Serial Deletions and Duplications Suggest a Mechanism for the Collinearity of Hoxd Genes in Limbs
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Detailed Review Paper on Retinoid Pathway Signalling
1 1 Detailed Review Paper on Retinoid Pathway Signalling 2 December 2020 3 2 4 Foreword 5 1. Project 4.97 to develop a Detailed Review Paper (DRP) on the Retinoid System 6 was added to the Test Guidelines Programme work plan in 2015. The project was 7 originally proposed by Sweden and the European Commission later joined the project as 8 a co-lead. In 2019, the OECD Secretariat was added to coordinate input from expert 9 consultants. The initial objectives of the project were to: 10 draft a review of the biology of retinoid signalling pathway, 11 describe retinoid-mediated effects on various organ systems, 12 identify relevant retinoid in vitro and ex vivo assays that measure mechanistic 13 effects of chemicals for development, and 14 Identify in vivo endpoints that could be added to existing test guidelines to 15 identify chemical effects on retinoid pathway signalling. 16 2. This DRP is intended to expand the recommendations for the retinoid pathway 17 included in the OECD Detailed Review Paper on the State of the Science on Novel In 18 vitro and In vivo Screening and Testing Methods and Endpoints for Evaluating 19 Endocrine Disruptors (DRP No 178). The retinoid signalling pathway was one of seven 20 endocrine pathways considered to be susceptible to environmental endocrine disruption 21 and for which relevant endpoints could be measured in new or existing OECD Test 22 Guidelines for evaluating endocrine disruption. Due to the complexity of retinoid 23 signalling across multiple organ systems, this effort was foreseen as a multi-step process. -
Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1. -
Supplemental Information
Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig. -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line -
Homeobox Genes D11–D13 and A13 Control Mouse Autopod Cortical
Research article Homeobox genes d11–d13 and a13 control mouse autopod cortical bone and joint formation Pablo Villavicencio-Lorini,1,2 Pia Kuss,1,2 Julia Friedrich,1,2 Julia Haupt,1,2 Muhammed Farooq,3 Seval Türkmen,2 Denis Duboule,4 Jochen Hecht,1,5 and Stefan Mundlos1,2,5 1Max Planck Institute for Molecular Genetics, Berlin, Germany. 2Institute for Medical Genetics, Charité, Universitätsmedizin Berlin, Berlin, Germany. 3Human Molecular Genetics Laboratory, National Institute for Biotechnology & Genetic Engineering (NIBGE), Faisalabad, Pakistan. 4National Research Centre Frontiers in Genetics, Department of Zoology and Animal Biology, University of Geneva, Geneva, Switzerland. 5Berlin-Brandenburg Center for Regenerative Therapies (BCRT), Charité, Universitätsmedizin Berlin, Berlin, Germany. The molecular mechanisms that govern bone and joint formation are complex, involving an integrated network of signaling pathways and gene regulators. We investigated the role of Hox genes, which are known to specify individual segments of the skeleton, in the formation of autopod limb bones (i.e., the hands and feet) using the mouse mutant synpolydactyly homolog (spdh), which encodes a polyalanine expansion in Hoxd13. We found that no cortical bone was formed in the autopod in spdh/spdh mice; instead, these bones underwent trabecular ossification after birth. Spdh/spdh metacarpals acquired an ovoid shape and developed ectopic joints, indicating a loss of long bone characteristics and thus a transformation of metacarpals into carpal bones. The perichon- drium of spdh/spdh mice showed abnormal morphology and decreased expression of Runt-related transcription factor 2 (Runx2), which was identified as a direct Hoxd13 transcriptional target. Hoxd11–/–Hoxd12–/–Hoxd13–/– tri- ple-knockout mice and Hoxd13–/–Hoxa13+/– mice exhibited similar but less severe defects, suggesting that these Hox genes have similar and complementary functions and that the spdh allele acts as a dominant negative. -
Genome-Wide DNA Methylation Analysis Reveals Molecular Subtypes of Pancreatic Cancer
www.impactjournals.com/oncotarget/ Oncotarget, 2017, Vol. 8, (No. 17), pp: 28990-29012 Research Paper Genome-wide DNA methylation analysis reveals molecular subtypes of pancreatic cancer Nitish Kumar Mishra1 and Chittibabu Guda1,2,3,4 1Department of Genetics, Cell Biology and Anatomy, University of Nebraska Medical Center, Omaha, NE, 68198, USA 2Bioinformatics and Systems Biology Core, University of Nebraska Medical Center, Omaha, NE, 68198, USA 3Department of Biochemistry and Molecular Biology, University of Nebraska Medical Center, Omaha, NE, 68198, USA 4Fred and Pamela Buffet Cancer Center, University of Nebraska Medical Center, Omaha, NE, 68198, USA Correspondence to: Chittibabu Guda, email: [email protected] Keywords: TCGA, pancreatic cancer, differential methylation, integrative analysis, molecular subtypes Received: October 20, 2016 Accepted: February 12, 2017 Published: March 07, 2017 Copyright: Mishra et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC-BY), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Pancreatic cancer (PC) is the fourth leading cause of cancer deaths in the United States with a five-year patient survival rate of only 6%. Early detection and treatment of this disease is hampered due to lack of reliable diagnostic and prognostic markers. Recent studies have shown that dynamic changes in the global DNA methylation and gene expression patterns play key roles in the PC development; hence, provide valuable insights for better understanding the initiation and progression of PC. In the current study, we used DNA methylation, gene expression, copy number, mutational and clinical data from pancreatic patients. -
Pig Antibodies
Pig Antibodies gene_name sku Entry_Name Protein_Names Organism Length Identity CDX‐2 ARP31476_P050 D0V4H7_PIG Caudal type homeobox 2 (Fragment) Sus scrofa (Pig) 147 100.00% CDX‐2 ARP31476_P050 A7MAE3_PIG Caudal type homeobox transcription factor 2 (Fragment) Sus scrofa (Pig) 75 100.00% Tnnt3 ARP51286_P050 Q75NH3_PIG Troponin T fast skeletal muscle type Sus scrofa (Pig) 271 85.00% Tnnt3 ARP51286_P050 Q75NH2_PIG Troponin T fast skeletal muscle type Sus scrofa (Pig) 266 85.00% Tnnt3 ARP51286_P050 Q75NH1_PIG Troponin T fast skeletal muscle type Sus scrofa (Pig) 260 85.00% Tnnt3 ARP51286_P050 Q75NH0_PIG Troponin T fast skeletal muscle type Sus scrofa (Pig) 250 85.00% Tnnt3 ARP51286_P050 Q75NG8_PIG Troponin T fast skeletal muscle type Sus scrofa (Pig) 266 85.00% Tnnt3 ARP51286_P050 Q75NG7_PIG Troponin T fast skeletal muscle type Sus scrofa (Pig) 260 85.00% Tnnt3 ARP51286_P050 Q75NG6_PIG Troponin T fast skeletal muscle type Sus scrofa (Pig) 250 85.00% Tnnt3 ARP51286_P050 TNNT3_PIG Troponin T, fast skeletal muscle (TnTf) Sus scrofa (Pig) 271 85.00% ORF Names:PANDA_000462 EMBL EFB13877.1OrganismAiluropod High mobility group protein B2 (High mobility group protein a melanoleuca (Giant panda) ARP31939_P050 HMGB2_PIG 2) (HMG‐2) Sus scrofa (Pig) 210 100.00% Agpat5 ARP47429_P050 B8XTR3_PIG 1‐acylglycerol‐3‐phosphate O‐acyltransferase 5 Sus scrofa (Pig) 365 85.00% irf9 ARP31200_P050 Q29390_PIG Transcriptional regulator ISGF3 gamma subunit (Fragment) Sus scrofa (Pig) 57 100.00% irf9 ARP31200_P050 Q0GFA1_PIG Interferon regulatory factor 9 Sus scrofa (Pig) -
Role of HOX Genes in Stem Cell Differentiation and Cancer
Thomas Jefferson University Jefferson Digital Commons Kimmel Cancer Center Papers, Presentations, and Grand Rounds Kimmel Cancer Center 7-22-2018 Role of HOX Genes in Stem Cell Differentiation and Cancer. Seema Bhatlekar Helen F. Graham Cancer Center and Research Institute; University of Delaware Jeremy Z Fields CATX Inc. Bruce M. Boman Thomas Jefferson University; Helen F. Graham Cancer Center and Research Institute; University of Delaware; CATX Inc. Follow this and additional works at: https://jdc.jefferson.edu/kimmelgrandrounds Part of the Oncology Commons Let us know how access to this document benefits ouy Recommended Citation Bhatlekar, Seema; Fields, Jeremy Z; and Boman, Bruce M., "Role of HOX Genes in Stem Cell Differentiation and Cancer." (2018). Kimmel Cancer Center Papers, Presentations, and Grand Rounds. Paper 62. https://jdc.jefferson.edu/kimmelgrandrounds/62 This Article is brought to you for free and open access by the Jefferson Digital Commons. The Jefferson Digital Commons is a service of Thomas Jefferson University's Center for Teaching and Learning (CTL). The Commons is a showcase for Jefferson books and journals, peer-reviewed scholarly publications, unique historical collections from the University archives, and teaching tools. The Jefferson Digital Commons allows researchers and interested readers anywhere in the world to learn about and keep up to date with Jefferson scholarship. This article has been accepted for inclusion in Kimmel Cancer Center Papers, Presentations, and Grand Rounds by an authorized administrator of the Jefferson Digital Commons. For more information, please contact: [email protected]. Hindawi Stem Cells International Volume 2018, Article ID 3569493, 15 pages https://doi.org/10.1155/2018/3569493 Review Article Role of HOX Genes in Stem Cell Differentiation and Cancer 1,2 3 1,2,3,4 Seema Bhatlekar , Jeremy Z. -
BMC Biology Biomed Central
BMC Biology BioMed Central Research article Open Access Classification and nomenclature of all human homeobox genes PeterWHHolland*†1, H Anne F Booth†1 and Elspeth A Bruford2 Address: 1Department of Zoology, University of Oxford, South Parks Road, Oxford, OX1 3PS, UK and 2HUGO Gene Nomenclature Committee, European Bioinformatics Institute (EMBL-EBI), Wellcome Trust Genome Campus, Hinxton, Cambridgeshire, CB10 1SA, UK Email: Peter WH Holland* - [email protected]; H Anne F Booth - [email protected]; Elspeth A Bruford - [email protected] * Corresponding author †Equal contributors Published: 26 October 2007 Received: 30 March 2007 Accepted: 26 October 2007 BMC Biology 2007, 5:47 doi:10.1186/1741-7007-5-47 This article is available from: http://www.biomedcentral.com/1741-7007/5/47 © 2007 Holland et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: The homeobox genes are a large and diverse group of genes, many of which play important roles in the embryonic development of animals. Increasingly, homeobox genes are being compared between genomes in an attempt to understand the evolution of animal development. Despite their importance, the full diversity of human homeobox genes has not previously been described. Results: We have identified all homeobox genes and pseudogenes in the euchromatic regions of the human genome, finding many unannotated, incorrectly annotated, unnamed, misnamed or misclassified genes and pseudogenes. -
Comprehensive Epigenome Characterization Reveals Diverse Transcriptional Regulation Across Human Vascular Endothelial Cells
Nakato et al. Epigenetics & Chromatin (2019) 12:77 https://doi.org/10.1186/s13072-019-0319-0 Epigenetics & Chromatin RESEARCH Open Access Comprehensive epigenome characterization reveals diverse transcriptional regulation across human vascular endothelial cells Ryuichiro Nakato1,2† , Youichiro Wada2,3*†, Ryo Nakaki4, Genta Nagae2,4, Yuki Katou5, Shuichi Tsutsumi4, Natsu Nakajima1, Hiroshi Fukuhara6, Atsushi Iguchi7, Takahide Kohro8, Yasuharu Kanki2,3, Yutaka Saito2,9,10, Mika Kobayashi3, Akashi Izumi‑Taguchi3, Naoki Osato2,4, Kenji Tatsuno4, Asuka Kamio4, Yoko Hayashi‑Takanaka2,11, Hiromi Wada3,12, Shinzo Ohta12, Masanori Aikawa13, Hiroyuki Nakajima7, Masaki Nakamura6, Rebecca C. McGee14, Kyle W. Heppner14, Tatsuo Kawakatsu15, Michiru Genno15, Hiroshi Yanase15, Haruki Kume6, Takaaki Senbonmatsu16, Yukio Homma6, Shigeyuki Nishimura16, Toutai Mitsuyama2,9, Hiroyuki Aburatani2,4, Hiroshi Kimura2,11,17* and Katsuhiko Shirahige2,5* Abstract Background: Endothelial cells (ECs) make up the innermost layer throughout the entire vasculature. Their phe‑ notypes and physiological functions are initially regulated by developmental signals and extracellular stimuli. The underlying molecular mechanisms responsible for the diverse phenotypes of ECs from diferent organs are not well understood. Results: To characterize the transcriptomic and epigenomic landscape in the vascular system, we cataloged gene expression and active histone marks in nine types of human ECs (generating 148 genome‑wide datasets) and carried out a comprehensive analysis with chromatin interaction data. We developed a robust procedure for comparative epigenome analysis that circumvents variations at the level of the individual and technical noise derived from sample preparation under various conditions. Through this approach, we identifed 3765 EC‑specifc enhancers, some of which were associated with disease‑associated genetic variations. -
View Conveyed by the Global Labelling
Fabre et al. BMC Biology (2018) 16:101 https://doi.org/10.1186/s12915-018-0570-z RESEARCHARTICLE Open Access Heterogeneous combinatorial expression of Hoxd genes in single cells during limb development P. J. Fabre1,4* , M. Leleu1, B. Mascrez2, Q. Lo Giudice4, J. Cobb3 and D. Duboule1,2* Abstract Background: Global analyses of gene expression during development reveal specific transcription patterns associated with the emergence of various cell types, tissues, and organs. These heterogeneous patterns are instrumental to ensure the proper formation of the different parts of our body, as shown by the phenotypic effects generated by functional genetic approaches. However, variations at the cellular level can be observed within each structure or organ. In the developing mammalian limbs, expression of Hox genes from the HoxD cluster is differentially controlled in space and time, in cells that will pattern the digits and the forearms. While the Hoxd genes broadly share a common regulatory landscape and large-scale analyses have suggested a homogenous Hox gene transcriptional program, it has not previously been clear whether Hoxd genes are expressed together at the same levels in the same cells. Results: We report a high degree of heterogeneity in the expression of the Hoxd11 and Hoxd13 genes. We analyzed single-limb bud cell transcriptomes and show that Hox genes are expressed in specific combinations that appear to match particular cell types. In cells giving rise to digits, we find that the expression of the five relevant Hoxd genes (Hoxd9 to Hoxd13) is unbalanced, despite their control by known global enhancers. We also report that specific combinatorial expression follows a pseudo-time sequence, which is established based on the transcriptional diversity of limb progenitors. -
Hox5 Interacts with Plzf to Restrict Shh Expression in the Developing Forelimb
Hox5 interacts with Plzf to restrict Shh expression in the developing forelimb Ben Xua,1, Steven M. Hrycaja, Daniel C. McIntyrea,2, Nicholas C. Bakera, Jun K. Takeuchib, Lucie Jeannottec, Zachary B. Gaberd, Bennett G. Novitchd, and Deneen M. Wellika,3 aDepartment of Internal Medicine, Division of Molecular Medicine and Genetics, University of Michigan, Ann Arbor, MI 48109; bCardiovascular Regeneration Institute of Molecular and Cellular Biosciences, University of Tokyo, Tokyo 113-0032, Japan; cCentre de Recherche en Cancérologie de l’Université Laval, Centre Hospitalier Universitaire de Québec, Québec, Canada G1R 2J6; and dDepartment of Neurobiology, Eli and Edythe Broad Center of Regenerative Medicine and Stem Cell Research, David Geffen School of Medicine at UCLA, Los Angeles, CA 90095 Edited by Clifford J. Tabin, Harvard Medical School, Boston, MA, and approved October 18, 2013 (received for review August 8, 2013) To date, only the five most posterior groups of Hox genes, Hox9– expression in limb AP patterning (12, 13). Although misexpression Hox13, have demonstrated loss-of-function roles in limb pattern- of more anterior Hox genes in mice reportedly affects limb patterning ing. Individual paralog groups control proximodistal patterning of (16), no loss-of-function mutants of anterior, non–abdominal B the limb skeletal elements. Hox9 genes also initiate the onset of (AbdB)-related genes have demonstrated defects in the patterning of Hand2 expression in the posterior forelimb compartment, and col- limb skeletal elements. Moreover, no HoxB or HoxC group genes had lectively, the posterior HoxA/D genes maintain posterior Sonic been shown to play a role in forelimb development until a report by Hedgehog (Shh) expression.