Effect of Aging on Bone and Stem Cell Potential: Mechanical, Histological and Molecular Evidence for Bone Loss and Impaired Differentiation Potential”

Home , Epiphyseal line

“EFFECT OF AGING ON BONE AND STEM CELL POTENTIAL: MECHANICAL, HISTOLOGICAL AND MOLECULAR EVIDENCE FOR BONE LOSS AND IMPAIRED DIFFERENTIATION POTENTIAL”

A DISSERTATION SUBMITTED

JOICE TOM J

IN PARTIAL FULFILLMENT OF THE REQUIREMENTS

FOR THE DEGREE OF

MASTER OF PHILOSOPHY

SREE CHITRA TIRUNAL INSTITUTE FOR MEDICAL SCIENCES AND TECHNOLOGY

THIUVANANTHAPURAM – 695 011 DECLARATION

I, Joice Tom J, hereby declare that I had personally carried out the work depicted in the dissertation entitled “Effect of aging on bone and stem cell potential: mechanical, histological and molecular evidence for bone loss and impaired differentiation potential” under the direct supervision of Dr. Annie John, Scientist F, Transmission Electron Microscopy Laboratory, Biomedical Technology Wing, Sree Chitra Tirunal Institute for Medical Sciences and Technology, Thiruvananthapuram, Kerala, India. External help sought are acknowledged.

Joice Tom J

SREE CHITRA TIRUNAL INSTITUTE FOR MEDICAL SCIENCES & TECHNOLOGY

THIRUVANANTHAPURAM– 695011, INDIA

(An Institute of National Importance under Govt. of India)

CERTIFICATE

This is to certify that the dissertation entitled “Effect of aging on bone and stem cell potential: mechanical, histological and molecular evidence for bone loss and impaired differentiation potential” submitted by Joice Tom J in partial fulfillment for the Degree of Master of Philosophy in Biomedical Technology to be awarded by this Institute. The entire work was done by him under my supervision and guidance at Transmission Electron Microscopy Lab, Biomedical

Technology Wing, Sree Chitra Tirunal Institute for Medical Sciences and

Technology (SCTIMST), Thiruvananthapuram-695011.

Thiruvananthapuram Name of Guide: Dr. Annie John

Date : Signature : The Dissertation

Entitled

“Effect of aging on bone and stem cell potential: mechanical, histological and molecular evidence for bone loss and impaired differentiation potential”

Submitted

Joice Tom J

For

Master of Philosophy

SREE CHITRA TIRUNAL INSTITUTE FOR MEDICAL SCIENCES AND TECHNOLOGY

TRIVANDRUM – 695 012

Evaluated and approved by

Signature Signature

Dr Annie John Examiner’s name and Designation

Acknowledgements

It is with deep sense of gratitude and satisfaction and with the divine blessings of God; I humbly present this dissertation in partial fulfillment of the Degree of Master of Philosophy.

I sincerely express my gratitude and respect to Dr. Annie John, Scientist F, Transmission Electron Microscopy Lab, BMT Wing, Sree Chitra Thirunal Institute for Medical Science and Technology, Trivandrum, for her inspiring guidance, scholarly supervision and providing all facilities to complete my M.Phil dissertation.

I am extremely grateful to The Director of SCTIMST, The Head, Biomedical Technology Wing for the commencement of the course of the Master of Philosophy Technology in Biomedical Research at BMT Wing and providing the necessary facilities to complete the course successfully. I am also obliged to The Deputy Registrar for the academic support bestowed on us to enable us to complete this M.Phil Programme.

I am greatly obliged to M.Phil co-ordinators for coordinating the M.Phil Program.

I would also like to thank Dr. Maya Nandakumar, SIC, Microbiology for her advice & permission to use the incubator for cell culture work and Mr. Pradeep Kumar and Ms. Sheetal for their help.

I am also indebted to Dr. V.S. Harikrishnan, Mr. Manoj M, Mr. Sarath Kumar and Mrs. Sreeja K.R, DLAS, for helping me in animal handling.

With great pleasure I extend my heartfelt thanks to Dr. Mira Mohanthy, Dr. Sabareeswaran A, Mrs. Sulaikha Baby, Mr.Joseph Sebastian for helping me in taking histology sections.

I would also like to thank Mr. Willi Paul, FADD for providing confocal raman microscope facility. I wish to thank Dr. Anoop Kumar T, SIC Molecular medicine for giving permission to use the facilities and Mr. Sreethu for the help. I would also like to thank Dr. Roy Joseph for providing facility to do compression testing. I wish to thank Dr. Anugya Bhatt, Mr. Renjith P Nair, Mr. Renjith S, Mr. Unnikrishnan S, Mrs. Subha and Mrs. Serene Hilary for their help and co- operation in proteomics works and FACS analysis.

My special thanks to Ms. Rakhi, Mr. Jaseer, Mr. Tilak and Ms.Shabeena.

I also express my profound sense of gratitude to Mrs. Sunitha for her sincere support and guidance towards the completion of my project work. Mrs. Beena, Mrs. Susan, Mr. Francis, Mr. Mir, Mr. Hadi, Mrs. Resmi – all deserve special thanks for their patience and kindness which amounted to substantial and needed support to complete my dissertation in time.

Finally to all my colleagues of the M.Phil. Program 2012-13, I would like to express my heartfelt thanks for the support and camaraderie.

Last but not the least, my parents, sister and brother deserve special mention for their prayers, affection and encouragement which has been an inspiring, driving and motivating force in my life.

Finally I am also indebted to countless others who helped me in completing this dissertation.

Joice Tom J.

ABBREVIATIONS

SEM EDAX Scanning Electron Microscopy Energy Dispersive X-ray

RANKL Receptor activator of nuclear factor kappa beta ligand

OPG Osteoprotegerin

RANK Receptor activator of nuclear factor kappa beta

PP 2A Cα Protein phosphatase 2A Cα

MSC Mesenchymal Stem Cell

ADMSC Adipose derived Mesenchymal Stem Cell

BMSC Bone marrow derived Mesenchymal Stem Cell

CD 90 Cluster of Differentiation 90

M-CSF Macrophage Colony Stimulating Factor

OSCAR Osteoclast-associated immunoglobulin-like receptor

SD Sprague Dawley

DLAS Division of Laboratory Animal Sciences

IAEC Institutional Animal Ethics Committee oC Degree Celsius

KN Kilo Newton

mm Millimeter

cm-1 Centimeter inverse

nm Nanometer

µm Micrometer

Mg Milligram

P4 Passage 4

PMMA Polymethyl methacrylate

DEPC Diethylpyrocarbonate

RT- PCR Real Time Polymerase Chain Reaction

DTT Dithiothreitol

GAPDH Glyceraldehyde 3-phosphate dehydrogenase

PBS Phosphate Buffered Saline

EDTA Ethylenediaminetetraacetic acid SDS PAGE Sodium Dodecyl Sulfate Polyacrylamide gel electrophoresis

FACS Fluorescent Activated Cell Sorter

DMEM HG Dulbecco's Modified Eagle Medium High Glucose

FBS Foetal Bovine Serum

RH Relative Humidity

LDH Lactate Dehydrogenase

Ca Calcium

P Phosphorus

Table of Contents

Title/Subtitle Page

No.

Synopsis 1

Chapter I Introduction 4

1.1 Background 4

1.2 Review of literature 8

1.2.1 Effects of Aging on organ systems 8

1.2.2 Changes in bone with Aging 9

1.2.3 Aging and bone strength 10

1.2.3.1 Mineralization 10

1.2.3.2 Organic component of Bone 10

1.2.3.3 Structural properties 11

1.2.4 Bone mass and remodeling 12

1.2.5 Molecular cross talk between RANKL, RANK and 12 OPG with Aging 1.2.6 Role of PP2A Cα in bone remodeling 14

1.2.7 Effect of Aging on stem cells 15

1.2.7.1 Aging and MSC 16

1.3 Hypothesis 18

1.4 Objectives 18

Chapter II: Materials and methods 19

2.1 Animal model 19

2.2 Mechanical testing 19

2.2.1 Sample preparation 19

2.2.2 Compression testing 19

2.3 SEM EDAX 20

2.4 Serum analysis 20

2.4.1 Calcium 20

2.4.2 Phosphorus 21

2.5 Confocal Raman Spectroscopy 22 2.5.1 Sample preparation 22

2.5.2 Confocal Raman Spectroscopy 22

2.6 PMMA Sectioning and staining (Histology) 23

2.6.1 Sample preparation and sample processing 23

2.6.2 Polishing 24

2.6.3 Staining 24

2.7 RNA isolation 24

2.7.1 Trizol method 24

2.7.2 Nanodrop 25

2.7.3 cDNA synthesis 25

2.7.4 Real- Time Polymerase chain reaction 26

2.8 Flow Cytometry analysis for stemness of bone 27 marrow

2.9 Culturing of Adipose derived mesenchymal stem 28 cells: (1 month and 15 months old female SD rats)

2.9.1 Isolation 28

2.9.2 Expansion of rat ADMSC in culture 29 2.10 Characterization of ADMSC 29

2.11 Alamar blue assay (proliferation) 29

2.12 Glucose assay of medium 31

2.13 Induction of ADMSC to osteogenic lineage 31

2.13.1 Calcium staining 32

2.13.2 Phosphorus staining 32

2.14 Cell viability and proliferation assay 32

2.14.1 Lactate Dehydrogenase assay 33

2.14.2 Picogreen assay 34

2.15 Statistical Analysis 34

Chapter III Results and Discussion 35

3.1 Animal model 35

3.2 Mechanical Testing 36

3.3 Histology 40

3.4 SEM EDAX analysis 42 3.4.1 Cortical region 42

3.4.2 Trabecular region 43

3.5 Serum analysis 45

3.6 Confocal Raman Spectroscopy 46

3.7 Real Time polymerase Chain Reaction 48

3.8 Stemness of Bone Marrow 50

Chapter IV: Results and Discussion 52

4.1 Adipose derived mesenchymal stem cells (1 month 52 old and 15 month old female SD rats)

4.1.1 Isolation from Sprague Dawley Rats 52

4.1.2 Expansion of rat ADMSC and proliferation rate 54

4.2 Characterization of ADMSC 54

4.3 Cell proliferation 55

4.3.1 Alamar Blue assay 55

4.3.2 Picogreen assay 57

4.4 Glucose assay from the medium 58 4.5 Osteogenic induction 59

4.5.1 Alizarn red staining (Calcium) 59

4.5.2 Von Kossa staining (phosphorus) 59

4.6 Cell viability (LDH assay) 61

5 Summary and Conclusion 62

References 65

Annexure 71

List of figures

Figure Title Page

No. No.

1 Sprague Dawley rats of different age groups 36

2 Mechanical testing showing the load and displacement 39 at maximum for tibia.

3 Stress at maximum load on the tibia. 39

4 Strain at maximum load on the tibia. 40

5 Young’s modulus (Stress/Strain) of the tibia. 40

6 PMMA embedded plastic sections stained with 41 Stevenels Blue van Gieson Picrofuchsin.

7 Scanning electron microscope images of the cortical 43 region of the tibial bone.

8 SEM EDAX of calcium and phosphorus of the cortical 43 region.

9 SEM image of the trabecular region of tibial bone. 44

10 SEM EDAX analysis of trabeculae. 44

11 Serum analysis of Calcium and Phosphorus. 45 12 Raman spectra of the bone showing phosphate, 47 carbonate and amide I peaks.

13 Comparison of RANKL, OPG and PP2A Cα expression. 49

14 RANKL/OPG ratio in 1 month and 15 months old SD 49 rats.

15 FACS analysis of CD 90 positive cells from bone 51 marrow.

16 Phase contrast images of Isolation flasks on day 5 and 53 day 7 from 1 month and 15 months old rat.

17 Phase contrast images of Passage 2 and passage 4 53 flasks from 1 month and 15 months old SD rats.

18 FACS analysis of CD 90 Positive ADMSC cells from P4 55 passage.

19 Alamar blue assay for proliferation at 24 hour and 3 56 days.

20 Picogreen assay for proliferation of induced ADMSC 57

21 Glucose level from the osteogenic medium 58

22 Alizarin red and von Kossa staining for Calcium and 60 Phosphorus from ADMSC.

23 LDH activity for P4 ADMSCs 61 List of Tables

Table Title Page

No. No.

1 Mechanical testing on the tibia from different age 38 groups of SD rats

2 Phosphate, Carbonate, amide I peak and the ratio 47 of the intensities from different age group of rats

SYNOPSIS

Bones constitute the main component of endoskeleton of vertebrates. It is a dynamic tissue which provides body support, mobility, protection and also sites for muscle attachment. Because of the crucial role played by the bone any change in its structural and functional properties affects whole organ system.

With aging almost all components of bone on which it is build upon seemed to be affected. There are numerous studies and papers published regarding the remodeling of bone, its regulation and how various diseases like osteoporosis; osteoarthritis etc affects the bone turnover. Even though much work has been carried out in this area there is no clear cut evidences for the mechanism of the bone loss.

To evaluate the effect of aging on bone, female Sprague Dawley rats of different age groups (1, 7 and 15 months) were selected. Physico- chemical characterization of bone with aging was analyzed for different age groups and mechanical properties seemed to increase with aging, except for strain (which represents the ability of the bone to adjust with the load on it) which is an indication of the onset for bone loss and confirms that bone has become brittle. To evaluate and compare extent of loss at cortical and trabecular region, SEM EDAX was used. Trabecular region was more affected as the calcium level tend to decrease, trabecular network thinning and increase in trabecular spaces occurred. This finding was further supported by the histology evaluation of the tibia in which epiphyseal plate was converted to epiphyseal line and the trabecular network exhibited thinning. Confocal Raman analysis revealed that the mineral crystallinity declined with aging which might have also contributed to the brittleness of the bone leading to increased risks of fracture.

To better understand the role and expression of key players in regulating bone turnover, expression of RANK-L and OPG were analyzed. Nearly 10 fold increase of RANK-L expression in the aged group indicated the extent of accelerated bone turnover with aging. OPG (antagonist of osteoclast activation) level increased slightly, so we assume that OPG might not be directly involved in increased bone turn-over. So role of another potential candidate gene PP2ACα was analyzed. Elevated expression of PP2A Cα showed its involvement in the increased bone turnover. The expression of PP2ACα with aging has not been referred much in literature and our result proved that this gene might be one of the potent activator of osteoclast or its precursors thus increasing the bone resorption process. More research had to be carried out to confirm this finding.

Mesenchymal Stem Cells has been interestingly suggested as possible autologous donor cells for cell based therapies and tissue engineering because of its capability to produce progeny that differentiate into cells of various connective tissue lineages and reduced chances of immune rejection. But it has been reported the therapeutic potential of stem cells may be limited by their senescence, biological aging or age of the donor. So it was of great interest to evaluate the morphological and functional differences of MSC (focusing on Adipose derived Mesenchymal Stem cells). Among the autologous cell sources adipose derived Mesenchymal stem cells (ADMSC) are considered as a better choice due to its high regenerative and differentiation potential and also ease with which adipose tissue can be accessed as well as the ease of isolating stem cells from harvested tissue.

Total number of potential stem cell in bone marrow derived Mesenchymal Stem Cell (BMSC) and Adipose derived Mesenchymal Stem Cell (ADMSC) was quantified using CD90 marker by flow cytometry. MSC exhibited a decline in the number of potential stem cell with aging in the bone marrow among the heterogenous population. Whereas ADMSCs exhibited almost

2 comparable results when cells were characterized at P4 passage. Morphology of isolated ADMSC retained its spindle shape (characteristics of MSC) until the fourth passage and after which an expanded morphology was exhibited. Also proliferation and osteogenic differentiation potential (1 week) of the ADMSCs seemed to decline with aging. This was evident from alamar blue assay (proliferation), Alizarin red and von Kossa staining, alkaline phosphatase activity (Differentiation). Further the cell viability also seemed to decrease with aging.

There is an increased bone turnover with aging and the molecular regulators of bone resorption, RANKL, OPG and PP2ACα are all involved in enhanced bone resorption. Also in-vitro stem cell differentiation and proliferation potential has been found to be impaired with the advancement of age. A better understanding of age related changes in bone cells and tissue in terms of mechanical, physical, molecular and bio-chemical properties offer new approaches to mitigate or avoid bone loss with aging and help in the improvement of therapeutics for the aged population. And an increased understanding of the biological mechanism of ADMSC derived from different ages will expand their functional applications in tissue engineering.

INTRODUCTION

1.1 Background

Aging can be defined as a complex biological phenomenon which results in the gradual, progressive, irreversible and deleterious decline in the functional properties of the organs ultimately leading to the death of the organism. Almost all organs are affected with aging. Of all the organs affected bone is one of the most important as it maintains the structure of the body and gives protection.

Bone or skeleton is a rigid structure which provides a frame work to support parts of the body along with providing protection to internal organs. Bone also serves as a site for muscle attachment and both together aid in locomotion and mobility. The bone contains cavities in which the bone marrow is present which helps in erythropoesis. Bone also aid in the homeostasis of minerals especially calcium and phosphorus.

Bones maintain a shape to facilitate their mechanical functions such as strong enough to withstand large forces and streamline shape to minimize energy demands. With aging bone becomes more slender and loses its thickness.

Bone is a composite tissue which is made up of an organic phase and an inorganic phase. The components of bone are designed in such a way that it would be able to resist fracture while maintaining the mass of the skeleton. In the inorganic phase mineral crystals contribute the major part. Mineral crystal, called as hydroxyapatite, is mainly formed of calcium, phosphorus. Mineral content of the bone increases with aging which increases the breaking stress of the bone. As a result of the increase in mineral content bones become stiffer but brittle. Organic matrix is mainly composed of type I collagen, but other types of collagen and several non-collagenous proteins are also present. Aging also affects the

4 properties of the collagen such as decrease in its strength, capacity to absorb energy and this further decreases the fracture toughness of the bone. Along with the mineral content, decrease of the collagen structure may also account for the increased brittleness.

The cells which are found in the bone are osteoblast, osteocyte and osteoclast. Osteoblasts are single nucleated bone forming cells. Osteoblasts are responsible for mineralization of the bone matrix and they produce a matrix of osteoid mainly composed of type I collagen. Osteoblasts originate from the osteoprogenitor cells located in the deeper layer of periosteum and the bone marrow. Osteoprogenitors are induced to differentiate into osteoblast under the influence of growth factors, mainly bone morphogenetic proteins (BMPs). Along with BMPs, fibroblast growth factors, platelet- derived growth factors and transforming growth factor beta also promote osteogenesis by the division of the osteoprogenitors. Some of the osteoblasts become small, quiescent bone-lining cells along inactive surfaces. The remaining osteoblasts are surrounded by mineral and extend long processes (dendrites), which allow signaling and nutrition to pass from cell to cell through channels in the bone called canaliculi. These mineral-surrounded cells are known as osteocytes, and they make up approximately 90% of the cells in bone.

Osteoclast on the other hand is a bone resorbing cell and removes bone tissue by removing its mineralized matrix and breaking up the organic bone (90% collagen). Osteoclasts are multinucleated, ruffle bordered cells which are seen in the pits in the bone surface called resorption bays or Howship’s lacunae. Osteoclasts are formed from the osteoclast precursors in the bone marrow. RANKL and Macrophage colony-stimulating factor (M-CSF) plays major role in the activation of the precursors. Normally the activation of the osteoclast by the RANKL is regulated by OPG which competes with RANK on osteoclast to bind its ligand. Whether there are any changes in OPG with aging is not fully understood.

Bone development occurs from the embryonic stage by process known as endochondral ossification. In the embryonic stage, cartilage is formed which is then replaced by bone. At first the chondrocytes proliferate, deposit a matrix, and then become surrounded by a mineralized matrix, and subsequently undergoes apoptosis. To it blood vessel grows which form a marrow cavity and the cartilage is replaced by bone. Ossification usually starts from the 3 month of embryonic development and almost all bones get completely ossified by the age of 25 years.

Aging has an effect on the bone fracture healing capacity. In children, fracture healing is more rapid when compared to that of elderly. Aging also affects the rate at which regain of the mechanical competence after fracture had occurred. Rate of cellular differentiation and hence the rate of repair also decreases with aging. The revascularization of the bone after fracture seemed to decline as a result of aging. Fracture healing usually occurs by the recapitulation of the endochondral ossification. During fracture healing the osteoblasts cells will lay down the bone and the osteoclasts cells will resorbs the old and damaged bone. With aging there is enhanced bone loss which makes the fracture healing difficult. The reason for enhanced bone loss might be due to decreased osteoblast number or due to increased activity of the osteoclast. The decreased number of osteoblast might be due to various factors of which one could be the decline in the progenitor cells- MSCs.

Stem cells are widely used in tissue engineering as therapeutic agent due to its self renewal property and plasticity. The stem cell source could be autologous or allogenous. For better therapy the use of autologous cells are preferred due to its low immune reactions and compatibility. For bone tissue engineering Mesenchymal stem cells are preferred because of it high differentiation potential to bone. MSCs could be of different in origin and the most commonly preferred cells are from bone marrow and adipose tissue. MSCs are

6 seemed to be affected with aging as there are evidences for decline in the number of cells with aging. This decline in number might be either due to cellular senescence or due to the senescence of the niche in which they reside.

So better understanding of the MSC and its response to aging is essential for providing a better therapeutic medicine for the old.

So important questions arises -

What might be the molecular factors contributing for triggered osteoclast activity? Whether the cells from the old retain the proliferation and differentiation potential as that of young cells? Could autologous cells from old serve as a cell source for tissue engineering?

Focus of Research on ‘how aging affects bone’ becomes relevant – on basis of mineral loss, cellular activation, remodeling rate etc.

1.2 Review of literature

Aging can be generally defined as complex biological phenomenon which results in the gradual, progressive, irreversible and deleterious decline in the functional properties of the organs ultimately leading to an increase in probability of death of an individual with time. This increase in probability of death leads to increase in disability in organisms.

Even though aging is a global phenomenon only little knowledge about the molecular mechanism of aging is elucidated till now. A useful conceptual framework for considering the problem of aging is the Disposable Soma model [Kirkwood and Holliday, 1979]. According to this model organisms invest much of its energy into maintenance of the soma to survive long enough to reproduce. So any disturbances to this maintenance lead to aging. These disturbances include nuclear DNA damage and damage to various cellular components. Any unrepaired DNA damage can lead to mutation which can become detrimental to the organism. Damage to both nuclear DNA, which encodes the vast majority of cellular RNA and proteins, and mitochondrial DNA has been proposed to contribute to aging [Karanjawala and Lieber, 2004].

1.2.1 Effect of aging on organ systems:

Almost entire system in an organism is affected by aging. One of the first signs of aging is evident on skin as it is an organ which has got high rate of replication and so the telomere theory of senescence plays a major role. Aging on skin is evident because of the loss of elasticity in skin, wrinkle formation, delayed wound healing and to a certain extend grey hairs. Thermoregulation is also seen to be affected due to the loss of fat deposition under the skin with aging.

Endocrine system shows marked differences with aging mainly with hormone levels throughout the body. Since almost all organs are controlled by hormones any changes in the endocrine system ultimately results in the changes in the proper functioning of the organs. Many researchers have studied and reported the estrogen decline soon after the menopause in women. It has been well studied that estrogen plays a major role in maintaining the bone density. So any fall in the levels of estrogen results in osteoporosis which is frequently evident in women. Similarly changes in the levels of testosterone, parathyroid hormone, calcitonin, vitamin B12 etc results in changes in bone density.

Aging in Cardiovascular system results in loss of myocytes from cardiac walls. With age the replacement of the loss is improper which is compensated by amyloid deposits and fibrosis. Aging results in narrowing of the arteries by the deposition of fat and also the loss of elasticity which results in low blood flow. This increases the risk of hypertension which can ultimately lead to cardiac failure.

Respiratory system shows a decline in the alveoli number in the lungs with aging which can adversely affect the normal gas exchange. Along with this the chemo receptors which signal brain with the deflection in the oxygen and carbon dioxide levels in blood also become less sensitive. Similarly the renal function and the neurological functions also gets affected by aging.

1.2.2 Changes in Bone with aging:

Skeletal system is one of the major systems in an organism body as it provides the structural framework and also protection to all the internal organs. So any changes in the skeletal system increase the chance of other organs getting vulnerable. With aging a gradual reduction in the bone density in both sexes have been reported. Accelerated reduction in the bone density during the post-menopausal period in females results in loss of 5–15% of bone mass

[Chahal and Drake, 2007]. The articular cartilage which is present on the epiphysis of bone also gets thinned and also the wear and tear increases with aging.

1.2.3 Aging and bone strength:

The bone strength is also affected by aging and it seemed to decrease with increase in the age of the organism. The factors which contribute to the strength of the bone are:

1.2.3.1 Mineralization:

In normal conditions bone removed by the osteoclasts are replaced by osteoblast which fill the space with collagenous osteoid [Davison, K. S. et al, 2006]. Soon after the formation of the osteoid the primary mineralization starts which is rapid and continues till the resorption cavity is 50- 60% mineralized. After it the mineralization rate slows down and secondary mineralization starts which can go up to years. The bone mineralization usually reaches up to 90- 95% and stalls [Boivin, G and Meunier, P.J., 2002].

The increasing levels of bone mineralization are accompanied by an increase in stiffness of the bone which is as result of the reduced toughness (energy required to cause a fracture) [Currey et al, 1996]. So more the mineralization occur the bone becomes more brittle. The bone which is hyper mineralized is more susceptible to fracture than a bone with low mineralization. Riggs et al., 1990, showed that there is an increase in BMD and increased fracture with patients who undergo fluoride treatment.

1.2.3.2 Organic Component of Bone:

The organic component in bone- collagen absorbs the maximum energy before a bone will fracture. Bone collagen contributes to the toughness of the

10 bone rather than its stiffness [Zioupos, 2001]. Still collagen content contribute indirectly to the stiffness of the bone as more the protein content in the bone, less will be the mineral which decreases the stiffness. The size and orientation of the bone crystals are also limited by the size and orientation of the collagen fibril. [Davison, K. S. et al, 2006].

Collagen denaturation is related to the age-dependent decrease in bone toughness [Wang et al., 2000]. Wang and coworkers (2002) showed that there is 35% decrease in strength and 50% decrease in the toughness of the collagen network associated with age-related declines in whole-bone strength and the amount of energy required to cause fracture.

Osteocytes also contribute to the mechanical properties of the bone because it acts as regulators of bone remodeling for repairing the damage [Qiu et al., 2003]. Osteocyte density was found to be low in areas of high micro crack density, which could be due to osteocyte death, thereby allowing high densities of micro cracks to occur [Mori et al., 1997]. Osteocyte death has been demonstrated to increase with age and is correlated with an increase in the accumulation of fatigue damage [Dunstan et al., 1993].

1.2.3.3 Structural Properties:

The diameter and the thickness of the cortex of the bone have major role on the biomechanical integrity [Oxlund et al., 1993]. The bones with thicker cortex mainly contribute to the bone strength and thinner cortexes are more prone to fracture [Crabtree et al., 2001]. With normal aging there is an increase in the diameter of the bone which increases their strength even though loss of bone from the endocortical surface are greater than the bone deposited in the periosteal surface. The cortical shell of vertebrae increases in cross-sectional area with age, increasing the biomechanical strength [Link et al., 2000].

The micro architecture of the trabecular network has a substantial impact on bone strength. Trabecular connectivity and the orientation are important in the maintenance of trabecular bone strength and stiffness. The bone can resist the strain more efficiently when the orientation of the trabeculae is inline. Increase in the trabecular connectivity reduces the framework which is been unsupported which in turn increases the ability to withstand stress and strain. Guo and Kim (2002) in their studies showed that the bone loss due to trabecular loss has larger impact on the bone strength than an equal mass loss due to trabecular thinning.

Trabecular thickness: Along with the trabecular network, trabecular thickness also plays a major role in determining the strength. Thicker trabecular are stronger. With aging the loss of trabeculae occurs, it becomes thinner which can contribute to the loss in strength.

1.2.4 Bone mass and remodeling:

Any small changes in the mineral content in cortical and trabecular bone result in loss in the bone strength and stiffness [Hernandez et al., 2001]. The degree of mineralization in adults is largely a reﬂection of the rate of bone turnover by remodeling [Meunier and Boivin, 1997]. Bone remodeling refers to the process where old bone is resorbed and replaced. During growth, remodeling plays a small part in the changes in bone mass, but after skeletal maturation it plays a dominant role. Typically, small loss in bone mass are observed over time in adults, which is thought to be a consequence of a small imbalance between osteoclast and osteoblast activity, with the former removing more bone per remodeling site than is replaced by the latter.

1.2.5 Molecular crosstalk between RANKL, RANK and OPG with aging:

Remodeling of the bone maintains the integrity of the skeleton by removing the old bone with high mineral content and high prevalence of fatigue 12 micro-fractures and replacing the loss with young bone of low mineral density and better mechanical properties [Frost, 2001; Parﬁtt, 1991; Bellantuono et al., 2009]. The osteoblastic cell proliferation was high in early ages with high rate of DNA replication taking place. But with aging the proliferation potential of osteoblastic cells decline [Cindy et al., 1997].

With aging the number of osteoclasts which leads to bone resorption increases. So the remodeling of the bone gets impaired. The main genes responsible for this over expression of the osteoclasts are RANKL, RANK and OPG. The balance and the interaction of these genes shifts the normal process of bone formation to increased bone loss. Various studies have been carried out on these genes.

RANKL or the receptor activator of nuclear factor kappa beta (NFkβ ligand) belongs to the tumor necrosis factor (TNF) family and is one of the major cytokine to play a major role in the bone metabolism. It regulates the development, activation and the maintenance of the osteoclasts [Kong et al., 1999, burgess et al.,1999]. Osteoblasts are the main reservoirs of the RANKL. The main function of RANKL in bone metabolism is the osteoclastogenesis. The interplay between RANKL and the M-CSF resulted in the formation of osteoclast from the monocyte progenitors [Lacey et al., 1998]. Matsuo et al. (2004) showed that under the influence of RANKL, osteoclast precursors join together to form multinucleated cell and also induces expression of tartrate-resistant acid phosphatase and cathepsin K, enzymes required for bone resorption. But the administration of the recombinant RANK in these animals reimposes osteoclastogenesis. At the same time osteoclastogenesis is blocked when OPG is administrated. Thus RANKL plays dual role depending on the receptor to which it binds.

RANK is the receptor activator of NFkβ. The interaction of RANK and RANKL results in initiation of osteoclastogenesis and activation of osteoclasts

[Hhsu et al., 1999]. RANK is found to be expressed on the surface of osteoclast progenitor cells, mature osteoclasts, chondrocytes etc. [Li et al., 2000]. Lacey et al. (1998) showed that the RANK gene knockout mice inhibit osteoclastogenesis and severe osteopetrosis was observed.

Osteoprotegerin (OPG) belongs to the TNF receptor (TNFR) super family but it differs from other members of the family as it is a soluble receptor [Tan et al., 2004]. OPG is a competitive receptor for RANKL. It competes with RANK and protects the bone by inhibiting the osteoclast [Kohli et al., 2013]. The OPG- RANKL complex counter balances the RANK-RANKL complex and it plays a major role in bone homeostasis. Yasuda et al. (1998) showed that in transgenic mice which has OPG gene knockout the onset of osteoporosis was earlier and spontaneous fractures was observed in these animals due to excess formation of RANK- RANKL. OPGs action on bone includes the inhibition of osteoclast differentiation, suppression of activation of osteoclast and induction of apoptosis of osteoclasts [Kwan et al., 2008]. According to Hakeda et al. (1998) the osteoclast activity can be inhibited by OPG even in the absence of RANKL through interactions with uncharacterized receptors on osteoclast.

RANKL and OPG were most commonly studied genes on bone remodeling since its discovery. Jay et al. (2003), worked on male C57BL/6 mice, and correlated the expression of RANKL and OPG to age related bone loss. He used young (6 week), adult (6 month) and old (24 month) mice and studied the RANKL and OPG expression in cell culture and found a 4 fold increase in RANKL with not much change in OPG.

1.2.6 Role of PP2A Cα in bone remodeling:

Most of the mechanism of a eukaryotic cell is regulated by protein phosphorylation. Phosphorylation plays a major role in protein expression [Sontag et al., 1995; Snaith et al., 1996]. Protein phosphatase 2A (PP2A) is a

14 member of the protein phosphatase family which regulate different cellular functions. The catalytic subunit of PP2A cloned for mammals showed that there are two different subunits present Cα and Cβ [Zhou et al., 2003]. Both consists of 309 amino acids and has an expected molecular mass of 35.6 kDa. 97% of the aminoacid sequences in Cα and Cβ are identical [Stone et al., 1989; Arino et al., 1988]. The expression of Cα subunit is 10 times more than the Cβ subunit [Khew-Goodall et al., 1988]. Specific functions of the two subunits are yet to be elucidated. Okamura et al. (2011) showed that the reduction of protein phosphatase 2A Cα enhanced the bone formation via the up regulation of osterix gene. In that particular study the gene PP 2A Cα was inhibited with okadic acid and the gene expression of osterix, bone sialoprotein and osteocalcin was analyzed which showed a marked increase when the gene was suppressed. The role of PP 2A Cα on osteoclastogenesis was again studied by Okamura et al. in 2013 in which he showed that the reduction of the gene decreased the expression of RANKL when compared to the cells in which the gene is normally expressed. But the expression of OPG was seemed to increase in PP2A Cα knockout cells. Again the NFATc1, cathespin K and OSCAR genes which are the precursor genes in the osteoclast formation are seemed to be down regulated when PP2A Cα is knocked out when compared to the normal cells. Okamura et al. has hypothesized that the PP2A Cα gene plays a major role in bone remodeling. The expression of this particular gene has a role in osteoclast formation whereas the down regulation of the gene results in enhanced osteoblastogenesis.

1.2.7 Effect of aging on stem cells

Stem cells are the major class of cells on which the regenerative potential of an organism depend. So any changes which lead to the loss of this potential ultimately affect the regenerative capacity. With aging the regenerative potential of stem cells is seen to decline. When talking about the self renewal ability it is

15 still a debate whether the stem cells undergoes juvenation or it ages with each cell divisions [Wagner et al., 2009]. Yet there are not many evidences whether adult stem cells undergo functional and molecular changes, whether the number of stem cells decreases with aging, or whether the aging is due to the extrinsic environmental factors without any effect on the stem cell population [Gazit et al., 2008, Giangreco et al., 2008].

1.2.7.1 Aging and MSC:

Mesenchymal stem cells (MSC) are pluripotent cells, which have the ability to differentiate into a large number of lineages, mainly osteogenic, chondrogenic and adipogenic, and are present in the bone marrow, adipose tissue and other tissues. They play an important role in tissue repair and regeneration. MSC are one of the most used adult stem cells in regenerative medicine due to its plasticity and accessibility. Deterioration in the process of repair and regeneration is contributed to the aging of the organism as it can cause aging of stem cell and decline in their number.

According to von Zglinicki and Martin-Ruiz (2005) the aging of cells during in vitro is dependent on the number of cell divisions. So usually after 20 to 50 cell population doublings, the size, granularity increases and the proliferation rate gradually comes down. Finally the cells stops its cell division but remains in metabolically active state and can remain in that particular state for long duration. Wagner et al., (2008) have shown that the MSCs start aging from the first passage in the culture. This aging is due to the differential expression of the genes which varies from donors. Fehrer et al., 2007 and Colter et al., 2000 showed that the pace of aging can be affected by the culture conditions. Cell division capacity prior to senescence is lower in adults than juveniles [Stenderup et al., 2003].

The differentiation potential of the MSCs into tri lineage is the one which have been studied the most in relation to aging. Several studies have claimed that the differentiation potential remains unchanged with aging where various others reported changes in the potentials. Stenderup et al., 2001 and Justesen et al., 2002 from the works have shown that the osteogenic potential of young and old MSCs remained same at early passages. Muraglia et al., 2000 studied the tri lineage potential of the MSC with aging and suggested that the differentiation potential to tri lineage remained same in early passages whereas the adipogenic potential was lost as the passage increased.

As age increases there are significant morphological, cellular, mechanical changes in skeletal system. It has been shown that bone loss increases with aging and can lead to osteoporosis. These all changes play a major role in bone fracture with age and delaying bone repair. The best therapeutic approach in repair of fracture is the use of autologous mesenchymal stem cells. MSC are very few in number in a person’s body and a decline in its number with age make this approach much difficult.

1.3 Hypothesis  Prove the extent of bone loss and the involvement of RANKL, OPG and PP2ACα in regulating bone turn over.

 Evaluate the efficiency of bone marrow derived MSC and adipose derived MSC in their proliferation and differentiation potential with aging.

1.4 Objectives

So objective of the study has been sub-divided as follows Effect of aging on bone

 To physico-chemically characterize bone properties with aging.  To bio- chemically characterize serum from aged model to estimate bone loss.  To evaluate the structural deterioration due to bone loss in cortex and trabeculae.  To estimate gene level expression of regulators of bone remodeling – RANKL, OPG and PP2ACα.

Effect of aging on stem cell potential:

 To Isolate BMSC and ADMSC  To characterize stem cell progenitors of ADMSC and BMSC.  To study proliferation and osteogenic differentiation potential of ADMSC with aging.

CHAPTER II

Materials and Methods

2.1 Animal Model:

For the study the animals selected were Sprague Dawley (SD) female rats of three age groups- 1 month old, 7 months old and 15 months old. Animals were provided by the Division of Laboratory Animal Sciences (DLAS), BMT Wing, SCTIMST, Trivandrum, India and experiments were conducted as per the guidelines of Committee for the Purpose of Control and Supervision on Experiments on Animals (CPCSEA) and approved by the Institutional Animal Ethics Committee (IAEC).

2.2 Mechanical Testing:

2.2.1 Sample preparation:

Bone samples were obtained from SD rats of different age groups. The bone samples were cleaned to remove all the fat and muscles attached to the bone. The mid diaphysis portion of the tibial bones were cut such that the sample will be almost straight with minimum bending. Samples were then stored at -80oC until analysis. For analysis the samples were taken and immersed in PBS to avoid drying off. The cut ends were trimmed and polished, such that the samples would stand freely on its base. The length and the diameter of the samples were recorded.

2.2.2 Compression testing:

The mechanical compression experiments were performed in an electromechanical universal testing machine (Instron 3345, Instron Corporation, Canton, USA). Compression tests were conducted with an elongation rate of

0.1mm/s using a load cell of 5 kN. The stress ζ- strain ε curves were obtained. Specimens were loaded along the principal stress direction of the bone until it broke.

2.3 SEM EDAX Analysis:

Bone samples were obtained from the SD rats of three age groups. The bones were cleaned to remove all the fat and the muscles attached to it. The tibial heads were then cut out using small hand saw and the tibial head was further cut down to equal halves. The samples were then washed with PBS to remove all the bone marrow attached to the trabecular network and then fixed in 0.3% gluteraldehyde until analysis. Samples were then stored at 4oC. Bone samples were placed on a metal stub uncoated with the cut portion facing upwards. The stub was placed into the vacuum chamber and vacuum was applied. Low voltage electrons were used to collect the images at 800X magnification using scanning electron microscope (ESEM FEI Quanta 200, Netherlands). The elementary composition of the cortex and the trabecular regions were analyzed using EDX. Elemental composition was determined as weight percent of calcium and phosphorus.

2.4 Serum analysis:

2.4.1 Calcium assay:

Calcium in the serum from 1 month and 15 month old animals were analyzed using calcium assay kit (Erba, Mannheim). The blood was collected and centrifuged at 1600 rpm for 10 minutes to collect the supernatant and stored at -80oC. For the assay 20 μl of the test sample was taken and treated with 1 ml of the reagent. Mixed well and the absorbance is measured at 630 nm.

The working of the reagent is based on the principle that the Arsenazo III combines with calcium ions at pH 6.75 to form a colored chromophore, the 20 absorbance of which is measured at 650 is proportional to calcium concentration. Arsenazo III has high affinity for calcium ions and shows no interference with other cations.

The amount of calcium in the serum is calculated using the formulae:

Calcium = Absorbance of Test X concentration of the standard (md/dl) (mg/dl) Absorbance of standard

2.4.2 Phosphorus assay:

Phosphorus in the serum from 1 month and 15 month old animals were analyzed using phosphorus assay kit (Erba, Mannheim). The blood was collected and centrifuged at 1600 rpm for 10 minutes to collect the supernatant and stored at -80oC. For the assay 20 μl of the test sample is mixed with 1 ml of the reagent and incubated for 5 minutes at 37oC. The absorbance is read at 340 nm against a reagent blank.

The reagent works on the principle that inorganic phosphorus in the medium combines with ammonium molybdate in the presence of strong acids to form phosphomlybdate. The formation of phosphomolybdate is measured at 340 nm and is directly proportional to the concentration of inorganic phosphorus present.

The amount of phosphorus is measured using the formula:

Phosphorus = Absorbance of Test X concentration of the standard (mg/dl) (mg/dl) Absorbance of standard

2.5 Confocal Raman Spectroscopy:

2.5.1 Sample preparation:

The bone samples were collected from the SD rat of different age groups aseptically during the fat tissue collection. The bone samples were cleaned to remove all the tissues. The bone samples were then cut and the bone marrow was removed. The samples were then freezed using liquid nitrogen and stored at -80oC. Frozen samples were taken and powdered using a motar and pestle.

2.5.2 Confocal Raman Spectroscopy:

Raman spectroscopy was used to characterize tissue composition of all the samples. Spectra ranging from 200- 1800 cm-1 were collected using confocal Raman spectroscope (Alpha 300 R, Germany) with a 532nm laser and an integration time of 5 seconds was given. Baseline correction was made to all peaks before calculation of peak heights of the phosphate (954- 955 cm-1), carbonate (1035- 1055 cm-1), and amide I (1660- 1663 cm-1) bands using Origin 6 software. Ratios of the peak heights of the phosphate/amide I bands, phosphate/ carbonate, carbonate/ amide l were calculated to give the extent of mineralization, carbonate substitution and bone remodeling respectively. Full- width and half-maximal (FWHM) of the phosphate band (mineral) was calculated to determine the crystallinity.

Raman spectroscopy is a vibrational spectroscopy technique used to assess scattered light from biologic molecules and ions. Raman scattering occurs when molecules within a specimen are excited by incident laser light. Vibrational motions within the molecules lead to a small fraction of the light (approximately one in 107 photons) losing energy and being scattered at longer wavelengths (Bazin et al., 2009) The wavelength difference between scattered and incident light corresponds to molecular vibrations and leads to bands at

22 characteristic frequency shifts in the Raman spectrum. These shifts are labeled in wave number units corresponding to the vibrational energy (cm-1). Frequency shifts serve as an important source of contrast in assessing tissue composition such as carbonate substitutions for phosphate positions in bone. The extracellular matrix also provides another source of contrast to bone tissue composition. The extracellular matrix contains many protein-rich vibrational modes, corresponding predominantly to collagen features such as amide backbone, protein secondary structure, and side chain composition (Michael et al., 2011).

2.6 PMMA Sectioning and Staining (Histology)

2.6.1 Sample preparation and Sample processing

The tibia from 1 month, 7 months and 15 months old female SD rats were collected during the fat tissue collection aseptically. The tibia was cleaned to remove all the tissues attached to it. The tibial head was cut out for PMMA sectioning.

The samples were dehydrated through a series of isopropanol (70%, 80%, 95% and 100%). After dehydration samples were immersed in acetone for exactly 24 hours followed by dehydration with 100% isopropanol. The samples were then infiltrated with PMMA for 8 days with two changes. Finally the samples were embedded in PMMA with 1% benzoyl peroxide. Vacuum was applied to remove all the moisture and the samples were left undisturbed till it solidifies.

PMMA embedded samples were taken and trimmed to remove excess PMMA. The sections were taken at 150 micron thickness with a high speed linear precision saw in isomet 5000 (Beuhler).

2.6.2 Polishing:

The sections were polished down with the help of polishing discs. The polishing was done in a decreasing range of 30 micron disc to 3 micron disc with Ecomet 3000 (Beuhler). The sections were viewed under the light microscope to ensure polishing.

2.6.3 Staining:

The polished sections were stained using Stevenels blue - van Gieson picofuschin stain. Stevenels blue is a nuclear stain which stains nucleus of all cells whereas van Gieson stains the connective tissue especially collagen and muscle. The section is immersed in prewarmed (60oC) Stevenels blue for 1 minute. After 1 minute the section is dipped in prewarmed distilled water for few seconds to destain excess stain followed by staining with van Gieson for 3 minutes.

2.7 RNA Isolation:

2.7.1 Trizol Method:

Weighed the bone sample from 1 month and 15 months old female SD rats preserved at -80oC and homogenized in Precellys 24 (Bertin technology) at 1x20sec with trizol reagent (TRI reagent) (1ml per 100 mg of the sample) and incubated the sample at room temperature for 15 minutes. The supernatant was transferred to fresh eppendorff tube and 0.2 ml of chloroform (Ranbaxy) added for each ml of trizol and the tube was shaken vigorously for 15 seconds. Thereafter the tube was incubated at room temperature for 2 minutes followed by centrifugation (Heraes) at 12000xg for 10 minutes at 4oC. The top aqueous portion was pipetted out of the three layer formed in the tube. Care must be taken to avoid pipetting the other layers. Again, 0.5ml of 100% isopropanol was added for each ml of trizol to the tube with the supernatant and incubated at

24 room temperature for 10 minutes and centrifuged at 12000xg for 10 minutes at 4oC and supernatant was discarded. For washing the pellet, 1ml of 75% ethanol was added for each ml of trizol and the sample was vortexed and centrifuged at 7500xg for 5 minutes at 4oC. The supernatant was discarded and pellet air dried for 10 minutes to completely remove the traces of ethanol. The pellet was resuspended in 20 μl DEPC water and incubated at 60oC for 10 minutes and the tube was sealed and stored at -20oC.

2.7.2 Nanodrop:

To quantify the isolated RNA and to check for the purity Nanodrop was performed. 2μl of the sample was used.

2.7.3 cDNA synthesis:

The isolated RNA was used for cDNA synthesis as RNA is less stable when compared to DNA. cDNA was synthesized using reverse transcriptase polymerase chain reaction (RT-PCR) in a thermocycler (Eppendorff). Approximately 1000 ng of RNA was used for cDNA synthesis. Superscript III reverse transcriptase kit (Invitrogen) was used. The reaction mixture was prepared as follows.

Appropriate amount of RNA which gives the approximately 1000 ng/ml of cDNA was taken. To it added

Reagent Volume

Oligo(dT)20 1 μl

dNTP 1 μl

The final volume was made up to 13 μl with DEPC water. The tubes were then heated at 65oC for 5 minutes and immediately transferred to ice for 1 minute. Keeping the tubes in ice, the following reagents were added as follows

Reagent Volume

5X first strand buffer 4 μl

0.1 M DTT 1 μl

RNase inhibitor 1 μl

SuperScript III RT enzyme 1 μl

The reagents were mixed thoroughly by pipetting up and down.

2.7.4 Real- Time Polymerase Chain Reaction:

The cDNA was amplified by real time PCR (Chromo4) using Full Velocity TM SYBR Green QPCR Master Mix. The reaction mixture was prepared in duplicate as given in the table below. Cycling conditions were as follows: Initial denaturation at 95oC for 15 minutes, denaturation at 95oC for 30s, Primer anneling temperature as given in table for 45s, and extension at 72oC for 30 seconds followed by plate reading and melting curve analysis. The PCR reaction was set for 39 cycles and finally the products are stored at 15oC.

Reagents Volume

DEPC 10.5 μl

Forward primer 1 μl

Reverse Primer 1 μl

SYBR Green 12.5 μl

cDNA 2 μl

Gene Forward primer Reverse Primer Annealing temperature

GAPDH GGCACAGTCAAGGCTGAGAATG ATGGTGGTGAAGACGCCAGTA 60oC

RANKL ACATCCCATCGGGTTCCCATAAA GGTTGGACACCTGGACGCTAATTT 60oC GTCAGT CCTCA

OPG ATATTGCCCCCAACGTTCAAC AGAGGGCGCATAGTCAGTAGACA 60oC

PP2ACα GGAATCACGAGAGCAGACAGATC AAGGCAGTGAGAGGAAGGTA 52oC

2.8 Flow Cytometry analysis for stem cell progenitors of bone marrow:

Femur bones from 1 month and 15 months old female SD rats were collected aseptically during adipose tissue collection. The femur bones were cleaned to remove all the muscle and both ends were cut at the epiphyseal ends. The bone marrow was flushed out using PBS into 15 ml tube (axygen) and

27 pelleted down at 2500 rpm for 10 minutes at 14oC. The pellet was then resuspended in 1 ml PBS and divided into two portions. One portion was used to stain with CD 90 (1:100 in PBS) primary antibody and incubated for 1 hour. After incubation the cells were pelleted down and treated with secondary antibody (1:200 in PBS) for 1 hour in dark. After 1 hour the cells were pelleted down and the RBCs present were lysed using 1X lysing buffer. After lysing the RBCs the cells were again pelleted down fixed in 3.7% paraformaldehyde and analyzed using flow cytometry (BD Biosciences FACS Aria). The second portion was used as control.

2.9 Culturing of Adipose derived mesenchymal stem cells: (1 month and 15 months old female SD rats)

2.9.1 Isolation

Tissue isolation and animal experiments were carried out as per the guidelines of the Institutional Animal Ethics Committee (IAEC).

Fat tissue was isolated from Sprague Dawley of different age groups (1 month, and 15 months) supplied by the Division of Laboratory Animal Sciences (DLAS), BMT Wing, SCTIMST. Subcutaneous fat was collected under sterile conditions into phosphate buffer saline (PBS) containing 2% antibiotics (Rosalin, Ranbaxy). The sample was then washed three times in PBS containing 1% antibiotics (Invitrogen). The adipose tissue is then cleaned and minced. Minced tissue is then digested in double the volume of 0.2% collagenase type I (Gibco, Invitrogen) in a shaking water bath set at 37oC for 1 hour. The digestion is then stopped with equal amount of DMEM HG medium containing FBS and was filtered using a 180 micron nylon mesh membrane filter (Millipore). Cells were pelleted down at 14oC, 2500rpm, 10 minutes (Hettich germany). The pellet was resuspended in 1ml DMEM HG and plated in 5 ml of DMEM HG, 10% FBS and

2 1% Antibiotics in a 25 cm flask (Nunc). The flask was kept in the CO2 incubator o (Hereaus) at 37 C with 5% CO2 and 95 % RH.

2.9.2 Expansion of rat ADMSC in culture

The isolated MSC culture at reaching 90% confluency was trypsinized using 1ml 0.25% trypsin (Invitrogen) for 25 cm2 flask and 3 ml for 75 cm2 flask. Flasks were then incubated in incubator for 3-5 minutes. This results in the detachment of the cells which was confirmed with the help of microscope (Leica). Gently tap was given for complete detachment. The action of trypsin was then stopped by adding medium (DMEM HG) containing FBS (Gibco) and centrifuged at 2500 rpm for 10 min at 10oC to pellet down the cells (Hettich Germany). The pellet was then resuspended and seeded into two 25 cm2 flasks (Nunc).

2.10 Characterization of ADMSCs

ADMSCs reaching 90% confluency in P4 passage were washed with PBS. The cells were then trypsinised with 0.25% trypsin (Invitrogen) and centrifuged at 2500 rpm for 10 minutes at 14oC. The pellet was resuspended in PBS and divided into two portions. One portion is used to incubate with CD 90 (1: 100 in PBS) primary antibody for one hour. After one hour incubation the cells were pelleted down and was incubated with FITC conjugated secondary antibody (1:200 in PBS) for 1 hour in dark. The fluorescence intensity of the secondary antibody was recorded using flow cytometry (BD Biosciences FACS Aria). The second portion was used as control.

2.11 Alamar Blue assay: (Proliferation)

Alamar blue assay is used to measure the proliferation potential of the differentiated and the undifferentiated cells. For assay P4 passage cells were seeded into a well plate with a seeding density of 1X104 cells. Alamar Blue(10% v/v) (Invitrogen) was added to the wells on 24h and 3 day of culture before the 29 cells became conﬂuent. Wells containing medium only (no cells) acted as a baseline control. Following the addition of Alamar blue, the cells were incubated for 4 h and the color change quantiﬁed by measuring the difference in spectral absorbance (δ-absorbance) at 570 nm (reduced form) and 595 nm (oxidised form) wavelengths of light for each time point (HIDEX Chameleon).

Alamar Blue assay was chosen as it allows repeated measurement of cell proliferation without destruction of the cultures, and it gives proliferation measurements equivalent to those carried out with BrdU incorporation. AlamarBlue is a proven cell viability indicator that uses the natural reducing power of living cells to convert resazurin to the fluorescent molecule, resorufin. The active ingredient of alamarBlue (resazurin) is a nontoxic, cell permeable compound that is blue in color and virtually nonfluorescent. Upon entering cells, resazurin is reduced to resorufin, which produces very bright red fluorescence. Viable cells continuously convert resazurin to resorufin, thereby generating a quantitative measure of viability and cytotoxicity.

The proliferation of the cells is calculated from the formula:

Percentage reduction of alamar blue = Sx- Scontrol S100% reduced- Scontrol where SX is the alamar Blue fluorescence signal of the sample at day x, S100%reduced is the signal of the 100% reduced form of alamar Blue and Scontrol is the signal from the control: the culture medium supplemented with 10 vol.% alamar Blue. The 100% reduced form of alamar Blue was produced by autoclaving controls (ie. culture medium supplemented with 10 vol. % alamar Blue) at 121°C for 15 minutes.

2.12 Glucose assay of the Medium:

The osteogenic medium from the culture of the differentiated ADMSCs of P4 passage were collected for 7 days and was analyzed for the presence of glucose.

Glucose in the medium from the P4 cell culture was analyzed using phosphorus assay kit (Erba, Mannheim). For the assay 10 μl of the test sample is mixed with 1 ml of the reagent and incubated at 37oC for 5 minutes. The absorbance of the standard and the blank is measured at 505/ 670 nm.

Glucose in the sample is oxidized to yield gluconic acid and hydrogen peroxide in the presence of glucose oxidase. The enzyme peroxidase catalyses the oxidative coupling of 4- aminoantipyrine with phenol to yield a colored quinoneimine complex, with absorbance proportional to the concentration of glucose in sample.

Amount of glucose present is calculated using the equation:

Glucose = Absorbance of Test X concentration of the standard (mg/dl) (mg/dl) Absorbance of standard

2.13 Induction of ADMSC to osteogenic lineage:

The rADMSC at P4 passage were trypsinised and counted using haemocytometer. About 1x104 cells were seeded onto the coverslip in non adherent 6 well plates (Nunc) and incubated for 1 hour for cells attachment. After incubation 3 ml medium was added carefully without disturbing the coverslip and o incubated for 24 hours at 37 C, 5% CO2 and 95% RH in CO2 incubator (Hereaus Germany) for the cells to proliferate. After 24 hours the medium was removed and cells were induced osteogenically with 3 ml osteogenic medium. The cells were maintained in osteogenic medium with change every 3 days. The coverslips

31 were maintained for one week. After one week the coverslips were picked for alizarin red and von kossa staining. The coverslips were washed with PBS twice to remove any traces of the medium and the fixed in 3.7% paraformaldehyde and stored at 4oC till assay.

2.13.1 Calcium staining

Rat ADMSCs that were induced to osteogenic lineage for 7 days were washed with PBS and fixed in 3.7% paraformaldehyde in Sorensen phosphate buffer for 24 hours. The cover slips were washed with PBS for 10 minutes and stained with 1% Alizarin red (Sigma chemicals) for 5 minutes to determine the calcium deposition. After 5 minutes the coverslip is washed with PBS, mounted with DPX and viewed under light microscope (Leica DM 600).

Alizarin Red S, an anthraquinone derivative, which stains the calcium deposits, is used to stain s the osteogenically induced cells. The reaction is not strictly specific for calcium, since magnesium, manganese, barium, strontium, and iron may interfere, but these elements usually do not occur in sufficient concentration to interfere with the staining. Calcium forms an Alizarin Red S- calcium complex in a chelation process, which results in dark red in color (James et al., 2008)

2.13.2 Phosphorus Staining

Rat ADMSCs that were induced to osteogenic lineage for 7 days were washed with PBS and fixed in 3.7% paraformaldehyde in Sorensen phosphate buffer for 24 hours. The coverslips were washed with distilled water and stained with 5% silver nitrate (Merck) in distilled water and exposed to UV for 15 minutes. The cells are then washed with distilled water, air dried, mounted in DPX and viewed under light microscope (Leica DM 600).

The von Kossa stain is used to quantify mineralization in cell culture. The method was originally developed by von Kossa. The stain principle is a precipitation reaction in which silver ions react with phosphate (not calcium) in the presence of acidic material. Photochemical degradation of silver phosphate to silver then occurs under light illumination. This results in the formation of brownish black precipitates (Zhang et al., 2008).

2.14 Cell viability and Proliferation assay:

2.14.1 Lactate Dehydrogenase assay:

The cell viability was quantitatively measured through the lactate dehydrogenase activity of the cell lysate using LDH reaction buffer. For this 1X104 rat ADMSCs at P4 passage were seeded on well plate and made osteogenic with osteogenic induction medium. The cells were cultured for 7 days and stored at -80oC after washing in PBS. Frozen cell samples were thawed on ice for 20 minutes and lysed with 1% triton X- 100 (300 μl) for 50 minutes followed by 10 minute sonication. 10 μl of the cell lysate was taken to an eppendorff and made up to 50 μl with 1% triton X- 100. It is mixed with LDH substrate (50 μl) and incubated at room temperature for 30 minutes. The reaction was stopped after 30 minutes with stop solution (50 μl). The absorbance was read at 492 nm (HIDEX Chameleon). The cell viability was measured from a calibration line constructed from cell suspension with increasing concentrations of cell numbers.

Lactate dehydrogenase (LDH) is used to measure the viability of the cells. LDH, which is a soluble cytosolic enzyme present in most eukaryotic cells, releases into culture medium upon cell death due to damage of plasma membrane. The increase of the LDH activity in culture supernatant is proportional to the number of lysed cells. LDH assay is based on colorimetric method in which LDH catalyses the conversion of lactate to pyruvate by the reduction of NAD+ to

NADH/H+. The formation of NADH is measured with the coupled reaction in which the tetrazolium salt INT is reduced to a red formazan product by catalyst diaphrose. The amount of soluble formazan is measured at 490 nm spectrophotometrically.

2.14.2 Picogreen assay:

The proliferation of the rat ADMSC was quantified using picogreen dsDNA Quantification reagent (Molecular Probes). For this 1X104 rat ADMSCs at P4 passage were seeded on well plate and made osteogenic with osteogenic induction medium. The cells were cultured for 7 days and stored at -80oC after washing in PBS. Frozen cell samples were thawed on ice for 20 minutes and lysed with 1% triton X- 100 (300 μl) for 50 minutes followed by 10 minute sonication. Aliqouted 10 μl of the cell lysate and mixed with picogreen on Tris- EDTA buffer (190 μl) for 5 minutes and the intensity of fluorescence was measured at an excitation and emission wavelengths of 485/ 535 nm in a microplate reader (HIDEX Chameleon). Relative fluorescence units were correlated with cell number using a calibration line constructed from cell suspension with increasing concentrations of cell numbers.

PicoGreen is a fluorochrome that selectively binds dsDNA. It has an excitation maximum at 480 nm (lesser peaks in the short-wave UV range) and an emission peak at 520 nm. When bound to dsDNA, fluorescence enhancement of PicoGreen is exceptionally high; little background occurs since the unbound dye has virtually no fluorescence. PicoGreen is very stable to photobleaching, allowing longer exposure times and assay flexibility.

2.15 Statistical Analysis:

The results were presented as means and standard deviation. Results were analyzed using ANOVA. A value of P<0.05 was considered as statistically significant. 34

CHAPTER III

Results and Discussion

3.1. Animal model:

Bone is a dynamic organ which aid in locomotion, support and protection to the entire organ system of an organism. Aging seems to affect bone and the extent to which it has been affected is not much understood. For understanding aging on bone, the use of animal models becomes essential. Large and small animals could be used to study the effects of aging on bone and to correlate the results with that of human. Among small animals, rat is the generally accepted model. The advantages of using rat as an animal model are: (Li. Mosekilde, 1995)

 The study can be conducted under very standardized conditions.  It is relatively cheap.  It is relatively short-term.  Rats have cancellous bone remodeling with remodeling sites very similar to those seen in human cancellous bone.  It is easy to perform biomechanical tests on rat bones under standardized conditions.  The anatomy of the rat skeleton has many similarities with the human skeleton (e.g. seemingly no periosteal cover on the proximal part of the femoral necks).

For the present study Sprague Dawley (SD) female rats of different age groups- 1 month old, 7 months old and 15 months old (Fig 1)were used. The age group was selected on the basis that the peak bone mass in female rat is reached by 8 months and further on the bone mass starts declining (Frost and Jee, 1992).

3.2. Mechanical testing:

Bone has the ability to withstand physiological loading conditions without any fracture. Fractures occur when stress from the load exceeds the material strength of the bone. Bone strength decreases either due to change in the tissue level material property or due to change in structural property which is dependent on bone remodeling (Davison et al., 2006).

With aging an increase in the mineralization has been reported which increases the bone stiffness. This also makes the bone more brittle leading to increased risk of fracture (Currey et al, 1996). The collagen also contributes to the mechanical property as it helps to absorb the maximum energy before a bone

36 will fracture. Bone collagen contributes to the toughness of the bone rather than its stiffness (Zioupos, 2001). One of the reasons for increased mechanical property in this study may be due to the fact that the collagen loss may not have started yet which in turn reduces the fracture incidences with increased mineralization.

The diameter and thickness of the cortex of the bone also have a major role on the biomechanical integrity (Oxlund et al., 1993). The bones with thicker cortex mainly contribute to the bone strength and thinner cortexes are more prone to fracture (Crabtree et al., 2001). With normal aging there is an increase in the diameter of the bone which increases their strength even though losses of bone from the endocortical surface are greater than the bone deposited in the periosteal surface (Link et al., 2000).

The tibia from SD rats was used for mechanical testing. The parameters analyzed were load at max, displacement at maximum, stress at maximum load, strain at max load and Young’s modulus. Load at maximum is the ability of the sample to withstand maximum load just before the fracture which is directly proportional to the stiffness of the bone. Displacement at maximum is the extent to which the sample adjusts to withstand the load. Stress is the force acting per unit area by the load. It is the ability of the bone to withstand the load. It is directly related to the mineral content of the bone. With increasing mineral content the stress also increase. Strain is the deformation per unit length to the load. Strain is linked to the collagen content. Young’s modulus is a ratio of stress to strain and is a measure of the stiffness of the bone. Except for the strain at max load all parameters seemed to increase with age groups whereas strain seemed to decline (Table 1). Load at max and displacement at max increases with increase in age (Fig. 2) and stress at max load increases with increase in age (Fig 3). The strain at max load was high in young animal and with age it declines (Fig. 4). The decline in strain with aging might be due to the loss of collagen which makes the

37 bone stiffer and increases the fracture susceptibility. Young’s modulus (Stress/Strain) of the tibia from SD rats of different age groups shows an increase with age (Fig 5). Except for Young’s modulus the differences were not statistically significant.

Table 1: Mechanical testing on the tibia from different age groups of SD rats

Age Groups of Load at Displacement Stress at max %Strain at Modulus SD Rats max (KN) at max (mm) load (MPa) max load (%) (AutYoung) (MPa)

1 month 0.09±0.04 0.27±0.08 36.70±16.13 3.09±0.97 1546.56±505.88

7 months 0.28±0.01 0.31±0.10 63.51±8.14 2.79±1.04 3068.65±783.65

15 months 0.30±0.03 0.36±0.12 64.83±16.95 2.96±0.78 3654.22±1078.98

3.3. Histology:

The PMMA embedded samples were sectioned and stained with Stevenels Blue van Gieson picrofuchsin. The Stevenels blue which contains methylene blue and potassium permanganate stains the nucleus blue whereas the van Gieson picrofuchsin which contains picric acid and acid fuchsin stains collagen yellow.

Epiphyseal plate is the region from which the bone grows in its length. It is mainly formed of the cartilage cells which are constantly dividing. As the cells formed from the epiphyseal plate gets old they begin to ossify and become a part of the bone. Bone growth occurs when the layers of ossified cells build up in size. Once the entire growth plate is ossified, all that remains of the epiphyseal plate is a thin dark mark called the epiphyseal line.

In 1 month old young female rat (Fig 6A), the epiphyseal growth zone of the tibia was broader with cartilage cells arranged in regular columns. Each cartilage cells were separated by thin wall of chondromucoid matrix. As the age progressed the width of the epiphyseal line decreased. At 7 months old (Fig 6B) the epiphyseal plate was reduced to half the width when compared to young rat. The cartilage cells could be distinguished but it was seen dispersed and the

41 epiphyseal line was seen to be irregular. In 15 months old animal (Fig 6C) the epiphyseal plate was converted to epiphyseal line and its thickness is greatly reduced. Calcification and Ossification of the epiphyseal line had taken place. The number of cartilage in the epiphyseal line is further more reduced. This indicates that aging has started in 15 months old animal and the extent of aging and its relation to mineral loss need to be analysed.

The trabecular bone in the both ends of the epiphyseal line also showed signs of bone loss. The trabecular bone in the lower region becomes thinner and the void spaces between the trabecular network increases from 7 months to 15 months old animal. Even though the bone loss from the trabeculae of 15 months old animal is not evident in the mechanical properties, the bone has commenced to weaken as evident from the decline in strain.

3.4 SEM EDAX Analysis:

SEM images of the cortical and trabecular regions below the epiphyseal line were taken and EDAX spectrum of cortical and trabecular regions were compared to analyze the changes in mineral content with aging.

3.4.1 Cortical region

The SEM images of the cortical region of the tibia from different age grouped animals (Fig 7A-C) do not show much difference. So to check for change in the mineral content EDAX spectrum was obtained. SEM EDAX result of the cortical regions (Fig 8) showed an increase in the phosphorus levels with aging whereas the calcium levels tend to decline, which may be possibly due to increased mineralization which increased the mechanical parameters with aging (Currey et al, 1996).

3.4.2 Trabecular region

SEM image of the trabeculae (Fig 9 A) from 1 month old rat showed that the trabecular network is being formed and the void space in between the network was very less as bone formation is in progress. In 7 months old animals (Fig 9 B) the trabecular network was completely formed and the trabecular spaces were well arranged. In 15 months old animal (Fig 9 C)the trabecuale got thinner and the trabecular spaces got widened indicating the onset of bone loss from the trabecular region (Davison et al., 2006). This further supported the data from SEM EDAX. The SEM EDAX of the trabecular region showed a decrease in the phosphorus and calcium level which may be considered as a sign of bone loss (Fig. 10).

The results from histology and SEM EDAX showed that the onset of bone loss from rats appears to be much earlier (15 months) from the trabecular region. But the loss from the cortical region which greatly influenced the mechanical properties may be evident only at later stages (24 months). The early onset of bone loss from trabeculae could serve as a tool in diagnosing the quality of bone individually with aging and use of therapeutics for preventing bone loss.

3.5 Serum Analysis of Calcium and Phosphorus

Serum analysis from 1 month and 15 months old animal (Fig.11) showed that the calcium levels increased with aging whereas the phosphorus declined. The increase in calcium levels in the serum can be correlated to the trabecular bone loss evident from the SEM EDAX. With aging the balance of the remodeling gets impaired which results in the activation of the osteoclasts. The activation of the osteoclasts may result in increased resorption of bone with increased release of minerals into circulation and it may be one of the reasons for an increase in calcium level in serum.

3.6. Confocal Raman Spectroscopy:

To analyse the change in the mineral content of the tibial bone and how aging affects the mineral constituents of the bone, Confocal raman spectroscopy was used. In this the bone samples from 1 month, 7 months and 15 months old female SD rats were powdered and analysed (Fig 12)

Raman spectroscopy yields at least three important composition measures that are components of bone quality. These are: mineral-to-matrix ratio, carbonate-to-phosphate ratio and mineral crystallinity. Since raman spectroscopy is affected by Raman scattering efﬁciency and other optical effects such as grain size, refractive index, and surface roughness of the specimen relative peak intensities or peak areas of selected pairs of bands were studied. They include dividing the primary phosphate band (approximately 959 cm-1) by the amide I band (1616–1720 cm-1) (Table 2) corresponds to the mineral-to- matrix ratio, which indicates the amount of mineralization (McCreadie et al., 2006). Raman measures of carbonate-to-phosphate (at 959 cm-1) ratios can provide valuable insights into the chemical composition of bones because it varies with bone architecture, age, and mineral crystallinity (Legros et al., 1987). The most experimentally accessible Raman measure of mineral crystallinity is the half maximal height of the primary phosphate band near 959 cm-1 (Faibish et al., 2006).

Table 2: Phosphate, Carbonate, amide I peak and the ratio of the intensities from different age group of rats

Carbonate substitution Peaks Phosphate Carbonate Amide 1 Mineralization Crystallinity

1 month 478.96 230.02 103.31 4.64 2.08 27.20

7 months 766.04 234.01 142.6 5.37 3.27 24.15

15 months 1349.1 356.95 187.44 7.19 3.78 23.39

With aging there was an increase in the mineralization and carbonate substitution. The increase in mineralization with aging increase the stiffness of the bone thus decreasing the toughness. As a result the bone becomes more

47 brittle and increases the risk of fracture formation (Davison et al., 2006). The increase in the carbonate substitution in place of phosphate and hydroxyl groups makes bone more brittle thus reducing the fracture toughness. So with aging the fracture susceptibility also increase. This is due to the loss of phosphate which changes the shape of mineral crystals, deteriorates the lattice symmetry and creates vacancies within the crystal lattice (Davison et al., 2006). The crystallinity which accounts for the strength of the bone seemed to decrease with aging. This might be due to the decline in the number of the mineral crystal due to coalescing of crystals. This can also lead to reduced toughness.

3.7 Real time Polymerase chain reaction:

Expression of RANKL and OPG from the whole bone was normalized to the expression of GAPDH. Relative expression of RANKL gene in bone was markedly increased with advancing age from 1 month to 15 months old (Fig 13). Compared with 1 month old rat the expression of RANKL was 9.7 folds higher in 15 months old rat. Whereas the relative expression of OPG gene was only 3.6 fold in 15 months old rat when compared to that of 1 month old rat. Similar increase in the OPG levels was shown by Kiviranta et al., 2005, in age groups of 2 and 12 months old mouse. The gene PP2ACα seemed to increase nearly 7 fold with aging.

Expression of RANKL and OPG from the study showed that the increase in the RANKL is not in proportion with OPG gene with advancing age in female Sprague Dawley rats and RANKL/ OPG ratio increased slightly with aging (Fig 14). Because of the opposing nature of OPG on RANKL action (Lacey et al., 1998) this would be expected to stimulate bone turnover and promote loss of bone (Burges et al., 1999). The age- related loss of bone can be correlated to the change in the expression of the RANKL and OPG genes which is accompanied by an increase in osteoclast progenitor pool population.

Since the expression of OPG (antagonist of osteoclast activation) remained increased and the bone loss from the trabecular region was enhanced the role of another osteoclast activator (PP2A Cα) was studied. The expression of PP2A Cα seemed to increase with aging. This might be one of the reasons for the activation of the osteoclast precursors and subsequent enhanced bone loss from the trabecular region. Okamura et al., 2011 showed that the expression RANKL and osteoclast specific gene increased in presence of PP2A Cα and it declined when PP2A Cα is knocked out. So even though the OPG, which is a regulator of osteoclast increase with age, it might be the PP2A Cα which promote osteoclastogenesis.

3.8 Stemness of Bone marrow:

Adult mesenchymal stem cell (MSC) has the potential to differentiate into chondrocytes, osteoblasts, adipocytes, fibroblasts, marrow stroma, and other tissues of mesenchymal origin. They reside in a diverse host of tissues throughout the adult organism and possess the ability to 'differentiate' cell types specific for tissues - bone marrow, adipose tissue, periosteum, muscle, blood, dermis etc. (Tuan et al., 2003). Of these tissues bone marrow is the most widely used one followed by adipose tissue. To check whether decline in osteogenic potential of the bone marrow derived MSCs with aging (D’lppolito et al., 1999) is due to the decline in progenitor cells in the bone marrow, FACS analysis was done. For flow cytometry CD 90 marker, a marker for stemness, was used (Fig. 15).

FACS showed that stem cells in the bone marrow declined with aging. In 1 month old rat there was 35.4% positive cells for CD 90 which denotes MSCs out of the heterogenous population in the bone marrow which includes HSC and other cells. Whereas as age increased, the stem cells also decreased and it declined to 11.6%. The decline in stem cells in the bone marrow may be due to increased senescence of the cells which led to apoptosis or it might be due to the influence of the aging bone marrow niche which reduced the stemness of progenitor cells. To confirm this further studies need to be carried out which includes the characterization of MSC from early passages. The decline in the progenitor cells from the bone marrow with aging indicated that the use of MSCs from older persons for cell based therapy may not be much effective.

CHAPTER IV

Results and Discussion

4.1. Adipose derived mesenchymal stem cells (1 month old and 15 month old female SD rats)

4.1.1 Isolation from Sprague Dawley Rats:

Adipose derived MSCs were isolated from the subcutaneous fat pads of 1 month old and 15 months old female Sprague Dawley rats as per the guidelines of Institutional Animal Ethics Committee (ICAE).

In the field of regenerative medicine Mesenchymal stem cells are of importance due to its multilineage potential and are present in various sites including bone marrow and adipose tissue. Isolation of MSCs from adipose tissue have advantages over bone marrow due to the ease with which adipose tissue can be accessed as well as the ease of isolating stem cells from harvested tissue (Schäffler et al., 2007). Initial enzymatic digestion of adipose tissue yields a mixture of stromal and vascular cells referred to as the stromal-vascular fraction (SVF) (Traktuev et al., 2008). MSCs from SVF were selected by the plastic adherence property of MSC. For this the adipose tissue was digested with collagenase type I, filtered, centrifuged and seeded on to 25 cm2 flask with medium. The non adherent cells are removed after 24 hours by changing the medium.

The images of the isolation flask on day 5 and day 7 showed that the number of cells on day 5 and day 7 in the flask from young rats is higher than older rats (Fig. 16). On day 5 the young cells reached almost 70 - 80% confluent whereas the older cells reached just 40- 50%. On day 7 the young cells became 100% confluent whereas the old cells attained only 70- 80% confluency. The

52 indicates that the proliferation rate of young cells escalates and as age progresses the potential declines or it may be due to the decline in the initial available stem cells.

4.1.2 Expansion of rat ADMSC and Proliferation rate:

The MSCs isolated from the adipose tissues were proliferated in 25 cm2 flask which became confluent by 7- 9th day (Fig. 17). The cells from the 1 month old rat became confluent by 7th day whereas the cells from the old rat became confluent only by 9th day. The cells upon reaching 90% confluency were trypsinised, centrifuged and seeded in 25 cm2 flasks to expand the cells. Further the 1 month old cells just took 2 days to reach confluency during every passage whereas the 15 months old cells took 3 days. After passage P4 the cells from the 15 months old rat looses it characteristic fibroblast morphology whereas the young cells maintained the morphology. The size and granularity of the cells also seemed to increase with aging. This indicated that the aging affects the proliferation and the morphology of the MSCs (Bonab et al., 2006).

4.2. Characterization of ADMSC:

Isolated MSCs were characterized at P4 passage to confirm the stemness property of the cells. For characterization CD marker was used. There is no CD marker which is confined to MSCs alone, but several positive and negative markers for MSCs have been identified so far (Sally and Elena, 2012). CD 90 (Thy 1 antigen) is one among the positive markers for MSCs and functions in mediating cell-cell interactions, adhesion of monocytes and leukocytes to endothelial cells and ﬁbroblasts and may have a role in the stromal adherence of CD34+ cells.

Cells from both the 1 month and 15 months old rats were found to be positive for the CD 90 marker (Fig 18). The 1 month old cells showed 87.7% positivity to CD 90 where as the 15 months old cells showed 83.5% positivity. The percentage of positive cells from 1 month and 15 months old cells were almost similar indicating that ADMSCs can serve as an autologous source of cells even with aging due to its availability and ease isolation.

4.3 Cell proliferation:

4.3.1 Alamar Blue Assay:

The osteogenically induced and uninduced cells of P4 passages from 1 month and 15 months old rats were used for alamar blue assay. In both osteogenically induced and uninduced cells the proliferation rates were higher in the 1 month old cells when compared to that of the 15 months old cells (Fig 19). Both the 1 month old and 15 months old cells showed higher proliferation during the initial stages, ie., 24 hours. As the time progressed the proliferation rate declined. This might be due to the fact that the nutrients uptake by the cells for

55 proliferation must be higher during initial stages of growth and as time progresses the byproducts of the metabolism from the cells might have reduced the proliferation.

Interestingly the differentiated cells showed much more proliferation rate when compared to that of the undifferentiated ADMSCs. This could be due to the fact that the growth factors which where supplemented to the medium for osteogenic induction might have enhanced the proliferation (Mantovani et al., 2012).

4.3.2 PicoGreen assay:

The proliferation of osteogenically induced cells with aging was analyzed by picogreen assay after 7 days culture (Fig 20). The aged groups showed a decline in the proliferation potential with aging which was significant (p<0.05). The decline in the proliferation potential of osteogenically induced cells with aging was a setback for the use of autologous cells in aged subjects even though the cell viability remained almost the same. This problem may be overcome with the use of special growth factors and supplements which could enhance the cell proliferation without affecting the cellular integrity.

4.4 Glucose assay from the medium:

The osteogenic medium from the P4 cell cultures were analysed for the glucose content for 7 days.

The glucose level in the osteogenic medium collected from P4 ADMSCs of 1 month and 15 months old rats for every 7 days (Fig 21), which could serve as an indicator of the metabolic activity of cells, showed an increase with the increase in days of culture. This result was in correlation with proliferation assay by alamar blue because in initial stages of seeding the proliferation potential of ADMSCs were high which utilized maximum nutrients from the medium (Folmes et al., 2012) and hence the glucose level declined. As the culture progressed, the proliferation potential decreased which increased the glucose level in the medium. Between aged groups, 15 months old animal had maximum glucose level from day 1 to day 7 when compared to that of the 1 month old cells as the proliferation potential of cells decreased with aging.

4.5 Osteogenic induction:

ADMSCs from 1 month and 15 months old were made osteogenic with osteogenic induction medium containing dexamethasone, L- ascorbic acid, β glycerophosphate for 7 days. The osteogenic potential of young and old ADMSCs were analysed by the alkaline phophatase activity, deposition of calcium and phosphorus. Both alizarin red staining and von Kossa staining represent qualitative measurement of the osteogenic potential of ADMSCs (Fig 21).

4.5.1 Alizarin red staining (Calcium)

The osteogenically induced cells from 1 month and 15 months old rats stained positively for alizarin red. An overall decreased osteogenic potential was found with increased age. In 1 month old rat the coverslip was uniformly stained troughout indicating the deposition of the calcium. Whereas age progressed the uniformity of the stain decreased due to the decline in the deposition of the calcium. The intensity of uptake of the stain was higher in young cells which declined with aging. The nodule which represents the mineralization seemed to be higher in 1 month when compared that of 15 months old. The change in the calcium deposition and nodule formation might be due to the decrease in proliferation and differentiation with aging. The aged cells proliferate slower which resulted in lower cell number and decreased cell interaction leading to lower mineral deposition.

4.5.2 Von Kossa Staining (phosphorus)

For determining the phosphorus deposition in osteogenically induced cells von kossa staining is used. The P4 cells from 1 month and 15 months old cells were used and staining was carried out after 7 days of osteogenic induction. There was a decrease in the phosphorus content upon osteogenic induction for 7 days. The 1 month old cells stained throughout the coverslips and the nodule 59 formation was more than 15 months old cells. This implies that the osteogenic potential of the cells decreased with progress in age.

The change in the mineral deposition and nodule formation might be due to decrease in proliferation and differentiation with aging. The aged cells proliferate slower which may have resulted in lower cell number and decreased cell interaction leading to lower mineral deposition. The differences in the staining intensity were very low and it might be due to minimum duration (7 days) of osteogenic induction. A marked decline in the staining could be noticed on longer osteogenic induction (D’Ippolito et al., 1999; Roura et al., 2006).

4.6 Cell viability and proliferation:

4.6.1 Lactate dehydrogenase assay (cell viability)

Lactate dehydrogenase assay was used to measure the viability of the cell (Korzeniewski et al., 1983). Lactate dehydrogenase assay of cells from 1 month and 15 months old cells (Fig 22) showed a decrease in the cell viability with aging. But the decrease in the cell viability was not significant (p>0.05) indicating that the cells which were osteogenically induced continue to be viable and the aging has not much influence on the viability of the cells. The cellular senescence is not much evident until 15 months. The results indicated the possibility of the use of autologous cells from aged subjects since the viability is not affected much. More studies are needed to be carried out to confirm the cell viability with aging in long term osteogenic induction and much more older cells.

Summary and Conclusion Bone is a dynamic tissue which plays an important role in homeostasis of calcium and phosphorus and provides a niche for bone marrow development. In humans, peak bone mass is attained during the third decade of life. Subsequently, bone mass declines slowly with advancing age. Any slight deviation from the normal functioning of bone affects the function of the entire organ system directly or indirectly. There are numerous studies regarding the remodeling of bone, its regulation and how various diseases like osteoporosis, osteoarthritis etc affects the bone turnover. But there is little information about the mechanisms by which aging influences bone loss and also the stem cell potential. A better understanding of age related changes in bone cells and tissue in terms of mechanical, bio-chemical, molecular and stem cell characteristics may offer new approaches to mitigate or avoid bone loss with aging and help in the improvement of therapeutics for the aged population. To understand the effect of aging on bone and its influence on bone turnover, Female Sprague Dawley rats of different age groups (1, 7 and 15 months old) were selected. Mechanical properties of tibia were analyzed and interestingly it seemed to increase with age. But it was evident that the decrease in strain, indicates that the collagen loss has started making the bone more brittle and susceptible to fractures in 15 months old animal model. With further advancement of age a sharp decline in mechanical strength may also be expected, since bone loss gets accelerated and bone becomes more fragile. Increasing serum Ca level also enhanced bone turnover and bone loss. Histology of undecalcified sections of tibial head exhibited the conversion of epiphyseal plate to epiphhyseal line and gave evidence for the onset of trabecular loss since the trabecular bone below the epiphyseal line became thinner and the inter-trabecular spaces in marrow cavity increased greatly. To evaluate the extent of bone loss SEM EDAX analysis was performed which depicted an increase in mineral content (Ca and P) for the cortical region with a

62 decrease in the trabecular region, indicating that the bone loss has started in the trabecular region being the active areas of bone remodeling. Raman spectroscopy studies proved that the crystallinity decreased with aging, thus making the bone more brittle and prone to fracture. From the above results it can be inferred that even though 15 months old rat model exhibited an increased mechanical strength and mineralization in the cortical region, bone loss was evident in the trabeculae region To evaluate and understand the molecular basis for increased bone loss the expression of key players of osteoclast cells in regulating bone turnover - RANKL and OPG was analyzed using Real time PCR. RANKL/OPG ratio was higher in 15 months old rats. Nearly 10 fold increased RANKL expression indicated the extent of accelerated bone turnover with aging. Since the level of OPG (antagonist to osteoclast activation) was seen increasing with aging, OPG may not be directly involved in increased bone turn-over. So the role of another potential candidate gene PP2ACα was analyzed. The expression of PP2A Cα showed an increased expression. This gene could be a suitable drug target to increase the bone quality with aging. The potential of stem cells derived from aged rats was evaluated for its efficacy to suit tissue engineering applications. The use of autologous stem cells from the aged may promote cell based therapies. Among the autologous cell sources – adipose derived mesenchymal stem cells (ADMSC) or Bone marrow derived mesenchymal stem cells (BMSC) are the most preferred choices. To quantify the number of stem cell progenitors available from each source, CD 90 positive cells was quantified using flow cytometry. On quantification, CD 90 positive cells from bone marrow exhibited a decrease in 15 months old rats, while that of ADMSC was almost comparable when compared with the young rats. It was obvious that ADMSC is a better choice since it could retain comparatively more number of progenitor stem cells that have the potential to be differentiated into different lineages. ADMSC has also yet another advantage due to the ease

63 with which adipose tissue can be accessed as well as the ease of isolating stem cells from harvested tissue. In-vitro studies indicated that proliferation and differentiation potential of the cultured ADMSCs seemed to decline with aging evident from von kossa and alizarin staining and lactate dehydrogenase and picogreen assay of un-induced and osteogenically induced cells. The study suggests that with aging there might be intrinsic change or decline in the metabolic activities of the stem cell population that may affect the physiological function and the potential of autologous ADMSC. The decline in the number of stem cell progenitors can be compromised using specialized culture niches delivering growth factors. This may improve the in-vitro differentiation and proliferation potential of the MSC from aged group to suit stem cell therapy applications. Taken together the study concludes that there is an increase in bone turnover with aging in the expression of RANK L and PP2Acα involved in accelerated trabecular loss. Morphological and functional differences and decline in the proliferation potential of ADMSC isolated from different age groups indicated the physiological senescence of these cells with aging. Future perspectives include the use of much more older rats (24 months) to analyze all the parameters and study the effect of aging in extreme old conditions. Further studies need to be done to analyze how PP2ACα regulates bone turnover, whether it directly activates osteoclast or does it influence RANK L production, so that the data may be used for gene targeting and drug designing. In-vitro proliferation and the differentiation potential of ADMSCs for longer culture period need to be evaluated to know whether terminal differentiation markers are expressed by the cells isolated from the aged group. Increased understanding of the biological and molecular mechanisms of bone loss and stem cell potential with aging will expand their functional applications in tissue engineering and maximize their therapeutic use.

REFERENCES

Arino J, Woon CW, Brautigan DL, Miller TB, Johnson GL. Human liver phosphatase 2A: cDNA and amino acid sequence of two catalytic subunit isotypes. Proc. Natl. Acad. Sci. 1988; 85: 4252–4251.

Bazin D, Chappard C, Combes C, Carpentier X, Rouziere S, Andre G, Matzen G, Allix M, Thiaudiere D, Reguer S, Jungers P, Daudon M. Diffraction techniques and vibrational spectroscopy opportunities to characterise bones. Osteoporosis Int. 2009; 20:1065–1075.

Bellantuono I, Aldahmash A, Kassem M. Aging of marrow stromal stem cells and their contribution to age related bone loss. Biochimica et biophysica acta. 2009; 1792: 364-370

BoivinG,Meunier PJ.Changes in bone remodeling rate inﬂuence the degree of mineralization of bone. Connect Tissue Res. 2002; 43: 535-537.

Bonab MM, Alimoghaddam F, Talebian F, Ghaffari SH, Ghavamzadeh A, Nikbin B. Aging of mesenchymal stem cell in vitro. BMC Cell Biology. 2006, 7:14

Burgess TL, Qian Y, Kaufman S, Ring BD, Van G, Capparelli C, et al. The ligand for osteoprotegrin (OPGL) directly activates mature osteoclasts. J Cell Biol. 1999;145:527–38.

Cao J, Venton L, Sakata T, Halloran BP. Expression of RANKL and OPG correlates with age-related bone loss in male C57BL/6 mice.J Bone Miner Res. 2003;18(2):270-7.

Chahal H S, Drake W M. The endocrine system and aging. Journal of Pathology. 2007; 211: 173– 180.

Cindy de Pollak, Arnaud E, Renier D, Marie PJ. Age-Related Changes in Bone Formation, Osteoblastic Cell Proliferation, and Differentiation During Postnatal Osteogenesis in Human Calvaria. Journal of Cellular Biochemistry. 1997; 64:128–139.

Colter DC, Class R, DiGirolamo CM, Prockop DJ. Rapid expansion of recycling stem cells in cultures of plastic-adherent cells from human bone marrow. Proc Natl Acad Sci. 2000; 97: 3213–3218.

Crabtree N, Loveridge N, Parker M, Rushton N, Power J, Bell KL, et al. Intracapsular hip fracture and the region-speciﬁc loss of cortical bone: analysis by peripheral quantitative computed tomography. J Bone Miner Res. 2001; 16: 1318- 1328.

Currey JD, Brear K, Zioupos P. The effects of aging and changes in mineral content in degrading the toughness of human femora. J Biomech. 1996; 29: 257- 260.

"Davison KS, Siminoski K, Adachi JD, Hanley DA, Goltzman D, Hodsman AB, Josse R, Kaiser S, Olszynski WP, Papaioannou A, Ste-Marie LG, Kendler DL,Tenenhouse A, Brown JP. Bone Strength: The Whole Is

Greater Than the Sum of Its Parts. Semin Arthritis Rheum. 2006 ;36(1): 22-31."

D'Ippolito G, Schiller PC, Ricordi C, Roos BA, Howard GA. Age related Osteogenic potential of Mesenchymal stromal stem cells from Humaan vertebral bone marrow. Journal of Bone and Mineral research. 1999; 14: 1115- 1122.

Dunstan CR, Somers NM, Evans RA. Osteocyte death and hipfracture. Calcif Tissue Int. 1993; 53: 113-116.

Faibish D, Ott SM, Boskey AL. Mineral changes in osteoporosis: a review. Clin Orthop Relat Res. 2006;443:28–38.

Fehrer C, Brunauer R, Laschober G, Unterluggauer H, Reitinger S. Reduced oxygen tension attenuates differentiation capacity of human mesenchymal stem cells and prolongs their lifespan. Aging Cell. 2007; 6: 745–757.

Folmes CDL, Dzeja PP, Nelson TJ, Terzic A. Metabollic Plasticity in Stem Cell Homeostasis and Differentiation. Cell Stem Cell. 2012; 11: 596-606.

Frost HM, Jee WSS. On the rat model of human osteopenias and oateoporosis. Bone and Mineral. 1992; 18: 227-236.

Frost HM. Why should many skeletal scientists and clinicians learn the Utah paradigm of skeletal physiology? J Musculoskelet Neuronal Interact. 2001; 2: 121–130.

Gazit R, Weissman IL, Rossi DJ. Hematopoietic stem cells and the aging hematopoietic system. Semin Hematol. 2008; 45,: 218–224.

Giangreco A, Qin M, Pintar JE, Watt FM. Epidermal stem cells are retained in vivo throughout skin aging. Aging Cell. 2008; 7: 250–259.

Goldman HM, McFarlin SC, Cooper DM, Thomas CD, Clement JG. Ontogenetic patterning of cortical bone microstructure and geometry at the human mid-shaft femur. Anat Rec (Hoboken). 2009; 292: 48-64.

Guo XE, Kim CH. Mechanical consequence of trabecular bone loss and its treatment: a three-dimensional model simulation. Bone. 2002; 30: 404-411. 66

Hakeda Y, Kobayashi Y, Yamaguchi K, Yasuda H, Tsuda E, Higashio K, Miyata T, Kumegawa M. Osteoclastogenesis inhibitory factor (OCIF) directly inhibits bone-resorbing activity of isolated mature osteoclasts. Biochem Biophys Res Commun. 1998; 251:796–801.

Henriksen K, Leeming DJ, Byrjalsen I, Nielsen RH, Sorensen MG, Dziegiel MH, Martin TJ, Christiansen C, Qvist P, Karsdal MA. Osteoclasts prefer aged bone. Osteoporos Int. 2007; 18: 751-759.

Hernandez CJ, Beaupre GS, Keller TS, Carter DR. The inﬂuence of bone volume fraction and ash fraction on bone strength and modulus. Bone. 2001; 29: 74- 78.

Hhsu H, Lacey DL, Dunstan CR, Solovyev I, Colombero A, Timms E, et al. Tumor necrosis factor receptor family member RANK mediates osteoclast differentiation and activation induced by osteoprotegrin ligand. Proc Natl Acad Sci USA. 1999;96:3540–5.

Justesen J, Stenderup K, Eriksen, Kassem M.. Maintenance of osteoblastic and adipocytic differentiation potential with age and osteoporosis in human marrow stromal cell cultures, Calcif Tissue Int. 2002; 71: 36–44.

Karanjawala ZE, Lieber MR. DNA damage and aging. Mech Aging Dev. 2004; 125: 405–416.Khew-Goodall Y, Hemmings BA. Tissue-specific expression of mRNAs encoding a and b catalytic subunits of protein phosphatase 2A. FEBS Lett. 1988; 238: 265-268.

Kirkwood TB, Holliday R. The evolution of aging and longevity. Proc R Soc Lond B Biol Sci. 1979; 205: 531–546.

Kiviranta R, Morko J, Alatalo SL, NicAmhlaoibh R, Risteli J, Laitala-Leinonen T, Vuorio E. Impaired bone resorption in cathepsin K-deficient mice is partially compensated for by enhanced osteoclastogenesis and increased expression of other proteases via an increased RANKL/OPG ratio. Bone. 2005;36(1):159-72.

Kohli SS, Kohli VS. Role of RANKL–RANK/osteoprotegerin molecular complex in bone remodeling and its immunopathologic implications. Indian J Endocrinol Metab. 2011; 15(3): 175–181.

Kong Y, Yoshida H, Sarasi I, Tan HL, Timms E, Capparelli C, et al. OPGL is a key regulation of osteoclastogenesis, lymphocyte development and lymph-node organogenesis. Nature. 1999;397:315–23.

Korzeniewski C, Callewaert DM. An Enzyme- Relaese Assay for Natural Cytotoxicity. Journel of Immunology Methods. 1983; 64: 313- 320.

Lacey DL, Timms E, Tan HL, Kelley MJ, Dunstan CR, Burgess T, et al. Osteoprotegrin ligand is a cytokine that regulates osteoclast differentiation and activation. Cell. 1998;93:165–76.

Legros R, Balmain N, Bonel G. Age-related changes in mineral of rat and bovine cortical bone. Calcif Tissue Int. 1987;41: 137–144.

Li J, Sarosi I, Yan XQ, Morony S, Capparelli C, Tan HL, et al. RANK is the intrinsic hematopoetic cell surface receptor that controls osteoclastogenesis and regulation of bone mass and calcium metabolism. Proc Natl Acad Sci U S A. 2000;97:1566–71.

Mantovani C, Raimondo S, Haneef MS, Geuna S, Terenghi G, Shawcross SG, Wiberg M. Morphological, molecular and functional differences of adult bone marrow- and adipose-derived stem cells isolated from rats of different ages. Exp Cell Res. 2012;318(16):2034-48.

Matsuo K, Galson DL, Zhao C, Peng L, Laplace C, Wang KZ, et al. Nuclear factor of activated T-cells (NFAT) rescues osteoclastogenesis in precursors lacking c-Fos. J Biol Chem. 2004;279:26475–80.

McCreadie BR, Morris MD, Chen TC, Sudhaker Rao D, Finney WF, Widjaja E, Goldstein SA. Bone tissue compositional differences in women with and without osteoporotic fracture. Bone. 2006; 39:1190–1195.

Meunier PJ, Boivin G. Bone mineral density reﬂects bone mass but also the degree of mineralization of bone: therapeutic implications. Bone. 1997; 21: 373- 377.

Mori S, Harruff R, Ambrosius W, Burr DB. Trabecular bone volume and microdamage accumulation in the femoral heads of women with and without femoral neck fractures. Bone. 1997; 21: 521-526.

Muraglia A, Cancedda R, Quarto R. Clonalmesenchymal progenitors fromhuman bone marrow differentiate in vitro according to a hierarchical model, J Cell Sci. 2000; 113: 1161–1166.

Okamura H, Di yang, Yoshida K, Haneji T. Protein phosphatase 2A Ca is involved in osteoclastogenesis by regulating RANKL and OPG expression in osteoblasts. FEBS Letters. 2013; 587; 48–53.

Okamura H, Yoshida K, Ochiai K, Haneji T. Reduction of protein phosphatase 2A Cα enhances bone formation and osteoblast differentiation through the expression of bone-speciﬁc transcription factor Osterix. Bone. 2011; 49: 368– 375.

Oxlund H, Ejersted C, Andreassen TT, Torring O, Nilsson MH. Parathyroid hormone (1-34) and (1-84) stimulate cortical bone formation both from periosteum and endosteum. Calcif Tissue Int. 1993; 53: 394-399.

Qiu S, Rao DS, Palnitkar S, Parﬁtt AM. Reduced iliac cancellous osteocyte density in patients with osteoporotic vertebral fracture. J Bone Miner Res. 2003; 18: 1657-1663.

Riggs BL, Hodgson SF, O’Fallon WM, Chao EY, Wahner HW, Muhs JM, et al. Effect of ﬂuoride treatment on the fracture rate in postmenopausal women with osteoporosis. N Engl J Med. 1990; 322 :802-809.

Roura S, Farre J, Soler- Botija C, Llach A, Hove- Madsen L, Cairo JJ, Godia F, Cinca J, Bayes-Genis A. Effect of aging on the pluripotential capacity of human CD 105+ mesenchymal stem cells. European Journal of Heart Failure. 2006; 8: 555 – 563

Sally AB, Elena J. Markers for characterization of Bone marrow multipotential stromal cells. Stem Cells international. 2012; 1- 12.

Schäffler A, Büchler C. Concise Review: Adipose Tissue-Derived Stromal Cells- Basic and Clinical Implications for Novel Cell-Based Therapies. STEM CELLS. 2007; 25: 818–827. Snaith HA, Armstrong CG, Guo Y, Kaiser K, Cohen PT. Deficiency of protein phosphatase 2A uncouples the nuclear and centrosome cycles and prevents attachment of microtubules to the kinetochore in Drosophila microtubule star (mts) embryos. J Cell Sci. 1996; 109:3001-12.

Sontag E, Nunbhakdi-Craig V, Bloom GS, Mumby MC. A novel pool of protein phosphatase 2A is associated with microtubules and is regulated during the cell cycle. J Cell Biol. 1995;128(6):1131-44.

Stenderup K, Justesen J, Clausen C, Kassem M. Aging is associated with decreased maximal life span and accelerated senescence of bone marrow stromal cells. Bone. 2003; 33: 919–926.

Stenderup K, Justesen J, Eriksen EF, Rattan SI, Kassem M. Number and proliferative capacity of osteogenic stem cells are maintained during aging and in patients with osteoporosis, J Bone Miner Res. 2001; 16: 1120–1129.

Stone SR, Hofsteenge J, Hemmings BA. Molecular cloning of cDNAs encoding two isoforms of the catalytic subunit of protein phosphatase 2A. Biochemistry. 1987; 26: 7215-7220

Tan KB, Harrop J, Reddy M, Young P, Terrett J, Emery J, Moore G, Truneh A. Characterization of a novel TNF-like ligand and recently described TNF ligand

69 and TNF receptor superfamily genes and their constitutive and inducible expression in hematopoietic and nonhematopoieticcells. Gene. 1997; 204: 35-46.

Traktuev DO, Merfeld-Clauss S, Li J, Kolonin M, Arap W, Pasqualini R, Johnstone BH, March KL. A population of multipotent CD34-positive adipose stromal cells share pericyte and mesenchymal surface markers, reside in a periendothelial location, and stabilize endothelial networks. Circ Res 102(1):77- 85, 2008.

Tuan RS, Boland G, Tuli R. Adult mesenchymal stem cells and cell-based tissue engineering. Arthritis Res Ther. 2003; 5(1): 32–45. von Zglinicki T, Martin-Ruiz CM. . Telomeres as biomarkers for aging and age- related diseases. Curr Mol Med. 2005; 5: 197–203.

Wagner W, Bork S, Horn P, Krunic D, Walenda T. Aging and Replicative Senescence Have Related Effects on Human Stem and Progenitor Cells. PLoS ONE. 2009; 4(6): e5846

Wagner W, Horn P, Castoldi M, Diehlmann A, Bork S. Replicative Senescence of Mesenchymal Stem Cells - a Continuous and Organized Process. PLoS ONE. 2008; 5: e2213..

Wang X, Bank RA, TeKoppele JM, Hubbard GB, Athanasiou KA, Agrawal CM. Effect of collagen denaturation on the toughness of bone. Clin Orthop Relat Res. 2000; 371: 228-239.

Wang X, Li X, Bank RA, Agrawal CM. Effects of collagen unwinding and cleavage on the mechanical integrity of the collagen network in bone. Calcif Tissue Int. 2002; 71: 186-192.

Yasuda H, Shima N, Nakagawa N, Mochizuki SI, Yano K, Fujise N, et al. Identity of osteoclastogenesis inhibitory factor (OCIF) and osteoprotegrin (OPG): A mechanism by which OPG/OCIF inhibits osteoclastogenesis in vitro. Endocrinology. 1998;139:1329–37.

Zhou J, Pham HT, Ruediger R, Walter G. Characterization of the Aalpha and Abeta subunit isoforms of protein phosphatase 2A: differences in expression, subunit interaction, and evolution. Biochem. J.2003; 369: 387–398

Zioupos P. Accumulation of in-vivo fatigue microdamage and its relation to biomechanical properties in aging human cortical bone. J Microsc. 2001; 201: 270-278.

ANNEXURE

Dulbecco’s Modified Essential Medium-High Glucose (DMEM-HG) (10% FBS, 1% Antibiotics) DMEM- HG 445 ml Antibiotics 5 ml FBS 50 ml

Phosphate Buffer saline (PBS) - 1000 ml NaCl 8.0 g KCl 2.0 g

Na2HPO4 1.15g

KH2PO4 2.0 g Dissolved in 1000ml deionised water and then autoclaved.

Osteogenic Medium (500ml) DMEM HG 410 ml FBS 75 ml Antibiotics 5 ml β Glycerophosphate 5ml Dexamethasone 122 μl L Ascorbic acid 5 ml

Sorensen’s Phosphate Buffer (100ml):-

Sorenson’s A (2.76 g 0.2 M NaH2PO4) 81 ml

Sorenson’s B (3.561 g 0.2 M Na2HPO4) 19ml

Paraformaldehyde (100ml):- Paraformaldehyde 3.7g

Sorensen’s buffer 50ml Distilled water 50ml Heat mixture carefully to dissolve paraformaldehyde. Boil with a stopper to avoid fumes coming out.

3% Gluteraldehyde (50ml):- Gluteraldehyde (25%) 6ml Sorensen’s buffer 44ml