УДК 577.112:616 Glucose tolerance in obese men is associated with dysregulation of some angiogenesis-related gene expressions in subcutaneous adipose tissue O.H. Minchenko1, Y.M. Bashta1, D.O. Minchenko1,2, O.O. Ratushna1 1Palladin Institute of Biochemistry National Academy of Sciences of Ukraine, Kyiv; 2Bogomolets National Medical University, Kyiv; E-mail: [email protected] Obesity and its metabolic complications are one of the most profound public health problems and result from interactions between genes and environmental. The development of obesity is tightly connected with dysregulation of intrinsic gene expression mechanisms controlling majority of metabolic processes, which are essential for regulation many physiological functions, including insulin sensitivity, cellular prolifera- tion and angiogenesis. Our objective was to evaluate if expression of angiogenesis related genes VEGF-A, CYR61, PDGFC, FGF1, FGF2, FGFR2, FGFRL1, E2F8, BAI2, HIF1A, and EPAS1 at mRNA level in adipose tissue could participate in the development of obesity and metabolic complications. We have shown that expression level of VEGF-A, PDGFC, FGF2, and FGFRL1 genes is decreased in adipose tissue of obese men with normal glucose tolerance (NGT) versus a group of control subjects. At the same time, in this group of obese individuals a significant up-regulation of CYR61, FGF1, FGFR2, E2F8, BAI2, and HIF1A gene expressions was observed. Impaired glucose tolerance (IGT) in obese patients associates with down-regulation of CYR61 and FGFR2 mRNA and up-regulations of E2F8, FGF1, FGF2, VEGF-A and its splice variant 189 mRNA expressions in adipose tissue versus obese (NGT) individuals. Thus, our data demonstrate that the expression of almost all studied genes is affected in subcutaneous adipose tissue of obese individuals with NGT and that glucose intolerance is associated with gene-specific changes in the expression of E2F8, FGF1, FGF2, VEGF-A, CYR61 and FGFR2 mRNAs. The data presented here provides evidence that VEGF-A, CYR61, PDGFC, FGF1, FGF2, FGFR2, FGFRL1, E2F8, BAI2, and HIF1A genes are possibly involved in the development of obesity and its complications. Key words: mRNA expression, VEGF-A, CYR61, FGF1, FGF2, FGFR2, E2F8, HIF1A, adipose tissue, obesity, men INTRODUCTION clock because biological rhythms are an integral component of essentially all aspects of life and Accumulating evidence raises the hypothesis regulate many physiological functions, includ- that development of obesity and its metabolic ing insulin sensitivity and cellular proliferation complications is tightly associated with dys- regulation of mechanisms controlling majority [4-7]. Molecular and cellular studies have de- of metabolic processes, especially in adipose monstrated relationships between the dysfunc- tissue, which is at the center of metabolic syn- tion of circadian clocks and the development of drome in obese individuals [1-3]. Obesity and obesity and metabolic abnormalities, including its metabolic complications are one of the most type 2 diabetes [8]. At the same time, metabolic profound public health problems and result from processes feed-back into the circadian clock, interactions between genes and environmen- affecting clock gene expression and timing of tal. There is data that development of obesity behavior [9]. is connected with dysregulation of numerous The growing adipose tissue is associated gene expressions mainly through biological with cell proliferation and angiogenesis like © O.H.Minchenko, Y.M.Bashta, D.O. Minchenko, O.O. Ratushna 12 ISSN 0201-8489 Фізіол. журн., 2016, Т. 62, № 2 O.H.Minchenko, Y.M.Bashta, D.O. Minchenko, O.O. Ratushna other growing tissues including tumors [10-12]. but FGFRL1 (fibroblast growth factor receptor- It is well known that angiogenesis is mediated by like 1) protein expression was lower in bladder numerous factors, but substantial evidence accu- tumors compared to normal tissue. Furthermore, mulating over the last decade has established the a marked difference between FGFRL1 and the fundamental role of vascular endothelial growth other family members is its lack of a cytoplasmic factor (VEGF) as a key regulator of normal and tyrosine kinase domain and potentially inhibit abnormal angiogenesis evidence especially in signaling. tumors [13-15]. Importantly, VEGF is released There is also data that transcription factor by tumor cells and induces neovascularization E2F8 creates complexes with other members in the majority of human tumors. Furthermore, of E2F family of transcription factors and co- VEGF is implicated in intraocular neovasculari- ordinates various cellular functions through the zation associated with diabetic retinopathy [16]. regulation of the expression of target genes, In addition, there are factors, such as connective thereby regulating cell cycle, apoptosis, and an- tissue growth factor (CTGF), which can bind giogenesis, including transcriptional activation VEGF and inhibits VEGF-induced angiogenesis of VEGFA in cooperation with HIF1 [26-28]. [17]. Moreover, downregulation of CTGF by the There is data [29] that metabolic reprogramming miR-17-92 microRNA enhances neovasculariza- of cancer cells without tumor suppressor LKB1 tion [17]. is realized through HIF1 [29]. Furthermore, an An important role in the control of angiogene- important role in metabolic integration plays sis also play cysteine-rich angiogenic inducer 61 the unfolded protein response/endoplasmic (CYR61), brain-specific angiogenesis inhibi- reticulum stress, which activates a complex set tor 2 (BAI2), platelet derived growth factor C of signaling pathways and links obesity with (PDGFC), fibroblast growth factors and their insulin action and contributes to the expression receptors, and some transcription factors like profile of many regulatory genes resulting in hypoxia inducible factor 1a (HIF1A), endo- peripheral insulin resistance and diabetic com- thelial PAS domain protein 1 (EPAS1/HIF2A), plications, acting by inhibiting insulin receptor and E2F8 (transcription factor of E2F family) signaling [30–33]. [18-25]. Thus, CYR61 and PDGFC play an However, detailed molecular mechanisms of important role in proliferation and angiogene- the involvement of angiogenesis-related genes in sis [18, 20]. Fibroblast growth factor proteins the development of obesity and its complications (FGF1 and FGF2), which also known as acidic are not clear yet and remain to be determined. and basic fibroblast growth hormones, are The aim of this study was to investigate the mitogenic signaling molecules that have roles expression of genes encoded key angiogenesis- in angiogenesis and function as a modifier of related factors in subcutaneous adipose tissue of endothelial cell migration and proliferation, but obese men with normal and impairment glucose FGF2 mainly induces lymphangiogenesis [21- tolerance for evaluation of possible significance 23]. Moreover, FGF1 is required for adaptive these genes in the development of obesity and its adipose remodeling and metabolic homeostasis complications, particularly glucose intolerance. and FGF2 prevents cancer cells from endoplas- mic reticulum stress-mediated apoptosis [21, METHODS 23]. Biological effect of the fibroblast growth factors is realized through the fibroblast growth The 18 adult males participated in the study. factor receptors, some of which are related They were divided into three equal groups: to VEGF signaling pathway [24, 25]. Thus, 6 lean healthy controls, 6 obese with normal FGFR2 (fibroblast growth factor receptor 2) glucose tolerance (NGT), and 6 obese with interacts predominantly with FGF1 and FGF2, impaired glucose tolerance (IGT). Clinical cha- ISSN 0201-8489 Фізіол. журн., 2016, Т. 62, № 2 13 Glucose tolerance in obese men is associated with dysregulation of some angiogenesis-related gene expressions racteristics of the study participants are shown in we used next forward and reverse primers: Table 1. All participants gave written informed 5’– CCACCACAGCAAATATCGTF –3’ and consent and the studies were approved by the 5’– CTTTGGCCTCAGGTAATCCA –3’, cor- local research ethics committees of Institute of respondingly. The nucleotide sequences of these Experimental Endocrinology Slovak Academy primers correspond to sequences 596 – 615 and of Sciences. 805 – 786 of human E2F8 cDNA (GenBank RNA was extracted from subcutaneous accession number NM_024680). The size of adipose tissue samples using RNasy Lipid Tis- amplified fragment is 210 bp. The amplification sue Mini Kit (QIAGEN, Germany) according of EPAS1 (endothelial PAS domain protein 1), to manufacturer’s protocol. The RNA pellets also known as hypoxia-inducible factor 2alpha were washed with 75 % ethanol and dissolved (HIF-2a), cDNA for real time RCR analysis was in nuclease-free water. For additional purifica- performed using two oligonucleotides primers: tion RNA samples were re-precipitated with forward – 5’– AAGCCTTGGAGGGTTTCATT 95 % ethanol and re-dissolved again in nuclease- –3’ and reverse – 5’– TCATGAAGAAGTCCC- free water. QuaniTect Reverse Transcription GCTCT –3’. The nucleotide sequences of these Kit (QIAGEN, Germany) was used for cDNA primers correspond to sequences 788 – 807 and synthesis according to manufacturer protocol. 1021 – 1002 of human EPAS1 cDNA (GenBank The expression levels of VEGF-A, CYR61, accession number NM_001430). The size of am- PDGFC, FGF1, FGF2, FGFR2, FGFRL1, E2F8, plified fragment is 234 bp. For amplification of BAI2, HIF1A, and EPAS1 genes were measured FGF1 (fibroblast growth factor 1) cDNA we used in subcutaneous