sign in sign up
<<
Home , Contractile vacuole, Cytostome, Glycosome, Kinetoplast, Parasitophorous vacuole, Vacuole

ROLE OF THE CONTRACTILE COMPLEX AS A

TRAFFICKING HUB IN CRUZI

by

SAYANTANEE NIYOGI

(Under the Direction of Roberto Docampo)

ABSTRACT

Trypanosoma cruzi is the etiologic agent of . It contains a Contractile

Vacuole Complex (CVC) that plays a vital role in the regulation of its volume and in its responses to osmotic stresses in all its cycle stages. It is peculiar that though,

T.cruzi is not a free-living it has a CVC; thus suggesting that the CVC could have functions beyond just as occurs in some other ; where the

CVC is involved in regulating calcium and in the transfer of to the surface. Besides, the approach of combined proteomic and bioinformatics analyses identified proteins localized to the CVC, several of them having trafficking roles, and implying to a potential novel role of the CVC.

Here we used a combination of genetic and biochemical approaches to establish the contribution of the CVC as a trafficking hub. T. cruzi relies on secretion of glycosylphosphatidylinositol (GPI)-anchored surface proteins for invasion of host cells and establishment of infection. In this study we show that the CVC acts as a trafficking intermediate before GPI-anchored proteins reach the cell surface. Additionally we also identify CVC-located TcRab11 as a regulator of protein transport of GPI-anchored trans- sialidase to the plasma membrane, a process essential for the establishment of infection.

Demonstration of the role of TcTS in infection has been previously difficult given the large number of genes encoding for this protein distributed through the of the parasite. We also studied the role of another CVC-located Rab. Rab32 is located in -related (LRO) and since acidocalcisomes are LROs we investigated whether TcRab32 is needed for the structure and function of acidocalcisomes. By constructing GDP-bound dominant negative mutants of TcRab32 we were able to show a defect in trafficking, which ultimately affects parasite infectivity. This study with

TcRab32 provides the link between the acidocalcisome and the complex as observed in T. cruzi and in some other protists like reinhardtii and discoideum.

Our results are consistent with a role of the CVC in regulating membrane traffic to maintain the function of the acidocalcisome as well as traffic to the plasma membrane of

T. cruzi.

INDEX WORDS: T.cruzi, Contractile Vacuole Complex (CVC), acidocalcisomes,

TcRab32, TcRab11, trans-sialidase, trafficking, membrane

ROLE OF THE CONTRACTILE VACUOLE COMPLEX AS A

TRAFFICKING HUB IN

by

SAYANTANEE NIYOGI

BSc., Asutosh College, Kolkata, India, 2006

MSc., University of Calcutta, Kolkata, India, 2008

A Dissertation Submitted to the Graduate Faculty of The University of Georgia in Partial

Fulfillment of the Requirements for the Degree

DOCTOR OF PHILOSOPHY

ATHENS, GEORGIA

2014

© 2014

SAYANTANEE NIYOGI

All Rights Reserved

ROLE OF THE CONTRACTILE VACUOLE COMPLEX AS A

TRAFFICKING HUB IN TRYPANOSOMA CRUZI

by

SAYANTANEE NIYOGI

Major Professor: Roberto Docampo

Committee: Boris Striepen

Rick Tarleton

Steve Hajduk

Electronic Version Approved:

Julie Coffield

Interim Dean of the Graduate School

The University of Georgia

August 2014 iv

DEDICATION

Dedicated to Maa, Baba, Titli and Deep for their constant encouragement, support and unconditional love. v

ACKNOWLEDGEMENTS

I would like to thank my mentor Dr Docampo for the opportunity, the support, the time and patience he provided for me and the great projects he had lined up for me. He had to start right from scratch with me!! When I joined the lab, I did not have a lot of experience on the bench, in designing experiments. But thanks to him, I think I have become slightly better at it. I thank him for all that he has taught me, all the knowledge he imparted on me and guiding me all along. His love for science, his dedication to work has been an inspiration to me; that helped me to work hard on my projects with full sincerity. He has always been keen on answering my doubts, correcting my mistakes and also making sure that I do not repeat those mistakes. He always encouraged me to present my work both in external meetings as well as in internal seminars; something that has helped boost my level of confidence. I would also like to thank Dr Moreno for all her invaluable suggestions during lab meeting; which definitely made my dissertation a lot more solid.

Also her review whenever I presented during a lab meeting or practiced for an upcoming seminar with her; is invaluable. I think I have learnt a lot about how important it is to be able to present your work and make sure that people can follow the talk from these discussions. Also I would like to thank my committee members Dr Striepen, Dr Tarleton and Dr Hajduk whose advice and suggestion added value to my thesis and towards the flow of the project.

Thanks to Veronica who trained me in my first year and for her positive criticizm. I am and will be ever grateful to Melina for being the best lab manager and being a great vi friend; for always answering my questions and always encouraging me in the toughest of time. Thanks to Noelia who is a great friend and a wonderful labmate; she helped answer some of my doubts regarding the writing of the dissertation. And everyone else in the

Docampo-Moreno lab; an environment that always inspired and taught me to work hard, help each other, to work together as a unit, discuss and share problems; and also taught me how important it is to recognize everyone’s contribution and also to be able to critically review each other’s as well as your own work. I can undoubtedly say these were the best 5 years of my life!!

A big thank you to my parents; for giving us the best education and the best childhood.

And most importantly making sure that we become nice human beings; something that I will carry with me wherever I go. They have made countless sacrifices to support me and my sister and give us a life which I know was very difficult for them to provide at the moment. My sister, for being my biggest cheerleader and for all the love she gives me.

Though I am the elder one, but her wisdom and mature suggestions have definitely taught me a lot in life. Thank you to my brother-in-law who is more like my own brother; for all the encouragement, the sense of humor you keep pouring in at difficult times which always manages to bring a smile to my face on those days, when going gets tough. My gratitude to my parents-in-law for being understanding and very supportive throughout.

And a big thank you to my husband for being my strength. Words will never do justice to what you mean to me. Thank you for being by my side, for backing me up when I fall down, for respecting my space and also being my biggest critique. You have indeed been my guide, my teacher and my best friend. Surprisingly all my worries disappeared after I vii came back home to him. The support and love from my family has been my biggest strength and instrumental in whatever I have been able to achieve. viii

TABLE OF CONTENTS

Page

ACKNOWLEDGEMENTS v

LIST OF FIGURES xi

CHAPTER

1 INTRODUCTION………………………………………………………………….1

Introduction…………………………………………………………………………….…...1

Structure of the Dissertation……………………………………………..…………………3

References ……………………………………………………………………….…………4

2 LITERATURE REVIEW…………………………………………………………..5

Trypanosoma cruzi and Chagas disease ……………………………………………………5

Life cycle of Trypanosoma cruzi …………………………………………………………..6

Contractile Vacuole Complex………………………………………………………………7

Acidocalcisomes…………………………………………………………………………..10

Traffic in trypanosomes…………………………………………………………………...13

Rab proteins………………………………………………………….……………………15

Tools to investigate the function of Rab proteins in vesicle fusion and transport mechanism……………………………………………………………………....16

GDP bound “OFF” stage of Rab proteins: examples……………………………………..18

Role of Rab32 protein in trafficking……………………………………………………...18

Role of Rab11 protein in trafficking………………………………………………………19 ix

Rab protein prenylation and potential treatment of Chagas disease………………………20

Overview of Trypanosoma cruzi infection……………………………………………...... 21

GPI-anchored surface proteins…………………………………………………………....23

Trans-sialidase…………………………………………………………………………....24

References………………………………………………………………………………...27

3 RAB11 REGULATES TRAFFICKING OF TRANS-SIALIDASE TO

THE PLASMA MEMBRANE THROUGH THE CONTRACTILE VACUOLE

COMPLEX OF TRYPANOSOMA CRUZI ………………………………………………..45

Abstract……………………………………………………………………………………46

Author Summary…………………………………………………………………………..47

Introduction……………………………………………………………………………..…47

Results …………………………………………………………………………………….50

Discussion…………………………………………………………………………………59

Materials and Methods….………………………………………………………………...64

References………………………………………………………………………………...73

4 RAB32 IS ESSENTIAL FOR MAINTAINING

FUNCTIONAL ACIDOCALCISOMES AND FOR GROWTH AND

VIRULENCE OF TRYPANOSOMA CRUZI……………………………………………101

Abstract………………………………………………………………………………..…102

Author Summary ………………………………………………………………………...102

Introduction………………………………………………………………………………103

Results……………………………………………………………………………………105

Discussion……………………………………………………………………………...... 111 x

Materials and methods…………………………………………………………………...113

References ……………………………………………………………………………….121

5 CONCLUSION…………………………………………………………………..139

Summary of key finding…………………………………………………………………139

Future work………………………………………………………………………………141

References ……………………………………………………………………………….147 xi

LIST OF FIGURES

Page

Figure 2.1: Life cycle of T. cruzi…………………………………………………………………39

Figure 2.2: The CVC in T. cruzi epimastigotes…………………………………………...40

Figure 2.3: Diagramatic representation of the and transporters

tentatively identified in the acidocalcisome of T. cruzi……………………………...……41

Figure 2.4: The GTP-GDP cycle of Rab-GTPases………………………………………..42

Figure 2.5: Schematic model summarizing the molecules involved on parasite-host cell interaction process exposed on the surface of a host cell and in trypomastigotes of T. cruzi……………………………………………………………………………...... 43

Figure 2.6: Model of T. cruzi invasion………………………………………………..…..44

Figure 3.1: Fluorescence microscopy analysis of TcRab11 in different stages

of T. cruzi……………………………………………………………………………...... 82

Figure 3.2: GFP-TcRab11DN localizes to the of different life cycle stages.....84

Figure 3.3: Regulatory volume changes of epimastigotes………………………………...85

Figure 3.4: Co-localization of GFP-TcRab11 and TcTS during amastigote differentiation in human foreskin fibroblasts……………………………………………………………...87

Figure 3.5: Localization of TcTS during differentiation to cell-derived and metacyclic

trypomastigotes…………………………………………………………………...... 88

Figure 3.6: Cryo-immunoelectron microscopy localization of GFP-TcRab11 and TcTS in amastigotes…………………………………………………………………………...... 89 xii

Figure 3.7: Overexpression of GFP-TcRab11DN reduces the surface

expression of TcTS……………………………………………………………………….91

Figure 3.8: Localization of surface proteins in GFP-TcRab11OE and

GFP-TcRab11DN-expressing parasites…………………………………………………..92

Figure 3.9: Localization of anti-Gal antibodies…………………………………………...93

Figure 3.10: Association of CVC proteins with rafts and reduced infectivity

Of TcRab11DN trypomastigotes………………………………………………………….94

Figure 3.11: Cryo-immunoelectron microscopy localization of GFP-TcRab11

in epimastigotes…………………………………………………………………………..96

Figure 3.12: Growth rate, and western blot analyses of overexpressed TcRab11…...... 97

Figure 3.13: TcAQP1 localization is not affected in GFP-TcRab11DN mutants and western blot analysis of wild type and GFP-TcRab11DN shows specificity of anti-SAPA antibodies…………………………...... 98

Figure 3.14: Localization of GFP-TcRab11 and gp35/50

during metacyclogenesis………………………………………………………………….99

Figure 3.15: Infections of host cells by trypomastigotes overexpressing TcRab11……..100

Figure 4.1: TcRab32 localization in different life stages of T. cruzi……………………127

Figure 4.2: TcRab32 is digeranylated in vitro…………………………………………..129

Figure 4.3: Localization of GFP-TcRab32 mutants……………………………………..130

Figure 4.4: Lack of colocalization between GFP-TcRab32 and mitochondrial

marker and localization of mitochondrial marker is not affected

in TcRab32 mutants……………………………………………………………………..131

Figure 4.5: Colocalization of GFP-TcRab32 and VP1 under osmotic stress…………...132 xiii

Figure 4.6: Reduced short chain poly P and PPi levels in TcRab32DN epimastigotes in comparison to wild type epimastigotes………………………………...133

Figure 4.7: Reduction in electron dense acidocalcisomes and considerable increase in empty vacuole in TcRab32DN epimastigotes in comparison

to wild type……………………………………………………………………………...134

Figure 4.8: Traffic of trans-sialidase is not affected in TcRab32DN

mutant trypomastigotes…………………………………………………………...……..135

Figure 4.9: Effect of TcRab32 mutations on the cell growth of epimastigotes

and their response to hyposmotic and hyperosmotic stress conditions…………………………………………………………...... 136

Figure 4.10: Reduced infectivity of TcRab32 mutant trypomastigotes…………………137 1

CHAPTER 1

INTRODUCTION

Introduction

Kinetoplastids are a group of flagellated protozoans that include the

Trypanosoma and , which are human with devastating health and economic effects. Because of their early divergence from other , they exhibit unusual characteristics. They are distinguished by the presence of a DNA-containing region known as “” in their single large . This was the first extranuclear DNA ever discovered, long before mammalian mitochondria were shown to contain DNA. Besides, trypanosomatids have unique peculiarities like the presence of organelles like , which are specialized containing most glycolytic enzymes [1] [2]; acidocalcisomes, acidic organelles rich in calcium and polyphosphate required for pH homeostasis and osmoregulation [3] [4]; contractile vacuole complex (CVC); needed to maintain osmoregulation [5], and as a trafficking intermediate; and biological processes first described in these like RNA editing, glycosylphosphatidylinositol(GPI)-anchor synthesis [6] and trans-splicing [7].

Details of the CVC and acidocalcisomes will be discussed in the following chapters.

Kinetoplastids are evolutionarily more early branched compared to the majority of other groups of parasitic protists, widespread and adaptable, which is an apparent reflection of their extremely successful life style. Although the different kinetoplastid pathogens have a similar genomic organization and similar cellular structures and all undergo 2 morphogenesis during their life cycle, these pathogens are transmitted by different vectors and cause specific diseases [8]. They are the causative agents of important diseases such as African sleeping sickness (caused by the group),

Chagas' disease (caused by Trypanosoma cruzi) and Leishmaniases (caused by

Leishmania spp). People primarily in tropical and subtropical areas of the world are at risk of contracting these diseases. Some of these parasites (T. brucei group) have an efficient capability to adapt to their hosts, evading the host immune system by antigenic variation.

A deep knowledge of what is occurring in the structures, organelles and in the cell of these parasites may open new perspectives for the control of disease through the development of (a) new chemotherapeutic agents, (b) vaccines or (c) more specific diagnostic procedures. The completion of genome sequences of trypanosomatids, T. brucei [9], T. cruzi [10] and [11] and also transcriptome and proteomic analyses have generated information that provide helpful tools for investigation. Besides, the TriTryp genome has advanced our understanding of the biology of these parasites and their host-parasite interaction.

Though significant advance has been made in understanding the mechanism used by these organisms in invading the host cell, very little is known about the molecular machinery involved in trafficking in T.cruzi; specifically traffic of surface proteins and endosomal targeting in T. cruzi. In this work we provide experimental evidence for the role of the contractile vacuole complex (CVC) as a trafficking hub, involved in the traffic of GPI-anchored proteins to the plasma membrane of the parasite and also its role as 3 endosomal system that transfers membrane proteins to the acidocalcisomes. We use a combination of genetic and biochemical approach to address the goal.

Structure of the Dissertation

The dissertation is subdivided into five chapters. Chapter 2 reviews the current knowledge regarding topics which are pertinent to the specific aims of my dissertation. In this chapter I try to portray a detailed analysis of key pathways that were necessary for our study, with a focus on mechanism of trafficking of GPI-anchored protein in other organisms, and also a detailed analysis of the function of Rab-GTPases and tools to investigate Rab function, as studied in other systems. This chapter also provides structural and functional overview of organelles studied in this research. Chapter 3 describes the role of T. cruzi Rab11 in the traffic of trans-sialidase to the plasma membrane via the contractile vacuole complex. This work was published in PLoS

Pathogens [12]. Chapter 4 describes the role of the other Rab-GTPase, T. cruzi Rab32, in maintaining the function of acidocalcisomes and its involvement in growth and virulence of the parasite. Chapter 5 provides an overall conclusion for this research in elucidating the role of the CVC as a trafficking intermediate in T. cruzi. It also highlights open questions pertinent for future study, not only limited to the of T. cruzi, but also to the other trypanosomatids. 4

REFERENCES 1. Parsons M (2004) Glycosomes: parasites and the divergence of peroxisomal purpose. Mol Microbiol 53: 717-724. 2. Opperdoes FR, Borst P (1977) Localization of nine glycolytic enzymes in a -like in Trypanosoma brucei: the . FEBS Lett 80: 360-364. 3. Docampo R, de Souza W, Miranda K, Rohloff P, Moreno SN (2005) Acidocalcisomes - conserved from to man. Nat Rev Microbiol 3: 251-261. 4. Docampo R, Scott DA, Vercesi AE, Moreno SN (1995) Intracellular Ca2+ storage in acidocalcisomes of Trypanosoma cruzi. Biochem J 310 ( Pt 3): 1005-1012. 5. Rohloff P, Docampo R (2008) A contractile vacuole complex is involved in osmoregulation in Trypanosoma cruzi. Exp Parasitol 118: 17-24. 6. Ferguson MA (1999) The structure, biosynthesis and functions of glycosylphosphatidylinositol anchors, and the contributions of trypanosome research. J Cell Sci 112 ( Pt 17): 2799-2809. 7. Liang XH, Haritan A, Uliel S, Michaeli S (2003) trans- and cis-splicing in trypanosomatids: mechanism, factors, and regulation. Eukaryot Cell 2: 830-840. 8. Mableson HE, Okello A, Picozzi K, Welburn SC (2014) Neglected zoonotic diseases- the long and winding road to advocacy. PLoS Negl Trop Dis 8: e2800. 9. Berriman M, Ghedin E, Hertz-Fowler C, Blandin G, Renauld H, et al. (2005) The genome of the African trypanosome Trypanosoma brucei. Science 309: 416-422. 10. El-Sayed NM, Myler PJ, Bartholomeu DC, Nilsson D, Aggarwal G, et al. (2005) The genome sequence of Trypanosoma cruzi, etiologic agent of Chagas disease. Science 309: 409-415. 11. Ivens AC, Peacock CS, Worthey EA, Murphy L, Aggarwal G, et al. (2005) The genome of the kinetoplastid parasite, Leishmania major. Science 309: 436-442. 12. Niyogi S, Mucci J, Campetella O, Docampo R (2014) Rab11 regulates trafficking of trans-sialidase to the plasma membrane through the contractile vacuole complex of Trypanosoma cruzi. PLoS Pathog 10: e1004224. 5

CHAPTER 2

LITERATURE OVERVIEW

Trypanosoma cruzi and Chagas disease

The obligate intracellular parasite Trypanosoma cruzi is the causative agent of Chagas disease, which is the leading cause of cardiac death in endemic areas throughout Latin

America, where it is mostly vector-borne transmitted to humans by contact with faeces of triatomine bugs, known as ‘kissing bugs’. The invertebrate hosts are Hemiptera and

Reduvidae such as Rhodinus prolixus, Triatoma infestans, and Panstrongylus megistus.

More than 11 million people are infected with the parasite and some 40 million more are at risk. Among other Neglected Tropical Diseases (NTD), Chagas disease ranks near the top in terms of annual death and DALYs (Disability Adjusted Life Years) lost [1,2]. In the past decades it has been increasingly detected in the United States of America,

Canada, many European and some Western Pacific countries. This is due mainly to population mobility between Latin America and the rest of the world [3] [4]. Although currently available nitroheterocyclic drugs (benznidazole and nifurtimox) are moderately efficacious when administered during the acute phase, they have been minimally successful in treating chronic infection. Chronic Chagas' cardiomyopathy is the most serious and frequent manifestation of Chagas’ disease characterized by cardiac arrhythmias, heart failure, and risk of sudden death from ventricular fibrillation or tachycardia [5]. It is the main cause of mortality among these patients and is associated to 6 a poorer survival compared with other forms of cardiomyopathies. Early detection of heart involvement in seropositive individuals remains challenging.

Life cycle of Trypanosoma cruzi

Persistent infection with T. cruzi causes Chagas disease. The parasite is transmitted to humans by infected blood-sucking Triatominae insects, which defecate after obtaining a blood meal and thus release the trypomastigotes in faeces. Scratching the area of bite causes the trypomastigotes to enter the wound and invade nearby cells. While intracellular, they differentiate into amastigotes that multiply by binary fission. The amastigotes differentiate into trypomastigotes, which are released into the bloodstream and infect cells of multiple organs and tissues, including the heart, gut, CNS, smooth muscle, and adipose and once again become amastigotes. The Triatominae insects become infected when they take a parasite-containing blood meal from an infected human or . The trypomastigotes undergo morphological and physiological transformations in the midgut of the vector and differentiate into infective trypomastigotes in the hindgut. The morphological characteristics of these developmental forms (intracellular, blood and insect stages) have been extensively investigated by different microscopy techniques. The structural details of the different forms are as following:

1) Amastigotes: They are spherical in shape, able to divide and are infective.

2) Trypomastigotes: these forms have a length of about 25 μm and a diameter of

about 2 μm. The kinetoplast is located posterior to the nucleus. These forms are

not able to divide. The nucleus is elongated and organized in the central portion of

the cell. 7

3) Epimastigotes: They are spindle-shaped, 20–40 μm long with kinetoplast located

anterior to the nucleus. These forms are able to divide. The nucleus has a rounded

shape.

Contractile vacuole complex

The Contractile Vacuole Complex (CVC) was first described in more than

200 years ago (Spallanzani, 1799) and was later found in a wide range of , photosynthetic and nonphotosynthetic and . Clark (1959) (J. Protozool.,

1959) was the first to describe the presence of a CVC in T. cruzi and reported a pulsation period (time between contractions) in epimastigotes between 1 min and 1 min and 15 s.

Besides T. cruzi the CVC is also present in Leishmania sp [6] and in monogenetic trypanosomes like Leptomonas collosoma [7] and luciliae [8] and apparently absent in Trypanosoma brucei.

Architecture: Structure and composition

The CVC is an intracellular compartment with an osmoregulatory role in different protists (discussed below). This compartment has a bipartite structure, consisting of a central vacuole or bladder and a surrounding loose network of tubules and vesicles named the spongiome [9]; [10]. Functional distinctions between these 2 components of the CVC were evidenced by the localization of different proteins to each compartment.

Recent proteomic analysis and microscopy studies of green fluorescent protein (GFP)- tagged proteins have revealed the presence of the vacuolar H+-ATPase, Rab11, Rab32,

AP180, VAMP1 and a putative phosphate transporter (PT) in the bladder while calmodulin and two SNAREs are localized to the spongiome [11]. The CVC is present in all the different life cycle stages of T.cruzi. Fig 2.2 shows a turgid central vacuole and 8 interconnected tubules forming a network in a well preserved contractile vacuole. In fact the contractile vacuole is believed to be docked to a domain of the flagellar pocket (Fig

2C, 2D) with the presence of an electron-dense region between the two. This domain of the contractile vacuole seems to get deformed because of its physical connection with the flagellar pocket (Fig 2.2D). This feature has been shown before in Leptomonas spp where the contractile vacuole membrane is permanently attached to the plasma membrane of the flagellar pocket by a dense adhesion plaque [7].

The search for other functions of the CVC

The function of the CVC with regard to osmoregulation in T.cruzi has been a subject of study in our lab for many years with the result of several publications stating the mechanistic role of this organelle. The CVC accumulates through an or water channel [12] [13] [14] and expels it out of the cell through pores in the plasma membrane [9,10]. It is important for regulatory volume decrease (RVD) after hyposmotic stress [13], as well as for shrinking of the cells when submitted to hyperosmotic stress

[4]. The CVC bladder does not burst during volume regulation phenomenon. It has been proposed [15] that the connected tubular spongiome acts as a reservoir for water which increases in surface area by virtue of the phospholipids present in the membrane to accommodate the increase in volume during hyposmotic stress. This result is supported by our data as shown in Figure 3.3C-D and 3.11B-C and discussed in chapter 3.

Other roles of the CVC in T. cruzi had not been investigated before this dissertation.

CVC has been studied in several protists and we will discuss its role below. The presence of several proteins related to calcium signaling [10] underscore the role of the CVC in

Ca2+ homeostasis. It also has a role in transfer of some proteins to the plasma membrane

9

[16-18]. In , the vacuolar ATPase (V-H+-ATPase) and calmodulin (CaM) move to the plasma membrane when cells are starved during stationary phase [16], and the Ca2+-ATPase PAT1 moves to the plasma membrane when cells are incubated at high Ca2+ concentrations [17]. Some luminal proteins, such as the adhesins DdCAD-1 and discoidin-1 can also be targeted to the cell surface via the CVC in D. discoideum [18,19]. We recently reported (Chapter 3) the role of the CVC in traffic of GPI-anchored surface proteins in T. cruzi [20]. In T. cruzi epimastigotes, the polyamine transporter TcPOT1.1, which localizes to CVC-like structures, has also been reported to appear in the plasma membrane when the culture medium is deficient in polyamines [21]. Also a phosphate transporter (TcPHO1) has been localized to the CVC

[11]. It is interesting to note that dajumin-GFP (the CVC marker) is trafficked to the

CVC of D. discoideum via the plasma membrane and is internalized by a clathrin- dependent mechanism, suggesting that clathrin-mediated may have a role in the biogenesis and/or, maintenance of the contractile vacuole by functioning in retrieval of proteins from the [22]

The proteomic and bioinformatics study [11] of the CVC of T. cruzi identified a cohort of proteins having trafficking roles. This study detected the presence of SNAREs 2.1 and

2.2, VAMP1 (VAMP7 homolog), AP180, and the small GTPases Rab11 and Rab32. The accumulation of all of these proteins which have role in vesicle fusion/fission and tethering events in the CVC, suggests that the CVC of T. cruzi was acts as a trafficking hub. 10

Acidocalcisome

Acidocalcisomes were first described in trypanosomes and later found in Apicomplexan parasites, , slime molds, fungi, eggs of different origins, and human cells [23].

These organelles are acidic compartments storing high concentrations of calcium and polyphosphate (polyP) [24]. Figure 2.3 shows the pumps and that are present in the membrane of the acidocalcisome and are necessary for their cation and water accumulation and release, as well as enzymes involved in the synthesis and degradation of pyrophosphate and polyP. A number of these pumps, channels, and exchangers in the membranes were biochemically characterized and their genes cloned and expressed.

Acidocalcisome: Structure

Acidocalcisome of protists in general are spherical in shape. Trypanosomatids are rich in very short chain polyP such as polyP3, polyP4, and polyP5. PolyP is arbitrarily divided into two forms: short-chain (from 3 to ~300 Pi) and long-chain (from 300 to ~1000 Pi) polyP, based on the method used for its extraction. Besides polyP, trypanosomatids also contain orthophosphate (Pi) and PPi. These phosphorus compounds are in close association to cations (, , magnesium, calcium, zinc, and iron) and basic amino [24] [25]. In eukaryotic cells, polyP is present in different compartments, including the , nucleus, , and mitochondria, but is preferentially accumulated in acidic such as the yeast vacuole and acidocalcisomes [23,26].

Taking into account its total concentration and the relative volume of acidocalcisomes in some of these cells (about 1–2% of the total cell volume), the intraorganellar concentration is in the molar range (~3 M) [24]. These vesicles are acidic and thus accumulate dyes like [27]. DAPI can be used to detect polyP in these

11 organelles [28]. By standard electron microscopy, they appear as empty vacuoles or vacuoles containing a thin layer of dense material or an that sticks to the inner face of the membrane. The electron-dense material inside acidocalcisomes is better preserved with the use of cryomethods [29] where the organelles seem completely filled by an electron-dense material. Two proton pumps were found in acidocalcisomes of protists. One is the vacuolar-type H+-ATPase, a macromolecular complex of 14 subunits

+ [30,31], and the other is the V-H -PPase, a single subunit protein that uses PPi instead of

ATP to transport .

Acidocalcisome: biogenesis

Acidocalcisome of eukaryotes is considered lysosome related organelles (LROs) like platelets dense granules and mast cell granules. Human platelet dense granules contain polyP and are similar to acidocalcisomes of bacteria and unicellular eukaryotes.

Polyphosphate released from platelets modulates blood coagulation and fibrinolysis. Mast cell granules also have polyP, that is released and acts as a novel pro-inflammatory regulator. Adaptor protein (AP) complexes are important mediators for vesicular transport of membrane proteins between cellular compartments, such as Golgi complex, , lysosomes, and plasma membrane [32]. AP-3 is involved in sorting of proteins to lysosomes and LROs from the Golgi or from endosomes. Knockdown of the

β3 or δ subunits of the AP-3 complex led to a decrease in the number of acidocalcisomes in both procyclic (PCF) and bloodstream forms of T. brucei [33].

Functional roles

Storage of phosphorus compounds (Pi, PPi, and polyP) and cations (calcium, magnesium, sodium, potassium, zinc, and iron) is one of the main roles of acidocalcisomes from 12 different protists. This storage in an intracellular compartment reduces the osmotic effect of large pools of these compounds in the cytosol. The recent discovery that polyP has critical roles in blood clotting [34], and inflammation [35] suggests that polyP present in could be involved in their pathogenicity. Decrease in the levels of polyP in parasites such as T. brucei, T. gondii, or L. major (reviewed in [36]) reduces their pathogenicity. It is not known whether this is due to osmotic fragility of the parasites as a result of changes in polyP levels that impact their ability to grow in vivo, making the immune response against them more successful, or to a role of polyP in modulating the immune response directly.

The discovery of an inositol 1,4,5-trisphosphate receptor (IP3R) in acidocalcisomes of T. brucei [37] indicates that these organelles have a significant role in Ca2+ signaling. Ca2+ release via IP3Rs stimulates activities critical for life.

Acidocalcisomes also appear to have a role in regulation of intracellular pH.

Acidocalcisomes have also an important role in osmoregulation. There is rapid hydrolysis or synthesis of acidocalcisome polyP during hypo- or hyperosmotic stress, respectively, in T. cruzi [38], as well as changes in sodium and chloride content in acidocalcisomes of

L. major in response to acute hyposmotic stress [39]. It has been proposed that the stimulus of cell swelling causes a spike in intracellular cAMP through an as yet unidentified adenylyl cyclase, which causes aquaporin (TcAQP1) containing acidocalcisome to fuse with the contractile vacuole and translocation of aquaporin [13].

This process helps the elimination of water by the contractile vacuole.

13

Traffic in trypanosomes

Trypanosomes appear to have a less complicated trafficking pathway in comparison to eukaryotes, partly due to their unicellular structure and also due to a reduction in the copy number of organelles in comparison to multicellular organisms. Trypanosomes have an elongated shape, with the presence of tightly spaced subpellicular subtending the plasma membrane. Endocytic and exocytic trafficking is restricted to the posterior flagellar pocket (FP). It sometimes also occur at areas of the plasma membrane where the cell , formed by sub-pellicular microtubules, is absent.

Endocytosis in T. cruzi also occurs through the , present in both epimastigotes and amastigotes.

One of the surface proteins whose traffic has been studied in T. brucei is the GPI- anchored Variant Surface Glycoprotein (VSG), which is responsible for antigenic variation in them. VSG is a major secretory cargo of T. brucei bloodstream forms, which is trafficked to the surface; from where it is endocytosed and recycled via the flagellar pocket [40], [41]. Secretory cargos leave the ER from defined ER exit sites (ERES) where they are loaded into COPII secretory vesicles [42]. Though the post-Golgi trafficking pathway is not very clear, it is known that cargo is destined either for the lysosome or the cell surface. Some players which belong to the Rab family of proteins responsible for vesicular fusion have been identified. These include TbRab5A/B (early ), TbRab11 (recycling endosome), and TbRab7 (late endosome) (reviewed in

[43]). The pathway from the post-Golgi to the lysosome, or the flagellar pocket or to the cell surface needs to be delineated. There are some basic similarities between the secretory pathways of trypanosomes with model organisms like yeast or vertebrate cells, 14 but there are some defined differences as well. Nevertheless, because of their streamlined architecture they offer unique opportunities to study general eukaryotic cell biology.

Endocytosis is rapid in T. brucei, probably because of the phenomenon of immune evasion of this parasite. Clathrin-mediated mechanisms are the major route for endocytosis in T. brucei and GPI-anchored proteins are endocytosed by clathrin- dependent pathways in trypanosomes [44].

The mechanisms involved in , endocytosis and recycling in T. cruzi are poorly understood compared to mammalian cells or to the related organism T. brucei. Most of what is known comes from structural and biochemical studies with regard to enzymes and endocytic markers, as will be discussed below. T. cruzi ingests nutrients from the environment by endocytosis, but the endocytic pathway and molecules/organelles involved in this important metabolic pathway are still poorly known. Data on fluid-phase of peroxidase and on receptor-mediated endocytosis of gold-labeled albumin, peroxidase, transferrin and LDL [45] by T. cruzi showed that the ingested material entered the cells through the cytostome and/or the flagellar pocket region [46,47]. Both sites open at the anterior cell end, where the single emerges. Endocytosis of transferrin-gold nanoparticles has been studied by [48]. But unlike

T. brucei, endocytosis is mostly clathrin-independent in T. cruzi. In an attempt to identify the compartments involved in endocytosis in T. cruzi, it has been found that ingested material concentrates in the reservosome, an acidic pre-lysosomal compartment in the posterior end of the cell, rich in cysteine proteinase, but which does not contain phosphatase or other lysosomal membrane proteins [49].

15

Rab proteins

Proteomic and bioinformatics analyses of proteins localized to the CVC identified several proteins with trafficking roles [11]. Among them, two Rab (Ras-related proteins in the brain) GTPases (Rab32 and Rab11) were identified, which are the subject of my research.

Rab proteins are members of the highly evolutionarily conserved Rab superfamily of

GTPases that are structurally related to the Ras proteins. They regulate different intracellular transport processes. Other members of the Ras superfamily such as Rho, Rab and Ran proteins, are regulated by similar interactions with nucleotides. However, they interact with distinct regulators and downstream target proteins, allowing them to contribute to unique cellular functions (Fig. 2.3). The related regions include at least four protein domains found in all GTPases that are involved in the binding of GTP or GDP

[50]. When Rabs, are in the GTP-bound state, they are thought to be functionally active and are inactive when they bind GDP [50]. Conversion of the GDP-bound Rab into the

GTP-bound form occurs through the exchange of GDP for GTP, which is catalyzed by a guanine nucleotide exchange factor (GEF) and causes a conformational change (Fig. 2.4).

The GTP-bound ‘active’ conformation is recognized by multiple effector proteins and is converted back to the GDP-bound ‘inactive’ form through hydrolysis of GTP, which is stimulated by a GTPase-activating protein (GAP) and releases an inorganic phosphate

(Pi). The newly synthesized Rab, in the GDP-bound form, is recognized by a Rab escort protein (REP). The REP presents the Rab to a geranylgeranyl transferase (GGT), which geranylgeranylates the Rab on one or two carboxy-terminal Cys residues. The geranylgeranylated, GDP-bound Rab is recognized by Rab GDP dissociation inhibitor

(GDI), which regulates the membrane cycle of the Rab. Targeting of the Rab–GDI 16 complex to specific membranes is mediated by interaction with a membrane-bound GDI displacement factor (GDF) that catalyzes the dissociation of Rab-GDI complex at particular membrane surfaces. Coordinated regulation of Rab proteins is instrumental in ensuring precision and fidelity of membrane trafficking. Accumulated evidence suggests that Rab GTPases recruit tethering and docking factors to establish firm contact between the membranes to fuse, after which SNAREs (Soluble NSF Attachment Protein Receptor) become involved and complete the fusion process [51,52]. Crystallographic structure of

Rab proteins have been identified which include structural motifs and modes of effector interaction that are distinct from those of other GTPase families. The active conformation

(GTP-bound) is stabilized by additional hydrogen bonding i phosphate of GTP, mediated by serine residues in the P-loop and switch I region, as well as an extensive hydrophobic interface between the switch I and II regions [53,54].

Besides the presence of a hydrophobic triad (residues Phe-58, Trp-75, and Tyr-90) to a structural flexibility, thus contributing to the mechanism by which different Rabs interact with their specific subset of effector proteins.

A total of 17 Rab proteins have been identified in T. cruzi. In addition to Rab32 and

Rab11, only three other Rab proteins: Rab4, Rab5 and Rab7 were studied in T. cruzi [55-

57]. The lack of genetic tools in T.cruzi prevented investigation regarding the mechanism of function of these Rabs.

Tools to investigate the function of Rab proteins in vesicle fusion and transport mechanism

There are several tools available to study the localization and function of Rab proteins in mammalian cells and to study the involvement of Rab isoforms in specialized membrane

17 trafficking events [58]. The tools include study of enhanced green fluorescent protein

(EGFP)-tagged mouse and human Rabs, FLAG-tagged Rabs, glutathione S-transferase

(GST)-tagged Rabs, Gal4-binding domain (GBD)-tagged Rabs, Tre-2/Bub2/Cdc16

(TBC) domain-containing Rab-GTPase activating proteins (GAPs), and small interfering

RNAs. EGFP-Rabs are used to screen for Rabs that are localized on specific organelles and regulate their transport, and GST-Rabs and GBD-Rabs are used to screen for novel

Rab effectors by GST pull-down assays and yeast two-hybrid assays, respectively.

Several methods have often been used to investigate the function of specific Rab isoforms in membrane traffic. The first, and most commonly used method, has been overexpression in cells of a constitutive active (CA) mutant that mimics the GTP-bound form or of a constitutive negative (CN) mutant that mimics the GDP-bound form (Fig.

2(a)). The second method, which has come into use recently, is knockdown of a specific

Rab by RNA interference technology. The third method is based on a genetic approach in which a specific Rab effector domain is overexpressed in cells. As the effectors that bind to Rab proteins and their binding domains have not been studied in detail, the third method has severe limitations. Since Rab-GAP is able to inactivate its substrate Rab by promoting GTPase activity, overexpression of Rab-GAP in cells should result in specific inactivation of its substrate Rab, which, in turn, would inhibit specific organelle transport.

Although the specific Rab-GAP of most mammalian Rabs has yet to be identified, a TBC domain is generally thought to function as a Rab-GAP. Although TBC/Rab-GAP proteins are useful for inactivating the function of endogenous Rab proteins, the results need to be interpreted carefully based on the specificity of some TBC/Rab-GAPs (e.g.,[59]).

Unfortunately the RNAi machinery is absent in T.cruzi [23]. Hence, expression of the CN 18 or CA form that mimics loss-of-function or gain-of function effects was used for our research. .

GDP bound “OFF” stage of Rab proteins: examples

Dominant-negative Rab mutants work in cells by competing with endogenous Rabs for binding to Rab-GEFs. The mutants cannot interact with downstream target proteins within cells, so when they are expressed in cells in excess they bind to GEFs and form

‘dead-end’ complexes. Thus sequestration of Rab-GEFs prevents the activation of endogenous Rabs [60]. Biological experiments supporting this view [61] have shown that the growth-inhibitory effect of Ras17N expression in mammalian cells, or of Ras15A expression in yeast, can be overcome by increased expression of either a Ras-specific

GEF or wild-type Ras. In addition, mutations within the region of Ras that interacts with

GEFs suppress the inhibitory phenotype of Ras17N.

Role of Rab32 protein in trafficking

Different Rab-GTPases localize to different organelles which gives every organelle a unique identity. Rab32 has been shown to regulate post-Golgi trafficking of melanogenic enzymes in mammalian cells [62] and transport and melanocyte biogenesis in Xenopus laevis [63]. It is known to regulate pigmentation, but it is not directly required for the formation of [62]. Rab32 has also been shown to regulate maturation along with a network of other Rab GTPases [64]. It is required for the formation of autophagic vacuoles and is involved in regulation of the clearance of aggregated proteins by in a nucleotide binding state dependent manner [65].

Human Rab32 expressed in COS cells localizes to mitochondria as an A-kinase

19 anchoring protein (AKAP), and the expression of its GDP-bound form causes the fragmentation of mitochondria [66].

No function of Rab32 has yet been reported in trypanosomes, although acidocalcisomes, as melanosomes, are lysosome-related organelles [67]. Interestingly, Rab32 was found in both and membrane fractions from human platelets [68]. Platelet dense granules are the most similar to acidocalcisomes in that they contain PPi and polyP and are rich in calcium (reviewed in [23]).

In this dissertation (Chapter 4) I study if the function of TcRab32 is conserved in T. cruzi, by regulating function of acidocalcisomes. TcRab32 has the “DIAGQ” domain that is present in Rab32 across all species. A similar replacement is found in Rab38, Rab29, and

Rab7L1/29 of mammalian cells, and in RabE from Dictyostelium discoideum [65], but there are no orthologs to any of these other Rabs in T. cruzi.

Role of Rab11 protein in trafficking

Rab11 is one of the best studied Rab-GTPases, other than Rab5. Rab11 regulates exocytic and recycling processes, thereby directing proteins and membranes towards the cell surface. Rab11 generally localizes to the trans-Golgi as well as post-Golgi endosomes of secretory pathway [69]. Rab11 has been shown to regulate traffic of several receptors and adhesion proteins which have roles in cell-cell adhesion, migration and invasion; with diverse cellular functions including ciliogenesis, cytokinesis, neuritogenesis, and oogenesis [70-73]. This high degree of functional complexity is achieved by mutually exclusive recruitment of a range of Rab11 effector proteins

In T. brucei, Rab11 localizes to the recycling endosomes [74]. It mediates the transfer of the glycosylphosphatidylinositol (GPI)-anchored proteins transferrin [75] and variant 20 surface glycoprotein (VSG) [76] to the plasma membrane. Rab11 depletion inhibited export, but not uptake, of internalized transferrin, thus implying its involvement in secretion pathway [77]. Besides, Rab11 localizes to the CVC of D. discoideum [78]. Our observation [11] that Rab11 localizes to the CVC in T. cruzi suggested that an uncharacterized membrane transport exists connecting the CVC to the plasma membrane.

That is the subject of Chapter 3 of my dissertation.

Rab protein prenylation and potential treatment of Chagas disease:

Protein prenylation is a post–translational modification that occurs in many eukaryotic cells which functions to bind proteins to cell membrane and they may direct protein- protein interactions and thus are needed for many biological activities. Among the many prenylated proteins Rabs form a distinct class. The C-terminus of Ras superfamily

GTPases terminates in a so-called CAAX box (where C is cysteine, A is usually but not necessarily an aliphatic , and X is a variety of different amino acids). The

CAAX box serves as a signal for a series of post-translational modifications: 1) farnesylation or geranylgeranylation of the cysteine sulfhydryl group, 2) endoproteolytic removal of AAX, and 3) methylation of the -carboxyl group of the prenylated cysteine residue. The hydrophobic C termini of Ras superfamily GTPases are thought to be important for anchoring these proteins to cellular membranes [79] [80]. The three structural classes of prenylation that have been identified are C-terminal farnesylation, C- terminal geranylation and C-terminal digeranylgeranylation. It involves transfer of a 15- carbon farnesyl or a 20-carbon geranylgeranyl from the corresponding prenyl- pyrophosphate to the sulfhydryl group of the carboxyl-terminal cysteine, respectively

[81] [28]. Since prenylation is required for the function of important regulators of cell

21 growth, inhibitors of these enzymes are likely to have therapeutic potential for the treatment of parasitic diseases. The fact that growth of T. brucei, T. cruzi, and L. mexicana is blocked by protein farnesyl transferase (PFT) inhibitors suggests that trypanosomatid PFT is a good target for treating sleeping sickness, Chagas disease, and In addition the mechanism of action of bisphosphonates involves the inhibition of the farnesyl pyrophosphate synthase, thereby preventing the prenylation of small GTPase signaling proteins, suggesting that they can be used to treat parasitic diseases [82].

Overview of Trypanosoma cruzi infection:

Adhesion of T. cruzi to Vertebrate Cells

The first steps of the T. cruzi-host cell interaction process can be divided into three stages: adhesion and recognition, signaling, and invasion. Invasion depends on the T. cruzi strain and which developmental stage is used, the morphology of the trypomastigote, whether slender or stout, and which host cell it is invading, as reviewed in [83]. The mechanisms by which T. cruzi infective forms gain access to the intracellular milieu are still being studied. The adhesion step involves the recognition of molecules present on the surface of both parasite and host cells (Figure 2.4). T. cruzi, need to escape their vacuole and instead replicate in the host cell cytosol. This vacuolar escape is the first step of egress, which needs to be perfectly controlled in order to lyse the vacuole but preserve host cell integrity. After replication, a second egress event then leads to the release of the progeny from the host cell. Importantly, both steps need to be individually regulated. This illustrates that the completion of replication must play a central role in triggering egress for vacuolar as well as cytosolic pathogens. The timing is likely 22 controlled by intrinsic cues to optimize the number of progeny to be released and to ensure that the replication and maturation of the transmission forms have been completed

Parasite Molecules

Different strains of T. cruzi as well as different forms of the parasite (tissue culture derived trypomastigotes, metacyclic trypomastigotes and amastigotes), express different molecules on their surface. These surface molecules interact with host components to invade mammalian cells. Some of these surface antigens central to our study have been discussed below.

Host cell molecules

One class of receptors present in mammalian cells is represented by lectin-like molecules.

Lectins are sugar-binding proteins which are highly specific for their sugar moieties and are involved in attachment between pathogens and host cells [84]. Carbohydrate residues present in the plasma membrane of mammalian cells can function as receptors. Studies show galactosyl, mannosyl and sialyl residues play a role in parasite internalization [85].

Integrins, receptors that mediate attachment between two cells or cell and , are involved in the invasion processes [86]. Another molecule present on the host cell surface and involved in trypomastigotes’ entry is the TGF receptor [87].

Model of T. cruzi invasion

As reviewed in [83] the model indicates three distinct mechanisms of T. cruzi entry into host cell (Fig. 2.5). (a) The lysosome dependent pathway is initiated by targeted Ca2+- regulated exocytosis of lysosomes in the plasma membrane; (b) in the dependent pathway trypomastigotes penetrate into a host cell through a plasma membrane expansion that culminates in assembly of a . Either early endosomes or

23 lysosomes can fuse with the parasitophorous vacuole; (c) in the lysosome-independent pathway, parasites enter cells through plasma membrane invaginations that accumulate

PIP3 (product of class I PI3K activation). Subsequently, internalized parasites are contained in a vacuole formed from the plasma membrane that maturates with the acquisition of early endosome markers (Rab5 and EEA1) and subsequently with the acquisition of lysosome markers; the trypomastigote forms gradually transform into an amastigote form with simultaneous of the parasitophorous vacuole membrane. Then, amastigotes in direct contact with the cytoplasm start to divide.

GPI-anchored surface proteins

Glycosylphosphatidylinositol (GPI)-anchoring is a common, relevant posttranslational modification of eukaryotic surface proteins [88]. GPI-anchored proteins have been postulated to serve diverse functions such as cell surface protection in protozoan parasites, synthesis in yeast or cell adhesion and transmembrane signaling in mammalian cells. GPI-anchored proteins are also the major cell surface molecules expressed by the kinetoplastids; T. brucei, T. cruzi and Leishmania spp. Considering their role in host cell invasion, protection from the host cell milieu, they are attractive targets for drugs against parasitic diseases and for design of diagnostic probes [89,90].

GPI-anchored proteins are usually transported from the (ER) to the plasma membrane through the , where lipid raft-like structures form

[91]. Sorting is achieved by the formation of domains rich in sphingolipids, cholesterol and GPI-anchored proteins, specifically incorporated into vesicular carriers destined for fusion with the plasma membrane. Though sorting is achieved mainly at the ER or the

Golgi, it can be achieved at several steps in the secretory pathway [92]. 24

Trypanosomatids have an abundance of GPI-anchored surface molecules. T. brucei is covered by a dense coat of GPI-anchored VSG protein. This primary secretory cargo is a stage-specific protein expressed by T. brucei [93]. Only correctly folded GPI-anchored

VSG is able to reach the cell surface; GPI-deficient VSG is retained in the ER and later degraded. In these parasites GPI-anchored homodimers are formed in the ER and reache the flagellar pocket via the Golgi apparatus [94].

GPI-anchored surface proteins are expressed in all developmental stages of T. cruzi and encoded by thousands of members of multigene families: mucins, associated surface proteins (MASP) [95] and members of the trans-sialidase family/gp85 glycoprotein [96,97] and metalloproteinase gp63. But, the traffic route taken by GPI- anchored proteins and the carrier proteins are yet to be characterized in T. cruzi. This topic is the aim of our study in Chapter 3.

Trans-sialidase

T. cruzi is unable to synthesize sialic acid and it depends on the host cell for it [98]. It is achieved by the expression of trans-sialidase on its surface. This enzymatic activity is different from the eukaryotic sialyltransferases present in the Golgi complex that exclusively use CMP-sialic acid as the donor substrate. Trans-sialidase is developmentally regulated in T. cruzi. The enzyme, located on the trypanosome surface, is responsible for transferring sialyl residues from host glycoconjugates to parasite molecules. Trans-sialidase is capable of directly transferring sialic acid residues between a variety of molecules ([99] [100] [101]). TcTS is crucial in the life cycle of the parasite because it allows the acquisition of sialyl residues from the host glycoconjugates preventing their lysis by the alternative complement pathway [102,103], and opsonization 25 followed by killing by natural antibodies [104]. Trans-sialidases are important for neural, glial and epithelial cell invasion through binding to the nerve growth factor receptors

[105,106], to prevent during infection [107], and to trigger the appearance of protective CD4+ and CD8+ T cells [108]. It also enables the parasite to infect/attach cells

[101,109], and exit the parasitophorous vacuole [110]. Pereira and colleagues [104] using trypomastigotes expressing trans-sialidases (TS+) and trypomastigotes that do not express trans-sialidases (TS−) demonstrated that the TS+ population was highly invasive, whereas

TS− was extremely inefficient to infect nonphagocytic cells.

TcTS is shed to the extracellular medium, including within the host cells [111], through the action of an endogenous phospholipase C, and also with vesicles of the plasma membrane [112]. The shed TcTS induces several hematological abnormalities and alters the immune system [113], [114,115]. SAPA (Shed-Acute-Phase-Antigen) is a family of three to six proteins of 160-200 kDa encoded by related genes which are mainly expressed in the infective (trypomastigote) stage of the parasite [116]. The amino acid sequence of SAPA as deduced from the DNA sequence showed that its C-terminal portion contained a variable number of repeated units of 12 amino acids in length [117].

The SAPA N-terminal region contained two Ser-X-Asp-X-Gly-X-Thr-Trp motifs that are conserved in bacterial and viral neuraminidases [118]. In addition, SAPA contained two other of such motifs having three out of the five amino acids similar. These repetitive motifs are readily detected by antibodies present in the sera from infected patients, thus suggesting that they are major targets of the immune system.

The trans-sialidase displayed by the epimastigote (the parasite form present in the reduviid vector) has a potential trans-membrane domain and is not released, even after 26 addition of exogenous phospholipase. But, the enzyme present in the trypomastigote (the infective form of the parasite that circulates in the blood of the vertebrate host) is anchored by a glycosylphosphatidylinositol (GPI) linkage to the T. cruzi surface and is released into the environment [119].

TcTS genes are distributed in several families of which only one is composed by genes encoding the active enzyme (TS) and its inactive isoform (iTS), which differs in only one mutation (Tyr342His) [120]that completely abolishes its TS activity, but retains its property to recognize terminal galactoses. The crystal structure of iTS has been determined [121]. The 680 amino acids-amino terminal contains the catalytic activity.

The recombinant protein binds sialic acid and galactose in vitro and competes with a neutralizing antibody to a discontinuous epitope of TS indicating that it is properly folded

[109].

Although TcTS has been known for several years, its structure has been solved and its catalytic role been studied, our understanding of its trafficking is still limited. Many biological roles have been attributed to TcTS in connection with Chagas disease; but due to the lack of efficient inhibition, its direct effect on invasion had been difficult to study.

This dissertation delineates its traffic pathway and demonstrates the effect of TS on host cell invasion (as addressed in Chapter 3).

27

REFERENCES

1. Hotez PJ, Dumonteil E, Heffernan MJ, Bottazzi ME (2013) Innovation for the 'bottom 100 million': eliminating neglected tropical diseases in the Americas. Adv Exp Med Biol 764: 1-12. 2. Hotez PJ, Bottazzi ME, Franco-Paredes C, Ault SK, Periago MR (2008) The neglected tropical diseases of Latin America and the Caribbean: a review of disease burden and distribution and a roadmap for control and elimination. PLoS Negl Trop Dis 2: e300. 3. Gascon J, Bern C, Pinazo MJ (2010) Chagas disease in Spain, the United States and other non-endemic countries. Acta Trop 115: 22-27. 4. Bern C, Kjos S, Yabsley MJ, Montgomery SP (2011) Trypanosoma cruzi and Chagas' Disease in the United States. Clin Microbiol Rev 24: 655-681. 5. Rassi A, Jr., Rassi A, Marin-Neto JA (2010) Chagas disease. Lancet 375: 1388-1402. 6. Figarella K, Uzcategui NL, Zhou Y, LeFurgey A, Ouellette M, et al. (2007) Biochemical characterization of Leishmania major aquaglyceroporin LmAQP1: possible role in volume regulation and osmotaxis. Mol Microbiol 65: 1006-1017. 7. Linder JC, Staehelin LA (1979) A novel model for fluid secretion by the trypanosomatid contractile vacuole apparatus. J Cell Biol 83: 371-382. 8. Baqui MM, De Moraes N, Milder RV, Pudles J (2000) A giant phosphoprotein localized at the spongiome region of Crithidia luciliae thermophila. J Eukaryot Microbiol 47: 532-537. 9. Allen RD, Naitoh Y (2002) Osmoregulation and contractile vacuoles of . Int Rev Cytol 215: 351-394. 10. Docampo R, Jimenez V, Lander N, Li ZH, Niyogi S (2013) New insights into roles of acidocalcisomes and contractile vacuole complex in osmoregulation in protists. Int Rev Cell Mol Biol 305: 69-113. 28

11. Ulrich PN, Jimenez V, Park M, Martins VP, Atwood J, 3rd, et al. (2011) Identification of contractile vacuole proteins in Trypanosoma cruzi. PLoS One 6: e18013. 12. Montalvetti A, Rohloff P, Docampo R (2004) A functional aquaporin co-localizes with the vacuolar proton pyrophosphatase to acidocalcisomes and the contractile vacuole complex of Trypanosoma cruzi. The Journal of biological chemistry 279: 38673-38682. 13. Rohloff P, Montalvetti A, Docampo R (2004) Acidocalcisomes and the contractile vacuole complex are involved in osmoregulation in Trypanosoma cruzi. The Journal of biological chemistry 279: 52270-52281. 14. Figarella K, Uzcategui NL, Zhou Y, LeFurgey A, Ouellette M, et al. (2007) Biochemical characterization of Leishmania major aquaglyceroporin LmAQP1: possible role in volume regulation and osmotaxis. Molecular 65: 1006-1017. 15. Clarke M, Kohler J, Arana Q, Liu T, Heuser J, et al. (2002) Dynamics of the vacuolar H+-ATPase in the contractile vacuole complex and the endosomal pathway of Dictyostelium cells. J Cell Sci 115: 2893-2905. 16. Heuser J, Zhu Q, Clarke M (1993) Proton pumps populate the contractile vacuoles of Dictyostelium amoebae. J Cell Biol 121: 1311-1327. 17. Moniakis J, Coukell MB, Janiec A (1999) Involvement of the Ca2+-ATPase PAT1 and the contractile vacuole in calcium regulation in Dictyostelium discoideum. J Cell Sci 112 ( Pt 3): 405-414. 18. Sesaki H, Wong EF, Siu CH (1997) The cell adhesion molecule DdCAD-1 in Dictyostelium is targeted to the cell surface by a nonclassical transport pathway involving contractile vacuoles. The Journal of cell biology 138: 939-951. 19. Sriskanthadevan S, Lee T, Lin Z, Yang D, Siu CH (2009) Cell adhesion molecule DdCAD-1 is imported into contractile vacuoles by membrane invagination in a Ca2+- and conformation-dependent manner. The Journal of biological chemistry 284: 36377-36386. 29

20. Niyogi S, Mucci J, Campetella O, Docampo R (2014) Rab11 regulates trafficking of trans-sialidase to the plasma membrane through the contractile vacuole complex of Trypanosoma cruzi. PLoS Pathog 10: e1004224. 21. Hasne MP, Coppens I, Soysa R, Ullman B (2010) A high-affinity putrescine- cadaverine transporter from Trypanosoma cruzi. Molecular microbiology 76: 78- 91. 22. Macro L, Jaiswal JK, Simon SM (2012) Dynamics of clathrin-mediated endocytosis and its requirement for organelle biogenesis in Dictyostelium. J Cell Sci 125: 5721-5732. 23. Docampo R (2011) Molecular parasitology in the 21st century. Essays Biochem 51: 1-13. 24. Docampo R, de Souza W, Miranda K, Rohloff P, Moreno SN (2005) Acidocalcisomes - conserved from bacteria to man. Nat Rev Microbiol 3: 251- 261. 25. Rohloff P, Rodrigues CO, Docampo R (2003) Regulatory volume decrease in Trypanosoma cruzi involves amino acid efflux and changes in intracellular calcium. Mol Biochem Parasitol 126: 219-230. 26. Rao NN, Gomez-Garcia MR, Kornberg A (2009) Inorganic polyphosphate: essential for growth and survival. Annu Rev Biochem 78: 605-647. 27. Docampo R, Scott DA, Vercesi AE, Moreno SN (1995) Intracellular Ca2+ storage in acidocalcisomes of Trypanosoma cruzi. Biochem J 310 ( Pt 3): 1005-1012. 28. Cuevas IC, Rohloff P, Sanchez DO, Docampo R (2005) Characterization of farnesylated protein tyrosine phosphatase TcPRL-1 from Trypanosoma cruzi. Eukaryot Cell 4: 1550-1561. 29. Scott DA, Docampo R, Dvorak JA, Shi S, Leapman RD (1997) In situ compositional analysis of acidocalcisomes in Trypanosoma cruzi. J Biol Chem 272: 28020- 28029. 30. Ruiz FA, Marchesini N, Seufferheld M, Govindjee, Docampo R (2001) The polyphosphate bodies of Chlamydomonas reinhardtii possess a proton-pumping pyrophosphatase and are similar to acidocalcisomes. J Biol Chem 276: 46196- 46203. 30

31. Yagisawa F, Nishida K, Yoshida M, Ohnuma M, Shimada T, et al. (2009) Identification of novel proteins in isolated polyphosphate vacuoles in the primitive red alga merolae. J 60: 882-893. 32. Besteiro S, Tonn D, Tetley L, Coombs GH, Mottram JC (2008) The AP3 adaptor is involved in the transport of membrane proteins to acidocalcisomes of Leishmania. Journal of cell science 121: 561-570. 33. Huang G, Fang J, Sant'Anna C, Li ZH, Wellems DL, et al. (2011) Adaptor protein-3 (AP-3) complex mediates the biogenesis of acidocalcisomes and is essential for growth and virulence of Trypanosoma brucei. The Journal of biological chemistry 286: 36619-36630. 34. Smith SA, Mutch NJ, Baskar D, Rohloff P, Docampo R, et al. (2006) Polyphosphate modulates blood coagulation and fibrinolysis. Proceedings of the National Academy of Sciences of the United States of America 103: 903-908. 35. Muller F, Mutch NJ, Schenk WA, Smith SA, Esterl L, et al. (2009) Platelet polyphosphates are proinflammatory and procoagulant mediators in vivo. Cell 139: 1143-1156. 36. Docampo R, Moreno SN (2011) Acidocalcisomes. Cell calcium 50: 113-119. 37. Huang G, Bartlett, P.D., Thomas, A.P., Moreno, S.N.J., Docampo, R. (2013) Acidocalcisomes of Trypanosoma brucei have an inositol 1,4,5-trisphosphate receptor that is required for growth and infectivity. Proc Natl Acad Sci USA in press. 38. Li ZH, Alvarez VE, De Gaudenzi JG, Sant'Anna C, Frasch AC, et al. (2011) Hyperosmotic stress induces aquaporin-dependent cell shrinkage, polyphosphate synthesis, amino acid accumulation, and global gene expression changes in Trypanosoma cruzi. The Journal of biological chemistry 286: 43959-43971. 39. LeFurgey A, Ingram P, Blum JJ (2001) Compartmental responses to acute osmotic stress in Leishmania major result in rapid loss of Na+ and Cl. Comparative biochemistry and physiology Part A, Molecular & integrative physiology 128: 385-394.

31

40. Engstler M, Thilo L, Weise F, Grunfelder CG, Schwarz H, et al. (2004) Kinetics of endocytosis and recycling of the GPI-anchored variant surface glycoprotein in Trypanosoma brucei. J Cell Sci 117: 1105-1115. 41. Bangs JD, Andrews NW, Hart GW, Englund PT (1986) Posttranslational modification and intracellular transport of a trypanosome variant surface glycoprotein. J Cell Biol 103: 255-263. 42. Hughes H, Stephens DJ (2008) Assembly, organization, and function of the COPII coat. Histochem Cell Biol 129: 129-151. 43. Ackers JP, Dhir V, Field MC (2005) A bioinformatic analysis of the RAB genes of Trypanosoma brucei. Mol Biochem Parasitol 141: 89-97. 44. Allen CL, Goulding D, Field MC (2003) Clathrin-mediated endocytosis is essential in Trypanosoma brucei. Embo j 22: 4991-5002. 45. Soares MJ, de Souza W (1991) Endocytosis of gold-labeled proteins and LDL by Trypanosoma cruzi. Parasitol Res 77: 461-468. 46. Rocha GM, Seabra SH, de Miranda KR, Cunha-e-Silva N, de Carvalho TM, et al. (2010) Attachment of flagellum to the cell body is important to the kinetics of transferrin uptake by Trypanosoma cruzi. Parasitol Int 59: 629-633. 47. Souza W (2009) Structural organization of Trypanosoma cruzi. Mem Inst Oswaldo Cruz 104 Suppl 1: 89-100. 48. Eger I, Soares MJ (2012) Endocytosis in Trypanosoma cruzi (: Kinetoplastea) epimastigotes: visualization of ingested transferrin-gold nanoparticle complexes by confocal laser microscopy. J Microbiol Methods 91: 101-105. 49. Soares MJ, Souto-Padron T, De Souza W (1992) Identification of a large pre- lysosomal compartment in the pathogenic protozoon Trypanosoma cruzi. J Cell Sci 102 ( Pt 1): 157-167. 50. Peter F, Nuoffer C, Pind SN, Balch WE (1994) Guanine nucleotide dissociation inhibitor is essential for Rab1 function in budding from the endoplasmic reticulum and transport through the Golgi stack. J Cell Biol 126: 1393-1406. 51. Pfeffer S, Aivazian D (2004) Targeting Rab GTPases to distinct membrane compartments. Nat Rev Mol Cell Biol 5: 886-896. 32

52. Stenmark H (2009) Rab GTPases as coordinators of vesicle traffic. Nat Rev Mol Cell Biol 10: 513-525. 53. Merithew E, Hatherly S, Dumas JJ, Lawe DC, Heller-Harrison R, et al. (2001) Structural plasticity of an invariant hydrophobic triad in the switch regions of Rab GTPases is a determinant of effector recognition. J Biol Chem 276: 13982-13988. 54. Dumas JJ, Zhu Z, Connolly JL, Lambright DG (1999) Structural basis of activation and GTP hydrolysis in Rab proteins. Structure 7: 413-423. 55. Ramos FP, Araripe JR, Urmenyi TP, Silva R, Cunha e Silva NL, et al. (2005) Characterization of RAB-like4, the first identified RAB-like protein from Trypanosoma cruzi with GTPase activity. Biochem Biophys Res Commun 333: 808-817. 56. Araripe JR, Ramos FP, Cunha e Silva NL, Urmenyi TP, Silva R, et al. (2005) Characterization of a RAB5 homologue in Trypanosoma cruzi. Biochem Biophys Res Commun 329: 638-645. 57. Araripe JR, Cunha e Silva NL, Leal ST, de Souza W, Rondinelli E (2004) Trypanosoma cruzi: TcRAB7 protein is localized at the Golgi apparatus in epimastigotes. Biochem Biophys Res Commun 321: 397-402. 58. Fukuda M (2010) How can mammalian Rab small GTPases be comprehensively analyzed?: Development of new tools to comprehensively analyze mammalian Rabs in membrane traffic. Histol Histopathol 25: 1473-1480. 59. Cuif MH, Possmayer F, Zander H, Bordes N, Jollivet F, et al. (1999) Characterization of GAPCenA, a GTPase activating protein for Rab6, part of which associates with the . Embo j 18: 1772-1782. 60. Feig LA (1999) Tools of the trade: use of dominant-inhibitory mutants of Ras-family GTPases. Nat Cell Biol 1: E25-27. 61. Chen SY, Huff SY, Lai CC, Der CJ, Powers S (1994) Ras-15A protein shares highly similar dominant-negative biological properties with Ras-17N and forms a stable, guanine-nucleotide resistant complex with CDC25 exchange factor. Oncogene 9: 2691-2698. 33

62. Wasmeier C, Romao M, Plowright L, Bennett DC, Raposo G, et al. (2006) Rab38 and Rab32 control post-Golgi trafficking of melanogenic enzymes. J Cell Biol 175: 271-281. 63. Park M, Serpinskaya AS, Papalopulu N, Gelfand VI (2007) Rab32 regulates melanosome transport in Xenopus melanophores by protein kinase a recruitment. Curr Biol 17: 2030-2034. 64. Seto S, Tsujimura K, Koide Y (2011) Rab GTPases regulating phagosome maturation are differentially recruited to mycobacterial . Traffic 12: 407-420. 65. Hirota Y, Tanaka Y (2009) A small GTPase, human Rab32, is required for the formation of autophagic vacuoles under basal conditions. Cell Mol Life Sci 66: 2913-2932. 66. Alto NM, Soderling J, Scott JD (2002) Rab32 is an A-kinase anchoring protein and participates in mitochondrial dynamics. J Cell Biol 158: 659-668. 67. Moreno SN, Docampo R (2009) The role of acidocalcisomes in parasitic protists. J Eukaryot Microbiol 56: 208-213. 68. Bao X, Faris AE, Jang EK, Haslam RJ (2002) Molecular cloning, bacterial expression and properties of Rab31 and Rab32. Eur J Biochem 269: 259-271. 69. Urbe S, Huber LA, Zerial M, Tooze SA, Parton RG (1993) Rab11, a small GTPase associated with both constitutive and regulated secretory pathways in PC12 cells. FEBS Lett 334: 175-182. 70. Hobdy-Henderson KC, Hales CM, Lapierre LA, Cheney RE, Goldenring JR (2003) Dynamics of the apical plasma membrane recycling system during cell division. Traffic 4: 681-693. 71. Knodler A, Feng S, Zhang J, Zhang X, Das A, et al. (2010) Coordination of Rab8 and Rab11 in primary ciliogenesis. Proc Natl Acad Sci U S A 107: 6346-6351. 72. Shirane M, Nakayama KI (2006) Protrudin induces neurite formation by directional membrane trafficking. Science 314: 818-821. 73. Schuh M (2011) An actin-dependent mechanism for long-range vesicle transport. Nat Cell Biol 13: 1431-1436. 34

74. Jeffries TR, Morgan GW, Field MC (2001) A developmentally regulated rab11 homologue in Trypanosoma brucei is involved in recycling processes. J Cell Sci 114: 2617-2626. 75. Pal A, Hall BS, Jeffries TR, Field MC (2003) Rab5 and Rab11 mediate transferrin and anti-variant surface glycoprotein antibody recycling in Trypanosoma brucei. Biochem J 374: 443-451. 76. Grunfelder CG, Engstler M, Weise F, Schwarz H, Stierhof YD, et al. (2003) Endocytosis of a glycosylphosphatidylinositol-anchored protein via clathrin- coated vesicles, sorting by default in endosomes, and exocytosis via RAB11- positive carriers. Mol Biol Cell 14: 2029-2040. 77. Hall BS, Smith E, Langer W, Jacobs LA, Goulding D, et al. (2005) Developmental variation in Rab11-dependent trafficking in Trypanosoma brucei. Eukaryot Cell 4: 971-980. 78. Harris E, Yoshida K, Cardelli J, Bush J (2001) Rab11-like GTPase associates with and regulates the structure and function of the contractile vacuole system in Dictyostelium. J Cell Sci 114: 3035-3045. 79. Gelb MH (1997) Protein prenylation, et cetera: signal transduction in two dimensions. Science 275: 1750-1751. 80. Glomset JA, Farnsworth CC (1994) Role of protein modification reactions in programming interactions between ras-related GTPases and cell membranes. Annu Rev Cell Biol 10: 181-205. 81. Nepomuceno-Silva JL, Yokoyama K, de Mello LD, Mendonca SM, Paixao JC, et al. (2001) TcRho1, a farnesylated Rho family homologue from Trypanosoma cruzi: cloning, trans-splicing, and prenylation studies. J Biol Chem 276: 29711-29718. 82. Raikkonen J, Taskinen M, Dunford JE, Monkkonen H, Auriola S, et al. (2011) Correlation between time-dependent inhibition of human farnesyl pyrophosphate synthase and blockade of mevalonate pathway by nitrogen-containing bisphosphonates in cultured cells. Biochem Biophys Res Commun 407: 663-667. 83. de Souza W, de Carvalho TM, Barrias ES (2010) Review on Trypanosoma cruzi: Host Cell Interaction. Int J Cell Biol 2010. 35

84. Ming M, Ewen ME, Pereira ME (1995) Trypanosome invasion of mammalian cells requires activation of the TGF beta signaling pathway. Cell 82: 287-296. 85. Barbosa HS, de Meirelles Mde N (1992) Ultrastructural detection in vitro of WGA-, RCA I-, and Con A-binding sites involved in the invasion of heart muscle cells by Trypanosoma cruzi. Parasitol Res 78: 404-409. 86. Ciavaglia Mdo C, de Carvalho TU, de Souza W (1993) Interaction of Trypanosoma cruzi with cells with altered glycosylation patterns. Biochem Biophys Res Commun 193: 718-721. 87. Hall BS, Pereira MA (2000) Dual role for transforming growth factor beta-dependent signaling in Trypanosoma cruzi infection of mammalian cells. Infect Immun 68: 2077-2081. 88. McConville MJ, Ferguson MA (1993) The structure, biosynthesis and function of glycosylated phosphatidylinositols in the parasitic protozoa and higher eukaryotes. Biochem J 294 ( Pt 2): 305-324. 89. Ferguson MA (1999) The structure, biosynthesis and functions of glycosylphosphatidylinositol anchors, and the contributions of trypanosome research. J Cell Sci 112 ( Pt 17): 2799-2809. 90. Guha-Niyogi A, Sullivan DR, Turco SJ (2001) Glycoconjugate structures of parasitic protozoa. Glycobiology 11: 45r-59r. 91. Fujita M, Kinoshita T (2012) GPI-anchor remodeling: potential functions of GPI- anchors in intracellular trafficking and membrane dynamics. Biochim Biophys Acta 1821: 1050-1058. 92. Lemmon SK, Traub LM (2000) Sorting in the endosomal system in yeast and animal cells. Curr Opin Cell Biol 12: 457-466. 93. Bangs JD (1998) Surface coats and secretory trafficking in African trypanosomes. Curr Opin Microbiol 1: 448-454. 94. Grunfelder CG, Engstler M, Weise F, Schwarz H, Stierhof YD, et al. (2002) Accumulation of a GPI-anchored protein at the cell surface requires sorting at multiple intracellular levels. Traffic 3: 547-559. 95. Di Noia JM, Buscaglia CA, De Marchi CR, Almeida IC, Frasch AC (2002) A Trypanosoma cruzi small surface molecule provides the first immunological 36

evidence that Chagas' disease is due to a single parasite lineage. J Exp Med 195: 401-413. 96. El-Sayed NM, Myler PJ, Bartholomeu DC, Nilsson D, Aggarwal G, et al. (2005) The genome sequence of Trypanosoma cruzi, etiologic agent of Chagas disease. Science 309: 409-415. 97. Freitas LM, dos Santos SL, Rodrigues-Luiz GF, Mendes TA, Rodrigues TS, et al. (2011) Genomic analyses, gene expression and antigenic profile of the trans- sialidase superfamily of Trypanosoma cruzi reveal an undetected level of complexity. PLoS One 6: e25914. 98. Giorgi ME, de Lederkremer RM (2011) Trans-sialidase and mucins of Trypanosoma cruzi: an important interplay for the parasite. Carbohydr Res 346: 1389-1393. 99. Previato JO, Andrade AF, Pessolani MC, Mendonca-Previato L (1985) Incorporation of sialic acid into Trypanosoma cruzi macromolecules. A proposal for a new metabolic route. Mol Biochem Parasitol 16: 85-96. 100. Zingales B, Carniol C, de Lederkremer RM, Colli W (1987) Direct sialic acid transfer from a protein donor to glycolipids of trypomastigote forms of Trypanosoma cruzi. Mol Biochem Parasitol 26: 135-144. 101. Schenkman S, Jiang MS, Hart GW, Nussenzweig V (1991) A novel cell surface trans-sialidase of Trypanosoma cruzi generates a stage-specific epitope required for invasion of mammalian cells. Cell 65: 1117-1125. 102. Tomlinson S, Pontes de Carvalho LC, Vandekerckhove F, Nussenzweig V (1994) Role of sialic acid in the resistance of Trypanosoma cruzi trypomastigotes to complement. J Immunol 153: 3141-3147. 103. Buscaglia CA, Campo VA, Frasch AC, Di Noia JM (2006) Trypanosoma cruzi surface mucins: host-dependent coat diversity. Nat Rev Microbiol 4: 229-236. 104. Pereira-Chioccola VL, Acosta-Serrano A, Correia de Almeida I, Ferguson MA, Souto-Padron T, et al. (2000) Mucin-like molecules form a negatively charged coat that protects Trypanosoma cruzi trypomastigotes from killing by human anti- alpha-galactosyl antibodies. J Cell Sci 113 ( Pt 7): 1299-1307. 37

105. de Melo-Jorge M, PereiraPerrin M (2007) The Chagas' disease parasite Trypanosoma cruzi exploits nerve growth factor receptor TrkA to infect mammalian hosts. Cell Host Microbe 1: 251-261. 106. Weinkauf C, Salvador R, Pereiraperrin M (2011) Neurotrophin receptor TrkC is an entry receptor for Trypanosoma cruzi in neural, glial, and epithelial cells. Infect Immun 79: 4081-4087. 107. Chuenkova MV, PereiraPerrin M (2009) Trypanosoma cruzi targets Akt in host cells as an intracellular antiapoptotic strategy. Sci Signal 2: ra74. 108. Risso MG, Pitcovsky TA, Caccuri RL, Campetella O, Leguizamon MS (2007) Immune system pathogenesis is prevented by the neutralization of the systemic trans-sialidase from Trypanosoma cruzi during severe infections. Parasitology 134: 503-510. 109. Buschiazzo A, Muia R, Larrieux N, Pitcovsky T, Mucci J, et al. (2012) Trypanosoma cruzi trans-sialidase in complex with a neutralizing antibody: structure/function studies towards the rational design of inhibitors. PLoS Pathog 8: e1002474. 110. Rubin-de-Celis SS, Uemura H, Yoshida N, Schenkman S (2006) Expression of trypomastigote trans-sialidase in metacyclic forms of Trypanosoma cruzi increases parasite escape from its parasitophorous vacuole. Cell Microbiol 8: 1888-1898. 111. Frevert U, Schenkman S, Nussenzweig V (1992) Stage-specific expression and intracellular shedding of the cell surface trans-sialidase of Trypanosoma cruzi. Infect Immun 60: 2349-2360. 112. Bayer-Santos E, Aguilar-Bonavides C, Rodrigues SP, Cordero EM, Marques AF, et al. (2013) Proteomic analysis of Trypanosoma cruzi secretome: characterization of two populations of extracellular vesicles and soluble proteins. J Proteome Res 12: 883-897. 113. Mucci J, Hidalgo A, Mocetti E, Argibay PF, Leguizamon MS, et al. (2002) Thymocyte depletion in Trypanosoma cruzi infection is mediated by trans- sialidase-induced apoptosis on nurse cells complex. Proc Natl Acad Sci U S A 99: 3896-3901.

38

114. Tribulatti MV, Mucci J, Van Rooijen N, Leguizamon MS, Campetella O (2005) The trans-sialidase from Trypanosoma cruzi induces thrombocytopenia during acute Chagas' disease by reducing the platelet sialic acid contents. Infect Immun 73: 201-207. 115. Freire-de-Lima L, Alisson-Silva F, Carvalho ST, Takiya CM, Rodrigues MM, et al. (2010) Trypanosoma cruzi subverts host cell sialylation and may compromise antigen-specific CD8+ T cell responses. J Biol Chem 285: 13388-13396. 116. Macina RA, Affranchino JL, Pollevick GD, Jazin EE, Frasch AC (1989) Variable number of repeat units in genes encoding Trypanosoma cruzi antigens. FEBS Lett 257: 365-368. 117. Pollevick GD, Affranchino JL, Frasch AC, Sanchez DO (1991) The complete sequence of a shed acute-phase antigen of Trypanosoma cruzi. Mol Biochem Parasitol 47: 247-250. 118. Roggentin P, Rothe B, Kaper JB, Galen J, Lawrisuk L, et al. (1989) Conserved sequences in bacterial and viral sialidases. Glycoconj J 6: 349-353. 119. Agusti R, Couto AS, Campetella OE, Frasch AC, de Lederkremer RM (1997) The trans-sialidase of Trypanosoma cruzi is anchored by two different . Glycobiology 7: 731-735. 120. Cremona ML, Campetella O, Sanchez DO, Frasch AC (1999) Enzymically inactive members of the trans-sialidase family from Trypanosoma cruzi display beta- galactose binding activity. Glycobiology 9: 581-587. 121. Oppezzo P, Obal G, Baraibar MA, Pritsch O, Alzari PM, et al. (2011) Crystal structure of an enzymatically inactive trans-sialidase-like lectin from Trypanosoma cruzi: the carbohydrate binding mechanism involves residual sialidase activity. Biochim Biophys Acta 1814: 1154-1161. 39

FIGURES

Figure 2.1. Life cycle of T. cruzi. The insect vector becomes infected after taking a parasite-containing blood meal from an infected human or animal. Two main forms are present in the insect vector: epimastigotes undergo morphological and physiological transformation in the midgut and differentiate into infective metacyclic trypomastigotes in the hindgut of the insect; the parasite is transmitted to humans by infected blood sucking insects which deposit trypomastigotes in their feces during feeding and two main forms in the vertebrate host are: intracellular amastigotes and bloodstream trypomastigotes. (Figure published in Docampo R. et al, 2013). 40

Figure 2.2 The CVC in T. cruzi epimastigotes. (A) Thin section of chemically fixed epimastigote showing the CVC. Collapsed aspect of the spongiome is denoted by arrows.

(B) Thin section of a high pressure freeze substituted epimastigote showing the CV and the interconnected tubules (arrows) that form the spongiome (Sp). (C) Virtual section showing the CV docked to the flagellar pocket (FP) and the electron-dense region between both structures (arrow and inset). (D) Virtual section and 3D model of the CVC and flagellar pocket (FP) where a deformation in the FP was observed (black arrows) and a tubule of the spongiome was connected to the central vacuole (white arrow). Scale bars¼200 nm. (Figure published in Docampo R. et al, 2013) 41

Figure 2.3. Diagramatic representation of the enzymes and transporters tentatively identified in the acidocalcisome of T. cruzi (Diagram from Docampo et al. 2011) 42

Figure 2.4. The GTP-GDP cycle of Rab-GTPases. The GDP-bound (Constitutive

Negative; CN), inactivated form of Rab is activated by specific GEF. The wild type form

(WT) which cycles between GDP and GTP-bound form of Rab is recruited to a specific type of organelle/vesicle. WT promotes the transport of the organelle/vesicle by interacting with specific effector molecules. The GTP bound (Constitutive Active; CA) form is inactivated by GAP. (Diagram from Peter F. et al. 1994) 43

Figure 2.5. Schematic model summarizing the molecules involved on parasite-host cell interaction process exposed on the surface of a host cell and in trypomastigotes of T. cruzi. The recognition between parasite and mammalian host cell involves cross- talk between numerous molecules present on the surface of both cell types; which is instrumental for adhesion to precede before invasion. Out of the surface proteins present in the cell surface of the trypomastigotes, we show results with trans-sialidase, Mucin,

GP35/50 in Chapter 3. (Diagram from de Souza et al. 2010). 44

Figure 2.6. Model of T. cruzi invasion. This diagram illustrates lysosome dependent, or actin dependent or lysosome-independent invasion pathway (Diagram from de Souza et al. 2010). 45

CHAPTER 3

RAB11 REGULATES TRAFFICKING OF TRANS-SIALIDASE TO THE

PLASMA MEMBRANE THROUGH THE CONTRACTILE VACUOLE

COMPLEX OF TRYPANOSOMA CRUZI

Sayantanee Niyogi, Juan Mucci, Oscar Campetella, Roberto Docampo. 2014.

PLOS Pathogens. June 26. 10(6): e1004224. doi:10.1371/journal.ppat.1004224.

Reprinted here with permission of publisher. 46

Abstract

Trypanosoma cruzi is the etiologic agent of Chagas disease. Although this is not a free- living organism it has conserved a contractile vacuole complex (CVC) to regulate its osmolarity. This obligate intracellular is, in addition, dependent on surface proteins to invade its hosts. Here we used a combination of genetic and biochemical approaches to delineate the contribution of the CVC to the traffic of glycosylphosphatidylinositol (GPI)-anchored proteins to the plasma membrane of the parasite and promote host invasion. While T. cruzi Rab11 (TcRab11) localized to the

CVC, a dominant negative (DN) mutant tagged with GFP (GFP-TcRab11DN) localized to the cytosol, and epimastigotes expressing this mutant were less responsive to hyposmotic and hyperosmotic stress. Mutant parasites were still able to differentiate into metacyclic forms and infect host cells. GPI-anchored trans-sialidase (TcTS), mucins of the 60-200 KDa family, and trypomastigote small surface antigen (TcTSSA II) co- localized with GFP-TcRab11 to the CVC during transformation of intracellular amastigotes into trypomastigotes. Mucins of the gp35/50 family also co-localized with the CVC during metacyclogenesis. Parasites expressing GFP-TcRab11DN prevented

TcTS, but not other membrane proteins, from reaching the plasma membrane, and were less infective as compared to wild type cells. Incubation of these mutants in the presence of exogenous recombinant active, but not inactive, TcTS, and a sialic acid donor, before infecting host cells, partially rescued infectivity of trypomastigotes. Taking together these results reveal roles of TcRab11 in osmoregulation and trafficking of trans-sialidase to the plasma membrane, the role of trans-sialidase in promoting infection, and a novel unconventional mechanism of GPI-anchored protein secretion. 47

Author Summary

Several free-living protozoa possess a contractile vacuole complex (CVC) that protects them from the hyposmotic environments where they live. Interestingly, the intracellular parasite Trypanosoma cruzi, the etiologic agent of Chagas disease, has conserved a CVC in all its developmental stages, where it has an osmoregulatory role under both hyposmotic and hyperosmotic conditions. We found here that the CVC of T. cruzi has an additional unconventional role in traffic of glycosylphosphatidylinositol (GPI)-anchored proteins to the plasma membrane of the parasite. A combination of genetic and biochemical approaches revealed the role of TcRab11, a protein localized to the CVC, in traffic of trans-sialidase (TcTS), a GPI-anchored protein important for host cell invasion, but not of other GPI-anchored proteins or integral membrane proteins, to the plasma membrane. Demonstration of the role of TcTS in infection has been previously difficult given the large number of genes encoding for this protein distributed through the genome of the parasite. However, by constructing dominant negative TcRab11 we were able to prevent traffic of TcTS to the plasma membrane and demonstrate its role in host invasion.

Introduction

The contractile vacuole complex (CVC) is an intracellular compartment with an osmoregulatory role in different protists. This compartment has a bipartite structure, consisting of a central vacuole or bladder and a surrounding loose network of tubules and vesicles named the spongiome [1,2]. The CVC accumulates water through an aquaporin

[3-7] and expels it out of the cell through pores in the plasma membrane [1,2].

Trypanosoma cruzi, the etiologic agent of Chagas disease or American trypanosomiasis, possesses a CVC [4,8,9] that is important for regulatory volume decrease (RVD) after

48 hyposmotic stress [4], as well as for shrinking of the cells when submitted to hyperosmotic stress [10].

Besides its osmoregulatory role, the CVC of some protists is an acidic calcium store [11] and has roles in calcium (Ca2+) sequestration and excretion pathways [12-16], as well as in transfer of some proteins to the plasma membrane [12,17,18]. Although it has been indicated that there is no much mixing or “scrambling” of contractile vacuoles and plasma membranes [19], transfer of membrane proteins from the CVC to the plasma membrane has been observed. In Dictyostelium discoideum, the vacuolar proton ATPase

(V-H+-ATPase) and calmodulin (CaM) move to the plasma membrane when cells are starved during stationary phase [17], and the Ca2+-ATPase PAT1 moves to the plasma membrane when cells are incubated at high Ca2+ concentrations [12]. Some luminal proteins, such as the adhesins DdCAD-1 and discoidin-1 can also be targeted to the cell surface via the CVC in D. discoideum [18,20]. In T. cruzi epimastigotes, the polyamine transporter TcPOT1.1, which localizes to CVC-like structures, has also been reported to appear in the plasma membrane when the culture medium is deficient in polyamines [21].

It is interesting to note that dajumin-GFP is trafficked to the CVC of D. discoideum via the plasma membrane and is internalized by a clathrin-dependent mechanism, suggesting that clathrin-mediated endocytosis may function as a back-up mechanism in case of transfer of proteins from the CVC to the plasma membrane [22].

It is remarkable that Rab11, a GTPase that localizes in recycling endosomes in most cells

[23], including Trypanosoma brucei [24], localizes to the CVC of D. discoideum [25] and

T. cruzi [26], suggesting that it might have some function in trafficking of proteins from the CVC to the plasma membrane, as recycling endosomes have. It was proposed [25] 49 that the CVC could be an evolutionary precursor to the recycling endosomal system in other eukaryotes.

In T. brucei, Rab11 mediates the transfer of the glycosylphosphatidylinositol (GPI)- anchored proteins transferrin [27] and variant surface glycoprotein (VSG) [28] to the plasma membrane. T. cruzi is also rich in GPI-anchored proteins, among them the trans- sialidase (TS)-like superfamily, which includes 1,430 gene members [29,30], and the mucins, encoded by 500 to 700 genes distributed into three groups of which group III is conformed by a single-copy gene named the trypomastigote small surface antigen (TSSA)

[31]. TcTS genes are actually distributed in several families of which only one is composed by genes encoding the active enzyme (TS) and its inactive isoform (iTS), which differs in only one mutation (Tyr342His) [32]. TcTS is crucial in the life cycle of the parasite because it allows the acquisition of sialyl residues from the host glycoconjugates preventing their lysis by the alternative complement pathway [33,34], and opsonization followed by killing by natural antibodies [35]. It also enables the parasite to infect/attach cells [36,37], and exit the parasitophorous vacuole [38]. The shed

TcTS induces several hematological abnormalities and alters the immune system [39-41].

Two major TcTSSA isoforms were originally recognized: TcTSSA I, present in TcI parasite stocks, which are linked to the sylvatic cycle of the parasite, and TcTSSA II, present in TcVI (previously TcIIe) isolates, which are linked to the more virulent strains

[31]. Since TcTSSA II is highly immunogenic it has been proposed as an immunological marker for the most virulent T. cruzi types [31], and as an adhesin, engaging surface receptor(s) and inducing signaling pathways in the host cell as a prerequisite for parasite internalization [42]. Another group of GPI-anchored surface proteins is that formed by

50 the mucin family of 60-200 KDa proteins bearing several oligosaccharide chains and present in tissue culture-derived trypomastigotes [43]. These T. cruzi O-linked oligosaccharide-containing proteins are highly immunogenic under the conditions of natural infection and are the targets for lytic anti-Gal antibodies [43-45]. Gp35/50 mucins are also GPI-anchored glycoproteins rich in threonine and expressed in epimastigotes and metacyclic forms of all T. cruzi isolates examined to date and are encoded by a large multigene family [46]. Gp35/50 mucins are recognized by monoclonal antibodies 10D8 and 2B10 [47], which react with galactofuranose- and galactopyranose-containing epitopes, respectively.

GPI-anchored proteins are usually transported from the endoplasmic reticulum (ER) to the plasma membrane through the Golgi apparatus, where lipid raft-like structures form

[48]. In this work we demonstrate that TcTS, TcTSSA II, and other mucins are transported to the plasma membrane of T. cruzi trypomastigotes through the CVC, which also possesses lipid-raft like structures, and that expression of dominant-interfering

TcRab11 mutants altered their morphology, osmoregulation, traffic of TcTS to the plasma membrane, and parasite infectivity. The results suggest the presence of a novel unconventional mechanism of GPI-anchored protein transport to the cell surface of eukaryotic cells.

Results

Localization of TcRab11 in different T. cruzi stages

In previous work we reported the N-terminal tagging of T. cruzi Rab11

(TcCLB.511407.60; TcRab11) with the green fluorescent protein (GFP) gene, and the localization of GFP-TcRab11 to the bladder of the CVC of epimastigotes of T. cruzi [26]. 51

Tagging with GFP was confirmed by western blot analysis [26]. Fig. 3.1A-C shows now that GFP-TcRab11 localizes to the bladder of the CVC of epimastigotes, trypomastigotes, and amastigotes. Fig. 3.1D shows the co-localization of GFP-TcRab11 with T. cruzi aquaporin 1 (TcAQP1), a marker for the CVC [3,4]. These experiments were done after submitting the cells to hyposmotic conditions, which increases the localization of

TcAQP1 to the CVC [4]. To confirm that the above results were not an artifact of protein overexpression and/or mistargeting we also used affinity-purified antibodies against

TbRab11 [24] (Fig. 3.1E and 3.1F). This antibody was shown to predominantly react with a protein of 24 kDa in all T. cruzi stages, as expected for TcRab11 (Fig. 3.1G).

TcRab11 is apparently less expressed in epimastigotes. Fig. 3.11 confirms the CVC localization of GFP-TcRab11 in epimastigotes submitted to hyposmotic stress by cryo- immunogold electron microscopy.

Localization of GFP-TcRab11DN mutant

Knockdown of Rabs by RNA interference (RNAi) is one of the preferred approaches to investigate the function of specific Rab isoforms in membrane traffic [49]. Unfortunately,

T. cruzi lacks an RNAi system [50]. To perform a functional analysis of TcRab11, we therefore developed an expression encoding a TcRab11 mutant that mimics the

GDP-bound form (dominant negative). An N-terminal GFP epitope tag was fused to the

T. cruzi point mutant TcRab11:S21N. TcRab11:S21N is predicted to bind GDP, based upon homology to known Ras-related protein mutations [51]. In transfected T. cruzi epimastigotes, GFP-TcRab11DN had a punctated cytosolic localization (Fig. 3.2A). This localization was maintained when epimastigotes were differentiated into trypomastigotes

(Fig. 3.2B) and intracellular amastigotes (Fig. 3.2C). This localization is because the

52 dominant negative TcRab11 (GDP-bound) gets locked in an intermediate cytosolic location. After membrane delivery by the GDP dissociation inhibitor (GDI), Rab proteins interconvert between inactive, GDP-bound forms and active, GTP-bound forms [52]. The growth rate of the mutant epimastigotes was not affected (Fig. 3.12A). We confirmed tagging of the mutant by western blot analysis (Fig. S2B). Together these results suggest that TcRab11 is localized to the membrane of the CVC in a GTP-dependent manner.

Densitometry analysis indicated that GFP-TcRab11 expression increased 5.2 fold compared to that in wild type epimastigotes (Fig 3.12C). We also investigated whether the dominant negative mutation of TcRab11 disrupted the structure and assembly of the

CVC. We did immunofluorescence studies on GFP-TcRab11DN mutant epimastigotes using an antibody against T. cruzi aquaporin 1, a CVC marker [4]. The same aquaporin distribution was observed in epimastigotes expressing the control GFP-TcRab11 (Fig.

3.13A) and the mutant GFP-TcRab11DN (Fig. 3.13B). The CVC can be identified in Fig.

3.13A and 3.13B because of its curvature and its location close to the kinetoplast. There was a greater concentration of TcAQP1 in the CVC with some punctate labeling corresponding to acidocalcisomes [4] (Fig. 3.13).

Cellular response to hyposmotic and hyperosmotic stresses

To examine the role of T. cruzi Rab11 in osmoregulation, wild-type, GFP-TcRab11- overexpressing (GFP-TcRab11OE), and GFP-TcRab11DN-expressing epimastigotes were submitted to hyposmotic stress and their regulatory volume decrease (RVD) measured using the light-scattering technique, as described previously [53]. This technique measures the changes in volume of the cells under hyposmotic (swelling and recovery) and hyperosmotic conditions (shrinking and partial recovery). After recovery

53 the cells recuperate their normal morphology. DN mutants were less able to recover their volume after hyposmotic stress than wild type cells, while recovery was faster in GFP-

TcRab11OE cells (OE, Fig. 3.3A). In addition, when submitted to hyperosmotic stress,

DN mutants shrank less while GFP-TcRab11OE cells shrank more than control cells

(Fig. 3.3B), and in all cases they did not recover their volume during the time of the experiment. It has been shown previously that when epimastigotes are submitted to hyperosmotic stress the parasites do not regain their normal volume at least during the following two hours [10]. GFP-TcRab11OE epimastigotes were also studied under hyposmotic and hyperosmotic stress conditions by video fluorescence microscopy.

Epimastigotes were immobilized on glass slides with poly-L-Lysine and bathed in hyposmotic/hyperosmotic buffer. Video microscopy data were collected (Figs. 3.3C and

3.3D show selected frames), which revealed changes in the morphology of the CVC when epimastigotes were treated under both hyposmotic (Fig. 3.3C) and hyperosmotic

(Fig. 3.3D) conditions. The single fluorescent spot corresponding to the CVC could be seen enlarging and fusing with other vacuoles probably resulting from enlarged tubular structures of the spongiome. Altogether, these results confirm the active participation of the CVC on the cellular response to both hyposmotic and hyperosmotic stresses [10], and indicate that alteration of TcRab11 function leads to disruption of osmoregulatory processes.

Trans-sialidase co-localizes with GFP-TcRab11 during differentiation of amastigotes into trypomastigotes

As Rab11 mediates the recycling of GPI-anchored proteins of T. brucei [27,28] we investigated whether TcRab11 affected the traffic of GPI-anchored proteins in T. cruzi. 54

Trans-sialidase is an abundant GPI-anchored protein present in the cell surface of trypomastigotes [54,55], where it catalyzes the transfer of sialic acid from host proteins to parasite mucins [56].

To investigate the possibility that TcRab11 mediates the traffic of TcTS to the plasma membrane, we infected L6E9 myoblasts with metacyclic trypomastigotes from stationary cultures of GFP-TcRab11OE parasites and obtained cell culture-derived trypomastigotes.

GFP-TcRab11OE trypomastigotes were used to infect fibroblasts and labeling of TcTS was detected by indirect immunofluorescence analysis using antibodies against the SAPA repeats [57] at different time points during infection (Fig. 3.4A). We found reaction with these antibodies starting 48 h after infection when the reaction co-localized with GFP-

TcRab11 in the contractile vacuole of intracellular amastigotes (Fig. 3.4A). Co- localization progressed to almost 100% of the cells by 106 h, after which, labeling of the

CVC gradually disappeared and surface labeling was more evident (Figs. 3.4A, and

3.4B), suggesting that TcTS traffics through the contractile vacuole before reaching the plasma membrane in differentiating trypomastigotes. Intermediate stages between amastigotes and trypomastigotes (‘epimastigote-like’ forms) found in the supernatants of tissue culture cells also showed co-localization of GFP-TcRab11 and TS (Fig. 3.5A) but in fully differentiated trypomastigotes labeling of TcTS was predominantly in patches of the plasma membrane while GFP-TcRab11 labeling remained in the CVC (Fig. 3.5B).

Cryo-immunogold electron microscopy confirmed the co-localization of GFP-TcRab11 and TcTS in the CVC (Fig. 3.6A). Co-localization was very intense in the spongiome of collapsed vacuoles (Fig. 3.6B). TcTS was also observed in the flagellar pocket (Figs.

3.6C, and 3.6D) and in patches in the plasma membrane (Figs. 3.6A, D), at earlier time 55 points than by IFA analysis. At later time points stronger labeling of TcTS was detected in patches of the plasma membrane and in vesicles close to the surface (Figs. 3.6E, F).

The surface localization of TcTS in trypomastigotes has been established before by immunogold electron microscopy studies [55,58].

Trans-sialidase co-localizes with GFP-TcRab11 in intermediate stages of differentiation from epimastigotes to metacylic trypomastigotes

As TcTS is also present in the surface of metacyclic trypomastigotes we investigated whether there was co-localization of TcTS with GFP-TcRab11 during differentiation of epimastigotes into metacyclic trypomastigotes as described under Materials and Methods.

Fig. 3.5C shows the co-localization of antibodies against TcTS with GFP-TcRab11 in intermediate forms that appeared around day 5 of the metacyclogenesis process.

TcRab11DN mutant prevents plasma membrane localization of TcTS but not of other plasma membrane proteins

To investigate whether mutation of TcRab11 affects general traffic of membrane proteins to the cell surface of trypomastigotes, wild type and GFP-TcRab11DN trypomastigotes were used to infect HF fibroblasts and labeling of TcTS and other membrane proteins were detected by indirect immmunofluorescence analysis after a full cycle of differentiation into trypomastigotes.

Wild type trypomastigotes showed labeling of TcTS in the plasma membrane (Fig. 3.7A) while GFP-TcRab11DN intermediate forms (Fig. 3.7B) and trypomastigotes (Fig. 3.7C), identified by the position of the kinetoplast anterior or posterior to the nucleus, respectively, showed predominantly cytosolic labeling of TcTS (Fig. 3.7B-D). This weak intracellular label with TcTS could be the result of ER retention and export to the cytosol

56 that ultimately results in its degradation by the ubiquitin/ system [59].

Labeling of GFP-TcRab11DN was predominantly punctated cytosolic, as described above for epimastigotes (Fig. 3.2A). These results suggest that DN mutation of TcRab11 inhibits traffic of TcTS to the plasma membrane. To further confirm this observation we used SAPA antibodies to assess surface expression of TcTS by flow cytometry on GFP-

TcRab11DN and wild type trypomastigotes. As expected, flow cytometric analysis shows reduction in surface expression of TcTS in the mutants as compared to control wild type trypomastigotes (Fig. 3.7E). Western blot analyses showed that these trypomastigotes maintained the overexpression of GFP-TcRab11 and GFP-TcRab11DN (Fig. 3.12D). To address the specificity of the TcTS antibody, total parasite lysates of wild type and GFP-

TcRab11DN were subjected to western blot analyses. Signals were observed in both lanes, matching the expected size of the TcTSs [37,60] (Fig. 3.13C).

We next investigated whether other GPI-anchored proteins or integral membrane proteins required TcRab11 for trafficking to the surface. We selected for study TcTSSA II, which is a mucin-type GPI-anchored protein [42], and GPI-anchored mucin-like glycoproteins expressed on the cell surface of trypomastigotes that are recognized by anti-α-galactosyl antibodies from patients with chronic Chagas disease [43-45]. Also selected was a P-

Type H+-ATPase, which is a proton pump important for maintenance of pH homeostasis and plasma membrane potential of T. cruzi different stages [61,62] and that also localizes to the endocytic pathway of the parasites [63]. Antibodies against TcTSSA II co- localized with GFP-TcRab11 as assayed by indirect immunofluorescence analysis of intermediate forms (Fig. 3.8A) and intracellular amastigotes (Fig. 3.8B) and trafficked to the plasma membrane of trypomastigotes (Fig. 3.8C). Antibodies against α-Gal also co- 57 localized with GFP-TcRab11 in the intermediate forms (Fig. 3.9A) before reaching the cell surface in the fully differentiated trypomastigotes (Fig. 3.9B). However, traffic of both mucins to the plasma membrane was not prevented in GFP-TcRab11DN-expressing parasites (Fig. 3.8D and 3.9C). Similarly, plasma membrane and intracellular localization of the P-type H+-ATPase, which did not co-localize with GFP-TcRab11, was not affected in GFP-Rab11DN parasites (Fig. 3.8E).

We also investigated the traffic of GPI-anchored surface antigens during metacyclogenesis, as described under Materials and Methods. We followed traffic of gp35/50 mucins, which are expressed in epimastigote and metacyclic forms.

Immunofluorescence assays on GFP-TcRab11OE parasites with monoclonal antibody

2B10 [64] demonstrates the co-localization of GFP-TcRab11 with gp35/50 in the CVC of intermediate stages of differentiation (obtained at day 5 of metacyclogenesis) towards metacyclics trypomastigotes (Fig. 3.14A) and the lack of co-localization in metacyclic forms (obtained at day 10 of metacyclogenesis) (Fig. 3.14B). However, GFP-

TcRab11DN mutants did not show any defect on the surface localization of this protein

(Fig. 3.14C).

CVC is enriched in lipid rafts

It has been proposed that GPI-anchored proteins acquire detergent resistance by fatty acid remodeling in the Golgi and their sorting is correlated with lipid raft formation at the trans-Golgi (TG) network [48]. To investigate whether the CVC possesses rafts we performed a detergent extraction of epimastigotes expressing different fusion constructs previously demonstrated to associate with this organelle (TcSNARE2.1-GFP that associates to the spongiome and GFP-TcRab11 that associates to the bladder [26],

58 followed by density gradient centrifugation in an Optiprep gradient to isolate detergent- insoluble raft fractions. To determine whether rafts contained the fusion proteins, detergent-insoluble fractions were separated using SDS-PAGE and analyzed by western blotting with anti-GFP antibody. As a control for the isolation of lipid raft, a dually acylated protein that is highly enriched in the flagellar membrane of T. cruzi, a 24-kDa flagellar calcium-binding protein (FCaBP; [65]) was also used and detected with monoclonal antibodies. Fractions from T. cruzi epimastigotes expressing cytoplasmic

GFP were used as negative control. Using this technique, we observed that GFP-

TcSNARE2.1, GFP-TcRab11, and FCaBP floated to the top of the Optiprep gradient

(Fig. 3.10A), suggesting the presence of lipid rafts in the CVC while GFP was associated with the heavier fractions. The association of GFP-TcRab11 with lipid rafts was further analyzed by another assay that is based on the temperature-dependence of lipid raft sensitivity to detergent [66] (Fig. 3.10B). As expected GFP-TcRab11 remained insoluble at 4°C and associated with the pellet fraction whereas it was soluble at 37oC after centrifugation, and a cytoplasmic protein, GFP, remained soluble at either temperature

(Fig. 3.10B).

Trans-sialidase activity requirement for infection

As TcTS is important for infectivity [36] we investigated whether GFP-TcRab11DN mutants were less effective than control cells or GFP-TcRab11OE parasites in the establishment of T. cruzi infections. Invasion was significantly reduced in GFP-

TcRab11DN mutants as compared with controls transfected with GFP alone or GFP-

TcRab11OE parasites (Figs. 3.10C and 3.10D). There was no significant difference between infections with wild-type trypomastigotes and trypomastigotes expressing GFP 59 alone (Fig. 3.15A and 3.15B). Pre-incubation of GFP-TcRab11DN-expressing trypomastigotes for 30 min in the presence of recombinant TcTS and sialofetuin (as a donor of sialic acid) [37] (Fig. 3.10D and 3.10E), but not asialofetuin (Fig. 3.15C and

3.15D) partially rescued the infectivity of the parasites demonstrating the importance of

TcTS activity for invasion of host cells.

The amino terminal 680 amino acids domain of TcTS contains the catalytic activity [67].

As a further control of the rescue experiments we did invasion experiments in the presence of inactive recombinant TcTS (iTS), whose crystal structure has been determined [68], and which differs in a single amino acid mutation Tyr342His that completely abolishes its TS activity, but retains its property to recognize terminal galactoses [32,69]. The recombinant protein binds sialic acid and galactose in vitro

[70,71] and competes with a neutralizing antibody to a discontinuous epitope of TS [37] indicating that it is properly folded. Incubation in the presence of iTS did not rescue the infectivity of GFP-TcRab11DN mutants (Fig. 3.10E and 3.10F). All invasion assays were done in the absence of fetal bovine serum to prevent the presence of any other putative exogenous sialic acid donors.

Discussion

The most significant finding of our studies is that GPI-anchored trans-sialidase (TcTS), mucins from tissue culture-derived or metacyclic trypomastigotes, and trypomastigote small surface antigen II (TcTSSA II) are trafficked to the plasma membrane of T. cruzi by an unconventional pathway involving the CVC and that the CVC is enriched in lipid rafts. We reported previously [26] that GFP-tagged TcRab11 localized to the CVC of

60 epimastigotes of T. cruzi. We now confirmed those results using antibodies against the protein and found it in the CVC of different stages of the life cycle of the parasite. In contrast, dominant negative TcRab11 has a punctated cytosolic localization indicating that CVC localization is GTP-dependent. Expression of the dominant negative form of

TcRab11 makes epimastigotes less responsive to hyposmotic and hyperosmotic stresses.

These results, together with the detection by video microscopy of morphological changes in the CVC under different osmotic conditions further demonstrate the role of the CVC in both hyposmotic [4] and hyperosmotic [10] stresses. Expression of GFP-TcRab11DN prevents traffic of TcTS, but not of other GPI-anchored (TcTSSA II, mucins) or integral

(H+-ATPase) membrane proteins to the plasma membrane of trypomastigotes, suggesting a specific role of TcRab11 in trafficking of TcTS, and that this is not a default pathway for all surface proteins. Dominant negative TcRab11 mutants might be acting by blocking or reducing the function of endogenous TcRab11, by competing or sequestering Rab11 effector proteins [49]. GFP-TcRab11DN-expressing trypomastigotes were less virulent but their pre-incubation with active, but not inactive, recombinant TcTS and a source of sialic acid partially rescued their virulence, underscoring the relevance of TcTS activity in infection. The identification of the specific role of TcTS in infection has been difficult to demonstrate in the past because of the impossibility of doing knockouts of the considerable number of gene copies encoding this protein scattered through the genome of this parasite.

In mammalian cells the GPI anchor is synthesized and transferred to proteins in the ER.

GPI-anchored proteins (GPI-Aps) exit the ER from ER exit sites (ERES) and are transported to the Golgi complex in COPII-coated vesicles [48]. Acquisition of detergent 61 resistance by fatty acid remodeling at the trans-Golgi facilitates their traffic to the plasma membrane [48]. A similar pathway has been proposed in case of the GPI-AP variant surface glycoprotein, or VSG, in Trypanosoma brucei, with the peculiarity that VSG reaches first the flagellar pocket, which is the sole region for endo and exocytosis in this organism [72]. GPI-APs are selectively endocytosed by a unique pathway involving clathrin-independent vesicles in mammalian cells [48], while VSG is internalized via clathrin-coated vesicles in T. brucei [72]. VSG can be retrieved from early and late endosomes to the TbRab11-positive exocytic carriers and returned to the cell surface via the flagellar pocket [72].

Very little is known about GPI-AP secretion or endocytosis in T. cruzi, although uncoated vesicles containing transferrin have been observed budding off the flagellar pocket membrane and cytostome of epimastigotes [73]. The trans-sialidase family of proteins is predominantly expressed on the surface of trypomastigotes. Our results, using anti-SAPA antibodies, are consistent with the synthesis of trans-sialidase in amastigotes starting at least 48 h after infection [74] and its traffic through the CVC before reaching the surface at the flagellar pocket. Anti-SAPA antibodies have been used before to localize TcTS to the surface of trypomastigotes by immunoelectron microscopy [58]. The presence of TcTS in the CVC by recycling from the surface is less probable because the protein is only detected in the plasma membrane at later time points and no further labeling of the CVC or endosomes is detected. It is possible that TcTS accumulates in the

CVC when rapidly synthesized during conversion of amastigotes into trypomastigotes and then reaches a steady state and is below the limit of detection afterwards. In addition, it is known that TcTS is shed to the extracellular medium, including within the host cells

62

[55], through the action of an endogenous phospholipase C, and also with vesicles of the plasma membrane [75]. Other GPI-APs like TcTSSA II, and other mucins, also traffic through the CVC before reaching the surface but its traffic to the surface is independent of TcRab11. A possible explanation for the traffic of GPI-anchored proteins through the

CVC is that this organelle could be enriched in microdomains (or lipid rafts) in which lipids with straight lipid chains, such as glycosphingolipids, phospholipids, and palmitoylated proteins are packed together with cholesterol in a compact and stable fashion [76]. Our results support the presence of lipid rafts in the CVC of T. cruzi. In this regard, a proteomic analysis of GPI-anchored membrane protein fractions from epimastigotes and metacyclic trypomastigotes, extracted using the neutral detergent

Triton X114 [77], detected several proteins that were later identified as present in the

CVC [26], such as TcRab11, and the membrane proteins V-H+-ATPase, and V-H+-PPase.

Transfer of membrane [12,16,17,21] and luminal [18,20] proteins from the CVC to the plasma membrane has been reported before in several cells, including T. cruzi epimastigotes [21]. However, the mechanism involved was not known. In this work, we provide evidence for a role of TcRab11 in the transfer of TcTS to the surface of the infective stages of the parasite. The presence of vesicles labeled with antibodies against

TcTS in the proximity of the plasma membrane suggests that vesicle trafficking from the

CVC is involved in this process.

Rab proteins regulate a number of processes through their interactions with Rab effectors.

Rab11 effectors in mammalian cells comprise Vb, Sec15, a component of the exocyst complex, and a Family of Interacting Proteins or FIPs [52]. FIPS orthologues are absent in trypanosomes, as well as class V but T. brucei Rab11 has been shown 63 to interact with a Sec15 orthologue [78]. Interestingly both Rab11 [25] and Sec15 [79] localize to the CVC of D. discoideum, and it was suggested that the CVC of D. discoideum could be a precursor to the recycling endosomal system of other eukaryotes

[2,25].

Our results confirm the role of the CVC in both hyposmotic [4] and hyperosmotic [10] stress and suggest that TcRab11 is important for the response of these cells to these osmotic stresses. During its developmental cycle in the mammalian and insect hosts, T. cruzi faces critical environmental challenges and ones that are especially dramatic are the changes in osmolarity. Trypomastigotes need to resist osmolarities of 1,400 mOsm/kg and return to isosmotic conditions (300 mOsm/kg) when circulating through the renal medulla [80]. Amastigotes reproduce in some tissues that have higher osmolarity than serum (330 in lymphoid tissues vs 300 mOsm/kg) [81], and epimastigotes need to resist high osmolarities (~1,000 mOsm/kg) in the rectal content of the insect vector [82].

TcRab11 appears to have a role in the resistance to these changes.

In summary, we describe a new unconventional pathway of GPI-APs to the plasma membrane that includes their traffic through the contractile vacuole complex. TcTS requires the participation of TcRab11 to reach the plasma membrane, while TcTSSA II and other mucins do not. This traffic of proteins through the CVC appears to be specific for GPI-APs, since other membrane proteins do not follow the same pathway.

64

Materials and Methods

Cell culture

Human foreskin fibroblasts (HFF) were grown in DMEM Low Glucose medium supplemented with 10% Cosmic CalfTM serum and 0.1% L-glutamine. Vero cells were grown in RPMI supplemented with 10% fetal bovine serum. L6E9 myoblasts were grown in DMEM High Glucose medium supplemented with 10% fetal bovine serum. Host cells were maintained at 37°C with 5% CO2. Tissue culture cell-derived trypomastigotes were obtained from L6E9 myoblasts infected with metacyclic trypomastigotes from stationary cultures of GFP-TcRab11OE and GFP-TcRab11DN parasites. T. cruzi amastigote and trypomastigote forms were collected from the culture medium of infected host cells, using a modification of the method of Schmatz and Murray [83] as described previously

[84]. Epimastigotes from T. cruzi were cultured in liver infusion tryptose (LIT) medium containing 10% newborn serum at 28°C [10]. T. cruzi epimastigotes transfected with

GFP-TcRab11OE and GFP-TcRab11DN were maintained in the presence of 250 µg/ml geneticin (G418).

Chemicals and reagents

Fetal bovine serum, newborn calf serum, Dulbecco’s phosphate buffer saline (PBS) and

Hank’s , 4’,6-diamidino-2-phenylindole (DAPI), DMEM and RPMI media, paraformaldehyde, bovine serum albumin, and protease inhibitors were purchased from

Sigma (St. Louis, MO). Restriction enzymes, were from New England BioLabs (Ipswich,

MA). pCR2.1-TOPO cloning kit, 1 kb plus DNA ladder, rabbit GFP antibodies and Gene

Tailor Site-Directed Mutagenesis System were from Invitrogen (Life Technologies,

Grand Island, NY). Hybond-N nylon membranes were obtained from PerkinElmer 65

(Waltham, MA). TbRab11 purified antibodies were a gift from Mark Field (University of

Dundee, Scotland). Monoclonal antibody 2B10 was a gift from Nobuko Yoshida (Federal

University of São Paulo, Brazil), Chagasic α-Gal antibodies were a gift from Igor de

Almeida (University of Texas, El Paso), antibody against TcTSSA II was a gift from

Carlos Buscaglia (National University of San Martin, Argentina), monoclonal antibody

FCaBP was a gift from David Engman (Northwestern University, Evanston, IL). Rabbit and goat GFP antibodies were from Abcam (Cambridge, MA). Recombinant active TcTS and inactive TcTS (iTS) were obtained as described (65-67). BCA Protein Assay Reagent was from Pierce (Thermo Fisher Scientific, Rockford, IL). All other reagents were analytical grade. The oligonucleotides were ordered from Sigma or IDT (Coralville, IA).

Metacyclogenesis

We followed the protocol described by Bourguignon et al. [85] with some modifications.

Epimastigotes were obtained after 4 days in LIT medium and submitted to a stress

(incubation for 2 h in a medium containing 190 mM NaCl, 17 mM KCl, 2 mM MgCl2, 2 mM CaCl2, 0.035% sodium bicarbonate, 8 mM phosphate, pH 6.9 at room temperature; triatome artificial urine (TAU) medium). After this stress, parasites were incubated for 96 h in TAU 3AAG medium (which consists of the previously described TAU medium supplemented with 10 mM L-proline, 50 mM sodium L-glutamate, 2 mM sodium L- aspartate, and 10 mM glucose). To increase the number of metacyclic forms, the contents of the flask were collected and resuspended in media containing fresh fetal bovine serum and incubated at 37°C for 20 h. The complement in the FBS kills epimastigotes while metacyclic trypomastigotes survive. Samples were harvested from the TAU 3AAG +

FBS-containing medium at days 5 and 10 of cultivation. 66

In vitro infection assay

HFF or irradiated myoblasts (6 x 105 cells per well) were equally distributed in a 12-well plate on a sterile coverslip in their respective growth media (as mentioned above) and were incubated for 24 h at 37°C in a 5% CO2 atmosphere. The following day, the cells were washed once with Dulbecco’s Hank’s solution, and 6 x 106 wild type, TcGFP, GFP-

TcRab11OE, or GFP-TcRab11DN trypomastigotes were added to each well (10 trypomastigotes per myoblast or HFF), and they were incubated for 4 h at 37°C in a 5%

CO2 atmosphere. To decrease the chances of contamination of cell derived- trypomastigotes with extracellular amastigotes, collections of parasites were centrifuged and incubated at 37°C for 2 h to allow trypomastigotes to swim to the surface. The supernatant was collected and used for subsequent invasion assays. Next, the parasites were removed from the plate, and the infected cells were washed extensively with

Dulbecco’s Hank’s solution and fixed for immunofluorescence assays. For rescue experiments the same number of trypomastigotes were incubated with PBS, pH 7.4, in the absence of serum, and with fetuin or asialofetuin ( made in PBS, pH 7.4, and sterilized by ) at a final concentration of 10 g/ml, and with 200 ng of active

(TcTS) or inactive (iTS) trans-sialidase for 30 min at room temperature before infecting host cells. For attachment/internalization assays, recently internalized parasites, and parasites caught in the process of invasion, were considered and manually counted in at least 200 DAPI-stained cells in 3 independent experiments. The percentage of infected cells and the average number of parasites per infected cell were determined.

67

Immunofluorescence and western blot analyses

For immunofluorescence microscopy, parasites were fixed in PBS, pH 7.4, with 4% paraformaldehyde, adhered to poly-lysine coverslips, and permeabilized for 3 min with

PBS, pH 7.4, containing 0.3% Triton X-100. Permeabilized cells were quenched for 30 min at room temperature with 50 mM NH4Cl and blocked overnight with 3% BSA in

PBS, pH 8.0. Both primary and secondary antibodies were incubated for 1 h at room temperature. Coverslips were mounted by using a mounting medium containing DAPI at

5 µg/ml for DNA-containing organelles. For imaging of intracellular parasites, mammalian cells were seeded onto sterile coverslips in 12-well culture plates and allowed to grow for 24 h. To semi-synchronize the infection, we added the parasites at a ratio of 10:1 (parasite/host cell) for 4 hours, washed the cells to eliminate extracellular parasites and fixed in cold methanol for 30 min. Infected cells were prepared for immunofluorescence analyses as described above for extracellular parasites, except for the permeabilization that was performed for 10 min with Triton X-100 in PBS, pH 7.4.

The dilution used for primary antibodies were as follows: rabbit anti-TcAQP1, 1:50 [3]; rabbit anti-TbRab11 [24] 1:200; rabbit polyclonal anti-GFP, 1:500; rabbit anti-TcTS [57],

1:2,000; rabbit anti-TcTSSA II [42], 1:200; rabbit anti-H+ATPase [63], 1:100.

Differential interference contrast (DIC) and direct fluorescence images were obtained by using an Olympus IX-71 inverted fluorescence microscope with a

PhotometrixCoolSnapHQ charge-coupled device camera driven by Delta Vision softWoRx3.5.1 (Applied Precision, Issaquah, WA). Images were deconvolved for 10 cycles using the same software and applying the “noise filter” at “medium” mode. This is an automatic deconvolution software and was applied to all channels; brightness and 68 contrast were the same in all channels. The figures were built by using Adobe Photoshop

10.0.1 (Adobe System, Inc., San Jose, CA).

For western blot analysis, ~108 T. cruzi epimastigotes, amastigotes or trypomastigotes were collected by centrifugation at 1,600 x g for 10 min, washed twice in PBS, pH 7.4, and resuspended in modified radioimmunoprecipitation analysis (RIPA) buffer (150 mM

NaCl, 20 mM Tris-Cl pH 7.5, 1 mM EDTA, 1% SDS and 0.1% Triton X-100) containing protease inhibitor cocktail (2 mM EDTA, 2 mM phenylmethylsulfonyl fluoride (PMSF),

2 mM tosylphenylalanylchloromethyl ketone (TPCK), 0.1 mM trans-epoxysuccinyl-L- leucylamido(4-guanidino) butane (E64) and Sigma P8340 protease inhibitor cocktail,

1:250). Cells were mechanically fragmented by passing lysates through a 20-gauge needle five times. The protein concentration was estimated by spectrophotometry, using the BCA Protein Assay Reagent. Twenty micrograms of protein from each total cell lysate was mixed with 2X Laemmli sample buffer, boiled for 5 min, and total homogenate of each sample were separated by SDS-PAGE. Proteins were transferred onto nitrocellulose membranes and blocked overnight with 5% nonfat dry milk in PBS-

0.1% Tween 20 (PBS-T). The following primary antibodies were applied at room temperature for 1 hr: rabbit anti-GFP at 1:1000, mFCaBP at 1:50, and rabbit anti-TcTS at

1:5000. Densitometric analysis of 3 independent experiments was performed with Alfa-

Imager software.

Flow cytometry

Tissue culture-derived trypomastigotes (106 cells) were fixed in 4% paraformaldehyde in

PBS, pH 7.4, and washed in blocking solution (3% BSA in PBS). After washing, cells were incubated with the anti-TcTS (1:2,000 dilution) in blocking solution for 1 hr on ice.

69

Parasites were washed and incubated in Alexa Fluor 633 goat anti-rabbit for one hour on ice. After washing, parasites were resuspended in PBS and samples were sorted on a

MoFlo cytometer (Cytomation, Fort Collins, CO) using a 633 nm argon laser for excitation and an emission filter of 632/647 nm band pass. Samples were manually gated to eliminate debris and dead parasites or cells. Data were analyzed using Summit version

3.1 (Cytomation) and prepared for publication using Flowjo version 4.0.2 (Treestar, San

Carlos, CA)

Generation of TcRab11 dominant negative mutant and transfection

Dominant negative forms of Rab11 were constructed via site directed mutagenesis by the use of Gene Tailor Site-Directed Mutagenesis System. This method involved methylating the TOPO blunt end vector containing the coding sequence for TcRab11 with DNA methylase at 37°C for 1 hour, followed by amplification of the plasmid in a mutagenesis reaction with two overlapping primers, forward, 5’-

GCGATAGTGGCGTCGGCAAGAACAACCTCATGACG-3’ and reverse, 5’-

CTTGCCGACGCCACTATCGCCGATGATGACAAC-3’ of which the forward primer had the target mutation, resulting in the mutation of amino acid serine to asparagine.

Mutations were confirmed by sequencing (Yale DNA Analysis Facility, Yale University,

New Haven, Connecticut). After transformation the resulting plasmid TcRab11S21N in

TOPO was digested with restriction enzymes BamHI and HindIII. The circular pTEX-N-

GFP vector was linearized by the corresponding restriction enzymes. Finally,

TcRab11S21N insert was ligated to pTEX-N-GFP followed by transformation. The plasmid pTEX-N-GFPTcRab11S21N was sequenced to confirm that the correct reading frame was used. T. cruzi CL strain epimastigotes were transfected in cytomix (120 mM 70

KCl, 0.15 mM CaCl2, 10 mM K2HPO4, 2 mM EDTA, 5 mM MgCl2, pH 7.6) containing

50 μg of the plasmid construct in a 4 mm cuvette. The cuvette was cooled on ice for 10 min and pulsed 3 times (1.5 kV, 25 μF) with a Gene Pulser Xcell™ (Bio-Rad), and expression of GFP-fusion proteins was verified by western blot analyses. Stable cell lines were established under drug selection with G418 at 250 μg/ml. Enrichment of GFP fluorescent parasites was performed with a high-speed cell sorter when needed (MoFlo

Legacy; Beckman-Coulter, Hialeah, FL).

Cryo-immunoelectron microscopy

HFF containing intracellular GFP-TcRab11OE expressing amastigotes were detached by treating the T25 flasks with 0.25% trypsin at 96 h and 106 h post-infection. The contents of the flask were collected and amastigotes were isolated from the host cells by passing them through a 20-gauge needle. The released amastigotes (with ~5% contamination of trypomastigotes) were fixed in 4% paraformaldehyde in 0.1 M cacodylate buffer, pH 7.3 for 1 h on ice. Epimastigotes were collected as described above and submitted to hyposmotic conditions. Hyposmotic stress was induced by addition of hyposmotic buffer

(64 mM NaCl, 4 mM KCl, 1.8 mM CaCl2, 0.53 mM MgCl2, 5.5 mM glucose, 50 mM D- mannitol, 5 mM Hepes-Na, pH 7.4) to a final osmolarity of 177 mosmol/L for 2 min and then fixed with 0.1 % glutaraldehyde and 4% paraformaldehyde in 0.1 M cacodylate buffer, pH 7.3 for 1 h on ice. The samples were processed for cryo-immunoelectron microscopy at the Molecular Microbiology Imaging Facility, Washington University

School of Medicine. The antibodies used were: goat anti-GFP (1:500), rabbit anti-GFP

(1:50), rabbit anti-TcTS (1:250), donkey anti-goat 18 nm colloidal gold, donkey anti- rabbit 18 nm colloidal gold, donkey anti-rabbit 12 nm colloidal gold. 71

Cell volume measurements

T. cruzi epimastigotes (GFP-TcRab11OE, GFP-TcRab11DN and wild-type) at log phase of growth (3 days) were collected at 1,600 g for 10 min (at a density of 1 x 108/ml), washed twice in PBS and resuspended in isosmotic buffer (64 mM NaCl, 4 mM KCl, 1.8 mM CaCl2, 0.53 mM MgCl2, 5.5 mM glucose, 150 mM D-mannitol, 5 mM Hepes-Na, pH 7.4, to a final osmolarity of 282 mosmol/L, as determined using an Advanced

Instruments 3D3 osmometer. Relative cell volume changes after osmotic stress were measured by light scattering. Aliquots of parasites were distributed in 96 well plates such that each well had 1 x 107 cells and an appropriate volume of the corresponding buffer was added for osmotic stress. Hyposmotic stress was induced by dilution of the isosmotic cell suspension with deionized water to a final osmolarity of 150 mOsm at time zero.

Hyperosmotic stress was induced by addition of hyperosmotic buffer (64 mM NaCl, 4 mM KCl, 1.8 mM CaCl2, 0.53 mM MgCl2, 5.5 mM glucose, 500 mM D-mannitol, 5 mM

Hepes-Na, pH 7.4) to a final osmolarity of 650 mosmol/L. Absorbance at 550 nm was monitored every 10 sec for 10 min using a SpectraMax M2e plate reader (Molecular

Devices) [10]. A decrease in absorbance corresponds to an increase in cell volume. The results were normalized respect to the value of a 3 min pre-reading under isosmotic conditions.

Video microscopy

Epimastigotes (1 x 108 cells) in logarithmic phase of growth were collected by centrifugation, washed 3 times in PBS and resuspended in isosmotic buffer (composition mentioned above). GFP-TcRab11 overexpressing epimastigotes were immobilized with poly-L-lysine on coverslips in MatTek glass bottom dishes for 30 min at room 72 temperature. Unattached cells were washed with PBS. To induce hyposmotic stress the isosmotic buffer was diluted by 1:1 with deionized water. Hyperosmotic stress was induced by bathing the chamber with hyperosmotic buffer (as described above). Time lapse photographic data were collected at 1 sec intervals with a 60X objective and a 1024

X 1024 field with a Delta Vision Elite system (Applied Precision). Video sequences were reconstructed using Quicktime software.

Lipid raft isolation

An Optiprep gradient centrifugation (sucrose float) procedure was used to isolate lipid rafts from T. cruzi epimastigotes wild type Y strain and those expressing GFP, GFP-

TcRab11 and GFP-TcSNARE2.1 fusion proteins using lysates equivalent to 2.5 x 108 mid log phase epimastigotes for each sample. The procedure was as described before [86] with minor modifications. Briefly, tubes were centrifuged continuously at 4 °C in a

Beckman Coulter OptimaTM L-100XP ultracentrifuge with a Beckman SW32Ti rotor at

35,000 rpm (210,000 x g) for 5 h and then 25,000 rpm (107,000 x g) for 8 h. After collecting the fractions, a 24 µl aliquot of each fraction was mixed with 6 µl of 5X SDS-

PAGE loading buffer, boiled for 10 min, and processed for SDS-PAGE and western blot analysis as above. The procedure for temperature-dependent Triton X-100 extraction for

GFP-TcRab11- and GFP-expressing epimastigotes was as described [66]. 73

REFERENCES

1. Allen RD, Naitoh Y (2002) Osmoregulation and contractile vacuoles of protozoa. International review of cytology 215: 351-394. 2. Docampo R, Jimenez V, Lander N, Li ZH, Niyogi S (2013) New insights into roles of acidocalcisomes and contractile vacuole complex in osmoregulation in protists. International review of cell and molecular biology 305: 69-113. 3. Montalvetti A, Rohloff P, Docampo R (2004) A functional aquaporin co-localizes with the vacuolar proton pyrophosphatase to acidocalcisomes and the contractile vacuole complex of Trypanosoma cruzi. The Journal of biological chemistry 279: 38673-38682. 4. Rohloff P, Montalvetti A, Docampo R (2004) Acidocalcisomes and the contractile vacuole complex are involved in osmoregulation in Trypanosoma cruzi. The Journal of biological chemistry 279: 52270-52281. 5. Figarella K, Uzcategui NL, Zhou Y, LeFurgey A, Ouellette M, et al. (2007) Biochemical characterization of Leishmania major aquaglyceroporin LmAQP1: possible role in volume regulation and osmotaxis. Molecular microbiology 65: 1006-1017. 6. Nishihara E, Yokota E, Tazaki A, Orii H, Katsuhara M, et al. (2008) Presence of aquaporin and V-ATPase on the contractile vacuole of . Biology of the cell / under the auspices of the European Cell Biology Organization 100: 179-188. 7. Komsic-Buchmann K, Stephan LM, Becker B (2012) The SEC6 protein is required for contractile vacuole function in Chlamydomonas reinhardtii. Journal of cell science 125: 2885-2895. 8. Clark TB (1959) Comparative morphology of four genera of trypanosomatidae. J Protozool 6: 227-232. 74

9. Girard-Dias W, Alcantara CL, Cunha ESN, de Souza W, Miranda K (2012) On the ultrastructural organization of Trypanosoma cruzi using cryopreparation methods and electron tomography. Histochemistry and cell biology 138: 821-831. 10. Li ZH, Alvarez VE, De Gaudenzi JG, Sant'Anna C, Frasch AC, et al. (2011) Hyperosmotic stress induces aquaporin-dependent cell shrinkage, polyphosphate synthesis, amino acid accumulation, and global gene expression changes in Trypanosoma cruzi. The Journal of biological chemistry 286: 43959-43971. 11. Patel S, Docampo R (2010) Acidic calcium stores open for business: expanding the potential for intracellular Ca2+ signaling. Trends in cell biology 20: 277-286. 12. Moniakis J, Coukell MB, Janiec A (1999) Involvement of the Ca2+-ATPase PAT1 and the contractile vacuole in calcium regulation in Dictyostelium discoideum. Journal of cell science 112 ( Pt 3): 405-414. 13. Malchow D, Lusche DF, Schlatterer C, De Lozanne A, Muller-Taubenberger A (2006) The contractile vacuole in Ca2+-regulation in Dictyostelium: its essential function for cAMP-induced Ca2+-influx. BMC 6: 31. 14. Ladenburger EM, Korn I, Kasielke N, Wassmer T, Plattner H (2006) An Ins(1,4,5)P3 receptor in Paramecium is associated with the osmoregulatory system. Journal of cell science 119: 3705-3717. 15. Ludlow MJ, Durai L, Ennion SJ (2009) Functional characterization of intracellular Dictyostelium discoideum P2X receptors. The Journal of biological chemistry 284: 35227-35239. 16. Sivaramakrishnan V, Fountain SJ (2012) A mechanism of intracellular P2X receptor activation. The Journal of biological chemistry 287: 28315-28326. 17. Heuser J, Zhu Q, Clarke M (1993) Proton pumps populate the contractile vacuoles of Dictyostelium amoebae. The Journal of cell biology 121: 1311-1327. 18. Sesaki H, Wong EF, Siu CH (1997) The cell adhesion molecule DdCAD-1 in Dictyostelium is targeted to the cell surface by a nonclassical transport pathway involving contractile vacuoles. The Journal of cell biology 138: 939-951. 19. Heuser J (2006) Evidence for recycling of contractile vacuole membrane during osmoregulation in Dictyostelium amoebae--a tribute to Gunther Gerisch. European journal of cell biology 85: 859-871. 75

20. Sriskanthadevan S, Lee T, Lin Z, Yang D, Siu CH (2009) Cell adhesion molecule DdCAD-1 is imported into contractile vacuoles by membrane invagination in a Ca2+- and conformation-dependent manner. The Journal of biological chemistry 284: 36377-36386. 21. Hasne MP, Coppens I, Soysa R, Ullman B (2010) A high-affinity putrescine- cadaverine transporter from Trypanosoma cruzi. Molecular microbiology 76: 78- 91. 22. Macro L, Jaiswal JK, Simon SM (2012) Dynamics of clathrin-mediated endocytosis and its requirement for organelle biogenesis in Dictyostelium. J Cell Sci 125: 5721-5732. 23. Kelly EE, Horgan CP, McCaffrey MW (2012) Rab11 proteins in health and disease. Biochemical Society transactions 40: 1360-1367. 24. Jeffries TR, Morgan GW, Field MC (2001) A developmentally regulated rab11 homologue in Trypanosoma brucei is involved in recycling processes. Journal of cell science 114: 2617-2626. 25. Harris E, Yoshida K, Cardelli J, Bush J (2001) Rab11-like GTPase associates with and regulates the structure and function of the contractile vacuole system in dictyostelium. Journal of cell science 114: 3035-3045. 26. Ulrich PN, Jimenez V, Park M, Martins VP, Atwood J, 3rd, et al. (2011) Identification of contractile vacuole proteins in Trypanosoma cruzi. PloS one 6: e18013. 27. Pal A, Hall BS, Jeffries TR, Field MC (2003) Rab5 and Rab11 mediate transferrin and anti-variant surface glycoprotein antibody recycling in Trypanosoma brucei. The Biochemical journal 374: 443-451. 28. Grunfelder CG, Engstler M, Weise F, Schwarz H, Stierhof YD, et al. (2003) Endocytosis of a glycosylphosphatidylinositol-anchored protein via clathrin- coated vesicles, sorting by default in endosomes, and exocytosis via RAB11- positive carriers. Molecular biology of the cell 14: 2029-2040. 29. El-Sayed NM, Myler PJ, Bartholomeu DC, Nilsson D, Aggarwal G, et al. (2005) The genome sequence of Trypanosoma cruzi, etiologic agent of Chagas disease. Science 309: 409-415. 76

30. Freitas LM, dos Santos SL, Rodrigues-Luiz GF, Mendes TA, Rodrigues TS, et al. (2011) Genomic analyses, gene expression and antigenic profile of the trans- sialidase superfamily of Trypanosoma cruzi reveal an undetected level of complexity. PloS one 6: e25914. 31. Di Noia JM, Buscaglia CA, De Marchi CR, Almeida IC, Frasch AC (2002) A Trypanosoma cruzi small surface molecule provides the first immunological evidence that Chagas' disease is due to a single parasite lineage. The Journal of experimental medicine 195: 401-413. 32. Cremona ML, Campetella O, Sanchez DO, Frasch AC (1999) Enzymically inactive members of the trans-sialidase family from Trypanosoma cruzi display beta- galactose binding activity. Glycobiology 9: 581-587. 33. Tomlinson S, Pontes de Carvalho LC, Vandekerckhove F, Nussenzweig V (1994) Role of sialic acid in the resistance of Trypanosoma cruzi trypomastigotes to complement. Journal of immunology 153: 3141-3147. 34. Buscaglia CA, Campo VA, Frasch AC, Di Noia JM (2006) Trypanosoma cruzi surface mucins: host-dependent coat diversity. Nature reviews Microbiology 4: 229-236. 35. Pereira-Chioccola VL, Acosta-Serrano A, Correia de Almeida I, Ferguson MA, Souto-Padron T, et al. (2000) Mucin-like molecules form a negatively charged coat that protects Trypanosoma cruzi trypomastigotes from killing by human anti- alpha-galactosyl antibodies. Journal of cell science 113 ( Pt 7): 1299-1307. 36. Schenkman S, Jiang MS, Hart GW, Nussenzweig V (1991) A novel cell surface trans- sialidase of Trypanosoma cruzi generates a stage-specific epitope required for invasion of mammalian cells. Cell 65: 1117-1125. 37. Buschiazzo A, Muia R, Larrieux N, Pitcovsky T, Mucci J, et al. (2012) Trypanosoma cruzi trans-sialidase in complex with a neutralizing antibody: structure/function studies towards the rational design of inhibitors. PLoS pathogens 8: e1002474. 38. Rubin-de-Celis SS, Uemura H, Yoshida N, Schenkman S (2006) Expression of trypomastigote trans-sialidase in metacyclic forms of Trypanosoma cruzi increases parasite escape from its parasitophorous vacuole. Cellular microbiology 8: 1888-1898. 77

39. Tribulatti MV, Mucci J, Van Rooijen N, Leguizamon MS, Campetella O (2005) The trans-sialidase from Trypanosoma cruzi induces thrombocytopenia during acute Chagas' disease by reducing the platelet sialic acid contents. Infection and immunity 73: 201-207. 40. Mucci J, Hidalgo A, Mocetti E, Argibay PF, Leguizamon MS, et al. (2002) Thymocyte depletion in Trypanosoma cruzi infection is mediated by trans- sialidase-induced apoptosis on nurse cells complex. Proceedings of the National Academy of Sciences of the United States of America 99: 3896-3901. 41. Freire-de-Lima L, Alisson-Silva F, Carvalho ST, Takiya CM, Rodrigues MM, et al. (2010) Trypanosoma cruzi subverts host cell sialylation and may compromise antigen-specific CD8+ T cell responses. J Biol Chem 285: 13388-13396. 42. Canepa GE, Degese MS, Budu A, Garcia CR, Buscaglia CA (2012) Involvement of TSSA (trypomastigote small surface antigen) in Trypanosoma cruzi invasion of mammalian cells. The Biochemical journal 444: 211-218. 43. Almeida IC, Ferguson MA, Schenkman S, Travassos LR (1994) Lytic anti-alpha- galactosyl antibodies from patients with chronic Chagas' disease recognize novel O-linked oligosaccharides on mucin-like glycosyl-phosphatidylinositol-anchored glycoproteins of Trypanosoma cruzi. Biochem J 304 ( Pt 3): 793-802. 44. Almeida IC, Krautz GM, Krettli AU, Travassos LR (1993) Glycoconjugates of Trypanosoma cruzi: a 74 kD antigen of trypomastigotes specifically reacts with lytic anti-alpha-galactosyl antibodies from patients with chronic Chagas disease. J Clin Lab Anal 7: 307-316. 45. Almeida IC, Milani SR, Gorin PA, Travassos LR (1991) Complement-mediated lysis of Trypanosoma cruzi trypomastigotes by human anti-alpha-galactosyl antibodies. J Immunol 146: 2394-2400. 46. Di Noia JM, D'Orso I, Aslund L, Sanchez DO, Frasch AC (1998) The Trypanosoma cruzi mucin family is transcribed from hundreds of genes having hypervariable regions. J Biol Chem 273: 10843-10850. 47. Yoshida N, Mortara RA, Araguth MF, Gonzalez JC, Russo M (1989) Metacyclic neutralizing effect of monoclonal antibody 10D8 directed to the 35- and 50- 78

kilodalton surface glycoconjugates of Trypanosoma cruzi. Infect Immun 57: 1663-1667. 48. Fujita M, Kinoshita T (2012) GPI-anchor remodeling: potential functions of GPI- anchors in intracellular trafficking and membrane dynamics. Biochimica et biophysica acta 1821: 1050-1058. 49. Fukuda M (2010) How can mammalian Rab small GTPases be comprehensively analyzed?: Development of new tools to comprehensively analyze mammalian Rabs in membrane traffic. Histology and histopathology 25: 1473-1480. 50. Docampo R (2011) Molecular parasitology in the 21st century. Essays in biochemistry 51: 1-13. 51. Feig LA (1999) Tools of the trade: use of dominant-inhibitory mutants of Ras-family GTPases. Nature cell biology 1: E25-27. 52. Stenmark H (2009) Rab GTPases as coordinators of vesicle traffic. Nature reviews Molecular cell biology 10: 513-525. 53. Rohloff P, Rodrigues CO, Docampo R (2003) Regulatory volume decrease in Trypanosoma cruzi involves amino acid efflux and changes in intracellular calcium. Molecular and biochemical parasitology 126: 219-230. 54. Pereira ME (1983) A developmentally regulated neuraminidase activity in Trypanosoma cruzi. Science 219: 1444-1446. 55. Frevert U, Schenkman S, Nussenzweig V (1992) Stage-specific expression and intracellular shedding of the cell surface trans-sialidase of Trypanosoma cruzi. Infection and immunity 60: 2349-2360. 56. Giorgi ME, de Lederkremer RM (2011) Trans-sialidase and mucins of Trypanosoma cruzi: an important interplay for the parasite. Carbohydrate research 346: 1389- 1393. 57. Buscaglia CA, Campetella O, Leguizamon MS, Frasch AC (1998) The repetitive domain of Trypanosoma cruzi trans-sialidase enhances the immune response against the catalytic domain. The Journal of infectious diseases 177: 431-436. 58. Souto-Padron T, Reyes MB, Leguizamon S, Campetella OE, Frasch AC, et al. (1989) Trypanosoma cruzi proteins which are antigenic during human infections are located in defined regions of the parasite. Eur J Cell Biol 50: 272-278.

79

59. Ellgaard L, Molinari M, Helenius A (1999) Setting the standards: quality control in the secretory pathway. Science 286: 1882-1888. 60. Parodi AJ, Pollevick GD, Mautner M, Buschiazzo A, Sanchez DO, et al. (1992) Identification of the gene(s) coding for the trans-sialidase of Trypanosoma cruzi. EMBO J 11: 1705-1710. 61. Vanderheyden N, Benaim G, Docampo R (1996) The role of a H(+)-ATPase in the regulation of cytoplasmic pH in Trypanosoma cruzi epimastigotes. The Biochemical journal 318 ( Pt 1): 103-109. 62. Luo S, Scott DA, Docampo R (2002) Trypanosoma cruzi H+-ATPase 1 (TcHA1) and 2 (TcHA2) genes complement yeast mutants defective in H+ pumps and encode plasma membrane P-type H+-ATPases with different enzymatic properties. The Journal of biological chemistry 277: 44497-44506. 63. Vieira M, Rohloff P, Luo S, Cunha-e-Silva NL, de Souza W, et al. (2005) Role for a P-type H+-ATPase in the acidification of the endocytic pathway of Trypanosoma cruzi. The Biochemical journal 392: 467-474. 64. Yoshida N (2006) Molecular basis of mammalian cell invasion by Trypanosoma cruzi. An Acad Bras Cienc 78: 87-111. 65. Tyler KM, Fridberg A, Toriello KM, Olson CL, Cieslak JA, et al. (2009) Flagellar membrane localization via association with lipid rafts. J Cell Sci 122: 859-866. 66. Maric D, McGwire BS, Buchanan KT, Olson CL, Emmer BT, et al. (2011) Molecular determinants of ciliary membrane localization of Trypanosoma cruzi flagellar calcium-binding protein. J Biol Chem 286: 33109-33117. 67. Campetella OE, Uttaro AD, Parodi AJ, Frasch AC (1994) A recombinant Trypanosoma cruzi trans-sialidase lacking the amino acid repeats retains the enzymatic activity. Mol Biochem Parasitol 64: 337-340. 68. Oppezzo P, Obal G, Baraibar MA, Pritsch O, Alzari PM, et al. (2011) Crystal structure of an enzymatically inactive trans-sialidase-like lectin from Trypanosoma cruzi: the carbohydrate binding mechanism involves residual sialidase activity. Biochim Biophys Acta 1814: 1154-1161. 80

69. Cremona ML, Sanchez DO, Frasch AC, Campetella O (1995) A single tyrosine differentiates active and inactive Trypanosoma cruzi trans-sialidases. Gene 160: 123-128. 70. Todeschini AR, Dias WB, Girard MF, Wieruszeski JM, Mendonca-Previato L, et al. (2004) Enzymatically inactive trans-sialidase from Trypanosoma cruzi binds sialyl and beta-galactopyranosyl residues in a sequential ordered mechanism. J Biol Chem 279: 5323-5328. 71. Todeschini AR, Girard MF, Wieruszeski JM, Nunes MP, DosReis GA, et al. (2002) trans-Sialidase from Trypanosoma cruzi binds host T-lymphocytes in a lectin manner. J Biol Chem 277: 45962-45968. 72. Silverman JS, Bangs JD (2012) Form and function in the trypanosomal secretory pathway. Current opinion in microbiology 15: 463-468. 73. Soares MJ, Souto-Padron T, De Souza W (1992) Identification of a large pre- lysosomal compartment in the pathogenic protozoon Trypanosoma cruzi. Journal of cell science 102 ( Pt 1): 157-167. 74. Chiribao ML, Libisch MG, Osinaga E, Parodi-Talice A, Robello C (2012) Cloning, localization and differential expression of the Trypanosoma cruzi TcOGNT-2 glycosyl transferase. Gene 498: 147-154. 75. Bayer-Santos E, Aguilar-Bonavides C, Rodrigues SP, Cordero EM, Marques AF, et al. (2013) Proteomic analysis of Trypanosoma cruzi secretome: characterization of two populations of extracellular vesicles and soluble proteins. Journal of proteome research 12: 883-897. 76. Maeda Y, Kinoshita T (2011) Structural remodeling, trafficking and functions of glycosylphosphatidylinositol-anchored proteins. Progress in lipid research 50: 411-424. 77. Cordero EM, Nakayasu ES, Gentil LG, Yoshida N, Almeida IC, et al. (2009) Proteomic analysis of detergent-solubilized membrane proteins from insect- developmental forms of Trypanosoma cruzi. Journal of proteome research 8: 3642-3652. 81

78. Gabernet-Castello C, Dubois KN, Nimmo C, Field MC (2011) Rab11 function in Trypanosoma brucei: identification of conserved and novel interaction partners. Eukaryotic cell 10: 1082-1094. 79. Essid M, Gopaldass N, Yoshida K, Merrifield C, Soldati T (2012) Rab8a regulates the exocyst-mediated kiss-and-run discharge of the Dictyostelium contractile vacuole. Molecular biology of the cell 23: 1267-1282. 80. Lang F, Busch GL, Volkl H (1998) The diversity of volume regulatory mechanisms. Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology 8: 1-45. 81. Go WY, Liu X, Roti MA, Liu F, Ho SN (2004) NFAT5/TonEBP mutant mice define osmotic stress as a critical feature of the lymphoid microenvironment. Proceedings of the National Academy of Sciences of the United States of America 101: 10673-10678. 82. Kollien AH, Grospietsch T, Kleffmann T, Zerbst-Boroffka I, Schaub GA (2001) Ionic composition of the rectal contents and excreta of the reduviid bug Triatoma infestans. Journal of insect physiology 47: 739-747. 83. Schmatz DM, Murray PK (1982) Cultivation of Trypanosoma cruzi in irradiated muscle cells: improved synchronization and enhanced trypomastigote production. Parasitology 85 (Pt 1): 115-125. 84. Moreno SN, Silva J, Vercesi AE, Docampo R (1994) Cytosolic-free calcium elevation in Trypanosoma cruzi is required for cell invasion. The Journal of experimental medicine 180: 1535-1540. 85. Bourguignon SC, de Souza W, Souto-Padron T (1998) Localization of lectin-binding sites on the surface of Trypanosoma cruzi grown in chemically defined conditions. Histochemistry and cell biology 110: 527-534. 86. de Paulo Martins V, Okura M, Maric D, Engman DM, Vieira M, et al. (2010) Acylation-dependent export of Trypanosoma cruzi phosphoinositide-specific phospholipase C to the outer surface of amastigotes. J Biol Chem 285: 30906- 30917. 82

FIGURES

Figure 3.1 Fluorescence microscopy analysis of TcRab11 in different stages of T. cruzi. (A-C) GFP fusion protein of TcRab11 was detected in the contractile vacuole bladder of epimastigotes (Epi, A), trypomastigotes (Trypo, B), and intracellular amastigotes (Ama, C) using antibodies against GFP. Upper panels show differential interference contrast microscopy (DIC) images merged with DAPI staining of DNA (in blue) and GFP-TcRab11 (in green). Lower panels show fluorescence images. (D) GFP-

TcRab11 (green) co-localizes with antibodies against T. cruzi aquaporin 1 (-AQP, red), a marker for the contractile vacuole, under hyposmotic conditions. (E) Antibodies against

TbRab11 (-Rab11, red) co-localize with GFP-TcRab11 (green). (F) Antibodies against

TbRab11 (red) localize to a compartment that resembles the contractile vacuole in (E). 83

DAPI staining is in blue. Arrowheads in D-F show co-localization between antibodies against TcAQP1 and GFP (D), TbRab11 antibody and GFP (E) and labeling with antibodies against TbRab11 (F), respectively. Bars in A-F = 10 µm. (G) Western blot analyses with TbRab11 antibody of lysates of epimastigotes overexpressing GFP-

TcRab11 (E-OE), or wild-type epimastigotes (E), trypomastigotes (T) and amastigotes

(A) showing bands (arrows) corresponding to the endogenous TcRab11 (24 kDa) and to

GFP-TcRab11 (50 kDa). The blots were sequentially probed with TbRab11 and anti- tubulin antibodies, used as loading control. 84

Figure 3.2 GFP-TcRab11DN localizes to the cytoplasm of different life cycle stages.

(A-C) GFP-TcRab11DN, mimicking the GDP–bound state of the protein has a cytosolic punctate localization in epimastigotes, (A), trypomastigotes (B), and intracelular amastigotes (C), as detected using antibodies against GFP. DNA was stained with DAPI.

Bars = 10 µm. 85

Figure 3.3 Regulatory volume changes of epimastigotes (A-B) Cells were pre- incubated in isosmotic buffer for 3 min and then subjected to hyposmotic (final osmolarity = 150 mOsm) (A) or hyperosmotic (final osmolarity = 650 mOsm) (B) stress.

Relative change in cell volume was followed by monitoring absorbance at 550 nm by light scattering. As compared to wild-type cells (WT), cells expressing GFP-TcRab11DN

(DN) failed to fully recover their volume after hyposmotic stress and shrank less after hyperosmotic stress, while cells overexpressing GFP-TcRab11 (OE) recovered their 86 volume faster after hyposmotic stress and shrank more after hyperosmotic stress. Values are means ± SD of three different experiments. Asterisks indicate statistically significant differences, p < 0.05, (Bonferroni’s multiple comparison “a posteriori” of one-way

ANOVA) at all time points after induction of osmotic stress. (C-D) Epimastigotes were immobilized on glass slides with poly-lysine and diluted with deionized water to a final osmolarity of 150 mOsm (C) or bathed with hyperosmotic (650 mOsm) buffer (D). Video microscopy data were collected and selected frames are shown. Times indicated in each frame represent 1 second apart after induction of stress. Arrowheads show different dilated compartments that transform into larger bladders at a later time. Results are representative of those obtained from at least three independent experiments. Bars = 10

µm. 87

Figure 3.4 Co-localization of GFP-TcRab11 and TcTS during amastigote differentiation in human foreskin fibroblasts. (A) Expression of TcTS becomes apparent at 48 h p.i., when antibodies against TcTS (red) co-localize with GFP-TcRab11, as detected with antibodies against GFP (green). Co-localization progresses to close to

80% of cells by 96 h, and after 106 h co-localization starts to decrease and surface labeling of TcTS is more evident. Scale bars = 10 µm. Insets shows co-localization at high magnification (double). (B) Percentage of amastigotes showing co-localization of

TcTS and GFP-Rab11 with time. Two hundred amastigotes were counted in each experiment and results are expressed as means ± SEM (n = 3). 88

Figure 3.5 Localization of TcTS during differentiation to cell-derived and metacyclic trypomastigotes. (A) Co-localization of TcTS and antibodies against GFP in intermediate stages (epimastigote-like) obtained from tissue culture supernatants. (B)

TcTS localizes to patches of the plasma membrane in fully differentiated trypomastigotes while GFP-TcRab11 remains in the CVC. (C) Co-localization of TcTS with GFP-

TcRab11 in epimastigotes during transformation into metacyclic stages. Scale bars (C-E)

= 10 µm. 89

Figure 3.6 Cryo-immunoelectron microscopy localization of GFP-TcRab11 and

TcTS in amastigotes. Amastigotes were isolated from HFF at different times p.i., as described under Materials and Methods. GFP-TcRab11 and TcTS were detected with goat anti-GFP, and rabbit anti-TcTS antibodies, and donkey anti-goat 18 nm colloidal gold and donkey anti-rabbit 12 nm colloidal gold, respectively. (A-D) Amastigotes obtained after 96 h p.i. Co-localization of antibodies against GFP (arrows) and TcTS

(small dots) is evident in the CV bladder (CV) and spongiome (Sp), while TcTS also 90 localizes to the flagellar pocket (FP) and in patches of the plasma membrane. Note in (B) a collapsed bladder and intense labeling of the spongiome. (E-F) Amastigotes obtained

106 h p.i. GFP-TcRab11 localizes to the CV bladder while TcTS localizes to vesicles (V, small arrows) close to the plasma membrane and in patches in the plasma membrane.

Scale bars = 500 nm. Note that the patchy appearance of the cytoplasm is due to the absence of glutaraldehyde in the fixative because it abolished labeling of TcTS. 91

Figure 3.7 Overexpression of GFP-TcRab11DN reduces the surface expression of

TcTS. Tissue culture-derived wild type, and GFP-TcRab11DN-expressing trypomastigotes and intermediate forms were fixed, permeabilized and stained with antibodies against TcTS (A), or both TcTS and GFP (B and C). Labeling of TcTS (red) in fully differentiated trypomastigotes was predominantly in surface patches (A). Labeling of GFP-TcRab11DN (green) was predominantly cytosolic while labeling of TcTS was punctated but did not reach the cell surface in intermediate forms (B) or fully differentiated trypomastigotes (C). (D) The fluorescence intensity of TcTS in the cell 92 surface of tissue culture-derived GFP-TcRab11DN-expressing trypomastigotes was measured in 200 cells in each experiment and expressed as percentage of control (wild- type trypomastigotes). Values are means ± SEM of 3 independent experiments. **p <

0.05. (E) FACS analysis of fixed GFP-TcRab11DN trypomastigotes reveals a decrease in the surface expression of TcTS as depicted by their lesser fluorescence intensity (DN) in comparison to that of wild type cells (WT). The negative control were unstained wild type trypomastigotes (US) showing background fluorescence. Wild type cells have two peaks of TcTS, suggesting the presence of intermediate stages in these asynchronously growing cultures. Data is representative of the profile analysis of 20,000 cells from 3 independent experiments.

Figure 3.8 Localization of surface proteins in GFP-TcRab11OE and GFP-

TcRab11DN-expressing parasites. Antibodies against TcTSSA II (red) co-localize with 93 antibodies against GFP (green) in intermediate forms (A) and amastigotes (B) but not in trypomastigotes expressing GFP-TcRab11, where they localize to the plasma membrane

(C). Antibodies against TcTSSA II (D) still localize to the plasma membrane in GFP-

TcRab11DN-expressing cells, while antibodies against the H+-ATPase (E) maintain their intracellular and plasma membrane localization in GFP-Rab11DN-expressing cells. In

(D) and (E) GFP staining localizes to the cytosol. Scale bars = 10 µm.

Figure 3.9 Localization of anti-Gal antibodies. (A) GFP-TcRab11 co-localizes with the anti-Gal antibodies in the CVC of the intermediate forms as detected by polyclonal antibody against GFP (green arrow) and anti-α-galactosyl antibodies from patients with chronic Chagas disease (red arrow), respectively. (B) Anti-Gal antibodies strongly label the surface of fully differentiated tissue culture derived trypomastigotes while GFP-

TcRab11 labels the CVC. (C) GFP-TcRab11DN mutants show a punctated cytosolic

94 localization (green) while anti-Gal antibodies (red) localize to the plasma membrane in intermediate stages. Scale bars (A-C) = 10 µm

Figure 3.10 Association of CVC proteins with lipid rafts and reduced infectivity of

TcRab11DN trypomastigote. (A) Parasite extracts were loaded at the bottom (fraction

9) of a discontinuous Optiprep density gradient and subjected to ultracentrifugation.

Fractions were collected and analyzed by anti-GFP and anti-FCaBP immunoblotting.

Fractions 2 and 3 contain the lipid raft interface. The TcSNARE2.1GFP (SNARE), GFP-

TcRab11 (Rab11), and FCaBP floated to the lipid raft interface. Lanes 6-9 represent the heavier fractions of the GFP and FCaBP derivatives and GFP alone was detected in these fractions. A whole cell lysate (WCL) is included in each panel as a control of loading.

Total protein in lysates of GFP-TcSNARE2.1-, GFP-TcRab11- and GFP-expressing epimastigotes were 1.41, 1.3 and 1.39 mg/ml, respectively. (B) T. cruzi expressing GFP-

TcRab11 or GFP were solubilized in Triton X-100 at 4°C or 37°C and separated into 95 soluble (S) and insoluble (P) fractions and analyzed by western blotting with anti-GFP.

Rab11-GFP partitions in the pellet fraction at 4°C, but is solubilized at 37°C, whereas

GFP is only detected in the soluble fraction. (C-D) Effect of TcRab11 overexpression

(OE) or mutation (DN) on trypomastigote invasion of host cells. In vitro infection assays were carried out as described under Materials and Methods. (E-F) Partial rescue of the infectivity of DN trypomastigotes by their incubation in the presence of active TcTS and sialofetuin, whereas inactive trans-sialidase (iTS) does not rescue the infectivity of GFP-

TcRab11DN mutants. Fetuin was present in all samples. Other conditions under

Materials and Methods. Values in C-F are mean ± SD (n = 3). *, ** and *** indicate that differences are statistically significant compared with respective controls, p < 0.05

(Ordinary one way ANOVA with Bonferroni post-test). 96

Supplementary figures

Figure 3.11 Cryo-immunoelectron microscopy localization of GFP-TcRab11 in epimastigotes. Epimastigotes were isolated and submitted to hyposmotic stress as described under Materials and Methods. GFP-TcRab11 was detected with rabbit anti-

GFP, and anti-rabbit 18 nm colloidal gold. GFP-TcRab11 localizes mainly to the CV bladder. Arrows in C show labeling of the dilated spongiome (Sp) tubules. CV; contractile vacuole bladder; Sp: spongiome; Fl, flagellum; K, kinetoplast. Scale bars =

100 nm. 97

Figure 3.12 Growth rate, and western blot analyses of overexpressed TcRab11. (A)

Growth rate of epimastigotes overexpressing (OE, blue) or expressing the dominant negative (DN, green) mutant of TcRab11, as compared to controls (C, red). (B) Western blot analyses of GFP-TcRab11OE (OE), GFP-TcRab11DN (DN) and GFP-expressing

(GFP) epimastigotes. Membranes were stripped and re-incubated with anti-tubulin antibody as a loading control (bottom panel). (C) Densitometry analysis of western blots of lysates from TcRab11 overexpressing epimastigotes (OE) as compared to those of control cells. Values in arbitrary units (AU) correspond to mean ± SD from 3 independent experiments. (D) Western blot analyses of GFP-TcRab11OE (OE), GFP-

TcRab11DN (DN) and GFP-expressing (GFP) trypomastigotes. Membranes were stripped and re-incubated with anti-tubulin antibody as a loading control (bottom panel). 98

Figure 3.13 TcAQP1 localization is not affected in GFP-TcRab11DN mutants and western blot analysis of wild type and GFP-TcRab11DN shows specificity of anti-

SAPA antibodies. (A) Co-localization of GFP-TcRab11, as detected with antibodies against GFP (green arrow), with antibodies against TcAQP1 (-TcAQP, red arrow) in epimastigotes. (B) GFP-TcRab11DN mutants show a punctated cytosolic localization as detected with anti-GFP (green), while antibodies against TcAQP1 still localize to the

CVC (red arrows). Co-localization is indicated in Merge images (yellow arrows). Bars =

10 µm. (C) Western blot analyses of GFP-TcRab11DN (DN), and wild type (WT) trypomastigotes using anti-SAPA antibodies. Membranes were stripped and re-incubated with anti-tubulin antibody as a loading control (bottom panel). 99

Figure 3.14 Localization of GFP-TcRab11 and gp35/50 mucins during metacyclogenesis. (A) GFP-TcRab11 co-localizes with gp35/50 mucins in the CVC of intermediate forms, as detected with polyclonal antibody against GFP (green arrow), and monoclonal antibody 2B10 (red arrow), respectively. Surface localization of gp35/50 is also evident (red). (B) GFP-TcRab11 (green arrows) does not co-localize with gp35/50 mucins, which have a surface localization in metacyclic trypomastigotes (red). (C) GFP-

TcRab11DN mutants show a punctated cytosolic localization of TcRab11DN (green) while gp35/50 mucins (red) localize to the plasma membrane in intermediate stages.

Scale bars (A-C) = 10 µm.

100

Figure 3.15 Infections of host cells by trypomastigotes overexpressing TcRab11. A-

B. TcRab11 overexpression (OE) does not cause significant changes in trypomastigote invasion of host cells as compared to wild type trypomastigotes. In vitro infection assays were carried out as described under Materials and Methods. (C-D). Recombinant active trans-sialidase rescues the infectivity of GFP-TcRab11DN mutants in the presence of fetuin (F) but not in the presence of asialofetuin (A). Other conditions under Materials and Methods. 101

CHAPTER 4

RAB32 IS ESSENTIAL FOR MAINTAINING FUNCTIONAL

ACIDOCALCISOMES AND FOR GROWTH AND VIRULENCE OF

TRYPANOSOMA CRUZI

Sayantanee Niyogi, Veronica Jimenez and Roberto Docampo. (To be submitted to PLoS

Pathogens) 102

Abstract

We recently reported that the contractile vacuole complex (CVC) of Trypanosoma cruzi, the etiologic agent of Chagas disease, is involved in the transfer of GPI-anchored proteins to the plasma membrane of the parasite during its differentiation to trypomastigotes and that the CVC-located small GTPase TcRab11 is essential for the specific transfer of trans-sialidase. Here we report that another CVC-located small GTPase, TcRab32, is important for acidocalcisome function, suggesting its involvement in trafficking of membrane proteins to these organelles. TcRab32 is geranylgeranylated and localizes to the CVC. A dominant negative (DN) mutant tagged with GFP (GFP-TcRab32DN) localizes to the cytosol, and epimastigotes expressing this dominant negative mutant are less responsive to osmotic stress. Mutant parasites are still able to differentiate into metacyclic forms and infect host cells but they are less virulent than wild type cells.

Parasites expressing GFP-TcRab32DN have a reduced number of acidocalcisomes, which are deficient in pyrophosphate (PPi) and polyphosphate (polyP), and are less electron- dense as compared to acidocalcisomes in wild type cells. Taking together these results reveal roles of TcRab32 in osmoregulation and trafficking of membrane proteins to acidocalcisomes and indicate that the CVC is a trafficking hub in these parasites.

Author Summary

The contractile vacuole complex (CVC) consists of a large vacuole or bladder and a loose network of tubules known as the spongiome. In addition to its role in osmoregulation, the

CVC of Trypanosoma cruzi has a role in trafficking of GPI-anchored proteins to the plasma membrane of differentiating cells. In this work we reveal that its role is not limited to the traffic of GPI-anchored proteins to the plasma membrane but also includes

103 the traffic of membrane proteins to acidocalcisomes. Expression of dominant negative mutants of the CVC-located GFP-TcRab32 results in acidocalcisomes of altered morphology and content and less virulent parasites revealing the similarity of its role to that of early/recycling endosomes.

Introduction

Trypanosoma cruzi [1], the etiologic agent of Chagas disease, together with Leishmania spp. [2], and a number of monogenetic trypanosomes [3,4], possess a contractile vacuole complex (CVC) involved in osmoregulation. In T. cruzi, the CVC was shown to be important for regulatory volume decrease (RVD) after hyposmotic stress [5], and for shrinking of the cells when submitted to hyperosmotic stress [6]. In addition, we recently reported a role for the CVC in trafficking glycosylphosphatidylinositol(GPI)-anchored proteins to the plasma membrane [7]. Previous studies in T. cruzi [8] and Dictyostelium discoideum [9-12] suggested that other soluble [9,10] and membrane [8,11,12] proteins can also be transported through the CVC to the plasma membrane. The presence of

Rab11, a small GTPase that localizes in recycling endosomes in most cells, including T. brucei [13], in the CVC of T. cruzi [14] and D. discoideum [15], suggested that the CVC could be an evolutionary precursor to the recycling endosomal system in other eukaryotes

[15,16].

In a previous proteomic and bioinformatics study of the CVC of T. cruzi we identified a number of proteins involved in trafficking roles, among them SNAREs 2.1 and 2.2,

VAMP1 (VAMP7 homolog), AP180, and the small GTPases Rab11 and Rab32 [14]. It was verified by immunofluorescence that indeed these proteins localize to the CVC. Rab proteins mediate tethering of incoming vesicles to the correct target organelle through

104 cycling between a GDP-bound inactive and a GTP-active form [17]. They have also been implicated in vesicle budding and in the interaction with cytoskeletal elements [17].

Different Rab GTPases are localized to different organelles and this represents an important determinant of each organelle identity [18-20]. Rab32 and its close homolog

Rab38 are predominantly expressed in lysosome-related organelles-(LROs)-producing cells such as melanocytes, and platelets [21], and it has been suggested that these Rabs could be the specificity factors that work in concert with the ubiquitous trafficking machinery for transport toward LROs [21]. It has been proposed that LROs arise by delivery of specific cargoes from the early endosomal network, comprising sorting and recycling endosomes [22,23].

T. cruzi possesses organelles with similarities to LROs of mammalian cells, known as acidocalcisomes [24-26]. As LROs of human platelets [27,28] and mast cells [29], acidocalcisomes have rounded morphology, are acidic, and rich in calcium, pyrophosphate (PPi) and polyphosphate (polyP). In addition, adaptor protein complex-3

(AP-3), the system known to be involved in transport of membrane proteins to LROs of mammalian cells [30], is also involved in the biogenesis of acidocalcisomes [31,32].

Interestingly, electron microscopy evidences of fusion of acidocalcisomes to the CVC of

T. cruzi [33], and D. discoideum [34] have been reported. Also, under hyposmotic stress acidocalcisomes fuse to the CVC and results in translocation of an aquaporin (TcAQP1)

[5]. In this work we demonstrate that the expression of dominant-interfering TcRab32 mutants altered osmoregulation, acidocalcisome number and content, and parasite infectivity. The results suggest that the CVC and TcRab32 are involved in trafficking membrane proteins involved in acidocalcisome biogenesis, and reaffirm the role of the

105

CVC as a trafficking hub.

Results

Localization of TcRab32 in different T. cruzi stages:

We reported that N-terminal tagging of T. cruzi Rab32 (TcRab32; TcCLB.506289.80) with green fluorescent protein (GFP) resulted in labeling of the CVC of epimastigotes and an additional punctated staining [14]. We confirmed this localization by indirect immunofluorescence analysis using an affinity purified TcRab32 antibody raised in mouse against the recombinant protein. For the generation of antibody against the protein, we expressed TcRab32 in Escherichia coli as a fusion protein with a C-terminal polyhistidine tag. Recombinant Rab32 proteins was purified by affinity chromatography using His-Bin cartridges and fractions were verified by SDS PAGE. Fig. 4.1A shows that the bacterially expressed rTcRab32 protein (including the His-tag) appears as a strong single band with an approximate molecular mass of 42 kDa. Fig. 4.1B-D shows that

αTcRab32 localizes to the bladder of the CVC of wild type epimastigotes, trypomastigotes, and amastigotes (arrows), with additional punctated staining especially in epimastigotes and trypomastigotes. This antibody was shown to predominantly react with a protein of 26 kDa in all T. cruzi stages (Fig. 4.1E).

In vitro prenylation studies of TcRab32

TcRab32 possesses the sequence CXC at the carboxyl terminus (Fig. 4.2A; denoted by red overlap) and it is known that Rab prenylation at Cys residues of the carboxyl terminus retain Rabs at membranes [35]. Previous studies using recombinant T. cruzi protein geranylgeranyl transferase I (GGTI) using a panel of mammalian and yeast protein substrates reported that two mammallian Rab family GTPases containing the C-

106 terminal CXC sequence did not serve as substrates for this enzyme, as expected [36].

Accordingly, Prenylation Prediction Suite (PrePS) predicts that geranylgenanyl transferase II (GGTII) is the enzyme involved in the prenylation of this protein. To examine whether TcRab32 is geranylgeranylated, we performed in vitro prenylation experiments (Fig. 4.2B) using recombinant Rab32 (rRab32) as substrate in the presence of a cytosolic epimastigote extract as the source of prenyltransferases. When tritiated geranylgeranyl pyrophosphate ([3H]GGPP) was used as the isoprenoid donor, His-tagged

TcRab32 was efficiently geranylgeranylated as shown by the labeled band of 42 kDa detected, corresponding to the His-tagged protein. The intensity of the prenylated band was strongest at 30 min, the optimum incubation time. Conversely, when tritiated farnesyl pyrophosphate ([3H]FPP) was used as donor, we were unable to detect prenylation of rTcRab32, even after exposure of the gel for more tan 2 weeks at -80°C

(data not shown). Therefore, TcRab32 is specifically geranylgeranylated.

Localization of TcRab32 mutants

To examine the role of the prenylation motif in targeting of TcRab32 to cell membranes, we generated mutants in which the prenylation motif was mutated and we studied the effect of this mutation on the localization of the protein. An N-terminal GFP epitope tag was fused to TcRab32 in which the C-terminal Cys residues were mutated to Ala. In transfected T. cruzi epimastigotes GFP-TcRab32C241A/243A had a cytosolic localization (Fig. 4.3A). We also constructed an expression plasmid encoding a TcRab32 mutant that mimics the GDP-bound form (dominant-negative; TcRab32T24N) (Fig.

4.3B) or the GTP-bound form (dominan-positive; TcRab32Q71L) (Fig. 4.3C). In transfected T. cruzi epimastigotes, GFP-TcRab32DN have a punctated cytosolic

107 localization while GFP-TcRab32DP have a preferential localization in the CVC.

Together, these results suggest that TcRab32 localizes to the membrane of the CVC in a

GTP-dependent manner with the COOH-terminal cysteines.

Lack of co-localization of GFP-TcRab32 with a mitochondrial marker

It has been reported that mammalian Rab32 functions as an A-kinase anchoring protein

(AKAP), interacting with the type II regulatory subunit (RII) of protein kinase A (PKA) and associating to the mitochondria [37]. An Ala at position 185 in the α5 helix acts as an anchoring determinant and introduction of a phenylalanine, which is conserved in this position in most Rab family members, prevents binding to RII. Interestingly, TcRab32 possesses a phenylalanine (F) at the equivalent position (Fig. 4.2A; denoted by blue asteriks), and, as expected, GFP-TcRab32 does not co-localize with the mitocondrial marker Mitotracker (Fig. 4.4A), and neither GFP-TcRab32DP (Fig. 4.4B) nor GFP-

TcRab32DN (Fig. 4.4C) affects mitocondrial labeling.

Co-localization of GFP-TcRab32 with TcVP1 under osmotic stress

It has been reported that mammalian [38] and Xenopus [39] Rab32 partially localizes to melanosomes, which are LROs. We therefore investigated whether TcRab32 partially co- localizes with the acidocalcisome marker vacuolar proton pyrophosphatase (VP1) [40].

We did not observe any significant overlap between antibodies to TbVP1 and against

GFP-TcRab32 under isosmotic conditions (Fig. 4.5A). However, under hyposmotic conditions (Fig. 4.5B) we observed that TcVP1 staining overlaps with GFP staining at the

CVC region, in agreement with the reported fusion of these organelles under hyposmotic stress [5,33].

108

TcRab32DN mutants have a decreased content of PPi and polyP

Most PPi and polyP in trypanosomes are accumulated in acidocalcisomes [25,26]. It is not known whether PPi is taken up from the cytosol or synthesized inside acidocalcisomes while synthesis of polyP is through the activity of polyP kinases such as that formed by the vacuolar transporter chaperone (VTC) complex [41,42]. This is a complex of at least two subunits in trypanosomatids, VTC1 and VTC4, both localized to the membrane of acidocalcisomes and of which VTC4 is the catalytic subunit [41,42].

We hypothesized that if TcRab32 was important for the biogenesis of acidocalcisomes these organelles would have a reduced ability to synthesize these compounds and that was exactly the case. Expression of the dominant-negative form of TcRab32 (GFP-

TcRab32DN) led to a significant reduction in the levels of PPi (~50%) (4.6A) and short- chain polyP (~80%) (4.6B) in comparison to GFP and wild type Rab32 expressing epimastigotes. There was, however, no significant change in the expression of long chain polyP (>300 up to 700–800 phosphate units) (4.6C), suggesting that only the activity of

TcVTC complex, which is mainly involved in the synthesis of short-chain polyP [41,42], is affected in these mutants. The results were further verified by visualization of short chain poly P extracted from the above cell lines, resolved by Urea-PAGE and stained with toluidine blue (4.6D).

Changes in acidocalcisome electron-density and number in GFP-TcRab32DN mutants

In previous work [43,44], electron microscopy techniques were used to demonstrate that treatment of fixed trypanosomes with yeast pyrophosphatase resulted in loss of the electron-density of acidocalcisomes, as observed in whole unstained cells, suggesting that

109

PPi (complexed with cations) was the main electron dense material of these organelles. In agreement with the considerable decrease in PPi and short chain polyP content of GFP-

TcRab32DN mutants (Fig. 4.6), we detected by transmission electron microscopy on intact unstained GFP-TcRab32DN (DN) expressing epimastigotes the presence of empty vacuoles in comparison to wild type epimastigotes (WT) (Fig. 4.7A) and that there was a significant reduction in the number of acidocalcisomes per cell (B). 84% of these DN cells have acidocalcisomes that were not electron-dense (C) with an average of ~10 empty vacuole per cell expressing GFP-TcRab32DN (D).

Cells deficient in Rab32 display no defect in the traffic of trans-sialidase to the plasma membrane

To investigate whether TcRab32 affects traffic of trans-sialidase (TcTS) to the cell surface of trypomastigotes, or this is a process specific for TcRab11 [7], we infected Vero cells with metacyclic trypomastigotes from stationary cultures of GFP-TcRab32DN parasites and obtained cell culture-derived trypomastigotes. GFP-TcRab32DN trypomastigotes were used to infect fibroblasts and labeling of TcTS was detected by indirect immunofluorescence analysis using antibodies against the SAPA repeats of TcTS after a full cycle of differentiation into trypomastigotes. Traffic of trans-sialidase to the surface was not affected in TcRab32-DN trypomastigotes, further demonstrating that the

CVC-dependent trafficking pathway of trans-sialidase is specifically TcRab11-mediated

(Fig. 4.8).

GFP-TcRab32DN mutants have reduced growth and response to osmotic stress

The growth rate of the epimastigotes expressing GFP-TcRab32DN (DN) mutants was significanlty reduced as compared to that of control epimastigotes expressing GFP alone

110

(C) (Fig. 4.9A). Wild-type, GFP-TcRab32-overexpressing (GFP-TcRab32OE), GFP-

TcRab32DP, and GFP-TcRab32DN-expressing epimastigotes were submitted to hyposmotic stress and their regulatory volume decrease (RVD) measured using a light- scattering technique, as described previously [7]. This technique measures the changes in volume of the cells under hyposmotic (swelling and recovery) and hyperosmotic conditions (shrinking and partial recovery). After recovery the cells recuperate their normal morphology (Fig. 4.9B). DN mutants were less able to recover their volume after hyposmotic stress than wild type cells, while recovery was faster in GFP-TcRab32OE cells (OE). The response in TcRab32DP cells was similar to that of wild type cells. In addition, when submitted to hyperosmotic stress (Fig. 4.9C), DN mutants shrank less while GFP-TcRab32OE and GFP-TcRab32DP cells shrank more than control cells, and in all cases they did not recover their volume during the time of the experiment. It has been shown before that when epimastigotes are submitted to hyperosmotic stress the parasites do not regain their normal volume at least during the subsequent two hours [6].

TcRab32 is required for infection

To study the effect of reduced polyP, and PPi levels and the effect of reduced cell viability on the rate of invasion of the GFP-TcRab32DN mutants, we fully differentiated them into cell derived trypomastigotes as described under Materials and Methods.

Invasion was significantly reduced in GFP-TcRab32DN and GFP-TcRab32OE mutants as compared with controls transfected with GFP alone or with wild type parasites (Fig

4.10A and 4.10B). Cytosolic localization of GFP-TcRab32DN mutants was maintained when epimastigotes were differentiated into trypomastigotes and intracellular amastigotes

(Fig. 4.10C).

111

Discussion

We show here that expression of dominant-negative form of the GTPase TcRab32 results in alterations in the number and content of acidocalcisomes, and in deficient response to osmotic stress, growth in vitro, and invasion of host cells. The results suggest that the

CVC, where TcRab32 is located, is involved in trafficking membrane proteins involved in the synthesis/transport of phosphorus compounds to acidocalcisomes.

We reported before that GFP-tagged TcRab32 localizes to the CVC of epimastigotes of

T. cruzi [42]. We now confirm those observations using antibodies against the protein and found it distributed in the CVC of different stages of the life cycle of the parasite and with a punctate staining in epimastigotes and amastigotes. Mutants deficient in the prenylation motif and dominant negative GFP-TcRab32, however, have a cytosolic localization indicating that CVC localization is geranylgeranylation- and GTP-dependent.

Dominant negative TcRab32 mutants might be acting by blocking or reducing the function of endogenous TcRab32, by competing or sequestering Rab32 effector proteins.

TcRab32, like other Rab32 proteins, contains amino acid sequences that are shared with only a small number of other Rab sequences [45]. For example, threonine in the

WDTAGQE sequence (GTP binding site), which is conserved in almost all Rab proteins, is replaced by isoleucine. A similar replacement is found in Rab38, Rab29, and

Rab7L1/29 of mammalian cells, and in RabE from Dictyostelium discoideum [45], but there are no orthologs to any of these other Rabs in T. cruzi [46]. TcRab32 also possesses three amino acids, the Gly at amino acid position 75, Asn-76, and Val-80 that are only conserved in the switch II region of Rab32 and Rab38 alone and not of any of the other

58 Rabs of mammalian cells [47]. Val-80 is required for binding of mammalian Rab32 to

112 its effector VPS9-ankyrin-repeat protein/Ankrd27 (Varp) and this interaction is important for trafficking of tyrosinase-related protein to melanosomes [47]. In contrast, TcRab32 has a phenylalanine at amino acid position 194 instead of an alanine in mammalian

Rab32. This Ala is an anchoring determinant for regulatory subunit II (RII subunit) of protein kinase A and responsible for mammalian Rab32 interaction with mitochondria

[37]. In agreement with those studies we found that TcRab32 does not associate with mitochondria. Interestingly, other authors were also unable to confirm the association of human Rab32 with COS cells mitochondria [45]

Traffic of trans-sialidase to the plasma membrane of trypomastigotes is not affected in

GFP-TcRab32DN expressing parasites suggesting that the trafficking pathways of membrane proteins to the plasma membrane and acidocalcisomes are independent of each other.

Rab proteins participate in membrane trafficking events involving membrane fusion, fission, and motility. Although our data do not distinguish between these events, the localization of TcRab32 in the CVC and the deficient morphology and content of acidocalcisomes upon expression of its dominant-negative form suggests that the CVC acts equivalent to the recycling/early endosomes of mammalian cells where TcRab32 functions as tether facilitating cargo loading into fused vesicles [48]. The fusion of CVC with acidocalcisomes would facilitate exchange of membrane proteins between the organelles such as translocation of TcAQP1 from acidocalcisomes to the CVC [5] or of membrane enzymes/transporters involved in the synthesis of phosphorus compounds from the CVC to the acidocalcisomes. This model would be consistent with the known interaction between Rab32 effector proteins and VAMP7 [38,47], which is a vesicle

113

SNARE protein involved in vesicle fusion, and its known interaction with the delta subunit of adaptor complex-3 (AP-3) [49]. An ortholog to VAMP7 is present in the CVC of T. cruzi [14] and AP-3 is known to be involved in the biogenesis of acidocalcisomes

[31,32].

In conclusion, we propose that the CVC is a trafficking hub involved not only in the transfer of GPI-anchored proteins to the plasma membrane but also as a specialized endosomal system that can be used to deliver membrane proteins important for the biogenesis of acidocalcisomes.

Materials and Methods

Cell culture

Epimastigotes from T. cruzi were cultured in liver infusion tryptose (LIT) medium containing 10% newborn serum at 28°C. T. cruzi epimastigotes transfected with GFP-

TcRab32OE, GFP-TcRab32DN, GFP-TcRab32DP and GFP-TcRab32C241A/243A were maintained in the presence of 250 µg/ml geneticin (G418). Human foreskin fibroblasts

(HFF) were grown in DMEM Low Glucose medium supplemented with 10% Cosmic

Calf serum and 0.1% L-glutamine. Vero cells were grown in RPMI supplemented with

10% fetal bovine serum. L6E9 myoblasts were grown in DMEM High Glucose medium supplemented with 10% fetal bovine serum. Host cells were maintained at 37°C with 5%

CO2. Tissue culture cell-derived trypomastigotes were obtained from Vero cells infected with metacyclic trypomastigotes from stationary cultures of GFP-TcRab32OE and GFP-

TcRab32DN parasites. T. cruzi amastigote and trypomastigote forms were collected from the culture medium of infected host cells, using a modification of the method of Schmatz and Murray [50] as described previously [51].

114

Chemicals and reagents

Fetal bovine serum, newborn calf serum, Dulbecco’s phosphate buffer saline (PBS) and

Hank’s solution, 4’,6-diamidino-2-phenylindole (DAPI), DMEM and RPMI media, paraformaldehyde, bovine serum albumin, and protease inhibitors were purchased from

Sigma (St. Louis, MO). Restriction enzymes, were from New England BioLabs (Ipswich,

MA). pCR2.1-TOPO cloning kit, 1 kb plus DNA ladder, rabbit GFP antibodies and Gene

Tailor Site-Directed Mutagenesis System were from Invitrogen (Life Technologies,

Grand Island, NY). Hybond-N nylon membranes were obtained from PerkinElmer

(Waltham, MA). Pierce ECL Western blotting substrate and BCA Protein Assay Reagent was from Pierce (Thermo Fisher Scientific, Rockford, IL). All other reagents were analytical grade. The oligonucleotides were ordered from Sigma or IDT (Coralville, IA).

Vector pET32 Ek/LIC, Benzonase® Nuclease, anti-Histidine tag antibodies, and S- protein HRP conjugate were from Novagen (EMD Millipore, Billerica, MA). Farnesyl

Pyrophosphate, [1-3H(N)]-, Triammonium Salt, 1mCi (37MBq), Geranylgeranyl

Pyrophosphate, Triammonium Salt,[1-3H(N)]-, 50µCi (1.85MBq) and EN3HANCE were from Perkin Elmer.

In vitro infection assay

HFF or irradiated myoblasts (6 x 105 cells per well) were equally distributed in a 12-well plate on a sterile coverslip in their respective growth media (as mentioned above) and were incubated for 24 h at 37°C in a 5% CO2 atmosphere. The following day, the cells were washed once with Dulbecco’s Hank’s solution, and 6 x 106 wild type, TcGFP, GFP-

TcRab32OE, or GFP-TcRab32DN trypomastigotes were added to each well (10 trypomastigotes per myoblast or HFF), and they were incubated for 4 h at 37°C in a 5%

115

CO2 atmosphere. To decrease the chances of contamination of cell derived- trypomastigotes with extracellular amastigotes, collections of parasites were centrifuged and incubated at 37°C for 2 h to allow trypomastigotes to swim to the surface. The supernatant was collected and used for subsequent invasion assays. Next, the parasites were removed from the plate, and the infected cells were washed extensively with

Dulbecco’s Hank’s solution and fixed for immunofluorescence assays. For attachment/internalization assays, recently internalized parasites, and parasites caught in the process of invasion, were considered and manually counted in at least 200 DAPI- stained cells in 3 independent experiments. The percentage of infected cells and the average number of parasites per infected cell were determined.

Immunofluorescence and western blot analyses

To determine if there are domains of contact between TcRab32 with the mitochondria in

T. cruzi epimastigotes, live cells were labelled for 30 min with Mitotracker Red CMXRos

(Invitrogen) at 50 nM in LIT medium and then fixed and processed for immunofluorescence. For immunofluorescence microscopy, parasites were fixed in PBS, pH 7.4, with 4% paraformaldehyde, adhered to poly-lysine coverslips, and permeabilized for 3 min with PBS, pH 7.4, containing 0.3% Triton X-100. Permeabilized cells were quenched for 30 min at room temperature with 50 mM NH4Cl and blocked overnight with 3% BSA in PBS, pH 8.0. Both primary and secondary antibodies were incubated for

1 h at room temperature. Coverslips were mounted by using a mounting medium containing DAPI at 5 µg/ml for staining DNA-containing organelles. For imaging of intracellular parasites, mammalian cells were seeded onto sterile coverslips in 12-well culture plates and allowed to grow for 24 h. To semi-synchronize the infection, we added

116 the parasites at a ratio of 10:1 (parasite/host cell) for 4 hours, washed the cells to eliminate extracellular parasites and fixed in cold methanol for 30 min. The dilution used for primary antibodies were as follows: mouse anti-Rab32 (1:200), rabbit polyclonal anti-

GFP (1:500); rabbit anti-TcTS (1:2000), polyclonal rabbit anti-TbVP1 (1:250) [40].

Differential interference contrast (DIC) and direct fluorescence images were obtained by using an Olympus IX-71 inverted fluorescence microscope with a Photometrix

CoolSnapHQ charge-coupled device camera driven by Delta Vision softWoRx3.5.1

(Applied Precision, Issaquah, WA). Images were deconvolved for 10 cycles using the same software and applying the “noise filter” at “medium” mode. This is an automatic deconvolution software and was applied to all channels; brightness and contrast were the same in all channels. The figures were built by using Adobe Photoshop 10.0.1 (Adobe

System, Inc., San Jose, CA).

Generation of TcRab32 dominant negative, dominant positive and prenylation- motif mutant and transfection

Dominant negative (GFP-TcRab32T24N), dominant positive (GFP-TcRab32Q71L) and prenylation-motif mutant (GFP-TcRab32C241A/243A) forms of TcRab32 were constructed via site directed mutagenesis by the use of Gene Tailor Site-Directed

Mutagenesis System. This method involved methylating the TOPO blunt end vector containing the coding sequence for TcRab32 with DNA methylase at 37°C for 1 hour, followed by amplification of the plasmid in a mutagenesis reaction with two overlapping primers, of which the forward primer had the target mutation, resulting in the mutation of amino acid threonine to asparagine (dominant negative), glutamine to leucine (dominant positive), or Cysteine to Alanine (prenylation-motif mutant). Mutations were confirmed

117 by sequencing (Yale DNA Analysis Facility, Yale University, New Haven, Connecticut).

After transformation the resulting in TOPO was digested with restriction enzymes BamHI and HindIII. The circular pTEX-N-GFP vector was linearized by the corresponding restriction enzymes. Finally, TcRab32T24N, TcRab32Q71L and

TcRab32C241A/243A inserts were ligated to pTEX-N-GFP followed by transformation.

The plasmid pTEX-GFPTcRab32T24N/Q71L/C241A/243A were sequenced to confirm that the correct reading frame was used. T. cruzi Y strain epimastigotes were transfected in cytomix (120 mM KCl, 0.15 mM CaCl2, 10 mM K2HPO4, 2 mM EDTA, 5 mM

MgCl2, pH 7.6) containing 50 μg of the plasmid construct in a 4 mm cuvette. The cuvette was cooled on ice for 10 min and pulsed 3 times (1.5 kV, 25 μF) with a Gene Pulser

Xcell™ (Bio-Rad), and expression of GFP-fusion proteins was verified by western blot analyses. Stable cell lines were established under drug selection with G418 at 250 μg/ml.

Enrichment of GFP fluorescent parasites was performed with a high-speed cell sorter when needed (MoFlo Legacy; Beckman-Coulter, Hialeah, FL).

Cell volume measurements

T. cruzi epimastigotes (GFP-TcRab32OE, GFP-TcRab32DN, GFP-TcRab32DP and wild- type) at log phase of growth (3 days) were collected at 1,600 g for 10 min (at a density of

1 x 108/ml) and volume measurement experiments after stress were done exactly as described in [7].

Recombinant protein expression, purification and antibody generation

DNA sequence corresponding to the entire open reading frame of TcRab32 was PCR- amplified from T. cruzi Y strain gDNA

(Forward primer: 5' GACGACGACAAGATGTCATACTCGAA -3', Reverse primer:

118

5' GAGGAGAAGCCCGGTTTAACAGGAGCAGCCCGAC-3') and ligation- independent cloned into vector pET32 Ek/LIC for heterologous expression in bacteria.

The sequence of several recombinant clones was verified and they were transformed by heat shock into E. coli BL21 Codon Plus (DE3)-RIPL chemically competent cells.

Expression of recombinant protein was obtained by induction in 0.5 mM isopropyl-β-

Dthiogalactopyranoside (IPTG) in LB broth overnight at 37° C. His-tagged recombinant protein was purified under denaturing conditions with His-Bind cartridges (Novagen).

Recombinant TcRab32 was used as immunogen for production of polyclonal antibody in mice. This antibody was generated at the Monoclonal Antibody Facility of the College of

Veterinary Medicine, University of Georgia (Athens, GA).

In-vitro prenylation

In vitro prenylation reactions were done as described in [52] and [53] with minor modifications. A total of 2 µCi of [3H] FPP or [3H] GGPP was used as isoprenoid donors. The assay reaction was carried out at 30°C for 30 min, 1 hour and 3 hour and 30 min was the optimum reaction time for this assay and resolved by SDS–10% PAGE. The gel was incubated in En3Hance, dried, and exposed to film at -80°C for 2 weeks.

Short chain and long chain polyphosphate quantification

Cells (2 x 108) in log phase were harvested and washed twice with buffer A. The PPi and short-chain polyP were extracted using 0.5 M perchloric acid (HClO4) [54], and the long- chain polyP was extracted using glass milk (Molecular Probes) as described [55]. PPi level was determined by the amount of Pi released upon treatment with an excess of

Saccharomyces cerevisiae inorganic pyrophosphatase (catalog no. I-1891, Sigma). The free Pi (released) amount was determined by using a standard curve. Briefly, the

119 enzymatic reaction was performed on 96-well plates with 50 mM Tris-HCl (pH 7.4), 6 mM MgCl2, inorganic pyrophosphatase, and extracted PPi samples at a final volume of

100µl. After incubation at 30 °C for 10 min, the reaction was immediately stopped by the addition of an equal amount of the fresh mixture of 3 parts of 0.045% malachite green with 1 part of 4.2% ammonium molybdate (Sigma), which was filtered prior to use. The absorbance at 660 nm was read using a SpectraMax M2e plate reader (Molecular

Devices, Sunnyvale, CA).

Short-chain and long-chain polyP levels were determined by the amount of Pi released upon treatment with an excess of the purified recombinant exopolyphosphatase of S. cerevisiae (rScPPX1) freshly purified in our laboratory (Ruiz et al., 2001).

Short chain PolyP extracted from 5 x 108 cells were mixed with 6X Dye (0.01% Orange

G; 30% glycerol; 10 mM TrisHCl pH 7.4; 1 mM EDTA) and resolved on 20% TBE

PAGE. Samples were run at 600 V 6 mA overnight at 4°C until the Orange G had run through 2/3 of the gel. Gels were stained with 0.1% Toluidine blue.

Transmission electron microscopy

For imaging whole epimastigote forms, cells were washed with filtered buffer A [116 mM NaCl, 5.4 mM KCl, 0.8 mM MgSO4, 50 mM Hepes (pH 7.2) and 5.5 mM glucose] twice, and directly applied to Formvar-coated copper grids, allowed to adhere for 10 min, carefully blotted dry, and observed in JEM-1210 electron microscope operating at 80 kV.

Whole unfixed epimastigotes of wild type and TcRab32DN were randomly selected and the number of acidocalcisome per cell was counted in 50 cells from 2 different preparations.

120

Cell growth measurement

Measured optical density at 600 nm as a measure of concentration of epimastigotes in suspensión in the Gilford spectrophotometer with a starting culture of 4.5 x 106 epimastigotes and monitored cell density for the next 7 days.

121

REFERENCES

1. Clark TB (1959) Comparative morphology of four genera of trypanosomatidae. J Protozool 6: 227-232. 2. Figarella K, Uzcategui NL, Zhou Y, LeFurgey A, Ouellette M, et al. (2007) Biochemical characterization of Leishmania major aquaglyceroporin LmAQP1: possible role in volume regulation and osmotaxis. Molecular microbiology 65: 1006-1017. 3. Linder JC, Staehelin LA (1979) A novel model for fluid secretion by the trypanosomatid contractile vacuole apparatus. The Journal of cell biology 83: 371-382. 4. Baqui MM, De Moraes N, Milder RV, Pudles J (2000) A giant phosphoprotein localized at the spongiome region of Crithidia luciliae thermophila. The Journal of eukaryotic microbiology 47: 532-537. 5. Rohloff P, Montalvetti A, Docampo R (2004) Acidocalcisomes and the contractile vacuole complex are involved in osmoregulation in Trypanosoma cruzi. The Journal of biological chemistry 279: 52270-52281. 6. Li ZH, Alvarez VE, De Gaudenzi JG, Sant'Anna C, Frasch AC, et al. (2011) Hyperosmotic stress induces aquaporin-dependent cell shrinkage, polyphosphate synthesis, amino acid accumulation, and global gene expression changes in Trypanosoma cruzi. The Journal of biological chemistry 286: 43959-43971. 7. Niyogi S, Mucci J, Campetella O, Docampo R (2014) Rab11 Regulates Trafficking of Trans-sialidase to the Plasma Membrane through the Contractile Vacuole Complex of Trypanosoma cruzi. PLoS Pathog 10: e1004224. 8. Hasne MP, Coppens I, Soysa R, Ullman B (2010) A high-affinity putrescine- cadaverine transporter from Trypanosoma cruzi. Molecular microbiology 76: 78- 91.

122

9. Sesaki H, Wong EF, Siu CH (1997) The cell adhesion molecule DdCAD-1 in Dictyostelium is targeted to the cell surface by a nonclassical transport pathway involving contractile vacuoles. The Journal of cell biology 138: 939-951. 10. Sriskanthadevan S, Lee T, Lin Z, Yang D, Siu CH (2009) Cell adhesion molecule DdCAD-1 is imported into contractile vacuoles by membrane invagination in a Ca2+- and conformation-dependent manner. The Journal of biological chemistry 284: 36377-36386. 11. Heuser J, Zhu Q, Clarke M (1993) Proton pumps populate the contractile vacuoles of Dictyostelium amoebae. The Journal of cell biology 121: 1311-1327. 12. Moniakis J, Coukell MB, Janiec A (1999) Involvement of the Ca2+-ATPase PAT1 and the contractile vacuole in calcium regulation in Dictyostelium discoideum. Journal of cell science 112 ( Pt 3): 405-414. 13. Jeffries TR, Morgan GW, Field MC (2001) A developmentally regulated rab11 homologue in Trypanosoma brucei is involved in recycling processes. Journal of cell science 114: 2617-2626. 14. Ulrich PN, Jimenez V, Park M, Martins VP, Atwood J, 3rd, et al. (2011) Identification of contractile vacuole proteins in Trypanosoma cruzi. PloS one 6: e18013. 15. Harris E, Yoshida K, Cardelli J, Bush J (2001) Rab11-like GTPase associates with and regulates the structure and function of the contractile vacuole system in dictyostelium. Journal of cell science 114: 3035-3045. 16. Docampo R, Jimenez V, Lander N, Li ZH, Niyogi S (2013) New insights into roles of acidocalcisomes and contractile vacuole complex in osmoregulation in protists. International review of cell and molecular biology 305: 69-113. 17. Zerial M, McBride H (2001) Rab proteins as membrane organizers. Nat Rev Mol Cell Biol 2: 107-117. 18. Pfeffer SR (2001) Rab GTPases: specifying and deciphering organelle identity and function. Trends Cell Biol 11: 487-491. 19. Munro S (2002) Organelle identity and the targeting of peripheral membrane proteins. Curr Opin Cell Biol 14: 506-514.

123

20. Seabra MC, Wasmeier C (2004) Controlling the location and activation of Rab GTPases. Curr Opin Cell Biol 16: 451-457. 21. Bultema JJ, Ambrosio AL, Burek CL, Di Pietro SM (2012) BLOC-2, AP-3, and AP-1 proteins function in concert with Rab38 and Rab32 proteins to mediate protein trafficking to lysosome-related organelles. J Biol Chem 287: 19550-19563. 22. Raposo G, Marks MS (2007) Melanosomes--dark organelles enlighten endosomal membrane transport. Nat Rev Mol Cell Biol 8: 786-797. 23. Delevoye C, Hurbain I, Tenza D, Sibarita JB, Uzan-Gafsou S, et al. (2009) AP-1 and KIF13A coordinate endosomal sorting and positioning during melanosome biogenesis. The Journal of cell biology 187: 247-264. 24. Docampo R, Scott DA, Vercesi AE, Moreno SN (1995) Intracellular Ca2+ storage in acidocalcisomes of Trypanosoma cruzi. The Biochemical journal 310 ( Pt 3): 1005-1012. 25. Docampo R, de Souza W, Miranda K, Rohloff P, Moreno SN (2005) Acidocalcisomes - conserved from bacteria to man. Nature reviews Microbiology 3: 251-261. 26. Docampo R, Moreno SN (2011) Acidocalcisomes. Cell calcium 50: 113-119. 27. Ruiz FA, Lea CR, Oldfield E, Docampo R (2004) Human platelet dense granules contain polyphosphate and are similar to acidocalcisomes of bacteria and unicellular eukaryotes. The Journal of biological chemistry 279: 44250-44257. 28. Smith SA, Mutch NJ, Baskar D, Rohloff P, Docampo R, et al. (2006) Polyphosphate modulates blood coagulation and fibrinolysis. Proceedings of the National Academy of Sciences of the United States of America 103: 903-908. 29. Moreno-Sanchez D, Hernandez-Ruiz L, Ruiz FA, Docampo R (2012) Polyphosphate is a novel pro-inflammatory regulator of mast cells and is located in acidocalcisomes. The Journal of biological chemistry 287: 28435-28444. 30. Theos AC, Tenza D, Martina JA, Hurbain I, Peden AA, et al. (2005) Functions of adaptor protein (AP)-3 and AP-1 in tyrosinase sorting from endosomes to melanosomes. Mol Biol Cell 16: 5356-5372.

124

31. Besteiro S, Tonn D, Tetley L, Coombs GH, Mottram JC (2008) The AP3 adaptor is involved in the transport of membrane proteins to acidocalcisomes of Leishmania. Journal of cell science 121: 561-570. 32. Huang G, Fang J, Sant'Anna C, Li ZH, Wellems DL, et al. (2011) Adaptor protein-3 (AP-3) complex mediates the biogenesis of acidocalcisomes and is essential for growth and virulence of Trypanosoma brucei. The Journal of biological chemistry 286: 36619-36630. 33. Montalvetti A, Rohloff P, Docampo R (2004) A functional aquaporin co-localizes with the vacuolar proton pyrophosphatase to acidocalcisomes and the contractile vacuole complex of Trypanosoma cruzi. The Journal of biological chemistry 279: 38673-38682. 34. Marchesini N, Ruiz FA, Vieira M, Docampo R (2002) Acidocalcisomes are functionally linked to the contractile vacuole of Dictyostelium discoideum. The Journal of biological chemistry 277: 8146-8153. 35. Jean S, Kiger AA (2012) Coordination between RAB GTPase and phosphoinositide regulation and functions. Nat Rev Mol Cell Biol 13: 463-470. 36. Yokoyama K, Gillespie JR, Van Voorhis WC, Buckner FS, Gelb MH (2008) Protein geranylgeranyltransferase-I of Trypanosoma cruzi. Mol Biochem Parasitol 157: 32-43. 37. Alto NM, Soderling J, Scott JD (2002) Rab32 is an A-kinase anchoring protein and participates in mitochondrial dynamics. J Cell Biol 158: 659-668. 38. Tamura K, Ohbayashi N, Maruta Y, Kanno E, Itoh T, et al. (2009) Varp is a novel Rab32/38-binding protein that regulates Tyrp1 trafficking in melanocytes. Mol Biol Cell 20: 2900-2908. 39. Park M, Serpinskaya AS, Papalopulu N, Gelfand VI (2007) Rab32 regulates melanosome transport in Xenopus melanophores by protein kinase a recruitment. Current biology : CB 17: 2030-2034. 40. Rodrigues CO, Scott DA, Docampo R (1999) Characterization of a vacuolar pyrophosphatase in Trypanosoma brucei and its localization to acidocalcisomes. Mol Cell Biol 19: 7712-7723.

125

41. Lander N, Ulrich PN, Docampo R (2013) Trypanosoma brucei vacuolar transporter chaperone 4 (TbVtc4) is an acidocalcisome required for in vivo infection. The Journal of biological chemistry 288: 34205-34216. 42. Ulrich PN, Lander N, Kurup SP, Reiss L, Brewer J, et al. (2014) The acidocalcisome vacuolar transporter chaperone 4 catalyzes the synthesis of polyphosphate in insect-stages of Trypanosoma brucei and T. cruzi. The Journal of eukaryotic microbiology 61: 155-165. 43. Urbina JA, Moreno B, Vierkotter S, Oldfield E, Payares G, et al. (1999) Trypanosoma cruzi contains major pyrophosphate stores, and its growth in vitro and in vivo is blocked by pyrophosphate analogs. The Journal of biological chemistry 274: 33609-33615. 44. Mendoza M, Mijares A, Rojas H, Rodriguez JP, Urbina JA, et al. (2002) Physiological and morphological evidences for the presence acidocalcisomes in Trypanosoma evansi: single cell fluorescence and 31P NMR studies. Mol Biochem Parasitol 125: 23-33. 45. Hirota Y, Tanaka Y (2009) A small GTPase, human Rab32, is required for the formation of autophagic vacuoles under basal conditions. Cell Mol Life Sci 66: 2913-2932. 46. Berriman M, Ghedin E, Hertz-Fowler C, Blandin G, Renauld H, et al. (2005) The genome of the African trypanosome Trypanosoma brucei. Science 309: 416-422. 47. Tamura K, Ohbayashi N, Ishibashi K, Fukuda M (2011) Structure-function analysis of VPS9-ankyrin-repeat protein (Varp) in the trafficking of tyrosinase-related protein 1 in melanocytes. J Biol Chem 286: 7507-7521. 48. Bultema JJ, Di Pietro SM (2013) Cell type-specific Rab32 and Rab38 cooperate with the ubiquitous lysosome biogenesis machinery to synthesize specialized lysosome-related organelles. Small GTPases 4: 16-21. 49. Martinez-Arca S, Rudge R, Vacca M, Raposo G, Camonis J, et al. (2003) A dual mechanism controlling the localization and function of exocytic v-SNAREs. Proc Natl Acad Sci U S A 100: 9011-9016.

126

50. Schmatz DM, Murray PK (1982) Cultivation of Trypanosoma cruzi in irradiated muscle cells: improved synchronization and enhanced trypomastigote production. Parasitology 85 (Pt 1): 115-125. 51. Moreno SN, Silva J, Vercesi AE, Docampo R (1994) Cytosolic-free calcium elevation in Trypanosoma cruzi is required for cell invasion. J Exp Med 180: 1535-1540. 52. Cuevas IC, Rohloff P, Sanchez DO, Docampo R (2005) Characterization of farnesylated protein tyrosine phosphatase TcPRL-1 from Trypanosoma cruzi. Eukaryot Cell 4: 1550-1561. 53. Nepomuceno-Silva JL, Yokoyama K, de Mello LD, Mendonca SM, Paixao JC, et al. (2001) TcRho1, a farnesylated Rho family homologue from Trypanosoma cruzi: cloning, trans-splicing, and prenylation studies. J Biol Chem 276: 29711-29718. 54. Ruiz FA, Rodrigues CO, Docampo R (2001) Rapid changes in polyphosphate content within acidocalcisomes in response to cell growth, differentiation, and environmental stress in Trypanosoma cruzi. J Biol Chem 276: 26114-26121. 55. Ault-Riche D, Fraley CD, Tzeng CM, Kornberg A (1998) Novel assay reveals multiple pathways regulating stress-induced accumulations of inorganic polyphosphate in Escherichia coli. J Bacteriol 180: 1841-1847.

127

FIGURES

Figure 4.1 TcRab32 localization in different life stages of T. cruzi. (A) Eluted and desalted fractions (E1 to E9) obtained during recombinant TcRab32 purification from

E.coli as analyzed by SDS PAGE showing a band of correct size (42 KDa) corresponding to the His-tagged protein. The 10% SDS PAGE gel was stained with Coommassie blue.

128

(B-D) TcRab32 was detected in the contractile vacuole bladder of epimastigotes (Epi), trypomastigotes (Trypo), and intracellular amastigotes (Ama) with additional punctated staining using specific antibodies against TcRab32 raised in mouse. (E) Western blot analyses with TcRab32 antibody of lysates of wild-type trypomastigotes (T), amastigotes

(A) and epimastigotes (E), showing bands (arrows) corresponding to the endogenous

TcRab32 (26 kDa). The blots were sequentially probed with anti-tubulin antibodies, used as loading control.

129

Figure 4.2 TcRab32 is digeranylated in vitro. (A) Comparison of the deduced amino acid sequence of T. cruzi Rab32 with human Rab32. The presence of the “WDIAGQE” and C terminal “CSC” domain is boxed in red and the presence of phenylalanine “F” at position 194 is denoted in blue asterisk. (B)Radiolabelled proteins were analyzed by

SDS-PAGE on a 15% gel followed by autoradiography. Lane 1 in the presence of all reactants; rTcRab32, epimastigote extract and (3H) GGPP, lanes 2 and 3 are negative

130 controls. Enzymatic assay performed for 30 min. A radioactive band of 42 KDa was observed corresponding to the His-tagged protein.

Figure 4.3 Localization of GFP-TcRab32 mutants. GFP-TcRab32 prenylation-motif mutants have a cytosolic localization. GFP-TcRab32DN mutants which mimic the GDP- bound state of the protein have a punctated cytosolic localization. GFP-TcRab32DP mutants that mimic the GTP-bound state of the proteins localize mainly to the membrane of the CVC.

131

Figure 4.4 Lack of colocalization between GFP-TcRab32 and mitochondrial marker and localization of mitochondrial marker is not affected in TcRab32 mutants. (A)

There is no colocalization between mitotracker (red) with GFP-TcRab32, as detected with antibodies against GFP (green). Mitotracker (red) labels the mitochondria in GFP-

TcRab32 DP (B) and GFP-TcRab32DN (C) epimastigotes. Labeling of the GFP-

TcRab32DP and GFP-TcRab32DN was detected with anti-GFP (green).

132

Figure 4.5 Colocalization of GFP-TcRab32 and VP1 under osmotic stress. (A) There is no colocalization between TbVP1 (red) with GFP-TcRab32 as detected with antibodies against GFP (green) under isosmotic conditions. (B) Overlap between signals for TcVP1

(red) and GFP-TcRab32 (green) in the CVC occur under hyposmotic stress conditions.

133

Figure 4.6 Reduced short chain poly P and PPi levels in TcRab32DN epimastigotes in comparison to wild type epimastigotes. Extracts from TcRab32DN epimastigotes

(DN) showed a 50% reduction in (A) PPi levels and an 80% reduction in (B) short chain poly P levels with no significant changes in (C) long chain poly P levels in comparison to

GFP (C) and TcRab32 (OE) epimastigotes. TcRab32OE epimastigotes (OE) have levels

134 of PPi and short chain poly P slightly more than control epimastigotes. Values are means

± SD of three different experiments. *Differences are statistically significant as compared to respective controls, p < 0.05 (Student’s t test). (D) Extracts of short chain PolyP produced by OE, GFP and DN resolved by Urea PAGE and visualized by toluidine blue.

ORG represents migration of orange G dye. Levels of short chain poly P lower in lanes labelled DN in comparison to lanes labelled OE and C.

Figure 4.7 Reduction in electron dense acidocalcisomes and considerable increase in empty vacuole in TcRab32DN epimastigotes in comparison to wild type. (A)

Transmission electron microscopy (TEM) image from whole unstained and unfixed

TcRab32DN epimastigotes (DN) show the presence of numerous empty vacuoles with complete loss of electron density of acidocalcisomes in comparison to wild type (WT)

135 epimastigotes. Scale bars, 2 µm (B) The number of acidocalcisomes per cell were counted in 70 random cells from 2 independent experiments and the numeric distribution of acidocalcisomes showed that majority of TcRab32DN epimastigotes had <10 or between 11-20 electron-dense acidocalcisomes. (C and D) In order to quantitate the phenotype of empty vacuoles we counted 50 random parasites in WT and DN after TEM and found that there is a significant increase in parasites with empty vacuoles in DN w.r.t

WT. * indicates differences are statistically significant compared with respective controls, p<0.05.

Figure 4.8 Traffic of trans-sialidase is not affected in TcRab32DN mutant trypomastigotes. GFP-TcRab32 DN mutants show a punctated cytosolic localization as

136 detected with anti-GFP (green), while antibodies against TcTS still localize to the surface.

160000000

140000000 C 120000000

100000000 DN 80000000

60000000

40000000

20000000 CELL DENSITY/ml CELL 0

0 2 4 6 8 10

TIME (DAYS)

Figure 4.9 Effect of TcRab32 mutations on the cell growth of epimastigotes and their response to hyposmotic and hyperosmotic stress conditions. (A) Growth rate of of epimastigotes expressing the dominant negative (DN) TcRab32 in comparison to GFP-

137 expressing (C) epimastigotes. (B) Cells were pre-incubated in isosmotic buffer for 3 min and then subjected to hyposmotic (final osmolarity = 150 mOsm) (C) or hyperosmotic

(final osmolarity = 650 mOsm) stress. Relative change in cell volume was followed by monitoring absorbance at 550 nm by light scattering. As compared to wild-type cells

(WT), cells expressing GFPTcRab32DN (DN) failed to fully recover their volume after hyposmotic stress and shrank less after hyperosmotic stress, while cells overexpressing

GFP-TcRab32 (OE) recovered their volume faster after hyposmotic stress and shrank more after hyperosmotic stress. The response of the GFPTcRab32DP (DP) was very similar to the wild-type cells. Values are means ± SD of three different experiments.

Asterisks indicate statistically significant differences, p<0.05, (Bonferroni’s multiple comparison ‘‘a posteriori’’ test of one-way ANOVA) at all time points after induction of osmotic stress.

Figure 4.10 Reduced infectivity of TcRab32 mutant trypomastigotes. (A and B)

Effect of TcRab32 overexpression (OE) or mutation (DN) on in vitro invasion by

138 trypomastigotes on host cell in comparison with control; wild type trypomastigotes (WT) and GFP-expressing trypomastigotes (GFP). Values are mean ±SD (n = 3). * indicate that differences are statistically significant compared with respective controls, p<0.05

(Ordinary one way ANOVA with Bonferroni post-test). (C) Punctated cytosolic localization of GFP-TcRab32DN trypomastigotes and amastigotes as detected using antibodies against GFP. DNA was stained with DAPI. Bars = 10 µm.

139

CHAPTER 5

CONCLUSION

Summary of key findings

At the beginning of my thesis work the role of the contractile vacuole complex (CVC) in osmoregulation was well established in T. cruzi. As T. cruzi is exposed to different host environments, the need for osmoregulation is critical in these parasites. Work from this laboratory has shown the role of CVC not only in regulating volume under conditions of hyposmotic stress [1], but also in shrinking of the parasites, under hyperosmotic stress

[2]. I got interested in studying the role of two Rab proteins: Rab11 (published in [3] and

Rab32 which were identified in a proteomic study of the CVC [4]. This study revealed the presence of a cohort of proteins which usually have function in regulation of intracellular traffic, vesicle fusion and protein secretion. Only a few Rab proteins:

TcRab7, TcRab5, and TcRab4 had been studied in T. cruzi, and molecular events of vesicle trafficking were still poorly understood [5] [6] [7]. Although the localization of some of these Rabs has been demonstrated, there was no functional study conducted with them. Our study provides the first experimental evidence of the mechanistic role of two

Rab GTPases in T. cruzi: TcRab11 and TcRab32.

Mutation of Rab proteins has been of major value in determining the physiological role of

Rabs in other cell systems. The approach is based upon the ability to make GTP- and

GDP-locked forms of the proteins, with dominant positive and negative effects,

140 respectively, over the endogenous Rab protein. We applied this same approach for studying TcRab32 and TcRab11.

Results with the dominant negative TcRab11 (TcRab11DN) were clear: there was a defect in osmoregulation in the Rab11 mutant parasites suggesting that volume regulation requires Rab11-dependent processes, such as membrane fusion. There was also a defect in traffic of GPI-anchored trans-sialidase to the surface and as a result, an inability to invade host cells properly in comparison to wild type parasites. Proper trafficking of surface proteins is important for evading host immune defenses and to support host invasion. The observed phenotype of perturbation in traffic was not a side effect of mutating a contractile vacuole complex resident protein as the morphology of the CVC was not affected in the mutant parasites. The observed phenotype was specific for the traffic of trans-sialidase because the membrane traffic of other proteins (both GPI- and non GPI-anchored) was not affected at all. The traffic of trans-sialidase was also unaffected in the Rab32 mutant trypomastigotes, further suggesting the uniqueness of each of these Rab proteins. Our study provides support for a role of the CVC as a trafficking hub in addition to its role in osmoregulation. TcRab11 is developmentally regulated and our results show that it has specific roles in different life cycle stages of T. cruzi, suggesting different requirements of the protein for survival in the insect and mammalian host.

The hypothesis that the CVC is a trafficking hub and an equivalent to early/recycling endosomes of other eukaryotes was additionally supported by the phenotypic changes occurring after mutation of the CVC-located TcRab32. Acidocalcisomes were less numerous and electron-dense, and deficient in PPi and polyP, suggesting a deficient

141 traffic of proteins involved in the biogenesis of these organelles. This phenotype suggested the traffic of proteins from the CVC to the acidocalcisomes. This ultimately resulted in a reduced ability of these parasites to invade host cells.

The purpose of my thesis was two-fold: to investigate the function of the CVC as a trafficking hub and to provide a detailed analysis of the roles of TcRab11 and TcRab32 in this process. The CVC is a fascinating complex product of . Much remains to be studied about how this organelle evolved. It is clear that this organelle is central to parasite growth, development and pathogenesis.

Future work

Does the Contractile Vacuole Complex (CVC) in T. cruzi have a role in calcium homeostasis?

A role of the CVC in calcium homeostasis has been proposed in the amoeba D. discoideum and in Paramecium tetraurelia on the basis of the presence in these organelles of different calcium transporters, such as a Ca2+-ATPase [8,9] and an inositol

2+ 1,4,5-trisphosphate receptor (IP3R) [10]. Ca -ATPase PAT1, usually present in the membrane of the CVC moves to the plasma membrane when cells are incubated at high

Ca2+ concentrations. The contractile vacuole membranes in Dictyostelium are also extremely rich in calmodulin [11]. The identification of peptides corresponding to a calcium channel (Tc00.1047053504105.130) and an IP3/ryanodine receptor

(Tc00.1047053509461.90) in subcellular fractions of T. cruzi enriched in the CVC implies that the CVC could have a possible role in Ca2+ signaling. Besides, fusion events may require a local calcium signal, as Ca2+ controls priming steps and prepares vesicles for fusion [12].

142

The role of the CVC as a trafficking hub remains to be fully characterized

The presence of SNAREs, such as SNARE2.1 (TcCLB.507625.183), SNARE2.2

(TcCLB.53506715.50), and VAMP1 (TcCLB.53511627.60) in the proteomic data of T. cruzi CVC and their localization to the CVC, suggests the existence of several membrane to membrane interactions that facilitate vesicle docking for subsequent fusion. The vesicle associated membrane proteins (VAMPs) belong to the R-SNAREs group.

Paramecium tetraurelia RSNARE PtSyb2-2 has been shown to localize to the entire contractile vacuole complex [13], and its orthologue in T. cruzi (VAMP1,

TcCLB.53511627.60) was detected in the CV bladder of epimastigotes submitted to hyposmotic stress. This could be indicative of a possible role of these contractile vacuole complex-localized SNAREs in fusion/fision events between the bladder and the spongiome or between the CVC and acidocalcisomes during swelling or collapse of the

CVC. In this regard, a study in Dictyostelium found that there is an interaction between adaptor protein AP180 (present in clathrin-coated vesicles on contractile vacuole bladders) and the contractile vacuole-localized SNARE, Vamp7, especially during fusion events of the CVC [14]. Orthologues of both AP180 (TcCLB.53503449.30) and VAMP7

(TcCLB.53511627.60) are present in the CVC of T. cruzi. All this reflects that a multitude of vesicle fusion and membrane interaction events probably exists in the CVC of T. cruzi.

To identify the interaction partners of TcRab32 and the study of their cell-type specific regulation

Presently we are immunoprecipitating proteins from the GFP-TcRab32-expressing cell line and doing mass spectrometric analysis to identify potential interaction partners of

143

TcRab32. Candidates of interest are VAMP7 and AP-3, which were identified in other eukaryotes as interaction partners for Rab32 [15]. VAMP7, which is a vesicle SNARE protein, is highly conserved across eukaryotes and the identification of an interaction between CVC-resident TcRab32 and VAMP7 in T. cruzi would further suggest a link between higher and lower eukaryotes. The delta subunit of the AP-3 complex, whose role in acidocalcisome biogenesis has been studied by our lab [16], is found to interact with

VAMP7 and direct its traffic along the endocytic pathway in mammalian cells. A possible interaction between TcRab32, VAMP7 and AP-3 might serve as a pre-requisite for the correct traffic of cargo to acidocalcisomes.

Precise regulation of Rab-GTPases requires activity and binding with Rab GAP (GTPase

Activating Protein), Rab GEF (guanine nucleotide exchange factor) and Rab GDI

(guanosine nucleotide dissociation inhibitor). Rab GEFs or Rab GAPs are activated at the right place and time. It is probable that the CVC-resident TcRab32 gets recruited at domains of endosomes. The failure to detect TcRab32 in the acidocalcisome membrane could be attributed to sensitivity issues of the immunofluorescence technique used in our experiments; or it can be that TcRab32 remain bound to vesicles (corresponding to the punctate staining detected) but they do not fuse with the acidocalcisomes. Understanding how the sequential activation of Rab GTPases is achieved during vesicle trafficking is a central question in the study of the cell biology of these parasites.

Possible changes in the acidocalcisome proteome in the Rab32 mutant parasites?

Experiments can be conducted to demonstrate the direct effect of TcRab32 mutation in these parasites and its effect (direct or indirect) on the membrane composition of the acidocalcisome. As the TcRab32DN parasites suffer a loss in the level of short chain

144 polyP (~80% reduction), without any change in long chain polyP it seems that the

TcVTC complex (Vacuolar Transporter Chaperone Complex), which is mainly involved in the synthesis of short chain polyP [17,18] is affected. The use of antibodies against components of the VTC complex will be appropriate to investigate if there is a loss or reduction in any of the components. An alternative will be to do proteomic analysis of acidocalcisomes of TcRab32 mutant parasites to study whether there is an altered content of membrane proteins. A detailed analysis has to be made while interpreting the data with appropriate controls to minimize false positive data and to subtract background. These data are often biased against proteins that are expressed in low abundance.

To investigate how cargo destined to the acidocalcisome is sorted out from lysosomal cargo

The acidocalcisome is a lysosome-related organelle (LRO) whose biogenesis is apparently dependent on protein sorting from the Golgi [19]. How cargo destined for the acidocalcisome is sorted from the lysosomal cargo at the trans-Golgi should be an interesting area to explore further. Most of the LROs coexist with conventional lysosomes as distinct organelles in the same cells [20]. What is the signal that avoids their undesirable fusion with lysosomes? Lysosomal hydrolases and membrane proteins follow the same route that comprises of the ER, Golgi and trans-Golgi network and endosomes to the lysosome (reviewed in [21]. The identification of specific receptors or individual adaptor proteins or lipid components, or dissection of the molecular machinery on the membrane of the acidocalcisome to look for particular traffic mediators would be relevant. To ensure that the TcRab32 mediates sorting to the acidocalcisome and has no effect on the lysosomal traffic we can investigate whether the localization of the

145 membrane glycoprotein p67 (a marker of the lysosome) [22] is unaltered in the Rab32 mutant parasites. Preliminary work from our lab has shown, with Trypanosoma brucei

AP-3, that the lysosomal traffic route is separated from that of the LRO (acidocalcisome in this case) route [19].

CVC as a potential drug target?

Despite T. cruzi trans-sialidase (TcTS) being known for several years our understanding of its intracellular trafficking is still limited. TS has been identified as a potential target for drug discovery and design. Besides having key role in host cell invasion, pathogenesis, and host immune system evasion, trans-sialidase is not present in the mammalian host, thus making it a potential drug candidate. The identification of the specific role of TcTS in infection has been difficult to demonstrate in the past because of the impossibility of doing knockouts of the considerable number of gene copies encoding this protein scattered through the genome of this parasite. The mechanistic details now known, through this work, regarding the traffic of TcTS in these parasites can be used in rational drug design experiments aiming at effective treatments of Chagas disease.

As sorting of GPI-anchored surface proteins responsible for invasion occurs at the CVC, disrupting the integrity of the CVC may act as a potential block to the surface traffic of the antigens, hence providing a mechanism for control of T. cruzi invasion. A deeper understanding of the intracellular traffic in T. cruzi will potentially open the door to new rational therapeutics. Besides, it will be helpful to dissect the information regarding key biological processes of these parasites and its effect on pathogenesis.

146

Hopefully this will just be the start in understanding the multi-faceted role of the contractile vacuole complex and unravelling its potential as a drug target, thus opening doors to new therapeutics.

147

REFERENCES

1. Rohloff P, Docampo R (2008) A contractile vacuole complex is involved in osmoregulation in Trypanosoma cruzi. Exp Parasitol 118: 17-24. 2. Li ZH, Alvarez VE, De Gaudenzi JG, Sant'Anna C, Frasch AC, et al. (2011) Hyperosmotic stress induces aquaporin-dependent cell shrinkage, polyphosphate synthesis, amino acid accumulation, and global gene expression changes in Trypanosoma cruzi. J Biol Chem 286: 43959-43971. 3. Niyogi S, Mucci J, Campetella O, Docampo R (2014) Rab11 Regulates Trafficking of Trans-sialidase to the Plasma Membrane through the Contractile Vacuole Complex of Trypanosoma cruzi. PLoS Pathog 10: e1004224. 4. Ulrich PN, Jimenez V, Park M, Martins VP, Atwood J, 3rd, et al. (2011) Identification of contractile vacuole proteins in Trypanosoma cruzi. PLoS One 6: e18013. 5. Araripe JR, Cunha e Silva NL, Leal ST, de Souza W, Rondinelli E (2004) Trypanosoma cruzi: TcRAB7 protein is localized at the Golgi apparatus in epimastigotes. Biochem Biophys Res Commun 321: 397-402. 6. Araripe JR, Ramos FP, Cunha e Silva NL, Urmenyi TP, Silva R, et al. (2005) Characterization of a RAB5 homologue in Trypanosoma cruzi. Biochem Biophys Res Commun 329: 638-645. 7. Ramos FP, Araripe JR, Urmenyi TP, Silva R, Cunha e Silva NL, et al. (2005) Characterization of RAB-like4, the first identified RAB-like protein from Trypanosoma cruzi with GTPase activity. Biochem Biophys Res Commun 333: 808-817. 8. Plattner H (2013) Contractile vacuole complex--its expanding protein inventory. Int Rev Cell Mol Biol 306: 371-416. 9. Bohme R, Bumann J, Aeckerle S, Malchow D (1987) A high-affinity plasma membrane Ca2+-ATPase in Dictyostelium discoideum: its relation to cAMP- induced Ca2+ fluxes. Biochim Biophys Acta 904: 125-130.

148

10. Ladenburger EM, Korn I, Kasielke N, Wassmer T, Plattner H (2006) An Ins(1,4,5)P3 receptor in Paramecium is associated with the osmoregulatory system. J Cell Sci 119: 3705-3717. 11. Heuser J, Zhu Q, Clarke M (1993) Proton pumps populate the contractile vacuoles of Dictyostelium amoebae. J Cell Biol 121: 1311-1327. 12. Neher E (2012) Introduction: regulated exocytosis. Cell Calcium 52: 196-198. 13. Schilde C, Wassmer T, Mansfeld J, Plattner H, Kissmehl R (2006) A multigene family encoding R-SNAREs in the Paramecium tetraurelia. Traffic 7: 440- 455. 14. Wen Y, Stavrou I, Bersuker K, Brady RJ, De Lozanne A, et al. (2009) AP180- mediated trafficking of Vamp7B limits homotypic fusion of Dictyostelium contractile vacuoles. Mol Biol Cell 20: 4278-4288. 15. Schafer IB, Hesketh GG, Bright NA, Gray SR, Pryor PR, et al. (2012) The binding of Varp to VAMP7 traps VAMP7 in a closed, fusogenically inactive conformation. Nat Struct Mol Biol 19: 1300-1309. 16. Huang G, Bartlett, P.D., Thomas, A.P., Moreno, S.N.J., Docampo, R. (2013) Acidocalcisomes of Trypanosoma brucei have an inositol 1,4,5-trisphosphate receptor that is required for growth and infectivity. Proc Natl Acad Sci USA in press. 17. Lander N, Ulrich PN, Docampo R (2013) Trypanosoma brucei vacuolar transporter chaperone 4 (TbVtc4) is an acidocalcisome polyphosphate kinase required for in vivo infection. The Journal of biological chemistry 288: 34205-34216. 18. Ulrich PN, Lander N, Kurup SP, Reiss L, Brewer J, et al. (2014) The acidocalcisome vacuolar transporter chaperone 4 catalyzes the synthesis of polyphosphate in insect-stages of Trypanosoma brucei and T. cruzi. The Journal of eukaryotic microbiology 61: 155-165. 19. Huang G, Fang J, Sant'Anna C, Li ZH, Wellems DL, et al. (2011) Adaptor protein-3 (AP-3) complex mediates the biogenesis of acidocalcisomes and is essential for growth and virulence of Trypanosoma brucei. J Biol Chem 286: 36619-36630. 20. Marks MS, Seabra MC (2001) The melanosome: membrane dynamics in black and white. Nat Rev Mol Cell Biol 2: 738-748.

149

21. Braulke T, Bonifacino JS (2009) Sorting of lysosomal proteins. Biochim Biophys Acta 1793: 605-614. 22. Tazeh NN, Silverman JS, Schwartz KJ, Sevova ES, Sutterwala SS, et al. (2009) Role of AP-1 in developmentally regulated lysosomal trafficking in Trypanosoma brucei. Eukaryot Cell 8: 1352-1361.