Genome Architecture Marked by Retrotransposons Modulates Predisposition to DNA Methylation in Cancer
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Detailed Review Paper on Retinoid Pathway Signalling
1 1 Detailed Review Paper on Retinoid Pathway Signalling 2 December 2020 3 2 4 Foreword 5 1. Project 4.97 to develop a Detailed Review Paper (DRP) on the Retinoid System 6 was added to the Test Guidelines Programme work plan in 2015. The project was 7 originally proposed by Sweden and the European Commission later joined the project as 8 a co-lead. In 2019, the OECD Secretariat was added to coordinate input from expert 9 consultants. The initial objectives of the project were to: 10 draft a review of the biology of retinoid signalling pathway, 11 describe retinoid-mediated effects on various organ systems, 12 identify relevant retinoid in vitro and ex vivo assays that measure mechanistic 13 effects of chemicals for development, and 14 Identify in vivo endpoints that could be added to existing test guidelines to 15 identify chemical effects on retinoid pathway signalling. 16 2. This DRP is intended to expand the recommendations for the retinoid pathway 17 included in the OECD Detailed Review Paper on the State of the Science on Novel In 18 vitro and In vivo Screening and Testing Methods and Endpoints for Evaluating 19 Endocrine Disruptors (DRP No 178). The retinoid signalling pathway was one of seven 20 endocrine pathways considered to be susceptible to environmental endocrine disruption 21 and for which relevant endpoints could be measured in new or existing OECD Test 22 Guidelines for evaluating endocrine disruption. Due to the complexity of retinoid 23 signalling across multiple organ systems, this effort was foreseen as a multi-step process. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Tyson Goldberg Et Al-2015-Development-1267-78
© 2015. Published by The Company of Biologists Ltd | Development (2015) 142, 1267-1278 doi:10.1242/dev.111526 RESEARCH ARTICLE STEM CELLS AND REGENERATION Duration of culture and sonic hedgehog signaling differentially specify PV versus SST cortical interneuron fates from embryonic stem cells Jennifer A. Tyson1,2, Ethan M. Goldberg3,4, Asif M. Maroof5, Qing Xu6, Timothy J. Petros7 and Stewart A. Anderson1,* ABSTRACT dysfunction is associated with a variety of neurological diseases, Medial ganglionic eminence (MGE)-derived GABAergic cortical including seizure disorders, schizophrenia and autism (Belforte et al., interneurons (cINs) consist of multiple subtypes that are involved in 2010; Chao et al., 2010; Inan et al., 2013). Interneurons are classified many cortical functions. They also have a remarkable capacity to into functionally distinct subgroups based on neurochemical markers, migrate, survive and integrate into cortical circuitry after transplantation connectivity profiles and electrophysiological properties (DeFelipe into postnatal cortex. These features have engendered considerable et al., 2013), with specific subtypes being implicated in different interest in generating distinct subgroups of interneurons from pluripotent disease etiologies (Binaschi et al., 2003; Levitt et al., 2004; Inan et al., stem cells (PSCs) for the study of interneuron fate and function, and for 2013; Jiang et al., 2013; Smith-Hicks, 2013). Genetic fate mapping the development of cell-based therapies. Although advances have been and transplantation studies -
Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7 -
Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1. -
Supplemental Information
Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig. -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line -
Class I Histone Deacetylases in Retinal Progenitors and Differentiating Ganglion Cells
ACCEPTED MANUSCRIPT Class I Histone Deacetylases in Retinal Progenitors and Differentiating Ganglion Cells #Ankita Saha1, 2, #Sarika Tiwari1, 2, Subramanian Dharmarajan1, 2, *Deborah C. Otteson3, and *Teri L. Belecky-Adams1, 2 *Both of the authors are corresponding authors #These authors contributed equally to this work 1Department of Biology, Indiana University-Purdue University Indianapolis, 723 W Michigan St, Indianapolis, IN-46202. 2Center for Developmental and Regenerative Biology, Indiana University- Purdue University Indianapolis, 723 W Michigan St, Indianapolis, IN-46202. 3 University of Houston College of Optometry, 4901 Calhoun Rd. Rm 2195, Houston, TX 77204- 2020. Ankita Saha:[email protected] Sarika Tiwari: [email protected] Subramanian Dharmarajan: [email protected] MANUSCRIPT Keywords: Histone Deacetylases, HDACs, mouse, murine, retina, progenitors, retinal ganglion cells Running Title: HDAC Localization in Murine Retina Correspondence should be sent to the following addresses: Teri L Belecky-Adams Department of Biology, SL306 Center for DevelopmentalACCEPTED and Regenerative Biology Indiana University-Purdue University Indianapolis. 723 W Michigan St. Indianapolis, IN-46202 Tel. (317)278-5715 Fax (317) 274-2846 E-mail: [email protected] ___________________________________________________________________ This is the author's manuscript of the article published in final edited form as: Saha, A., Tiwari, S., Dharmarajan, S., Otteson, D. C., & Belecky-Adams, T. L. (2018). Class I histone deacetylases in retinal progenitors and differentiating ganglion cells. Gene Expression Patterns. https://doi.org/10.1016/j.gep.2018.08.007 ACCEPTED MANUSCRIPT Deborah C. Otteson University Eye Institute, Room 2195 University of Houston 4901 Calhoun Rd. Houston, TX 77204-2020 Tel. (713) 743-1952 Fax (713) 74302053 E-mail: [email protected] MANUSCRIPT ACCEPTED 2 ACCEPTED MANUSCRIPT Abstract Background: The acetylation state of histones has been used as an indicator of the developmental state of progenitor and differentiating cells. -
Homeobox Genes D11–D13 and A13 Control Mouse Autopod Cortical
Research article Homeobox genes d11–d13 and a13 control mouse autopod cortical bone and joint formation Pablo Villavicencio-Lorini,1,2 Pia Kuss,1,2 Julia Friedrich,1,2 Julia Haupt,1,2 Muhammed Farooq,3 Seval Türkmen,2 Denis Duboule,4 Jochen Hecht,1,5 and Stefan Mundlos1,2,5 1Max Planck Institute for Molecular Genetics, Berlin, Germany. 2Institute for Medical Genetics, Charité, Universitätsmedizin Berlin, Berlin, Germany. 3Human Molecular Genetics Laboratory, National Institute for Biotechnology & Genetic Engineering (NIBGE), Faisalabad, Pakistan. 4National Research Centre Frontiers in Genetics, Department of Zoology and Animal Biology, University of Geneva, Geneva, Switzerland. 5Berlin-Brandenburg Center for Regenerative Therapies (BCRT), Charité, Universitätsmedizin Berlin, Berlin, Germany. The molecular mechanisms that govern bone and joint formation are complex, involving an integrated network of signaling pathways and gene regulators. We investigated the role of Hox genes, which are known to specify individual segments of the skeleton, in the formation of autopod limb bones (i.e., the hands and feet) using the mouse mutant synpolydactyly homolog (spdh), which encodes a polyalanine expansion in Hoxd13. We found that no cortical bone was formed in the autopod in spdh/spdh mice; instead, these bones underwent trabecular ossification after birth. Spdh/spdh metacarpals acquired an ovoid shape and developed ectopic joints, indicating a loss of long bone characteristics and thus a transformation of metacarpals into carpal bones. The perichon- drium of spdh/spdh mice showed abnormal morphology and decreased expression of Runt-related transcription factor 2 (Runx2), which was identified as a direct Hoxd13 transcriptional target. Hoxd11–/–Hoxd12–/–Hoxd13–/– tri- ple-knockout mice and Hoxd13–/–Hoxa13+/– mice exhibited similar but less severe defects, suggesting that these Hox genes have similar and complementary functions and that the spdh allele acts as a dominant negative. -
Genome-Wide DNA Methylation Analysis Reveals Molecular Subtypes of Pancreatic Cancer
www.impactjournals.com/oncotarget/ Oncotarget, 2017, Vol. 8, (No. 17), pp: 28990-29012 Research Paper Genome-wide DNA methylation analysis reveals molecular subtypes of pancreatic cancer Nitish Kumar Mishra1 and Chittibabu Guda1,2,3,4 1Department of Genetics, Cell Biology and Anatomy, University of Nebraska Medical Center, Omaha, NE, 68198, USA 2Bioinformatics and Systems Biology Core, University of Nebraska Medical Center, Omaha, NE, 68198, USA 3Department of Biochemistry and Molecular Biology, University of Nebraska Medical Center, Omaha, NE, 68198, USA 4Fred and Pamela Buffet Cancer Center, University of Nebraska Medical Center, Omaha, NE, 68198, USA Correspondence to: Chittibabu Guda, email: [email protected] Keywords: TCGA, pancreatic cancer, differential methylation, integrative analysis, molecular subtypes Received: October 20, 2016 Accepted: February 12, 2017 Published: March 07, 2017 Copyright: Mishra et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC-BY), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Pancreatic cancer (PC) is the fourth leading cause of cancer deaths in the United States with a five-year patient survival rate of only 6%. Early detection and treatment of this disease is hampered due to lack of reliable diagnostic and prognostic markers. Recent studies have shown that dynamic changes in the global DNA methylation and gene expression patterns play key roles in the PC development; hence, provide valuable insights for better understanding the initiation and progression of PC. In the current study, we used DNA methylation, gene expression, copy number, mutational and clinical data from pancreatic patients. -
Exclusion of Dlx5/6 Expression from the Distal-Most Mandibular Arches Enables BMP-Mediated Specification of the Distal Cap
Exclusion of Dlx5/6 expression from the distal-most mandibular arches enables BMP-mediated specification of the distal cap Joshua W. Vincentza, Jose J. Casasnovasa, Ralston M. Barnesb, Jianwen Quec, David E. Clouthierd, Jun Wange, and Anthony B. Firullia,1 aRiley Heart Research Center, Herman B. Wells Center for Pediatric Research Division of Pediatric Cardiology, Departments of Anatomy, Biochemistry, and Medical and Molecular Genetics, Indiana University Medical School, Indianapolis, IN 46202; bBiologics Discovery California, Bristol-Myers Squibb, Redwood City, CA 94063; cDepartment of Medicine, Columbia University Medical Center, New York, NY 10032; dDepartment of Craniofacial Biology, University of Colorado Anschutz Medical Campus, Aurora, CO 80108; and eDepartment of Molecular Physiology and Biophysics, Texas Heart Institute, Baylor College of Medicine, Houston, TX 77030 Edited by Clifford J. Tabin, Harvard Medical School, Boston, MA, and approved May 26, 2016 (received for review March 8, 2016) Cranial neural crest cells (crNCCs) migrate from the neural tube to Smads, H2, and GATA2/3 provide positive transcriptional inputs the pharyngeal arches (PAs) of the developing embryo and, sub- that serve to counteract the activity of Dlx proteins, thereby re- sequently, differentiate into bone and connective tissue to form the lieving EDN1-meditated repression. Together, these findings in- mandible. Within the PAs, crNCCs respond to local signaling cues to tegrate the communication between BMP and EDN1 signaling partition into the proximo-distally oriented subdomains that convey that establishes the distal cap of the mandible. positional information to these developing tissues. Here, we show that the distal-most of these subdomains, the distal cap, is marked Results by expression of the transcription factor Hand1 (H1) and gives rise to The H1Cre Lineage Gives Rise to the Lower Incisors, in a HAND Factor- the ectomesenchymal derivatives of the lower incisors. -
Dlx5 and Dlx6 Expression in Gabaergic Neurons Controls Behavior, Metabolism, Healthy Aging and Lifespan
Dlx5 and Dlx6 expression in GABAergic neurons controls behavior, metabolism, healthy aging and lifespan. Camille de Lombares, Eglantine Heude, Gladys Alfama, Anastasia Fontaine, Rim Hassouna, Cecile Vernochet, Fabrice de Chaumont, Christophe Olivo-Marin, Elodie Ey, Sebastien Parnaudeau, et al. To cite this version: Camille de Lombares, Eglantine Heude, Gladys Alfama, Anastasia Fontaine, Rim Hassouna, et al.. Dlx5 and Dlx6 expression in GABAergic neurons controls behavior, metabolism, healthy aging and lifespan.. Aging, Impact Journals, 2019, 11 (17), pp.6638-6656. 10.18632/aging.102141. mnhn- 02295464 HAL Id: mnhn-02295464 https://hal-mnhn.archives-ouvertes.fr/mnhn-02295464 Submitted on 4 Feb 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution| 4.0 International License www.aging-us.com AGING 2019, Vol. 11, No. 17 Research Paper Dlx5 and Dlx6 expression in GABAergic neurons controls behavior, metabolism, healthy aging and lifespan Camille de Lombares1, Eglantine Heude1, Gladys Alfama1, Anastasia Fontaine1,