AKT at 24 hours.
    [Show full text]
  • Expression Profiling of KLF4
    Expression Profiling of KLF4 AJCR0000006 Supplemental Data Figure S1. Snapshot of enriched gene sets identified by GSEA in Klf4-null MEFs. Figure S2. Snapshot of enriched gene sets identified by GSEA in wild type MEFs. 98 Am J Cancer Res 2011;1(1):85-97 Table S1: Functional Annotation Clustering of Genes Up-Regulated in Klf4 -Null MEFs ILLUMINA_ID Gene Symbol Gene Name (Description) P -value Fold-Change Cell Cycle 8.00E-03 ILMN_1217331 Mcm6 MINICHROMOSOME MAINTENANCE DEFICIENT 6 40.36 ILMN_2723931 E2f6 E2F TRANSCRIPTION FACTOR 6 26.8 ILMN_2724570 Mapk12 MITOGEN-ACTIVATED PROTEIN KINASE 12 22.19 ILMN_1218470 Cdk2 CYCLIN-DEPENDENT KINASE 2 9.32 ILMN_1234909 Tipin TIMELESS INTERACTING PROTEIN 5.3 ILMN_1212692 Mapk13 SAPK/ERK/KINASE 4 4.96 ILMN_2666690 Cul7 CULLIN 7 2.23 ILMN_2681776 Mapk6 MITOGEN ACTIVATED PROTEIN KINASE 4 2.11 ILMN_2652909 Ddit3 DNA-DAMAGE INDUCIBLE TRANSCRIPT 3 2.07 ILMN_2742152 Gadd45a GROWTH ARREST AND DNA-DAMAGE-INDUCIBLE 45 ALPHA 1.92 ILMN_1212787 Pttg1 PITUITARY TUMOR-TRANSFORMING 1 1.8 ILMN_1216721 Cdk5 CYCLIN-DEPENDENT KINASE 5 1.78 ILMN_1227009 Gas2l1 GROWTH ARREST-SPECIFIC 2 LIKE 1 1.74 ILMN_2663009 Rassf5 RAS ASSOCIATION (RALGDS/AF-6) DOMAIN FAMILY 5 1.64 ILMN_1220454 Anapc13 ANAPHASE PROMOTING COMPLEX SUBUNIT 13 1.61 ILMN_1216213 Incenp INNER CENTROMERE PROTEIN 1.56 ILMN_1256301 Rcc2 REGULATOR OF CHROMOSOME CONDENSATION 2 1.53 Extracellular Matrix 5.80E-06 ILMN_2735184 Col18a1 PROCOLLAGEN, TYPE XVIII, ALPHA 1 51.5 ILMN_1223997 Crtap CARTILAGE ASSOCIATED PROTEIN 32.74 ILMN_2753809 Mmp3 MATRIX METALLOPEPTIDASE
    [Show full text]
  • Annals of Medical and Clinical Oncology Chen C, Et Al
    Annals of Medical and Clinical Oncology Chen C, et al. Ann med clin Oncol 3: 125. Short Commentary DOI: 10.29011/AMCO-125.000125 Commentary Referring to Pericyte FAK Negatively Regulates Gas6/ Axl Signalling To Suppress Tumour Angiogenesis and Tumour Growth Chen Chen, Hongyan Wang, Binfeng Wu and Jinghua Chen* Key Laboratory of Carbohydrate Chemistry and Biotechnology, Ministry of Education, School of Pharmaceutical Sciences, Jiangnan University, Wuxi 214122, PR China *Corresponding author: Jinghua Chen, Key Laboratory of Carbohydrate Chemistry and Biotechnology, Ministry of Education, School of Pharmaceutical Sciences, Jiangnan University, Wuxi 214122, PR China Citation: Chen C, Wang H, Wu B, Chen J (2020) Commentary Referring to Pericyte FAK Negatively Regulates Gas6/Axl Signalling To Suppress Tumour Angiogenesis and Tumour Growth. Ann med clin Oncol 3: 125. DOI: 10.29011/AMCO-125.000125 Received Date: 07 December, 2020; Accepted Date: 20 December, 2020; Published Date: 28 December, 2020 The published research article utilized multiple mouse Interestingly, knockout of FAK was specific to pericytes other models including melanoma, lung carcinoma and pancreatic B-cell than endothelial cells, mice models demonstrated that loss of insulinoma. Two hallmarks of cancer [1] such as angiogenesis and FAK from pericytes significantly promoted ɑ-SMA expression tumour growth had been evaluated. Two major molecules FAK (common metastatic biomarker) and NG-2 (typical angiogenesis (focal adhesion kinase 1) and Axl undertook the innovative roles related biomarker) in three cancer cells model. It suggested that of this elegant paper. They both belong to protein Tyrosine Kinase FAK may function as the tumour suppressive gene. However, (TK) family [2].
    [Show full text]
  • Cysteine-Rich 61 (Cyr61): a Biomarker Reflecting Disease Activity In
    Fan et al. Arthritis Research & Therapy (2019) 21:123 https://doi.org/10.1186/s13075-019-1906-y RESEARCHARTICLE Open Access Cysteine-rich 61 (Cyr61): a biomarker reflecting disease activity in rheumatoid arthritis Yong Fan†, Xinlei Yang†, Juan Zhao, Xiaoying Sun, Wenhui Xie, Yanrong Huang, Guangtao Li, Yanjie Hao and Zhuoli Zhang* Abstract Background: Numerous preclinical studies have revealed a critical role of cysteine-rich 61 (Cyr61) in the pathogenesis of rheumatoid arthritis (RA). But there is little literature discussing the clinical value of circulation Cyr61 in RA patients. The aim of our study is to investigate the serum Cyr61 level and its association with disease activity in RA patients. Methods: A training cohort was derived from consecutive RA patients who visited our clinic from Jun 2014 to Nov 2018. Serum samples were obtained at the enrollment time. To further confirm discovery, an independent validation cohort was set up based on a registered clinical trial. Paired serum samples of active RA patients were respectively collected at baseline and 12 weeks after uniformed treatment. Serum Cyr61 concentration was detected by enzyme-linked immunosorbent assay. The comparison of Cyr61 between RA patients and controls, the correlation between Cyr61 levels with disease activity, and the change of Cyr61 after treatment were analyzed by appropriate statistical analyses. Results: A total of 177 definite RA patients and 50 age- and gender-matched healthy controls were enrolled in the training cohort. Significantly elevated serum Cyr61 concentration was found in RA patients, demonstrating excellent diagnostic ability to discriminate RA from healthy controls (area under the curve (AUC) = 0.98, P < 0.001).
    [Show full text]
  • Salt-Inducible Kinases Dictate Parathyroid Hormone Receptor Action in Bone Development and Remodeling
    Salt-inducible kinases dictate parathyroid hormone receptor action in bone development and remodeling Shigeki Nishimori, … , Henry M. Kronenberg, Marc N. Wein J Clin Invest. 2019. https://doi.org/10.1172/JCI130126. Research In-Press Preview Bone Biology Endocrinology The parathyroid hormone receptor (PTH1R) mediates the biologic actions of parathyroid hormone (PTH) and parathyroid hormone related protein (PTHrP). Here, we showed that salt inducible kinases (SIKs) are key kinases that control the skeletal actions downstream of PTH1R and that this GPCR, when activated, inhibited cellular SIK activity. Sik gene deletion led to phenotypic changes that were remarkably similar to models of increased PTH1R signaling. In growth plate chondrocytes, PTHrP inhibited SIK3 and ablation of this kinase in proliferating chondrocytes rescued perinatal lethality of PTHrP-null mice. Combined deletion of Sik2/Sik3 in osteoblasts and osteocytes led to a dramatic increase in bone mass that closely resembled the skeletal and molecular phenotypes observed when these bone cells express a constitutively active PTH1R that causes Jansen’s metaphyseal chondrodysplasia. Finally, genetic evidence demonstrated that class IIa HDACs were key PTH1R-regulated SIK substrates in both chondrocytes and osteocytes. Taken together, our findings established that SIK inhibition is central to PTH1R action in bone development and remodeling. Furthermore, this work highlighted the key role of cAMP-regulated salt inducible kinases downstream of GPCR action. Find the latest version: https://jci.me/130126/pdf 1 Salt-inducible kinases dictate parathyroid hormone receptor action in bone development 2 and remodeling 3 4 Shigeki Nishimori1,2, Maureen J. O’Meara1, Christian Castro1, Hiroshi Noda1,3, Murat Cetinbas4, 5 Janaina da Silva Martins1, Ugur Ayturk5, Daniel J.
    [Show full text]
  • Alternative Splicing Generates an Isoform of the Human Sef Gene with Altered Subcellular Localization and Specificity
    Alternative splicing generates an isoform of the human Sef gene with altered subcellular localization and specificity Ella Preger*, Inbal Ziv*, Ariel Shabtay*, Ifat Sher*, Michael Tsang†, Igor B. Dawid†, Yael Altuvia‡, and Dina Ron*§ *Department of Biology, Technion–Israel Institute of Technology, Haifa 32000, Israel; †Laboratory of Molecular Genetics, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD 20892; and ‡Department of Molecular Genetics and Biotechnology, Hebrew University–Hadassah Medical School, Jerusalem 91120, Israel Contributed by Igor B. Dawid, December 1, 2003 Receptor tyrosine kinases (RTKs) control a multitude of biological FGFs comprise a family of 22 structurally related polypeptide processes and are therefore subjected to multiple levels of regu- mitogens that control cell proliferation, differentiation, survival, lation. Negative feedback is one of the mechanisms that provide an and migration and play a key role in embryonic patterning effective means to control RTK-mediated signaling. Sef has re- (14–16). They signal via binding and activation of a family of cently been identified as a specific antagonist of fibroblast growth cell-surface tyrosine kinase receptors designated FGF receptors factor (FGF) signaling in zebrafish and subsequently in mouse and 1–4 (FGFR1–FGFR4) (17–20). Activated receptors trigger sev- human. Sef encodes a putative type I transmembrane protein that eral signal transduction cascades including the Ras͞MAPK and antagonizes the Ras͞mitogen-activated protein kinase pathway in the PI3-kinase pathway (15, 21). Depending on the cell type, all three species. Mouse Sef was also shown to inhibit the phos- FGF can also activate other MAPK pathways, such that leading phatidylinositol 3-kinase pathway.
    [Show full text]
  • PDGF-C and PDGF-D Signaling in Vascular Diseases and Animal Models
    Molecular Aspects of Medicine 62 (2018) 1e11 Contents lists available at ScienceDirect Molecular Aspects of Medicine journal homepage: www.elsevier.com/locate/mam PDGF-C and PDGF-D signaling in vascular diseases and animal models * Erika Folestad a, Anne Kunath b, Dick Wågsater€ b, a Division of Vascular Biology, Department of Medical Biochemistry and Biophysics, Karolinska Institutet, Stockholm, Sweden b Division of Drug Research, Department of Medical and Health Sciences, Linkoping€ University, Linkoping,€ Sweden article info abstract Article history: Members of the platelet-derived growth factor (PDGF) family are well known to be involved in different Received 31 August 2017 pathological conditions. The cellular and molecular mechanisms induced by the PDGF signaling have Received in revised form been well studied. Nevertheless, there is much more to discover about their functions and some 14 November 2017 important questions to be answered. This review summarizes the known roles of two of the PDGFs, Accepted 22 January 2018 PDGF-C and PDGF-D, in vascular diseases. There are clear implications for these growth factors in several Available online 14 February 2018 vascular diseases, such as atherosclerosis and stroke. The PDGF receptors are broadly expressed in the cardiovascular system in cells such as fibroblasts, smooth muscle cells and pericytes. Altered expression Keywords: Aneurysm of the receptors and the ligands have been found in various cardiovascular diseases and current studies fi Atherosclerosis have shown important implications of PDGF-C and PDGF-D signaling in brosis, neovascularization, Growth factor atherosclerosis and restenosis. Myocardial infarction © 2018 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND Smooth muscle cells license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
    [Show full text]
  • TABLE S1 Complete Overview of Protocols for Induction of Pscs Into
    TABLE S1 Complete overview of protocols for induction of PSCs into renal lineages Ref 2D/ Cell type Protocol Days Growth factors Outcome Other analyses # 3D hiPSC, hESC, Collagen type I tx murine epidydymal fat pads,ex vivo 54 2D 8 Y27632, AA, CHIR, BMP7 IM miPSC, mESC Matrigel with murine fetal kidney hiPSC, hESC, Suspension,han tx murine epidydymal fat pads,ex vivo 54 2D 20 AA, CHIR, BMP7 IM miPSC, mESC ging drop with murine fetal kidney tx murine epidydymal fat pads,ex vivo 55 hiPSC, hESC Matrigel 2D 14 CHIR, TTNPB/AM580, Y27632 IM with murine fetal kidney Injury, tx murine epidydymal fat 57 hiPSC Suspension 2D 28 AA, CHIR, BMP7, TGF-β1, TTNPB, DMH1 NP pads,spinal cord assay Matrigel,membr 58 mNPC, hESC 3D 7 BPM7, FGF9, Heparin, Y27632, CHIR, LDN, BMP4, IGF1, IGF2 NP Clonal expansion ane filter iMatrix,spinal 59 hiPSC 3D 10 LIF, Y27632, FGF2/FGF9, TGF-α, DAPT, CHIR, BMP7 NP Clonal expansion cord assay iMatrix,spinal 59 murine NP 3D 8-19 LIF, Y27632, FGF2/FGF9, TGF- α, DAPT, CHIR, BMP7 NP Clonal expansion cord assay murine NP, Suspension, 60 3D 7-19 BMP7, FGF2, Heparin, Y27632, LIF NP Nephrotoxicity, injury model human NP membrane filter Suspension, Contractility and permeability assay, ex 61 hiPSC 2D 10 AA, BMP7, RA Pod gelatin vivo with murine fetal kidney Matrigel. 62 hiPSC, hESC fibronectin, 2D < 50 FGF2, AA, WNT3A, BMP4, BMP7, RA, FGF2, HGF or RA + VITD3 Pod collagen type I Matrigel, Contractility and uptake assay,ex vivo 63 hiPSC 2D 13 Y27632, CP21R7, BMP4, RA, BMP7, FGF9, VITD3 Pod collagen type I with murine fetal kidney Collagen
    [Show full text]
  • A Novel Fibroblast Growth Factor 1 Variant Reverses Nonalcoholic Fatty Liver Disease in Type 2 Diabetes
    University of Louisville ThinkIR: The University of Louisville's Institutional Repository Electronic Theses and Dissertations 8-2018 A novel fibroblast growth factor 1 variant reverses nonalcoholic fatty liver disease in type 2 diabetes. Qian Lin University of Louisville Follow this and additional works at: https://ir.library.louisville.edu/etd Part of the Endocrine System Diseases Commons, and the Pharmacology Commons Recommended Citation Lin, Qian, "A novel fibroblast growth factor 1 variant reverses nonalcoholic fatty liver disease in type 2 diabetes." (2018). Electronic Theses and Dissertations. Paper 3016. https://doi.org/10.18297/etd/3016 This Doctoral Dissertation is brought to you for free and open access by ThinkIR: The University of Louisville's Institutional Repository. It has been accepted for inclusion in Electronic Theses and Dissertations by an authorized administrator of ThinkIR: The University of Louisville's Institutional Repository. This title appears here courtesy of the author, who has retained all other copyrights. For more information, please contact [email protected]. A NOVEL FIBROBLAST GROWTH FACTOR 1 VARIANT REVERSES NONALCOHOLIC FATTY LIVER DISEASE IN TYPE 2 DIABETES BY Qian Lin M.S. at Wenzhou Medical University, 2016 A Dissertation Submitted to the Faculty of the School of Medicine of the University of Louisville for the Degree of Doctor of Philosophy in Pharmacology and Toxicology Department of Pharmacology and Toxicology University of Louisville Louisville, Kentucky August 2018 A NOVEL FIBROBLAST GROWTH FACTOR 1 VARIANT REVERSES NONALCOHOLIC FATTY LIVER DISEASE IN TYPE 2 DIABETES BY Qian Lin Dissertation Approved on August 2, 2018 Dissertation Committee: Dr. Yi Tan Dr. Paul Epstein Dr.
    [Show full text]
  • The Roles of Fgfs in the Early Development of Vertebrate Limbs
    Downloaded from genesdev.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press REVIEW The roles of FGFs in the early development of vertebrate limbs Gail R. Martin1 Department of Anatomy and Program in Developmental Biology, School of Medicine, University of California at San Francisco, San Francisco, California 94143–0452 USA ‘‘Fibroblast growth factor’’ (FGF) was first identified 25 tion of two closely related proteins—acidic FGF and ba- years ago as a mitogenic activity in pituitary extracts sic FGF (now designated FGF1 and FGF2, respectively). (Armelin 1973; Gospodarowicz 1974). This modest ob- With the advent of gene isolation techniques it became servation subsequently led to the identification of a large apparent that the Fgf1 and Fgf2 genes are members of a family of proteins that affect cell proliferation, differen- large family, now known to be comprised of at least 17 tiation, survival, and motility (for review, see Basilico genes, Fgf1–Fgf17, in mammals (see Coulier et al. 1997; and Moscatelli 1992; Baird 1994). Recently, evidence has McWhirter et al. 1997; Hoshikawa et al. 1998; Miyake been accumulating that specific members of the FGF 1998). At least five of these genes are expressed in the family function as key intercellular signaling molecules developing limb (see Table 1). The proteins encoded by in embryogenesis (for review, see Goldfarb 1996). Indeed, the 17 different FGF genes range from 155 to 268 amino it may be no exaggeration to say that, in conjunction acid residues in length, and each contains a conserved with the members of a small number of other signaling ‘‘core’’ sequence of ∼120 amino acids that confers a com- molecule families [including WNT (Parr and McMahon mon tertiary structure and the ability to bind heparin or 1994), Hedgehog (HH) (Hammerschmidt et al.
    [Show full text]
  • Upregulated Expression of FGF13/FHF2 Mediates Resistance To
    OPEN Upregulated expression of FGF13/FHF2 SUBJECT AREAS: mediates resistance to platinum drugs in CANCER THERAPEUTIC RESISTANCE cervical cancer cells CANCER PREVENTION Tomoko Okada1, Kazuhiro Murata1,2, Ryoma Hirose1,3, Chie Matsuda1, Tsunehiko Komatsu2, STRESS SIGNALLING Masahiko Ikekita3, Miyako Nakawatari4, Fumiaki Nakayama4, Masaru Wakatsuki5, Tatsuya Ohno5,6, CHEMOTHERAPY Shingo Kato5,7, Takashi Imai4 & Toru Imamura1,3 Received 1Signaling Molecules Research Group, Biomedical Research Institute, National Institute of Advanced Industrial Science and 27 June 2013 2 Technology (AIST), Tsukuba, Ibaraki 305-8566, Japan, Division of Hematology, 3rd Department of Internal Medicine, Teikyo 3 Accepted University Chiba Medical Center, Ichihara, Chiba 299-0111, Japan, Department of Applied Biological Science, Faculty of Science 4 18 September 2013 and Technology, Tokyo University of Science, Noda, Chiba 278-8510, Japan, Advanced Radiation Biology Research Program, National Institute of Radiological Sciences, Chiba, Chiba 263-8555, Japan, 5Research Center Hospital for Charged Particle Published Therapy, National Institute of Radiological Sciences, Chiba, Chiba 263-8555, Japan, 6Gunma University Graduate School of 11 October 2013 Medicine, Maebashi, Gunma 371-8511, Japan, 7Saitama Medical University International Medical Center, Hidaka, Saitama 350- 1298, Japan. Correspondence and Cancer cells often develop drug resistance. In cisplatin-resistant HeLa cisR cells, fibroblast growth factor 13 requests for materials (FGF13/FHF2) gene and protein expression was strongly upregulated, and intracellular platinum should be addressed to concentrations were kept low. When the FGF13 expression was suppressed, both the cells’ resistance to T.Imamura (imamura- platinum drugs and their ability to keep intracellular platinum low were abolished. Overexpression of [email protected]) FGF13 in parent cells led to greater resistance to cisplatin and reductions in the intracellular platinum concentration.
    [Show full text]
  • Ep 3217179 A1
    (19) TZZ¥ ___T (11) EP 3 217 179 A1 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.: 13.09.2017 Bulletin 2017/37 G01N 33/68 (2006.01) (21) Application number: 17167637.2 (22) Date of filing: 02.10.2013 (84) Designated Contracting States: • LIU, Xinjun AL AT BE BG CH CY CZ DE DK EE ES FI FR GB San Diego, CA 92130 (US) GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO • HAUENSTEIN, Scott PL PT RO RS SE SI SK SM TR San Diego, CA 92130 (US) • KIRKLAND, Richard (30) Priority: 05.10.2012 US 201261710491 P San Diego, CA 92111 (US) 17.05.2013 US 201361824959 P (74) Representative: Krishnan, Sri (62) Document number(s) of the earlier application(s) in Nestec S.A. accordance with Art. 76 EPC: Centre de Recherche Nestlé 13779638.9 / 2 904 405 Vers-chez-les-Blanc Case Postale 44 (71) Applicant: Nestec S.A. 1000 Lausanne 26 (CH) 1800 Vevey (CH) Remarks: (72) Inventors: This application was filed on 21-04-2017 as a • SINGH, Sharat divisional application to the application mentioned Rancho Santa Fe, CA 92127 (US) under INID code 62. (54) METHODS FOR PREDICTING AND MONITORING MUCOSAL HEALING (57) The present invention provides methods for pre- an individual with a disease such as IBD. Information on dicting the likelihood of mucosal healing in an individual mucosal healing status derived from the use of the with a disease such as inflammatory bowel disease present invention can also aid in optimizing therapy (IBD).
    [Show full text]