US 20090286290A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2009/0286290 A1 HARA et al. (43) Pub. Date: Nov. 19, 2009

(54) METHOD FOR PRODUCING AN L-AMINO (30) Foreign Application Priority Data ACD Dec. 19, 2006 (JP) ...... 2006-341019 (76) Inventors: YOSHIHIKO HARA, Kawasaki-shi (JP); HIROSHI Publication Classification IZUI, Kawasaki-shi (JP): JUN NAKAMURA, Kawasaki-shi (JP): (51) Int. Cl. RANKONISHI, Kawasaki-shi (JP) CI2P I3/24 (2006.01) CI2P I3/04 (2006.01) Correspondence Address: CI2P I3/14 (2006.01) CERMAK KENEALY VADYA & NAKAUMA CI2P I3/10 (2006.01) LLP ACS LLC (52) U.S. Cl...... 435/107:435/106; 435/110; 435/114 515 EAST BRADDOCK ROAD, SUITEB ALEXANDRIA, VA 22314 (US) (57) ABSTRACT

(21) Appl. NoTNO. 12/478,0499 A microorganism which has an L-amino acid producing abil ity and has been modified so that succinate dehydrogenase (22) Filed: Jun. 4, 2009 activity and C-ketoglutarate dehydrogenase activity are O O decreased is cultured in a medium to produce and accumulate Related U.S. Application Data an L-amino acid in the medium or cells of the microorganism, (63) Continuation of application No. PCT/JP2007/067387, and the L-amino acid is collected from the medium or cells to filed on Sep. 6, 2007. produce the L-amino acid.

f W SPMWPlaclacIsacsca

Sect(Ecl136), cat Patent Application Publication Nov. 19, 2009 Sheet 1 of 2 US 2009/0286290 A1

Fig. 1

TERnB Kpn Hindp Cat Kpn Red-t3 sacB Hind

laCl RSF-Red-TER 12568 bp af PlacUV5 Patent Application Publication Nov. 19, 2009 Sheet 2 of 2 US 2009/0286290 A1

Hid US 2009/0286290 A1 Nov. 19, 2009

METHOD FOR PRODUCING ANL-AMNO glutamicum was effective for enhancement of L-glutamic ACD acid-producing ability in a coryneform bacterium belonging to the genus Corynebacterium or Brevibacterium (refer to Japanese Patent Laid-open No. H7-121228). Furthermore, it 0001. This application is a continuation under 35 U.S.C. was reported that introduction of a citrate synthase gene from S120 of PCT Patent Application No. PCT/JP2007/067387, a coryneform bacterium into an enterobacterium belonging to filed Sep. 6, 2007, which claims priority under 35 U.S.C. the genus Enterobacter, Klebsiella, Serratia, Erwinia or S119 to Japanese Patent Application No. 2006-341019, filed Escherichia was effective for enhancement of L-glutamic on Dec. 19, 2006, which are incorporated in their entireties by acid-producing ability (refer to Japanese Patent Laid-open reference. The Sequence Listing in electronic format filed No. 2000-189175). herewith is also hereby incorporated by reference in its 0009. It is also known that microorganisms which are defi entirety (File Name: US-398 Seq List: File Size: 199 KB: cient in C-ketoglutarate dehydrogenase (C-KGDH) produce a Date Created: Jun. 4, 2009). marked amount of L-glutamic acid (EP771879 A. EP0952221A, EP1078989 A). BACKGROUND OF THE INVENTION 0010. Succinate dehydrogenase (SDH) is an enzyme which catalyzes the reaction of converting Succinic acid to 0002 1. Field of the Invention fumaric acid, and it was reported that a coryneform bacterium 0003. The present invention relates to a method for pro deficient in the gene of this enzyme produced a small amount ducing an L-amino acid such as L-glutamic acid using a of L-glutamic acid (EP1106684 A). microorganism. L-Glutamic acid is useful as an ingredient of 0011 Furthermore, although a succinate dehydrogenase seasonings, and the other L-amino acids are useful in industry deficient strain is also known for Escherichia coli belonging as animal feed additives, health food ingredients, amino acid to the enterobacteria (J. Gen. Microbiol., 1978 July; 107 (1): infusions, and the like. 1-13), the relationship between Succinate dehydrogenase 0004 2. Brief Description of the Related Art deficiency and L-glutamic acid production has not been pre 0005 Methods for producing a target substance such as an viously reported. L-amino acid by fermentation using a bacterium can include methods of using a wild-type bacterium (wild-type strain), an 0012. Furthermore, it is known that if C.-ketoglutarate auxotrophic strain derived from a wild-type strain, a meta dehydrogenase is deleted in an Escherichia coli strain, the bolic regulation mutant strain derived from a wild-type strain strain becomes Succinic acid auxotrophic, but the double as a strain resistant to various drugs, a strain having properties deficiency of SDH and C.-ketoglutarate dehydrogenase of both auxotrophic strain and metabolic regulation mutant, causes the Strain to recover from the Succinic acid auxotrophy and the like. (J. Gen. Microbiol., 1978 July; 107 (1): 1-13). However, the 0006 For example, L-glutamic acid can be produced by effect of the double deficiency of O-ketoglutarate dehydroge fermentation using an L-glutamic acid-producing bacterium nase and Succinate dehydrogenase on production of an of the so-called coryneform bacterium belonging to the genus L-amino acid Such as L-glutamic acid is not known. Brevibacterium, Corynebacterium or Microbacterium or a mutant strain thereof (refer to Kunihiko Akashi, et. al. SUMMARY OF THE INVENTION “Amino Acid Fermentation', Gakkai Shuppan Center, 1986, 0013 An aspect of the present invention is to provide a pp. 195-215). Moreover, as methods for producing bacterium that can be capable of efficiently producing an L-glutamic acid using other strains, methods utilizing a L-amino acid, and to provide a method of efficiently produc microorganism belonging to the genus Bacillus, Streptomy ing an L-amino acid using the bacterium. ces, Penicillium, or the like (refer to U.S. Pat. No. 3,220,929), 0014. It has been found that productivity of L-amino acid Pseudomonas, Arthrobacter, Serratia, Candida, or the like Such as L-glutamic acid in a bacterium can be improved by (refer to U.S. Pat. No. 3,563,857), Bacillus, Pseudomonas, modifying the bacterium so that Succinate dehydrogenase Serratia, Aerobacter aerogenes (currently Enterobacter activity and C-ketoglutarate dehydrogenase activity are aerogenes), or the like (refer to, Japanese Patent Publication decreased. (Kokoku) No. S32-9393), a mutant strain of Escherichia coli 0015. It is an aspect of the present invention to provide a (refer to Japanese Patent Laid-open (Kokai) No. H5-244970), method for producing an L-amino acid, the method compris and the like are known. Furthermore, the inventors of the ing culturing in a medium a microorganism which has an present invention proposed a method of producing L-amino acid producing ability and has been modified so that L-glutamic acid using a microorganism belonging to the Succinate dehydrogenase activity and C.-ketoglutarate dehy genus Klebsiella, Erwinia, Pantoea, or Enterobacter (refer to drogenase activity are decreased to produce and accumulate Japanese Patent Laid-open Nos. 2000-106869, 2000-1891.69 an L-amino acid in the medium or cells of the microorganism, and 2000-189175). and collecting the L-amino acid from the medium or cells. 0007. In recent years, recombinant DNA techniques have 0016. It is a further aspect of the present invention to been used in the production of target Substances by fermen provide the aforementioned method, wherein the succinate tation. For example, L-amino acid productivity of a bacterium dehydrogenase activity or the C-ketoglutarate dehydrogenase can be improved by enhancing expression of a gene encoding activity can be decreased by reducing expression of a gene an L-amino acid biosynthetic enzyme (U.S. Pat. Nos. 5,168, encoding Succinate dehydrogenase or C-ketoglutarate dehy 056 and 5,776.736), or by enhancing uptake of a carbon drogenase or disrupting the gene. source to the L-amino acid biosynthesis system (U.S. Pat. No. 0017. It is a further aspect of the present invention to 5,906,925). provide the aforementioned method, wherein the gene encod 0008 For example, as for L-glutamic acid production, it ing Succinate dehydrogenase is selected from the group con was reported that introduction of a gene encoding citrate sisting of the Sdha gene, the SdhB gene, the SdhC gene, the synthase from Escherichia coli or Corynebacterium sdhD gene, and combinations thereof. US 2009/0286290 A1 Nov. 19, 2009

0018. It is a further aspect of the present invention to So forth. L-glutamic acid or L-amino acid of which precursor provide the aforementioned method, wherein the gene encod is L-glutamic acid or L-glutamine is preferred. Among these, ing O-ketoglutarate dehydrogenase is selected from the group L-glutamic acid, L-glutamine, L-proline, L-arginine, L-orni consisting of the SucA gene, the odha gene, the Such3 gene, thine and L-citrulline are preferred. and combinations thereof. 0031 Exemplary microorganisms used for the present 0019. It is a further aspect of the present invention to invention can include, but are not limited to, bacteria belong provide the aforementioned method, wherein the microor ing to Enterobacteriaceae such as those of genera Escheri ganism is a bacterium belonging to the family Enterobacte chia, Pantoea, and Enterobacter, coryneform bacteria Such as riaceae or a coryneform bacterium. Corynebacterium glutamicum and Brevibacterium lactofer 0020. It is a further aspect of the present invention to mentum, and Bacillus bacteria Such as Bacillus subtilis. provide the aforementioned method, wherein the L-amino 0032 Coryneform bacteria can include those bacteria hav acid is L-glutamic acid, or an L-amino acid which is biosyn ing beenhitherto classified into the genus Brevibacterium, but thesized via L-glutamic acid as a precursor. classified into the genus Corynebacterium at present (Int. J. 0021. It is a further aspect of the present invention to Syst. Bacteriol. 41, 255 (1991)), and can include bacteria provide the aforementioned method, wherein the L-amino belonging to the genus Brevibacterium closely relative to the acid is selected from the group consisting of L-arginine, genus Corynebacterium. Examples of Such coryneform bac L-proline, L-ornithine, L-citrulline, and L-glutamine. teria are listed below. 0033 Corynebacterium acetoacidophilum BRIEF DESCRIPTION OF THE DRAWINGS 0034 Corynebacterium acetoglutamicum 0035 Corynebacterium alkanolyticum 0022 FIG. 1 shows the structure of the helper plasmid 0036 Corynebacterium callunae RSF-Red-TER. 0037 Corynebacterium glutamicum 0023 FIG. 2 shows the construction of the helper plasmid 0038 Corynebacterium lilium RSF-Red-TER. 0039 Corynebacterium melasseCola 0040 Corynebacterium thermoaminogenes (Corynebac DETAILED DESCRIPTION OF EXEMPLARY terium efficiens) EMBODIMENTS 0041 Corynebacterium herculis 0024. Hereafter, the present invention will be explained in 0042. Brevibacterium divaricatum detail. 0043. Brevibacterium flavum 0025 <1> Microorganism 0044 Brevibacterium immariophilum 0026 Exemplary methods of the present invention include 0045 Brevibacterium lactofermentum (Corynebacterium a method for producing an L-amino acid, which utilizes a glutamicum) microorganism which has an L-amino acid producing ability 0046 Brevibacterium roseum and which has been modified so that Succinate dehydrogenase 0047 Brevibacterium saccharolyticum activity and C-ketoglutarate dehydrogenase activity are 0048 Brevibacterium thiogenitalis decreased. 0049 Corynebacterium ammoniagenes 0027 Exemplary microorganisms used for the present 0050 Brevibacterium album invention can be obtained by modifying a microorganism 0051 Brevibacterium cerinum which has an L-amino acid producing ability used as a parent 0.052 Microbacterium ammoniaphilum strain so that Succinate dehydrogenase and C.-ketoglutarate 0053 Specific examples of the bacteria include the follow dehydrogenase activity of the microorganism is decreased. 1ngS. The microorganism can also be obtained by imparting an 0054 Corynebacterium acetoacidophilum ATCC 13870 L-amino acid producing ability to or enhancing an L-amino 0055 Corynebacterium acetoglutamicum ATCC 15806 acid producing ability of a microorganism modified so that 0056 Corynebacterium alkanolyticum ATCC 21511 Succinate dehydrogenase and O-ketoglutarate dehydrogenase 0057 Corynebacterium callunae ATCC 15991 activity of the microorganism is decreased. 0058 Corynebacterium glutamicum ATCC 13020, ATCC 0028. The microorganism may inherently have an ability 13032, ATCC 13060 to produce an L-amino acid, or the ability may be imparted by 0059 Corynebacterium lilium ATCC 15990 breeding using a mutation method, a recombinant DNA tech 0060 Corynebacterium melassecola ATCC 17965 nique or the like. 0061 Corynebacterium thermoaminogenes AJ12340 0029. The words “ability to produce L-amino acid refers (FERM BP-1539) to an ability to produce L-amino acid to Such a degree that 0062 Corynebacterium herculis ATCC 13868 L-amino acid can be collected from the medium or cells when 0063 Brevibacterium divaricatum ATCC 14020 microorganism is cultured in the medium. For example, it 0064 Brevibacterium flavum ATCC 13826, ATCC 14067 means that the microorganism exhibits an ability to produce 0065 Brevibacterium immariophilum ATCC 14068 L-amino acid in an amount that is larger than is produced by 0066 Brevibacterium lactofermentum ATCC 13869 a wild-type or unmodified strain of the microorganism cul (Corynebacterium glutamicum ATCC 13869) tured under the same conditions. 0067 Brevibacterium roseum ATCC 13825 0030 Examples of the L-amino acid can include L-lysine, 0068 Brevibacterium saccharolyticum ATCC 14066 L-glutamic acid, L-threonine, L-valine, L-leucine, L-isoleu 0069 Brevibacterium thiogenitalis ATCC 19240 cine, L-serine, L-asparaginic acid, L-asparagine, 0070 Corynebacterium ammonia genes ATCC 6871, L-glutamine, L-arginine, L-cysteine (cystine), L-methionine, ATCC 6872 L-phenylalanine, L-tryptophan, L-tyrosine, L-glycine, L-ala (0071 Brevibacterium album ATCC 15111 nine, L-proline, L-ornithine, L-citrulline, L-homoserine and 0072 Brevibacterium cerinum ATCC 15112 US 2009/0286290 A1 Nov. 19, 2009

0073 Microbacterium ammoniaphilum ATCC 15354 I0081 Pantoea anamatis AJ13356 (FERM BP-6615, 0074 These strains are available from the American Type EP0952221A) Culture Collection (ATCC) (Address: P.O. Box 1549, Manas I0082 Although these strains are described as Entero sas, Va. 20108, 1, United States of America). That is, regis bacter agglomerans in EP0952221A, they are currently clas tration numbers are given to each of the strains, and the strains sified as Pantoea anamatis on the basis of nucleotide sequence can be ordered using these registration numbers. AJ12340 analysis of 16S rRNA etc., as described above. strain was deposited on Oct. 27, 1987 in National Institute of I0083. Examples of the Erwinia bacteria can include Bioscience and Human Technology of Agency of Industrial Erwinia amylovora and Erwinia carotovora, and examples of Science and Technology (currently independent administra the Klebsiella bacteria can include Klebsiella planticola. tive agency, National Institute of Advanced Industrial Science Specific examples can include the following strains: and Technology, International Patent Organism Depositary, I0084 Erwinia amylovora ATCC 15580 Tsukuba Central 6, 1-1, Higashi 1-Chome, Tsukuba-shi, 0085. Erwinia carotovora ATCC 15713 Ibaraki-ken, 305-8566, Japan), as an accession number of I0086 Klebsiella planticola AJ13399 (FERM BP-6600, FERM BP-1539 based on the Budapest Treaty. EP955368A) 0075 Exemplary microorganisms belonging to Entero I0087 Klebsiella planticola AJ13410 (FERM BP-6617, bacteriaceae used for the present invention can include, but EP955368A). are not limited to, bacteria belonging to the genera Escheri I0088 <1-1> Impartation or Enhancement of L-Amino chia, Enterobacter; Pantoea, Klebsiella, Serratia, Erwinia, Acid-Producing Ability Salmonella, Morganella or the like and having an L-amino I0089. Hereinafter, methods for imparting an L-amino acid producing ability. Specifically, bacteria belonging to the acid-producing ability to Such microorganisms as described family Enterobacteriaceae according to the classification above, or methods for enhancing an L-amino acid-producing shown in NCBI (National Center for Biotechnology Informa ability of Such microorganisms as described above, are tion) database (http://www.ncbi.nlm.nih.gov/htbin-post/Tax described. onomy/wgetorg?mode=Tree&id=1236&lvl=3&kee 0090. To impart the ability to produce an L-amino acid, p=1&srchmode=1&unlock) can be used. Among the bacteria methods conventionally employed in the breeding of the of the family Enterobacteriaceae, bacteria belonging to the coryneform bacteria or bacteria of the genus Escherichia (see genus Escherichia, Enterobacter, or Pantoea can be used as “Amino Acid Fermentation', Gakkai Shuppan Center (Ltd.), the parent strain. 1st Edition, published May 30, 1986, pp. 77-100) can be 0076 Escherichia bacteria which can be used as the parent applied. Such methods include acquisition of an auxotrophic strain can include, but are not limited to, Escherichia bacteria mutant, an analogue-resistant strain, or a metabolic regula reported by Neidhardt et al. (Neidhardt, F. C. et al., Escheri tion mutant, or construction of a recombinant strain having chia coli and Salmonella Tiphimurium, American Society for enhanced expression of an L-amino acid biosynthesis Microbiology, Washington D.C., 1029 table 1), such as enzyme. In the breeding of L-amino acid-producing bacteria, Escherichia coli. Specific examples of Escherichia coli one or two or more properties, such as auxotrophic mutation, include Escherichia coli W3110 strain (ATCC 27325), and analogue resistance, or metabolic regulation mutation can be MG1655 strain (ATCC 47076), which is derived from the imparted. The expression of one or two or more L-amino acid wild-type (prototype) Escherichia coli K12 strain, and the biosynthesis enzymes can be enhanced. Furthermore, the like. impartation of properties such as auxotrophic mutation, ana logue resistance, or metabolic regulation mutation may be 0077. In particular, Pantoea bacteria, Erwinia bacteria and combined with the enhancement of biosynthesis enzymes. Enterobacter bacteria are classified as Y-proteobacteria, and 0091 An auxotrophic mutant strain, L-amino acid ana they are taxonomically very close to one another (J. Gen. logue-resistant strain, or metabolic regulation mutant strain Appl. Microbiol. December 1997, 43(6), 355-361; Interna with an ability to produce an L-amino acid can be obtained by tional Journal of Systematic Bacteriology, October 1997, pp. Subjecting a parent strain or wild-type strain to a conventional 1061-1067). In recent years, some bacteria belonging to the mutatagenesis, such as exposure to X-rays or UV irradiation, genus Enterobacter were reclassified as Pantoea agglomer or treatment with a mutagen such as N-methyl-N'-nitro-N- ans, Pantoea dispersa, or the like, on the basis of DNA-DNA nitrosoguanidine, etc., and then selecting those which exhibit hybridization experiments etc. (International Journal of Sys an autotrophy, analogue resistance, or metabolic regulation tematic Bacteriology, July 1989, 39(3), p. 337-345). Further mutation and which also have the ability to produce an more, some bacteria belonging to the genus Erwinia were L-amino acid from the obtained mutant strains. An L-amino re-classified as Pantoea ananas or Pantoea stewartii (refer to acid-producing bacterium can also be obtained by enhancing International Journal of Systematic Bacteriology, January an enzymatic activity of L-amino acid biosynthesis enzyme 1993, 43(1), pp. 162-173). by gene recombination. 0078 Examples of the Enterobacter bacteria can include 0092 Methods for imparting an L-amino acid-producing Enterobacter agglomerans, Enterobacter aerogenes, and the ability, and microorganisms to which an L-amino acid pro like. Specifically, the strains exemplified in EP952221A can ducing ability is imparted will be exemplified below. be used. A typical strain of the genus Enterobacteris Entero 0093 Examples of methods for impartation or enhance bacter agglomerans ATCC 12287. ment of L-glutamic acid-producing ability by breeding can 007.9 Typical strains of the Pantoea bacteria can include include modifying one or more genes encoding an L-glutamic Pantoea anamatis, Pantoea Stewartii, Pantoea agglomerans, acid biosynthetic enzyme so that expression of these genes is and Pantoea citrea. Specific examples can include the follow enhanced. Examples of Such genes can include, but are not ing strains: limited to, genes encoding glutamate dehydrogenase (gdha), 0080 Pantoea anamatis AJ13355 (FERM BP-6614, glutamine synthetase (glnA), glutamate synthetase (gltAB), EP0952221A) isocitrate dehydrogenase (icaA), aconitate hydratase (acna, US 2009/0286290 A1 Nov. 19, 2009 acnB), citrate synthase (gltA), phosphoenolpyruvate car enhanced activity of phosphoketolase include the following boxylase (ppc), pyruvate carboxylase, pyruvate dehydroge microorganisms (WO2006/016705): nase (aceEF, lpdA), pyruvate kinase (pykA, pykF), phospho 0100 Brevibacterium lactofermentum ATCC enolpyruvate synthase (ppSA), enolase (eno), 13869AsucA (pVK9-Xfp) phosphoglyceromutase (pgmA, pgmI), phosphoglycerate 0101 Brevibacterium lactofermentum ATCC kinase (pgk), glyceraldehyde-3-phophate dehydrogenase 13869AsucA (pVK9-PS2 xpkA) (gapA), triose phosphate isomerase (tpiA), fructose bisphos 0102 L-Glutamic acid-producing ability can also be phate aldolase (fbp), phosphofructokinase (pkA, pikB), glu imparted by enhancing the 6-phosphogluconate dehydratase cose phosphate isomerase (pgi), methyl citrate synthase activity, the 2-keto-3-deoxy-6-phosphogluconate aldolase (prpC), and the like. The abbreviations in parentheses repre activity, or both. Examples of a microorganism of which sent the gene names (the same shall apply to the same occa 6-phosphogluconate dehydratase activity and the 2-keto-3- sions hereafter). deoxy-6-phosphogluconate aldolase are increased include 0094 Expression of these genes can be increased or the microorganism disclosed in Japanese Patent Laid-open enhanced by introduction of an amplification plasmid No. 2003-274988. Furthermore, L-glutamic acid-producing obtained by introducing a DNA fragment containing any of ability can also be imparted by amplifying the yhfK gene, these genes into an appropriate plasmid Such as a plasmid which is an L-glutamic acid secretion gene (WO2005/ vector containing at least a gene responsible for replication of 085419). the plasmid in a microorganism. Other methods of increasing 0.103 As an L-glutamic acid-producing microorganism gene expression include increasing the copy number of these which can be used for the present invention, a microorganism genes on the bacterial chromosome by conjugation, gene having an ability to accumulate L-glutamic acid in a liquid transfer, etc., or introducing a mutation into the promoter medium in an amount exceeding the Saturation concentration region of these genes (refer to International Patent Publica of L-glutamic acid when it is cultured under acidic conditions tion WO95/34672). (henceforth also referred to as an L-glutamic acid accumula 0095. When a gene is introduced into the aforementioned tion ability under acidic conditions) can be used. For plasmid for amplification or chromosome, the promoter for example, by obtaining a strain of which resistance to expressing the gene can be any promoter including the native L-glutamic acid in a low pH environmentis improved accord promoter for the gene to be amplified and a modified pro ing to the method described in EP1078989A, the ability to moter, so long as it functions in the chosen coryneform bac accumulate L-glutamic acid in an amount exceeding the satu teria. The amount of gene expression can be controlled by ration concentration can be imparted. choosing a suitable promoter or moving -35 or -10 region 0104 Specific examples of the microorganism originally closer to consensus sequence. Examples of coryneform bac having the L-glutamic acid accumulation ability under acidic teria which have been modified to enhance expression of the conditions can include the Pantoea anamatis AJ13355 strain citrate synthase gene, isocitrate dehydrogenase gene, pyru (FERM BP-6614), AJ13356 strain (FERM BP-6615), vate dehydrogenase gene, and/or glutamate dehydrogenase AJ13601 strain (FERM BP-7207) (for these, refer to gene are described in International Patent Publication WO00/ EP0952221A), SC17sucA strain, SC17sucA/RSFCPG+ 18935 and EP1010755A. pSTVCB strain, NP106 strain, NA1 strain, and the like. 0096. Moreover, the L-glutamic acid producing ability 0105. The Pantoea ananatis AJ13355 strain was isolated can also be imparted by reducing or deleting the activity of an from Soil in Iwata-shi, Shizuoka, Japan as a strain that can enzyme that catalyzes a reaction which branches off from the proliferate in a medium containing L-glutamic acid and a L-glutamic acid biosynthetic pathway and produces a com carbon source at low pH. The AJ13356 strain was obtained by pound other than L-glutamic acid. Examples of enzymes that deleting the O.KGDH-E1 subunit gene (sucA) of the AJ13355 catalyze a reaction which branches off from the L-glutamic strain. acid biosynthetic pathway and produces a compound other 01.06 Pantoea anamatis AJ13355 and AJ13356 stains than L-glutamic acid can include isocitrate lyase, acetohy were deposited on Feb. 19, 1998 in National Institute of droxy acid synthase, acetolactate synthase, formate acetyl Bioscience and Human Technology of Agency of Industrial transferase, lactate dehydrogenase, glutamate decarboxylase, Science and Technology (currently independent administra 1-pyrroline-5-carboxylate dehydrogenase, acetyl-CoA tive agency, National Institute of Advanced Industrial Science hydrase (International Patent Publication WO2006/057450), and Technology, International Patent Organism Depositary, and the like. Tsukuba Central 6, 1-1, Higashi 1-Chome, Tsukuba-shi, 0097 Activities of the enzymes described above can be Ibaraki-ken, 305-8566, Japan), as accession numbers of decreased or deleted by a method similar to the methods for FERMP-16644 and FERMP-16645 respectively, the origi decreasing or deleting the Succinate dehydrogenase activity nal deposit was converted to an international deposit based on or C-ketoglutarate dehydrogenase activity described later. the Budapest Treaty on Jan. 11, 1999, and deposited as acces 0098. Moreover, L-glutamic acid-producing ability can sion numbers of FERM BP-6614 and FERM BP-6615, also be imparted to a coryneform bacterium by amplifying the respectively. These strains were identified when they were yggB gene (NCgl 1221; NP 600492. Reports small-conduc isolated, and deposited as Enterobacter agglomerans and tance . . . gi: 19552490) or by introducing a mutantyggB deposited as Enterobacter agglomerans AJ13354 and gene containing a mutation in the coding region thereof AJ13355 strains, but these strains have been reclassified as (WO2006/070944). Pantoea anamatis based on an analysis of the nucleotide 0099 Examples of methods to enhance L-glutamic acid sequence of 16S rRNA (see below examples). Moreover, producing ability can include introducing genes encoding although the AJ13601 strain described below is also depos D-xylulose-5-phosphate phosphoketolase and/or fructose-6- ited at the depository as Enterobacter agglomerans, it is phosphate phosphoketolase (these are collectively called described as Pantoea anamatis in this specification. The Pan phosphoketolase). Examples of microorganisms which have toea anamatis AJ13601 stain was deposited on Aug. 18, 1999 US 2009/0286290 A1 Nov. 19, 2009

in National Institute of Bioscience and Human Technology of (O112 Brevibacterium flavum AJ11355 (FERM P-5007, Agency of Industrial Science and Technology (currently Japanese Patent Laid-open No. 56-1889) independent administrative agency, National Institute of 0113 Corynebacterium glutamicum AJ1 1368 (FERM Advanced Industrial Science and Technology, International P-5020, Japanese Patent Laid-open No. 56-1889) Patent Organism Depositary, Tsukuba Central 6, 1-1, Higashi 0114 Brevibacterium flavum AJ11217 (FERM P-4318, 1-Chome, Tsukuba-shi, Ibaraki-ken, 305-8566, Japan), as an Japanese Patent Laid-open No. 57-2689) accession number of FERMP-17156, and the original deposit 0115 Corynebacterium glutamicum AJ11218 (FERM was converted to an international deposit based on Budapest P-4319, Japanese Patent Laid-open No. 57-2689) Treaty on Jul. 6, 2000, with an accession number of FERM 0116 Brevibacterium flavum AJ11564 (FERM BP-5472, BP-7207. Japanese Patent Laid-open No. 56-140895) 0107 Furthermore, examples of L-glutamic acid produc 0117 Brevibacterium flavum AJ11439 (FERM BP-5136, ing Pantoea anamatis strain include bacteria belonging to the Japanese Patent Laid-open No. 56-35981) genus Pantoea in which C.-ketoglutarate dehydrogenase 0118 Corynebacterium glutamicum H7684 (FERM (C-KGDH) activity is eliminated or reduced. Examples of BP-3004, Japanese Patent Laid-open No. 04-88994) such strains include the AJ13356 strain, and the SC17sucA 0119 Brevibacterium lactofermentum AJ11426 (FERM strain (U.S. Pat. No. 6,596.517) which is a sucA gene-defi P-5123, Japanese Patent Laid-open No. 56-048890) cient strain derived from the SC 17 strain selected as a low I0120 Corynebacterium glutamicum AJ11440 (FERM phlegm production mutant strain from the AJ13355 strain. P-5137, Japanese Patent Laid-open No. 56-048890) The SC17sucA strain was assigned a private number of I0121 Brevibacterium lactofermentum AJ11796 (FERM AJ417, deposited at the National Institute of Advanced Indus P-6402, Japanese Patent Laid-open No. 58-158192) trial Science and Technology, International Patent Organism 0.122 Examples of microorganisms having L-glutamine Depositary (Tsukuba Central 6, 1-1, Higashi 1-Chome, producing ability can include bacteria in which glutamate Tsukuba-shi, Ibaraki-ken, Japan, postal code: 305-8566) on dehydrogenase activity is enhanced, bacteria in which Feb. 26, 2004, and assigned an accession number of FERM glutamine synthetase (glnA) activity is enhanced, and bacte BP-O8646. ria in which glutaminase gene is disrupted (European Patent The SC17sucA/RSFCPG+pSTVCB strain described above Application Laid-open Nos. 1229121 and 1424398). was obtained by introducing into the SC17sucA strain the Enhancement of the glutamine synthetase activity can also be plasmid RSFCPG containing the citrate synthase gene (gltA), attained by disrupting the glutamine adenylyltransferase phosphoenolpyruvate carboxylase gene (ppsA) and the (glnE) or disrupting the PII control protein (glnB). Further glutamate dehydrogenase gene (gdh A) derived from Escheri more, a strain which belongs to the genus Escherichia and has chia coli, and the plasmid pSTVCB containing the citrate a mutant glutamine synthetase in which the tyrosine residue synthase gene (gltA) derived from Brevibacterium lactofer at position 397 is replaced with another amino acid residue mentum. The AJ13601 strain was selected from the can also be exemplified as an L-glutamine producing bacte SC17sucA/RSFCPG+pSTVCB strain as having resistance to rium (U.S. Patent Application Publication No. 2003/ L-glutamic acid of a high concentration at a low pH. Further 0148474). more, the NP106 strain corresponds to the AJ13601 strain in I0123. Other methods for imparting or enhancing which the plasmid RSFCPG+pSTVCB are eliminated as L-glutamine-producing ability can be the method of impart ing 6-diazo-5-oxo-norleucine resistance (Japanese Patent described in the examples. Laid-open No. 3-232497), imparting purine analogue resis 0108. As other methods for imparting or enhancing tance and methionine Sulfoxide resistance (Japanese Patent L-glutamic acid producing ability, there can be mentioned Laid-open No. 61-202694), imparting C.-ketomaleic acid methods of imparting resistance to an organic acid analogue, resistance (Japanese Patent Laid-open No. 56-151495), and respiratory inhibitor or the like and methods of imparting the like. Specific examples of coryneform bacteria having sensitivity to a cell wall synthesis inhibitor. Examples can L-glutamine-producing ability can include the following include, for example, imparting monofluoroacetic acid resis tance (Japanese Patent Laid-open No. 50-113209), imparting strains. adenine resistance or thymine resistance (Japanese Patent (0.124 Brevibacterium flavum AJ11573 (FERM P-5492, Laid-open No. 57-065198), attenuating urease (Japanese Japanese Patent Laid-open No. 56-161495) Patent Laid-open No. 52-038088), imparting malonic acid (0.125 Brevibacterium flavum AJ11576 (FERM resistance (Japanese Patent Laid-open No. 52-038088), BP-10381, Japanese Patent Laid-open No. 56-161495) imparting resistance to benzopyrons or naphthoduinones (0.126 Brevibacterium flavum AJ12212 (FERM P-8123, (Japanese Patent Laid-open No. 56-1889), imparting Japanese Patent Laid-open No. 61-202694) HOQNO resistance (Japanese Patent Laid-open No. 0127 Examples of microorganisms having L-proline-pro 56-140895), imparting C.-ketomalonic acid resistance (Japa ducing ability can include, for example, bacteria having nese Patent Laid-open No. 57-2689), imparting guanidine Y-glutamyl kinase which is desensitized to feedback inhibi resistance (Japanese Patent Laid-open No. 56-35981), tion by L-proline and bacteria in which L-proline decompo imparting sensitivity to penicillin (Japanese Patent Laid-open sition system is attenuated. The method of modifying bacteria using a DNA encoding Y-glutamyl kinase desensitized to No. 4-88994), and the like. feedback inhibition by L-proline is disclosed in Dandekar, A. 0109 Specific examples of such resistant bacteria include M., Uratsu S. L., J. Bacteriol. 170, 12:5943-5 (1988). Fur the following Strains. thermore, examples of the method for obtaining a bacterium 0110 Brevibacterium flavum AJ3949 (FERM BP-2632, of in L-proline decomposition system is attenuated can Japanese Patent Laid-open No. 50-113209) include, for example, a method of introducing a mutation into 0111 Corynebacterium glutamicum AJ1 1628 (FERM a proline dehydrogenase gene for reducing its enzymatic P-5736, Japanese Patent Laid-open No. 57-065198) activity. Example of bacteria having L-proline-producing US 2009/0286290 A1 Nov. 19, 2009

ability can include the Escherichia coli NRRL B-12403 and are amplified (Japanese Patent Laid-open Nos. 2-458, NRRL B-12404 strains (British Patent No. 2075056), 2-42988 and 8-47397), and so forth. Escherichia coli VKPMB-8012 strain (U.S. Patent Applica 0.134 Examples of L-isoleucine-producing strains of tion Publication No. 2002/0058315), and strains having the coryneform bacteria can include the coryneform bacterium in mutant plasmid disclosed in German Patent No. 3127361 or which the brnE gene encoding a branched chain amino acid the mutant plasmid disclosed in the reference of Bloom F. R. excretion protein is amplified (Japanese Patent Laid-openNo. et al. (The 15th Miami Winter Symposium, 1983, p.34). 2001-169788), coryneform bacteria to which L-isoleucine 0128. Furthermore, examples of microorganisms having producing ability is imparted by protoplast fusion with a L-proline-producing ability also can include the Escherichia L-lysine-producing bacterium (Japanese Patent Laid-open coli 702 strain (VKPMB-8011), which is a 34-dehydrox No. 62-74293), homoserine dehydrogenase-enhanced yproline and aZetidine-2-carboxylate resistant strain, coryneform bacteria (Japanese Patent Laid-open No. 702ilvA strain (VKPMB-8012 strain), which is an ilvA-de 62-91193), threonine hydroxamate resistant strains (Japanese ficient strain of the 702 strain, E. coli strains in which activity Patent Laid-open No. 62-195293), C.-ketomalonic acid resis of protein encoded by the b2682, b2683, b1242 or b3434 gene tant strains (Japanese Patent Laid-open No. 61-15695), and is enhanced (Japanese Patent Laid-open No. 2002-300874), the methyllysine resistant strains (Japanese Patent Laid-open and the like. No. 61-15696). 0129. Examples of L-proline-producing strains of coryne 0.135 L-Valine-producing ability may be imparted by form bacteria can include the DL-3,4-dehydroproline resis increasing the activities of L-valine synthetic enzymes tant strain (FERM BP-1219, U.S. Pat. No. 4,224.409), the encoded by the ilvGMEDA operon, in particular, activity of strains in which citrate synthetase activity increases 1.4 times acetohydroxylate synthase encoded by the ilvG gene (Japa or more as compared to parent strains thereof (FERMP-5332, nese Patent Publication No. 02-748418). Such L-valine syn FERM P-5333, FERM P-5342, FERMP-5343, Japanese thetic enzymes can be desensitized to the feedback inhibition Patent No. 1426823), and the strain to which acetic acid by L-valine. L-Valine-producing ability can also be imparted auxotrophy is imparted (FERM P-5931). by decreasing expression of acetolactate synthase III gene 0130. Examples of microorganism having L-leucine-pro (ilvIH gene). ducing ability can include Escherichia coli strains resistant to 0.136 Moreover, L-valine-producing ability can also be 4-azaleucine or 5.5.5-trifluoroleucine such as H-9068 (ATCC imparted by imparting amino acid analogue-resistance to a 21530), H-9070 (FERM BP-4704) and H-9072 (FERM bacterium. Examples of Such bacteria can include mutant BP-4706) (U.S. Pat. No. 5,744,331), Escherichia coli strains strains which are auxotrophic to L-isoleucine and L-methion having isopropyl malate synthase desensitized to feedback ine and resistant to D-ribose, purine nucleoside, or pyrimi inhibition by L-leucine (European Patent No. 1067191), dine ribonucleoside (FERM P-1841 and P-5556; Japanese Escherichia coli Strains resistant to B-2-thienylalanine and Patent Laid-open No. 53-025034), and a mutant strain that is |B-hydroxyleucine such as AJ11478 (U.S. Pat. No. 5,763, resistant to polyketide (FERMP-9325, Japanese Patent No. 231), Escherichia coli 57 (VKPM B-7386, Russian Patent 1934507). No. 2140450), and the like. 0.137 Examples of L-valine-producing bacteria also can 0131 Examples of L-leucine-producing strains of coryne include strains with aminoacyl t-RNA synthetase mutants form bacteria can include 2-thiazolealanine and 3-hydroxy (U.S. Pat. No. 5,658,766). For example, E. coli VL1970, leucine resistant Strain (Japanese Patent Laid-open No. which has a mutation in the ileS gene encoding isoleucine 8-266295), valine analogue resistant strain (Japanese Patent tRNA synthetase, can be used. E. coli VL1970 was deposited Laid-open No. 63-248392), valine auxotrophic strain (Japa at the Russian National Collection of Industrial Microorgan nese Patent Publication No. 38-4395), S-(2-aminoethyl)-L- isms (VKPM) (1 Dorozhny proezd., 1 Moscow 117545, Rus cysteine (AEC) resistant strain (Japanese Patent Publication sia) on Jun. 24, 1988 under an accession number VKPM No. 51-37347), and phenylalanine, valine and isoleucineaux B-4411. otrophic strain (Japanese Patent Publication No. 54-36233). 0.138. Furthermore, mutants requiring lipoic acid for 0132 Examples of microorganism having L-cysteine-pro growth and/or lacking H"-ATPase (WO96/06926) can also be ducing ability can include Escherichia coli JM15 strain which used as parent strains. is transformed with a cysE allele encoding serine acetyltrans 0.139 Examples of L-valine-producing strain of coryne ferases desensitized to feedback inhibition (U.S. Pat. No. form bacteria can include, for example, a strain modified so 6.218,168), Escherichia coli W3110 strain having over-ex that expression of a gene encoding an enzyme which partici pressed genes which encode proteins Suitable for excreting pates in the L-valine biosynthesis is enhanced. Examples of substances toxic for cells (U.S. Pat. No. 5,972,663), Escheri the enzyme which participates in the L-valine biosynthesis chia coli strain having lowered cysteine desulfhydrase activ can include, for example, those encoded by the ilvBNC ity (Japanese Patent Laid-open No. 11-155571), Escherichia operon, i.e., Such as acetohydroxy acid synthase encoded by coli W3110 strain in which a transcriptional activator for ilvBN and isomeroreductase (ilvC) (WO00/50624). In addi cysteine regulon encoded by the cysB gene is amplified tion, since the ilvBNC operon is under the control of the (WO01/27307), and the like. operon by L-valine and/or L-isoleucine and/or L-leucine, the 0133 Examples of microorganisms having L-isoleucine attenuation can be eliminated in order to eliminate the expres producing ability include, for example, mutants strains of the sion Suppression by L-valine to be produced. genus Escherichia having resistance to 6-dimethylaminopu 0140 Examples of microorganisms having an L-alanine rine (Japanese Patent Laid-open No. 5-304969), mutants hav producing ability can include coryneform bacteria deficient ing resistance to L-isoleucine hydroxamate, thiaisoleucine, in the H-ATPase activity (Appl. Microbiol. Biotechnol. DL-ethionine or arginine hydroxamate (Japanese Patent 2001 November; 57(4): 534-40), coryneform bacteria in Laid-open No. 5-130882), recombinant strains in which which aspartate B-decarboxylase gene is amplified (Japanese threonine deaminase gene and acetohydroxate synthase gene Patent Laid-open No. 07-163383), and the like. US 2009/0286290 A1 Nov. 19, 2009

0141 Examples of microorganisms having an L-arginine openNo. 49-126819); a strain resistant to a histidine analogue producing ability can include, Escherichia colimutant strains or tryptophan analogue (Japanese Patent Laid-open No. which have resistance to C.-methylmethionine, p-fluorophe 52-114092); a strain auxotrophic for at least one of methion nylalanine, D-arginine, arginine hydroxamate, AEC (S-(2- ine, histidine, threonine, proline, isoleucine, lysine, adenine, aminoethyl)-cysteine), C.-methylserine, B-2-thienylalanine, guanine and uracil (or uracil precursor) (Japanese Patent or Sulfaguanidine (refer to Japanese Patent Laid-open No. Laid-open No. 52-99289); a strain resistant to arginine 56-106598). The Escherichia coli 237 strain which is an hydroxamate (Japanese Patent Publication No. 51-6754); a L-arginine producing strain which harbors highly active strain auxotrophic for Succinic acid or resistant to a nucleic N-acetylglutamate synthase having a mutation for resistance acid base analogue (Japanese Patent Laid-openNo. 58-9692); to feedback inhibition by L-arginine (Russian Patent Appli a strain deficient in arginine decomposition ability, resistant cation No. 2000117677) can also be used as an L-arginine to an arginine antagonist and canavanine and auxotrophic for producing bacterium. The 237 strain was deposited in the lysine (Japanese Patent Laid-open No. 52-8729); a strain Russian National Collection of Industrial Microorganisms resistant to arginine, arginine hydroxamate, homoarginine, (VKPM) (GNII Genetika) on Apr. 10, 2000 under an acces D-arginine and canavanine, or resistant to arginine hydrox sion number of VKPMB-7925, and the original deposit was amate and 6-azauracil (Japanese Patent Laid-open No. converted to an international deposit based on the Budapest 53-143288); a strain resistant to canavanine (Japanese Patent Treaty on May 18, 2001. The Escherichia coli 382 strain, Laid-open No. 53-3586); or the like. which is a derivative of the 237 strain and is an L-arginine 0145 Specific examples of coryneform bacteria having producing strain having improved ability to assimilate acetic L-arginine-producing ability can include the following acid (Japanese Patent Laid-open No. 2002-017342), can also strains. be used. The Escherichia coli 382 strain was deposited in the 0146 Brevibacterium flavum AJ11169 (FERM P-4161) Russian National Collection of Industrial Microorganisms (VKPM) on Apr. 10, 2000 under an accession number of 0147 Brevibacterium lactofermentum AJ12092 (FERM VKPMB-7926. P-7273) 0142. As microorganisms having an L-arginine-produc 0148 Brevibacterium flavum AJ11336 (FERM P-4939) ing ability, strains in which the expression of one or more 0149 Brevibacterium flavum AJ11345 (FERM P-4948) genes encoding an L-arginine biosynthetic enzyme is (O150 Brevibacterium lactofermentum AJ12430 (FERM increased can also be used. Examples of the L-arginine bio BP-2228) synthetic enzyme can include one or more enzymes selected 0151. Furthermore, a strain deficient in ArgR, which is an from N-acetylglutaminate synthetase (argA), N-acetyl arginine repressor (U.S. Published Patent Application No. glutamyl phosphate reductase (argC), ornithine acetyl trans 2002/0045223) and a strain in which glutamine synthetase ferase (arg.J), N-acetylglutamate kinase (argB), acetylorni activity is increased (U.S. Published Patent Application No. thine transaminase (arg)), acetylornithine deacetylase 2005/0014236) can also be used. (argE), ornithine carbamoyl transferase (argF), argininosuc 0152 L-Citrulline and L-ornithine share common biosyn cinic acid synthetase (argG), argininosuccinic acid lyase thetic pathways with L-arginine, and the ability to produce (argH), and carbamoyl phosphate synthetase (carAB). A L-citrulline and L-ornithine can be imparted by increasing the mutant N-acetylglutamate synthase gene (argA) encoding the enzymatic activities of N-acetylglutamate syntase (argA), enzyme in which the amino acid sequence corresponding to N-acetylglutamylphosphate reductase (argC), ornithine positions 15 to 19 of a wild-type enzyme is replaced and the acetyltransferase (arg.J), N-acetylglutamate kinase (argB), feedback inhibition by L-arginine is thereby canceled acetylornithine transaminase (arg)), and acetylornithine (EP1170361A) also can be used. deacetylase (argE) (WO2006/35831). 0143 Although L-arginine-producing coryneform bacte 0153. Examples of microorganisms having an L-lysine ria are not particularly limited so long as they have an L-argi producing ability can include L-lysine analogue resistant nine-producing ability, examples can include wild-type strains and metabolic regulation mutants having L-lysine strains of coryneform bacteria; coryneform bacteria resistant producing ability. Specific examples include the Escherichia to certain agents including Sulfa drugs, 2-thiazolealanine, coli AJ11442 strain (FERM BP-1543, NRRL B-12185, see C.-amino-B-hydroxyvaleric acid and so forth; coryneform Japanese Patent Laid-open No. 56-18596 and U.S. Pat. No. bacteria exhibiting auxotrophy for L-histidine, L-proline, 4.346,170) and the Escherichia coli VL611 strain (Japanese L-threonine, L-isoleucine, L-methionine or L-tryptophan in Patent Laid-open No. 2000-189180). The WC196 strain addition to the resistance to 2-thiazolealanine (Japanese (WO96/17930) can also be used as an L-lysine-producing Patent Laid-open No. 54-4409); coryneform bacteria resis Escherichia coli bacterium. This bacterial strain was bred tant to ketomalonic acid, fluoromalonic acid or monofluoro from conferring AEC(S-(2-aminoethyl)-cysteine) resistance acetic acid (Japanese Patent Laid-open No. 57-18989); to the W3110 strain, which is derived from Escherichia coli coryneform bacteria resistant to argininol (Japanese Patent K-12. This strain was named Escherichia coli AJ13069 and Laid-open No. 62-24075); coryneform bacteria resistant to was deposited on Dec. 6, 1994 in National Institute of Bio X-guanidine (X represents a derivative of fatty acid or ali Science and Human Technology of Agency of Industrial Sci phatic chain, Japanese Patent Laid-open No. 2-186995), and ence and Technology (currently independent administrative the like. agency, National Institute of Advanced Industrial Science and 0144. A coryneform bacterium having L-arginine-produc Technology, International Patent Organism Depositary, ing ability can be bred as a strain resistant to 5-azauracil, Tsukuba Central 6, 1-1, Higashi 1-Chome, Tsukuba-shi, 6-azauracil, 2-thiouracil, 5-fluorouracil, 5-bromouracil, Ibaraki-ken, 305-8566, Japan), with an accession number of 5-azacytosine, 6-azacytosine and the like; a strain resistant to FERMP-14690, and the original deposit was converted to an arginine hydroxamate and 2-thiouracil; Strain resistant to international deposit based on Budapest Treaty on Sep. 29. arginine hydroxamate and 6-azauracil (Japanese Patent Laid 1995, with an accession number number of FERM BP-5252. US 2009/0286290 A1 Nov. 19, 2009

0154 Examples of L-lysine producing coryneform bacte decarboxylase (cada, ldcC), and malic enzyme. The strains ria can include S-(2-aminoethyl)cysteine (abbreviated as in which activities of the enzymes are decreased or deleted are "AEC hereinafter) resistant mutant strains (Brevibacterium disclosed in WO95/23864, WO96/17930, WO2005/010175, lactofermentum AJ11082 (NRRL B-11470) strain etc., refer and the like. to Japanese Patent Publication Nos. 56-1914, 56-1915, 0159. Examples of microorganisms having an L-tryp 57-14157, 57-14158, 57-30474, 58-10075, 59-4993, tophan-producing ability can include Strains in which one or 61-35840, 62-24074, 62-36673, 5-11958, 7-112437 and more of activities of the enzymes selected from anthranilate 7-112438); mutant strains requiring an amino acid Such as synthase (trpE), phosphoglycerate dehydrogenase (serA), L-homoserine for their growth (refer to Japanese Patent Pub and tryptophan synthase are enhanced. The anthranilate Syn lication Nos. 48-28078 and 56-6499); mutant strains having thase and phosphoglycerate dehydrogenase are both subject resistance to AEC and further requiring an amino acid such as to feedback inhibition by L-tryptophan and L-serine, respec L-leucine, L-homoserine, L-proline, L-serine, L-arginine, tively, and therefore the enzymatic activities can be enhanced L-alanine and L-valine (refer to U.S. Pat. Nos. 3,708.395 and by making the microorganisms contain a desensitized type 3.825,472); L-lysine producing mutant strains having resis mutant enzyme. Specifically, a bacterium harboring a desen tance to DL-C.-amino-e-caprolactam, C.-amino-lauryllactam, sitized type enzyme can be obtained by, for example, mutat aspartic acid analogue, Sulfa drug, quinoid and N-lauroyleu ing the anthranilate synthase gene and/or phosphoglycerate cine; L-lysine producing mutant Strains having resistance to dehydrogenase gene so that the encoded enzymes are desen oxaloacetate decarboxylase or a respiratory tract enzyme sitized to the feedback inhibition and introducing the mutant inhibitor (Japanese Patent Laid-open Nos. 50-53588, genes into the bacterium. Specific examples of Such a bacte 50-31093, 52-102498, 53-9394, 53-86089, 55-9783, rium can include a transformant obtained by introducing the 55-9759, 56-32995, 56-39778, Japanese Patent Publication plasmid pGH5 (WO94/08031) which contains a mutant serA Nos. 53-43591 and 53-1833); L-lysine producing mutant gene which has been mutated so that it encodes feedback strains requiringinositol oracetic acid (Japanese Patent Laid inhibition-desensitized phosphoglycerate dehydrogenase open Nos. 55-9784 and 56-8692); L-lysine producing mutant into the Escherichia coli SV164 strain which has a desensi strains that are sensitive to fluoropyruvic acid or a tempera tized anthranilate synthase. ture of 34° C. or higher (Japanese Patent Laid-open Nos. 0160 L-Tryptophan-producing ability can also be 55-9783 and 53-86090); L-lysine producing mutant strains of imparted by introducing a recombinant DNA containing the Brevibacterium or Corynebacterium bacteria having resis tryptophan operon. Specific examples can include Escheri tance to ethylene glycol (U.S. Pat. No. 4,411,997) and so chia coli transformed with the tryptophan operon which con forth. tains a gene encoding desensitized anthranilate synthase 0155 Microorganisms to which L-lysine producing abil (Japanese Patent Laid-open Nos. 57-71397 and 62-244382, ity is imparted can also be obtained by enhancing the activity U.S. Pat. No. 4,371,614). Moreover, L-tryptophan-producing of an L-lysine biosynthetic enzyme. Activity of an L-lysine ability can also be increased or imparted by enhancing biosynthetic enzyme can be enhanced by increasing the copy expression of a gene which encodes tryptophan synthase number of the gene encoding the L-lysine biosynthetic (trpBA) in the tryptophan operon. The tryptophan synthase enzyme or by modifying an expression regulatory sequence includes C. and B Subunits, which are encoded by trp A and of the gene encoding the enzyme. trpB, respectively. 0156 Examples of genes encoding L-lysine biosynthetic 016.1 L-Tryptophan-producing ability can also be enzymes include genes encoding enzymes of the diami imparted by deleting trpR encoding the repressor of the tryp nopimelate synthesis pathway Such as the dihydrodipicoli tophan operon, or introducing a mutation into trpR so that the nate synthase gene (dapA), aspartokinase gene (lysC), dihy activity of the repressor is decreased (U.S. Pat. No. 4,371,614 drodipicolinate reductase gene (dapB), diaminopimelate and WO2005/056776). decarboxylase gene (lySA), diaminopimelate dehydrogenase 0162 Strains in which malate synthase-isocitrate lyase gene (ddh) (WO96/40934 for all the foregoing genes), phos isocitrate dehydrogenasekinase/phosphatase operon (ace phoenolpyrvate carboxylase gene (ppc) (Japanese Patent operon) is constitutively expressed or expression of the Laid-open No. 60-87788), aspartate aminotransferase gene operon is enhanced also can be examples of L-tryptophan (aspC) (Japanese Patent Publication No. 6-102028), diami producing strains. Specifically, in an exemplary embodiment nopimelate epimerase gene (dapF) (Japanese Patent Laid according to the presently disclosed subject matter, the pro open No. 2003-135066), and aspartate semialdehyde dehy moter of the ace operon is not Suppressed by the repressor drogenease gene (asd) (WO00/61723), and genes encoding iclR, or the suppression by iclR is eliminated. Such strains can enzymes of aminoadipic acid synthesis pathway Such as be obtained by disrupting the iclR gene. homoaconitate hydratase gene (Japanese Patent Laid-open 0163 A strain in which the expression of the ace operon is No. 2000-157276). enhanced can be obtained by ligating a DNA comprising the 0157. The gene encoding aspartokinase III (lysC) can be ace operon to a strong promoter, and introducing it into cells modified so that the enzyme is desensitized to feedback inhi using a plasmid or by homologous recombination, or by bition by L-lysine. Such a modified lysC gene can be obtained transferring it with a transposon, so that multiple copies of the by the method described in U.S. Pat. No. 5,932,453. DNAs are integrated into the chromosomal DNA. 0158. The microorganisms having L-lysine-producing 0164. Examples of microorganisms having an L-tryp ability can have reduced activity of an enzyme that catalyzes tophan-producing ability can further include the Escherichia a reaction which produces a compound other than L-lysine or coli AGX17 (pGX44) strain (NRRL B-12263), which is aux can be deficient in Such an activity, or can have reduced otrophic for L-phenylalanine and L-tyrosine, and AGX6 activity of an enzyme that negatively acts on L-lysine produc (pGX50) aroP strain (NRRL B-12264) which harbors plas tion or can be deficient in Such an activity. Examples of Such mid pGX50 which includes the tryptophan operon (refer to enzymes can include homoserine dehydrogenase, lysine U.S. Pat. No. 4,371,614 for both). US 2009/0286290 A1 Nov. 19, 2009

0.165. As coryneform bacteria having L-tryptophan-pro which threonine decomposition is decreased. Examples of ducing ability, Corynebacterium glutamicum AJ 12118 which the Escherichia bacterium in which threonine decomposition is resistant to sulfaguanidine (FERM BP-478, Japanese is decreased can include, for example, the TDH6 strain which Patent No. 1681002), a coryneform bacterium into which the is deficient in threonine dehydrogenase activity (Japanese tryptophan operon is introduced (Japanese Patent Laid-open Patent Laid-open No. 2001-346578), and the like. No. 63-240794), and a coryneform bacterium into which a 0170 The activities of the L-threonine biosynthetic gene encoding shikimate kinase of a coryneform bacterium is enzymes are inhibited by the endoproduct, L-threonine, and introduced (Japanese Patent Laid-open No. 01-994749) can therefore L-threonine biosynthetic enzymes can be modified be used. so as to be desensitized to feedback inhibition by L-threonine 0166 L-Tryptophan, L-phenylalanine, and L-tyrosine are for constructing L-threonine-producing strains. The above all aromatic amino acids and have a common biosynthesis described thrA, thrB and thro genes constitute a threonine pathway. Examples of the genes encoding biosynthesis operon, and the threonine operon forms an attenuator struc enzymes for these aromatic amino acids can include ture. Since the expression of threonine operon is inhibited by deoxyarabino-heptuloSonate phosphate synthase (aroG), isoleucine and threonine in the culture medium and also 3-dehydroquinate synthase (aroB), Shikimic acid dehydroge inhibited by attenuation, the threonine operon can be modi nase (aroE), shikimate kinase (aroL), 5-enolpyruvylshiki fied by removing leader sequence or attenuator in the attenu mate-3-phosphate synthase (aroA), and chorismate synthase ation region (Lynn, S. P. Burton, W. S., Donohue, T. J., (aroC) (EP763127A). Therefore, by introducing multiple Gould, R. M., Gumport, R.I., and Gardner, J. F.J., Mol. Biol. copies of genes encoding these enzyme into cell with a plas 194:59-69 (1987); WO02/26993; WO2005/049808). mid or into genome, the ability for producing an aromatic 0171 The native promoter of the threonine operon locat amino acid can be improved. It is known that these genes can ing upstream of the threonine operon can be replaced with a be controlled by a tyrosine repressor (tyrR), and therefore an non-native promoter (WO98/04715), or the threonine operon aromatic amino acid biosynthesis enzyme activity can also be can be constructed so that expression of genes involved in the increased by deleting the tyrR gene (see European Patent No. threonine synthesis is controlled by the repressor and pro 763127). moter of M-phage (European Patent No. 0593.792). Further 0167 Examples of microorganism having L-phenylala more, mutant Escherichia bacteria that are desensitized to nine-producing ability include, but are not limited to, strains feedback inhibition by L-threonine can be obtained by belonging to the genus Escherichia such as E. coli AJ12739 screening for strains resistant to O-amino-B-hydroxyisova (tyrA:Tn 10, tyrR) (VKPM B-8197) deficient in tyr A and leric acid (AHV). tyrR, E. coli HW1089 (ATCC 55371) harboring a mutant 0172. The thereonine operon can be modified so as to be pheA34 gene (U.S. Pat. No. 5,354,672), E. coli MWEC101-b desensitized to feedback inhibition by L-threonine in a host (KR8903681), E. coli NRRL B-12141, NRRL B-12145, bacterium. Alternatively, this modified operon can be con NRRL B-12146, and NRRL B-12147 (U.S. Pat. No. 4,407, nected to a potent promoter to increase the expression of this 952). E. coli K-12 W3110 (tyrA)/pPHAB (FERMBP-3566), modified operon. The copy number can be increased by E. coli K-12 W3110 (tyrA)/pPHAD (FERM BP-12659), E. amplification with a plasmid. Alternatively, the copy number coli K-12 W3110 (tyr A)/pPHATerm (FERM BP-12662) can be increased by using a transposon or Mu-phage so that and E. coli K-12 W3110 (tyr A)/pBR-aroG4, p.ACMAB), the operon is transferred onto a chromosome of a host bacte also called AJ12604 (FERM BP-3579) also can be used (Eu 1. ropean Patent Publication No. 488-424 B1). Examples fur 0173 L-Threonine-producing bacterium can also be ther include the Strains in which yedA and yddG genes are obtained by enhancing expression of genes involved in the amplified, which are L-phenylalanine-secreting genes glycolytic pathway, TCA cycle, or respiratory chain, genes (WO03/044192, U.S. Published Patent Applications No. that regulate the expression of these genes, or genes involved 2003/0148473 and 2003/0157667). in Sugar uptake, besides the genes of L-threonine biosynthetic 0168 As phenylalanine-producing strains of coryneform enzymes. Examples of these genes that can be effective for bacteria, the Corynebacterium glutamicum strains BPS-13 L-threonine production can include the transhydrogenase (FERM BP-1777), K77 (FERM BP-2062) and K78 (FERM gene (pntAB) (European Patent Publication No. 733712B), BP-2063) in which phosphoenolpyruvate carboxylase or phosphoenolpyruvate carboxylase gene (pepC) (WO95/ pyruvate kinase activity is decreased (EP331145A, Japanese 06114), phosphoenolpyruvate synthase gene (pps) (European Patent Laid-open No. 02-303495), tyrosine auxotrophic Patent Publication No. 877090B), pyruvate carboxylase gene strain (Japanese Patent Laid-open No. 05-049489), and the derived from coryneform bacterium or Bacillus bacterium like can be used. (WO99/18228, EP1092776A). 0169. Other examples of microorganisms having L-threo 0.174 L-Threonine-producing bacterium can also be nine-producing ability can include microorganisms belong obtained by enhancing expression of a gene that imparts ing to the family Enterobacteriaceae in which one or more L-threonine resistance and/or a gene that imparts L-ho activities of L-threonine biosynthesis system enzymes are moserine resistance, or by imparting L-threonine resistance enhanced. Examples of genes encoding L-threonine biosyn and/or L-homoserine resistance to a host bacterium. thetic enzymes can include aspartokinase III gene (lysC), Examples of the genes that impart the resistance can include aspartate semialdehyde dehydrogenase gene (asd), aspartoki the rhtA gene (Res. Microbiol. 154:123-135 (2003)), rht3 nase I gene (thrA), homoserine kinase gene (thrB), and threo gene (EP0994.190A), rhtC gene (EP1013765A), yfiK gene, nine synthase gene (thrC) encoded by the threonine operon. and yeaS gene (EP1016710A). Methods for imparting The abbreviations of the gene names are indicated in the L-threonine resistance to a host bacterium are described in parentheses. Two or more kinds of these genes can be intro EPO994.190A or WO90/O4636. duced. The genes encoding the L-threonine biosynthetic (0175 Escherichia coli VKPM B-3996 (U.S. Pat. No. enzymes can be introduced into an Escherichia bacterium in 5,175,107) can also be exemplified as a microorganism hav US 2009/0286290 A1 Nov. 19, 2009

ing L-threonine-producing ability. The VKPMB-3996 strain 0183 The succinate dehydrogenase (henceforth also was deposited on Nov. 19, 1987 in the Russian National referred to as “SDH) is the enzyme of EC: 1.3.99.1, which Collection of Industrial Microorganisms (VKPM), GNII reversibly catalyzes the following reaction. In accordance Genetika under an accession number VKPM B-3996. The with the presently disclosed subject matter, SDH activity VKPMB-3996 strain contains the plasmid pVIC40 (WO90/ means the activity for catalyzing the following reaction. 04636) which was obtained by inserting threonine biosyn Succinic acid-FAD<->Fumaric acid--FADH2 thetic genes (threonine operon: thrABC) into a wide host range plasmid vector pAYC32 containing the streptomycin 018.4 SDH can include three or four subunit structures resistance marker (Chistorerdov, A.Y., and Tsygankov, Y.D., depending on the type of microorganism, and the activity Plasmid, 16, 161-167 (1986)). The threonine operon in thereof can be decreased by modifying at least one of these pVIC40 contains a mutant thrA gene which encodes aspar proteins so that it does not normally function. Specifically, tokinase I-homoserine dehydrogenase I which is Substan SDH can include the following subunits (names of genes tially desensitized to feedback inhibition by threonine. encoding the Subunits are indicated in parentheses), and the (0176) The Escherichia coli B-5318 strain (European membrane anchor protein is encoded solely by schC or by Patent Publication No. 0593.792B) also can be exemplified as sdhC and SdhD depending on species. a L-threonine-producing ability-imparted bacterium. The 0185. SDHA: flavoprotein subunit (sdhA) B-5318 strain was deposited in the Russian National Collec 0186 SDHB: Fe S protein subunit (sdhB) tion of Industrial Microorganisms (VKPM), GNII Genetika 0187. SDHC: membrane anchor protein (sdh(C) on Nov. 19, 1987 under an accession number of VKPM 0188 SDHD: membrane anchor protein (sdhD) B-5318. The VKPMB-5318 strain is prototrophic with regard 0189 Furthermore, the SDH subunit complex can have the to L-isoleucine, and harbors a recombinant plasmid DNA activities of both SDH and fumarate reductase. For example, which contains the threonine operon, i.e., genes involved in the SDH subunit complex of coryneform bacteria has the threonine biosynthesis, deficient in the attenuator region, activities of both SDH and fumarate reductase (WO2005/ which is a transcription control region originally located 021770). downstream from the C1 temperature-sensitive repressor, 0190. The SDH activity can be confirmed by measuring PR-promoter, and Cro protein N-terminal sequence derived the reduction of 2,6-dichloroindophenol (DCIP) as an indica from w phage, and is constructed so that the expression of the tive index. A specific method is described in Tatsuki genes involved in the threonine biosynthesis is regulated by Kurokawa and Junshi Sakamoto, Arch. Microbiol. (2005) the repressor and promoter derived from w phage. 183:317-324. 0177. In the L-amino acid producing bacterium in accor 0191 In accordance with the presently disclosed subject dance with the presently disclosed subject matter, genes matter, the genes encoding the SDH subunits, and the operon involved in Sugar uptake, Sugar metabolism (glycolysis sys containing them are generically referred to as the 'genes tem) and energy metabolism can be amplified, in addition to encoding SDH.” genes encoding inherent biosynthetic enzymes. 0.192 As genes encoding SDH of enterobacteria, the 0.178 Examples of the genes involved in sugar metabo nucleotide sequences of Such genes of Pantoea anamatis and lism can include genes encoding an enzyme in the glycolytic the amino acid sequences of the subunits are shown in SEQID pathway or enzyme involved in Sugar uptake, such as the NOS: 1 to 6. glucose-6-phosphate isomerase gene (pgi, WO01/02542), 0193 As the genes encoding SDH of coryneform bacteria, phosphoenolpyruvate synthase gene (pps, EP877090A), for example, there are disclosed the sequences of the Sdh phosphoglucomutase gene (pgm, WO03/04598), fructose operon of Corynebacterium glutamicum (GenBank acces bisphosphate aldolase gene (fbp, WO03/04664), pyruvate sion No. NCg10359 (sdhc) NCg 10360 (sdhA) NCg10361 kinase gene (pykF, WO03/008609), transaldolase gene (talB. (sdhB)), and the sdh operon of Brevibacterium flavum (Japa WO03/008611), fumarase gene (fum, WO01/02545), phos nese Patent Laid-open No. 2005-095169, EP672077A1). phoenolpyruvate synthase gene (pps, EP877090A), non-PTS 0194 As the genes encoding SDH of coryneform bacteria, Sucrose uptake gene (c.Sc, EP14991 1A), and Sucrose-assimi the nucleotide sequences of the genes of Corynebacterium lating gene (scraB operon, WO90/04636). glutamicum ATCC 13032, and the amino acid sequences of the subunits are shown in SEQ ID NOS: 73 to 76, and the 0179 Examples of genes encoding enzymes involved in nucleotide sequences of the genes of Brevibacterium lactof energy metabolism can include transhydrogenase gene ermentum (Corynebacterium glutamicum) ATCC 13869 and (pntAB, U.S. Pat. No. 5,830,716) and cytochromoebo type the amino acid sequences of the subunits are shown in SEQID oxidase gene (cyoB, EP1070376A). NOS: 77 to 80. 0180 A microorganism in accordance with the presently 0.195. In accordance with the presently disclosed subject disclosed Subject matter can be a microorganism having an matter, the C-ketoglutarate dehydrogenase (henceforth also L-amino acid-producing ability as described above and modi referred to as "O-KGDH) activity means an activity of cata fied so that Succinate dehydrogenase activity and O-ketoglu lyzing the reaction oxidatively decarboxylating O-ketoglu tarate dehydrogenase activity are decreased. taric acid (2-oxoglutaric acid) to generate Succinyl-CoA. The 0181 <1-2> Decrease of Succinate Dehydrogenase Activ aforementioned reaction can be catalyzed by three kinds of ity and C-Ketoglutarate Dehydrogenase Activity enzymes, C.-KGDH (Elo, C.-ketoglutarate dehydrogenase, 0182. The expression “activities of the enzymes are EC: 1.2.4.2), dihydrolipoamide S-succinyltransferase (E2O, decreased' means that the Succinate dehydrogenase activity EC: 2.3.1.61), and dihydrolipoamide dehydrogenase (E3, and the C-ketoglutarate dehydrogenase activity are lower EC: 1.8.1.4). That is, these three kinds of subunits can cata than in a non-modified strain such as wild-type strain or lyze the following reactions, respectively, and the activity for parent strain, which includes that the enzyme activities have catalyzing a reaction consisting of a combination of these completely disappeared. three kinds of reactions is called the C.-KGDH activity. The US 2009/0286290 A1 Nov. 19, 2009

C.-KGDH activity can be confirmed by measurement accord or the enzyme protein molecule can be made not to be pro ing to the method of Shiio et al. (Isamu Shiio and Kyoko duced at all. Furthermore, the enzyme activity per molecule Ujigawa-Takeda, Agric. Biol. Chem., 44 (8), 1897-1904, of the enzyme protein can be reduced, or the activity can be 1980). eliminated. The number of enzyme protein molecules can be 0196. Elo: 2-oxoglutarate--dihydrolipoyllysine-residue decreased by decreasing expression of the gene encoding the Succinyltransferaselipoyllysine-dihydrolipoyllysine-resi enzyme. Decreasing expression includes decreasing tran due SuccinyltransferaseS-Succinyldihydrolipoyllysine+CO Scription of mRNA transcribed from the gene and decreasing 0.197 E2o: CoA--enzyme N6-(S-succinyldihydrolipoyl) translation of the mRNA. Moreover, an enzyme protein mol lysine=succinyl-CoA--enzyme N6-(dihydrolipoyl)lysine ecule can be made not to be produced at all, or enzymatic (0198 E3: protein N6-(dihydrolipoyl)lysine--NAD" pro activity per molecule of the enzyme protein can be decreased, tein N6-(lipoyl)lysine+NADH+H" or the activity can be eliminated by disruption of the gene 0199 C.-KGDH is also referred to as oxoglutarate dehy encoding the enzyme. Examples of the wild-type strain used drogenase or 2-oxoglutarate dehydrogenase. as an object of the comparison include the Pantoea anamatis 0200. In Enterobacteriaceae bacteria such as Pantoea AJ13355 strain, Klebsiella planticola AJ13399 strain, anamatis, the protein Subunits which each have three kinds of Corynebacterium glutamicum ATCC 13032 strain, Brevibac enzymatic activities form a complex. The subunits are terium lactofermentum ATCC 13869 strain, Brevibacterium encoded by SucA, such and lpd, respectively, and the SucA flavum ATCC 14067 strain, and the like. and Such genes are located downstream from the Succinate 0208. The gene encoding SDH can correspond to one or dehydrogenase iron-sulfur protein gene (sdhB) (U.S. Pat. No. more of the genes encoding the subunits of SDH, or the whole 6,331.419). Although these genes are described as genes of operon, and a mutation can be introduced into any of the Enterobacter agglomerans AJ13355 in the aforementioned genes encoding the subunits (SDHA, SDHB, SDHC, SDHD) patent, this strain was later reclassified into Pantoea anamatis. 0209 Although the gene encoding C-KGDH can corre 0201 AS genes encoding C-KGDH of enterobacteria, the spond to one or more of the genes encoding the Subunits of nucleotide sequences of the SucA and Such3 genes and the C-KGDH or the whole gene cluster, it can be a gene encoding SucC gene locating downstream thereof and the amino acid the Elo Subunit (SucA or odh A), or a gene encoding the E20 sequences of the Subunits of Pantoea anamatis are shown in subunit (sucB). SEQ ID NOS: 7 to 11. Furthermore, sucA, such3 and sucC 0210 Since the nucleotide sequences of the genes encod encoding O-KGDH of Escherichia coli have been disclosed ing the subunits of SDH or C-KGDH can differ depending on as Genbank NP 415254 and NP 415255, respectively. species to which the microorganism belongs or strain, the 0202 In coryneform bacteria, the Elo subunit can be genes encoding them can be variants of the nucleotide encoded by the odha gene (registered as NCg 11084 of Gen sequences of SEQ ID NOS: 1, 7, 12, 14, 73, 77 and 81. Bank Accession No. NC 003450, which is also referred to as Variants of the genes can be listed by searching an appropriate the sucA gene), and the E3 subunit can be encoded by the lpd database, such as BLAST (http://blast.genome.jp/), or the gene (GenBank Accession No.Y 16642). On the other hand, it like, with reference to the nucleotide sequences of SEQ ID is estimated that the E2o subunit can be encoded by the odha NOS: 1, 7, 12, 14,73, 77 and 81. The variants of the genes can gene and can constitute a bifunctional protein along with the include homologues of the genes, such as genes which can be Elo subunit (Usuda et al., Microbiology, 142, 3347-3354, amplified by PCR using a chromosome of a microorganism 1996), or can be encoded by the gene registered as NCg 12126 Such as Enterobacteriaceae and coryneform bacteria as a of GenBank Accession No. NC 003450, which is different template and synthetic oligonucleotidesprepared on the basis from the odh A gene. Therefore, in accordance with the pres of for example, the nucleotide sequences of SEQID NOS: 1. ently disclosed subject matter, although the odh A gene 7, 12, 14, 73 and 81. encodes the Elo subunit, it can also encode the E20 subunit. 0211 Examples of the subunits of SDH can include pro 0203 The nucleotide sequence of the odh A gene of Brevi teins having one of the amino acid sequences of SEQ ID bacterium lactofermentum and the amino acid sequence of NOS: 2 to 4, 6, 74 to 76 and 78 to 80, and examples of the the Elo subunit encoded thereby (NCg 11084 of GenBank subunits of C-KGDH include proteins having one of the Accession No. NC 003450, WO2006/028298) are shown in amino acid sequences of SEQID NOS: 8 to 11, 13, 15 and 81. SEQ ID NOS: 12 and 13. Furthermore, the nucleotide However, since the codons may differ and hence the nucle sequence of the aforementioned NCg 12126 of GenBank otide sequences of the genes may differ depending on species Accession No. NC 003450 and the amino acid sequence of or strains of bacteria, the genes can encode a protein having the E20 subunit encoded thereby are shown in SEQID NOS: any of the amino acid sequences which can include one or 14 and 15. more Substitutions, deletions, insertions or additions of one or 0204. In accordance with the presently disclosed subject several amino acid residues, so long as the function of the matter, genes encoding each of the C-KGDH subunits, and encoded protein is maintained. The number of the “one or the gene cluster containing them are generically referred to as several amino acid residues is, for example, 1 to 20, and in the “genes encoding C-KGDH'. another example 1 to 10, and in another example 1 to 5. These 0205 The enzymatic activities can be decreased by, for Substitutions, deletions, insertions, or additions of one or example, the following methods. several amino acids can be conservative mutations preserving 0206 (1) Method of Disrupting Genes which Encode normal functions of the proteins. Such a conservative muta Enzymes by Gene Recombination tion can be a mutation wherein Substitution takes place mutu 0207. By modifying a gene encoding SDH or C.-KGDH ally among Phe, Trp and Tyr, if the substitution site is an (henceforth also referred to simply as “enzyme') by gene aromatic amino acid; among Leu, Ile and Val, if the Substitu recombination, the number of the molecules of the enzyme tion site is a hydrophobic amino acid; between Gln and ASn, protein encoded by any of these genes per cell can be if it is a polar amino acid; among Lys, Arg and His, if it is a decreased as compared to a parent Strain or wild-type strain, basic amino acid; between Asp and Glu, if it is an acidic US 2009/0286290 A1 Nov. 19, 2009

amino acid; and between Ser and Thr, if it is an amino acid 0215. The expression that “to modify a gene by gene having a hydroxyl group. Typical examples of conservative recombination” means to delete a part or all of an expression mutations can be conservative Substitutions. Examples of control sequence such as promoter region, a coding region, or Substitutions considered conservative Substitutions can a non-coding region of the gene on a chromosome, or insert include: Substitution of Seror Thr for Ala; substitution of Gln, another sequence into any of these regions using homologous His or Lys for Arg; substitution of Glu, Gln, Lys, His or Asp recombination, and thereby decrease intracellular enzyme for ASn; substitution of Asn. Glu or Gln for Asp; substitution activity. A gene modification can be performed to such an of Ser or Ala for Cys; substitution of Asn. Glu, Lys, His, Asp extent that inactivation of the gene should no longer be or Arg for Gln; substitution of Asn., Gln, Lys or Asp for Glu; restored by spontaneous mutation. substitution of Pro for Gly; substitution of Asn., Lys, Gln, Arg 0216. However, the modification can be performed with a or Tyr for His; substitution of Leu, Met, Val or Phe for Ile: conventional mutagenesis such as X-ray or ultraviolet irra substitution of Ile, Met, Val or Phe for Leu; substitution of diation or a treatment with a mutagen such as N-methyl-N'- ASn, Glu, Gln, His or Arg for Lys; substitution of Ile, Leu, Val nitro-N-nitrosoguanidine, so long as the SDH and C.-KGDH or Phe for Met; substitution of Trp, Tyr, Met, Ile or Leu for activities are decreased. Phe; substitution of Thr or Ala for Ser; substitution of Ser or 0217. The expression control sequence can be modified Ala for Thr; substitution of Phe or Tyr for Trp; substitution of for one or more nucleotides. In another exemplary embodi His, Phe or Trp for Tyr; and substitution of Met, Ile or Leu for ment in accordance with the disclosed subject matter the Val. expression control sequence can be modified for two or more 0212. The variants of the genes are not limited to genes nucleotides. And, in another exemplary embodiment in accor having a nucleotide sequence of the coding regions in the dance with the disclosed subject matter the expression control nucleotide sequences of SEQID NOS: 1, 7, 12, 14,73,77 and sequence can be modified for three or more nucleotides. 81, and can be a DNA which hybridizes with a nucleotide When a deletion is performed for a coding region, the region sequence complementary to any of those nucleotide to be deleted can be in the N-terminus region, an internal sequences and nucleotide sequences of the coding regions or region, or in the C-terminus region, or the entire coding a probe prepared from any of those nucleotide sequences region, so long as the function of the enzyme protein is under stringent conditions. The term "stringent conditions' decreased or eliminated. Deletion of a longer region will refers to conditions where a so-called specific hybrid is usually ensure inactivation of the gene. Furthermore, the formed and a non-specific hybrid is not formed. Examples reading frames upstream and downstream of the deleted thereof can include conditions where DNAS having high region can be different from each other. homology, for example, homology of 80% or more, and in 0218. Also, when another sequence is inserted into the another example 90% or more, and in another example 95% coding region, the sequence can be inserted into any region, or more, and in another example 97% or more, and in another and inserting a longer region will usually ensure inactivation example 99% or more, hybridize with each other and DNAS of the gene. The reading frames upstream and downstream of having homology less than the value described above do not the insertion site can be different from each other. The other hybridize with each other; and specifically can include wash sequence is not particularly limited so long as the sequence ing conditions of typical Southern hybridization, e.g., wash has the effect of decreasing or eliminating the function of the ing at 60°C., 1xSSC, 0.1% SDS, and in another example 60° enzyme protein, and examples can include a transposon car C., 0.1xSSC, 0.1% SDS, and in another example 68° C., rying an antibiotic resistance gene or a gene useful for 0.1 xSSC, 0.1% SDS, once or twice or three times. Although L-glutamic acid production. the length of the probe can be chosen Suitably depending on 0219. A gene on the chromosome can be modified as the hybridization conditions, it is usually 100 bp to 1 kbp. described above by, for example, preparing a deletion-type 0213 Gene modification can be achieved by, for example, version of the gene in which a partial sequence of the gene is deleting a part of or the entire coding region of a gene on a deleted so as it is unable to produce an enzyme protein that chromosome, modifying an expression control sequence can normally function, and transforming a bacterium with a Such as a promoter and the Shine-Dalgarno (SD) sequence, DNA containing the deletion-type gene to cause homologous and the like. Furthermore, expression of a gene can also be recombination between the deletion-type gene and the native decreased by modification of a non-translation region other gene on the chromosome, and thereby Substitute the deletion than expression control sequence. Moreover, the entire gene type gene for the gene on the genome. The enzyme protein including a flanking region on both sides of the gene on the encoded by the deletion-type gene has a conformation differ chromosome can be deleted. Furthermore, it also can be ent from that of the wild-type enzyme protein, if it is even achieved by introducing a mutation for one or more amino produced, and thus the function is decreased or eliminated. acid Substitutions (missense mutation), introducing a stop Such gene disruption based on gene Substitution utilizing codon (nonsense mutation), or introducing a frameshift muta homologous recombination has been already established, and tion which adds or deletes one or two nucleotides by gene can be performed by methods using a linear DNA such as recombination (Journal of Biological Chemistry, 272: 8611 Red-driven integration (Datsenko, K. A., and Wanner, B. L., 8617 (1997); Proceedings of the National Academy of Sci Proc. Natl. Acad. Sci. USA,97:6640-6645 (2000)), and Red ences, USA, 955511-5515 (1998); Journal of Biological driven integration in combination with an excisive system Chemistry, 266, 20833-20839 (1991)). derived from phage described in Cho, E. H., Gumport, R.I., 0214 Moreover, in enterobacteria, the sucA and such} Gardner, J. F.J. Bacteriol. 184: 5200-5203 (2002) (WO2005/ genes are located upstream of the Sdh operon, and therefore a 010175), using a plasmid containing a temperature-sensitive mutation for decreasing expression of the Sdh operon and replication origin, or a plasmid capable of conjugative trans thereby decrease expression of the SucA and SucF3 genes can fer, methods utilizing a Suicide vector which does not have a be introduced. Such a mutation can be utilized in accordance replication origin usable in the chosen host (U.S. Pat. No. with the presently disclosed subject matter. 6,303,383, Japanese Patent Laid-open No. 05-007491) etc. US 2009/0286290 A1 Nov. 19, 2009

0220. As shown in Reference Example 1, a strain resistant cinic acid auxotrophy (J. Gen. Microbiol., 1978 July; 107(1): to a w Red gene product, for example, the Pantoea anamatis 1-13). Therefore, by selecting a strain which can recover from SC17(0) strain, can be suitably used for the Red driven inte succinic acid auxotrophy from C-KGDH activity-decreased gration. The SC17(0) strain was deposited in the Russian strains, an O-KGDH and SDH activity-decreased strain can National Collection of Industrial Microorganisms (VKPM), be obtained. Specifically, C.-KGDH activity-decreased GNII Genetika on Sep. 21, 2005 under an accession number strains can be plated on a minimal medium not containing of VKPMB-9246. succinic acid, and allowed to form colonies. In an O-KGDH 0221 Decreased transcription of the genes can be con activity-decreased strain which can grow in the minimal firmed by comparison of the mRNA levels of the genes with medium not containing Succinic acid, the gene encoding SDH those in the wild-type or unmodified strain. Examples of highly frequently can contain a mutation. methods for measuring expression can include Northern 0237) <3> Method for Producing L-Amino Acid hybridization and Reverse-Transcriptase PCR (RT-PCR) 0238. By culturing such a microorganism as described (Molecular Cloning, Cold Spring Harbor Laboratory Press, above in a medium to produce and accumulate an L-amino Cold spring Harbor (USA), (2001)). The decrease of tran acid in the medium or cells and collecting the L-amino acid Scription can be at any level so long as it is decreased com from the medium or the cells, L-amino acid can be produced. pared with that of a wild-type or unmodified strain. For 0239. A medium used for the culture can be a medium example, the level can be decreased to within a range of 75% containing a carbon Source, a nitrogen source and mineral or less, to within a range of 50% or less, to within a range of salts as well as organic trace nutrients such as amino acids and 25% or less, to within a range of 10% or less, or to a value of Vitamins, as required. Either a synthetic medium or a natural 0%, of the level of a wild-type or unmodified strain. medium can be used. Any carbon source and any nitrogen 0222. The decrease in the amount of protein encoded by a Source can be used so long as they can be utilized by the strain gene can be confirmed by Western blotting using an antibody to be cultured. (Molecular Cloning, Cold Spring Harbor Laboratory Press, 0240 Sugars Such as glucose, glycerol, fructose, Sucrose, Cold spring Harbor (USA), (2001)). The decrease of the maltose, mannose, galactose, starch hydrolysates and molas protein amount can beat any level so long as it is decreased as ses can be used as the carbon Source. In addition, organic compared to that of a wild-type or unmodified strain, and for acids such as acetic acid and citric acid, and alcohols such as example, the level can include a range of 75% or less, a range ethanol can also be used each alone or in a combination with of 50% or less, a range of 25% or less, a range of 10% or less, other carbon sources. Ammonia, ammonium salts such as or a value of 0%, of the level of a wild-type or unmodified ammonium Sulfate, ammonium carbonate, ammonium chlo strain. ride, ammonium phosphate and ammonium acetate, nitric 0223 (2) Acquisition of C-KGDH Activity-Decreased acid salts and so forth can be used as the nitrogen source. Strain Utilizing Auxotrophy Amino acids, vitamins, fatty acids, nucleic acids, those con 0224. An C.-KGDH activity-decreased strain can be taining those Substances such as peptone, casamino acid, obtained by the method of (1) described above, and can also yeast extract and soybean protein decomposition product, and be obtained by the following method utilizing auxotrophy. the like, can be used as the organic trace nutrients. When an 0225. For example, microbial cells can subjected to a auxotrophic mutant strain that requires an amino acid or the usual mutagenesis using N-methyl-N'-nitro-N-nitrosoguani like for its growth is used, the required nutrient can be supple dine (for example, 250 ug/ml, 30°C., 20 minutes), and then mented. Phosphoric acid salts, magnesium salts, calcium cultured on a solid medium to allow colony formation. By salts, iron salts, manganese salts, and the like, can be used as separating a mutated Strain which cannot grow in a medium the mineral salts. containing L-glutamic acid as a single carbon Source and 0241 The culture can be performed in aerobic conditions, single nitrogen source from the colonies by the replica plat while the fermentation temperature can be controlled to be 20 ing, an O.-KGDH activity-decreased strain can be isolated. to 45° C., and pH to be 3 to 9. For adjustment of pH, an 0226 Examples of C-KGDH activity-decreased strain inorganic or organic acidic or alkaline Substance, ammonia include, for example, the following strains. gas or the like can be used. A substantial amount of L-amino 0227 Brevibacterium lactofermentum AJ12821 (FERM acid can be accumulated in the culture medium or cells after BP-4172, U.S. Pat. No. 5.492.818) 10 to 120 hours of culture in such a manner as described 0228 Brevibacterium flavum AJ12822 (FERM BP-4173, above. U.S. Pat. No. 5.492.818) 0242 Moreover, when the objective L-amino acid is 0229 Corynebacterium glutamicum AJ12823 (FERM L-glutamic acid, the culture can be performed to produce and BP-4174, U.S. Pat. No. 5.492.818) accumulate L-glutamic acid with precipitating L-glutamic 0230 Brevibacterium lactofermentum AS stain (WO95/ acid in a medium using, as the medium, a liquid medium 34672) adjusted to satisfy a condition under which L-glutamic acid is 0231 Corynebacterium glutamicum OAGN, OA2-2, precipitated. Examples of the condition under which OAGN2-2 (WO2006/028298) L-glutamic acid is precipitated can include, for example, pH 0232 Pantoea ananatis AJ13601 (FERM BP-7207) within a range of 5.0 to 4.0, pH within a range of 4.5 to 4.0, pH 0233 Klebsiella planticola AJ13410 (FERM BP-6617) within a range of 4.3 to 4.0, or a pH of 4.0. In order to obtain 0234 Pantoea ananatis AJ13355 (FERM BP-6614) both improvement of growth under an acidic condition and 0235 (3) Acquisition of SDH Activity-Decreased Strain efficient precipitation of L-glutamic acid, the pH can be Using Succinic Acid Auxotrophy as Indicative Index within a range of 5.0 to 4.0, a range of 4.5 to 4.0, or a range of 0236 An O-KGDH activity-decreased strain can require 4.3 to 4.0. The culture can be performed at the aforemen Succinic acid for growth due to decrease of Succinyl-CoA tioned pH for the whole culture period or a part of it. supply. On the other hand, it is known that an O-KGDH and 0243 Collection of L-amino acid from the culture broth SDH double deficient strain can be recovered from the suc after the culture can be performed in a conventional manner. US 2009/0286290 A1 Nov. 19, 2009

For example, after the cells are removed from the culture 3-21 (2004)). Furthermore, the RSF-Red-TER plasmid con broth, L-amino acid can be collected by concentrating the tains the levanSucrase gene (sacB), and by using this gene, the broth to crystallize the L-amino acid, ion exchange chroma plasmid can be collected from cells in a medium containing tography, or the like. When the culture is performed under SUCOS. conditions under which L-glutamic acid is precipitated, 0250 In Escherichia coli, the frequency of integration of a L-glutamic acid precipitated in the medium can be collected PCR-generated DNA fragment along with the short flanking by centrifugation or filtration. In this case, L-glutamic acid region provided by the RSF-Red-TER plasmid is as high as dissolving in the medium can be precipitated and then sepa the frequency obtainable using the pKD46 helper plasmid rated together. (Datsenko, K. A., Wanner, B. L., Proc. Natl. Acad. Sci. USA, 0244. In addition, the culture can be performed in a 97, 6640-6645 (2000)). However, expression of the Red medium containing trehalose. As for the concentration of genes is toxic to Pantoea anamatis. Cells transformed with the trehalose contained in the medium, exemplary ranges of the RSF-Red-TER helper plasmid grow extremely slowly in the concentration can include the range of 0.1 g/L or more, is the LB medium containing IPTG (isopropyl-B-D-thiogalactopy range of 0.2 g/L or more, and the range of 0.5 g/L or more. ranoside, 1 mM) and an appropriate antibiotic (25 g/ml of When a coryneform bacterium is used, in particular, exem chloramphenicol or 40 ug/ml of kanamycin), and the effi plary ranges of the concentration can include the range of 0.5 ciency of Red-mediated recombination is extremely low g/L or more, th range of 0.75 g/L or more, and the range of 2 (10), if observed at all. g/L or more. As trehalose added to the medium, crystalline 0251 A variant strain of Pantoea ananatis which is resis trehalose can be dissolved, or trehalose can be contained in a tant to expression of all three of the Red genes was selected. mother liquor obtained after a target Substance is collected For this purpose, the RSF-Red-TER plasmid was introduced from a fermentation liquor produced in a fermentation pro into the Pantoea ananatis SC 17 strain (U.S. Pat. No. 6,596, cess may also be used. Moreover, trehalose contained in the 517) by electroporation. After an 18 hour culture, about 10° of medium can be trehalose produced in a fermentation broth as transformants were obtained, and among these, 10 clones a by-product. formed large colonies, and the remainder all formed 0245. Furthermore, if betaine (N-methylglycine, N.N- extremely small colonies. After an 18 hour culture, the large dimethylglycine, N.N.N-trimethylglycine, 2-hydroxyethyl colonies had a size of about 2 mm, and the Small colonies had trimethyl ammonium) is added in addition to trehalose, pro a size of about 0.2 mm. Whereas the small colonies did not ductivity of the target substance can be further improved. grow any more even if the culture was extended to 24 hours, Exemplary ranges of the concentration of betaine can be a the large colonies continued to grow. One of the large colony range of 0.1 g/L or more, a range of 0.25 g/L or more, and a Pantoea anamatis mutant strains and resistant to expression of range of 0.5 g/L or more. all of the three W. Red genes (gam, bet, and exo) was used for the further analysis. EXAMPLES (0252) The RSF-Red-TER plasmid DNA was isolated from 0246 Hereinafter, the present invention will be described one clone of the large colony clones, and from several clones in more detail by referring to examples. of Small colonies, and transformed again into Escherichia coli MG 1655 to examine the ability of the plasmid to synthe Reference Example 1 size an active Red gene product. By a control experiment for Red-dependent integration in the obtained transformants, it Construction of Pantoea ananatis Strain which is was demonstrated that only the plasmid isolated from the Resistant to the W. Red Gene Product large colony clone induced expression of the W. Red genes 0247 To disrupt the sdhA gene in Pantoea ananatis, a required for the Red-dependent integration. In order to inves recipient strain was constructed which can efficiently carry tigate whether the Red-mediated integration occurs in the out the method called “Red-driven integration' or “Red-me selected large colony clone, electroporation was performed diated integration’ (Proc. Natl. Acad. Sci. USA, 97, 6640 using a linear DNA fragment produced by PCR. This frag 6645 (2000)). ment was designed so that it should containa Kim' marker and 0248 First, the novel helper plasmid RSF-Red-TER a flanking region of 40 bp homologous to the hisD gene. This which expresses the gam, bet and exogenes of w (henceforth fragment was integrated into the hisD gene of Pantoea anana referred to as “w Red genes') was constructed (FIG. 1). The tis at the SmaI recognition site. Two Small colony clones were details thereof will be described in Reference Example 2. used as control. The nucleotide sequence of the hisD gene of 0249. This plasmid can be used in a wide range of hosts Pantoea ananatis is shown in SEQID NO: 16. For PCR, the having different genetic backgrounds. This is because 1) this oligonucleotides of SEQ ID NOS: 17 and 18 were used as plasmid has the replicon of the RSF 1010 wide host spectrum primers, and the pMW 118-(watt-Km-watt) plasmid was used plasmid (Scholz, et al., 1989; Buchanan-Wollaston et al., as the template. The two small colony clones which were not 1987), which can be stably maintained by many types of gram resistant to the W. Red genes, were used as a control. Construc negative and gram positive bacteria, and even plant cells, 2) tion of the pMW 118-(wattl-Km-wattR) plasmid will be thew Red genes, gam, bet and exogenes, are under the control explained in detail in Reference Example 3. of the PlacUV5 promoter, which is recognized by the RNA 0253) The RSF-Red-TER plasmid can induce expression polymerases of many types of bacteria (for example, Brun of the Red genes by the lacI gene carried on the plasmid. Two schwig, E. and Darzins, A., Gene, 111, 1, 35-41 (1992); kinds of induction conditions were investigated. In the first Dehio, M. et al, Gene, 215, 2, 223-229 (1998)), and 3) the group, IPTG (1 mM) was added 1 hour before the electropo autoregulation factor Prs-lacI and the p-non-dependent ration, and in the second group, IPTG was added at the start of transcription terminator (TrrnB) of the rmB operon of the culture for preparation of cells of which electroporation is Escherichia coli lower the basal expression level of the Red possible. The growth rate of the cells harboring RSF-Red genes (Skorokhodova, A. Yu et al. Biotekhnologiya (Rus), 5, TER derived from the large colony clone was not significantly US 2009/0286290 A1 Nov. 19, 2009

lower than that of a strain not having the SC17 plasmid. The PlacIsachBcat was digested with BglII, blunt-ended with addition of IPTG only slightly decreased the growth rate of DNA polymerase I Klenow fragment, and successively these cultures. On the other hand, the progeny of the small digested with SacI. A 3.8 kb BglII-SacI fragment of the colony clones grew extremely slowly even without the addi pMWPlacIsacBcat plasmid was eluted from 1% agarose tion of IPTG, and after induction, growth was substantially gel, and ligated with the RSF 1010 vector which had been arrested. After electroporation of the cells of the progeny of treated with Pst and SacI. Escherichia coli TG1 was trans the large colony clone, many Kim clones grew (18 clones formed with the ligation mixture, and plated on the LB after a short induction time, and about 100 clones after an medium containing chloramphenicol (50 mg/L). The plas extended induction time). All the 100 clones that were inves mids isolated from the grown clones were analyzed with tigated had a His phenotype, and about 20 clones were restriction enzymes to obtain a RSFsacB plasmid. In order to confirmed by PCR to have the expected structure of chromo construct a RSFsacBPMCS vector, a DNA fragment con some in the cells. On the other hand, even when electropora taining the Prs promoter was amplified by PCR using tion was performed with the progeny of the Small colony oligonucleotides of SEQID NOS: 23 and 24 as primers and clones, an integrated Strain was not obtained. the pMW1 19-PlacI plasmid as the template. The obtained 0254 The obtained large colony clone was grown on a fragment of 146 bp was digested with SacI and NotI, and plate containing 7% Sucrose to eliminate the plasmid, and ligated with the SacI-NotI large fragment of the RSFsacB transformed again with RSF-Red-TER. The strain without plasmid. Then, by PCR using the oligonucleotides of SEQID the plasmid was designated SC 17(0). This strain was depos NOS: 25 and 26 as primers, and the pKD46 plasmid (Dat ited at the Russian National Collection of Industrial Micro senko, K. A., Wanner, B. L., Proc. Natl. Acad. Sci. USA, 97. organisms (VKPM, GNII Genetica (address: Russia, 117545 6640-6645 (2000)) as the template, a DNA fragment of 2.3 kb Moscow, 1 Dorozhny proezd. 1) on Sep. 21, 2005, and containing the WRedo?y genes and the transcription termina assigned an accession number of VKPMB-9246. tortL3 was amplified. The obtained fragment was cloned into 0255 All the clones which grew after the aforementioned the RSFSacBP,iac MCS vector at the PvuI-Not site. In this re-transformation formed large colonies like the parent strain way, the RSFRed plasmid was designed. clone SC17(0). The Red-mediated integration experiment 0259. In order to eliminate the read through transcription was performed in the SC17(0) strain re-transformed with the of the Red genes, a p-dependent transcription terminator of RSF-Red-TER plasmid. Three of the independent transfor thermB operon of Escherichia coli was inserted at a position mants were investigated using the same DNA fragment as that between the cat gene and the Prs promoter. For this pur used for the previous experiment. The short induction time (1 pose, a DNA fragment containing the Prs promoter and hour before electroporation) was employed. Kim clones the TrrnB terminator was amplified by PCR using the oligo exceeding ten clones grew in each experiment. All the exam nucleotides of SEQ ID NOS: 27 and 24 as primers and the ined clones had the His phenotype. In this way, a mutant chromosome of Escherichia coli BW3350 as a template. strain designated SC 17(0) resistant to the expression of the w These obtained fragments were treated with KpnI and ligated. Red genes was selected. This strain can be used as a recipient Then, the 0.5 kb fragment containing both Prs and TrrnB strain suitable for the Red-dependent integration into the was amplified by PCR using the oligonucleotides of SEQID Pantoea anamatis chromosome. NOS: 24 and 28 as primers. The obtained DNA fragment was digested with EcoRI, blunt-ended by a treatment with DNA Reference Example 2 polymerase I Klenow fragment, digested with BamHI, and ligated with the Ecl136II-BamHI large fragment of the RSF Construction of Helper Plasmid RSF-Red-TER sacBPlacMCS vector. The obtained plasmid was designated 0256 The construction scheme of the helper plasmid RSF-Red-TER. RSF-Red-TER is shown in FIG. 2. 0257. As a first step of the construction, a RSFsacBPlac Reference Example 3 MCS vector was designed. For this purpose, DNA fragments containing the cat gene of the p ACYC184 plasmid and the Construction of the pMW 118-(wattl-Km-wattR) structural gene region of the sacB gene of Bacillus subtilis Plasmid were amplified by PCR using the oligonucleotides of SEQID NOS: 19 and 20, and 21 and 22, respectively. These oligo 0260 The pMW 118-Ouattl-Km-wattR) plasmid was con nucleotides contained BglII, SacI, Xbaland BamHI restric structed from the pMW 118-attL-Tc-attR (WO2005/010175) tion enzyme sites, required and convenient for further clon plasmid by replacing the tetracycline resistance marker gene ing, in the 5' end regions, respectively. The obtained sacB with the kanamycin resistance gene of the puC4K plasmid. fragment of 1.5 kb was cloned into the previously obtained For that purpose, the EcoRI-HindIII large fragment from pMW1 19-PlacIvector at the Xbal-BamHI site. This vector pMW1 18-atti-Tc-attR plasmid was ligated to two fragments was constructed in the same manner as that described for the from the puC4K plasmid: HindIII-PstI fragment (676 bp) pMW 118-PlacI vector (Skorokhodova, A. Yu et al. and EcoRI-HindIII fragment (585 bp). Basic pMW1 18-attL Biotekhnologiya (Rus), 5, 3-21 (2004)). However, this vector Tc-attR was obtained by ligation of the following four frag contained a polylinker moiety derived from pMW219 instead ments: of the pMW218 plasmid. 0261) 1) the BglII-EcoRI fragment (114 bp) including atti, 0258. Then, the aforementioned cat fragment of 1.0 kb (SEQ ID NO:31) which was obtained by PCR amplification was treated with BglII and SacI, and cloned into the RSF of the region corresponding to attL of the Escherichia coli PlacIsacF3 plasmid obtained in the previous step at the W3350 (containing prophage) chromosome using the prim BamHI-SacI site. The obtained plasmid PMW-PlacIsach3 ers P1 and P2 (SEQ ID NOS: 29 and 30) (these primers cat contained the PlacUV5-lacI-sacB-cat fragment. In order contained the Subsidiary recognition sites for BglII and to subclone this fragment into the RSF1010 vector, PMW EcoRI): US 2009/0286290 A1 Nov. 19, 2009

0262 2) the PstI-HindIII fragment (182 bp) including attR (0272. The primer 1 (SEQ ID NO: 42) and the primer 2 (SEQ ID NO:34) which was obtained by PCR amplification (SEQ ID NO: 43) for amplifying a part of RSFCPG of the region corresponding to attR of the Escherichia coli (EP1233068A) other than ORF of the gltA gene were W3350 (containing prophage) chromosome using the prim designed. By using these primers and RSFCPG as the tem ers P3 and P2 (SEQ ID NOS: 32 and 33) (these primers plate, PCR was performed to obtain a fragment of about 14.9 contained the subsidiary recognition sites for Pst and Hin kb. As for prpC, PCR was performed using the primer 3 (SEQ dIII): ID NO. 44) and the primer 4 (SEQ ID NO: 45) and the 0263. 3) the BglII-HindIII large fragment (3916 bp) of chromosomal DNA of the E. coli W3110 strain as the tem pMW1 18-ter rrnB. The plasmid pMW 118-ter rrnB was plate to obtain a fragment of about 1.2 kb. Both the PCR obtained by ligation of the following three DNA fragments: products were treated with BglII and Kipni, ligated, and then 0264 the large DNA fragment (2359 bp) including the used to transform the E. coli JM109 strain. All the colonies AatiI-EcoRI fragment of pMW 118 that was obtained by which emerged were collected, and plasmids were extracted digesting pMW 118 with EcoRI, treating with Klenow from the colonies as a mixture. The E. coli ME8330 strain fragment of DNA polymerase I, and then digesting with which is a citrate synthase (CS) deficient strain was trans Aat; formed with the plasmid mixture, and the cell Suspension was 0265 the small AatiI-BglII fragment (1194 bp) of applied on the M9 minimal medium (containing 5 g of glu pUC19 including the bla gene for amplicillin resistance cose, 2 mM magnesium sulfate, 3 g of monopotassium phos (Ap'), which was obtained by PCR amplification of the phate, 0.5g of Sodium chloride, 1 g of ammonium chloride corresponding region of the puC19 plasmid using the and 6 g of disodium phosphate in 1 L of pure water) contain primers P5 and P6 (SEQ ID NOS: 35 and 36) (these ing 50 mg/L of uracil and 5 mg/L of thiamine HC1. From the primers contained the Subsidiary recognition sites for emerged strains, a plasmid was extracted and designated PstI, Aat|I and BglII); RSFPPG. This plasmid RSFPPG was introduced into the 0266 the small BglII-PstI fragment (363 bp) of the Pantoea ananatis NP106 strain, which is an L-glutamic acid transcription terminator ter rrnB, which was obtained producing strain, to construct an L-glutamic acid producing by PCR amplification of the corresponding region of the strain, NP106/RSFPPG (this strain is referred to as “NA1 Escherichia coli MG 1655 chromosome using the prim strain'). ers P7 and P8 (SEQID NOS:37 and 38) (these primers 0273. The NP106 strain was obtained as follows. The Pan contained the subsidiary recognition sites for PstI and toea ananatis AJ13601 strain described above was cultured BglII); and overnight at 34°C. in the LBGM9 liquid medium with shak 0267 4) the small EcoRI-PstI fragment (1388 bp) (SEQ ing, and then the medium was diluted so that 100 to 200 ID NO:39) of pML-Tc-ter thrL including the tetracycline colonies appear per one plate and applied to an LBGM9 plate resistance gene and the ter thrI transcription terminator, the containing 12.5 mg/L of tetracycline. The colonies which pML-Tc-ter thrL plasmid was obtained by the following two appeared were replicated on an LBGM9 plate containing 12.5 steps: mg/L of tetracycline and 25 mg/L of chloramphenicol. A 0268 the pML-ter thrL plasmid was obtained by strain which is sensitive to chloramphenicol was selected to digesting the pML-MCS plasmid (Mashko, S. V. et al., obtain a strain from which pSTVCB was eliminated. This Biotekhnologiya (in Russian), 2001, no. 5, 3-20) with strain was designated G106S. The G106S strain was further the Xbal and BamHI, followed by ligation of the large cultured overnight at 34°C. in the LBGM9 liquid medium fragment (3342 bp) with the Xbal-BamHI fragment (68 with shaking, and the medium was diluted so that 100 to 200 bp) carrying ter thrL terminator obtained by PCR colonies should appear per one plate, and applied to an amplification of the corresponding region of the LBGM9 plate without drugs. The colonies which appeared Escherichia coli MG 1655 chromosome using the prim were replicated to an LBGM9 plate containing 12.5 mg/L of ers P9 and P10 (SEQID NOS:40 and 41) (these primers tetracycline and an LBGM9 plate without drugs. A strain contained the subsidiary recognition sites for PstI, Xbal which was sensitive to tetracycline was selected to obtain a and BamHI); and strain from which RSFCPG was eliminated. This strain was 0269 the pML-Tc-ter thrL plasmid was obtained by designated NP106. The NP106 obtained as described above is digesting the pML-ter thrL plasmid with KpnI and Xbal a strain not containing both two of the plasmids RSFCPG and followed by treatment with Klenow fragment of DNA pSTVCB, which are harbored by the AJ13601 strain. polymerase I and ligated with the small EcoRI-Van91 I 0274 (2) Construction of schA Gene-Disrupted Strain fragment (1317 bp) of pBR322 including the tetracy (0275 PCR was performed using pMW-attl-Km-attR as cline resistance gene (pBR322 was digested with EcoRI the template and the primers of SEQID NOS: 46 and 47 to and Van 91 I and then treated with Klenow fragment of amplify a gene fragment containing a kanamycin resistance DNA polymerase I). gene, attL and attR sequences of phage at the both ends of the resistance gene, and 50 bp upstream sequence and 50 bp Example 1 downstream sequence of the Sdha gene added to the outer ends of the W phage sequences. This fragment was purified Effect of schA Gene and sucA Gene Disruption in using Wizard PCR Prep DNA Purification System (produced Pantoea anamatis by Promega). 0270 (1) Construction of Glutamic Acid-Producing Plas (0276. Then, the SC17(0) strain was transformed with mid RSFPPG RSF-Red-TER to obtain an SC17(0)/RSF-Red-TER strain. (0271 A plasmid RSFPPG was constructed in which This strain was cultured overnight in the L. medium (medium L-glutamic acid biosynthesis system genes, prpC gene (Inter containing 10 g of Bacto tryptone, 5g of yeast extract and 5 national Patent Publication WO2006/051660), ppc gene and g of NaCl in 1 L of pure water, pH 7.0) containing 25 mg/L of gdh gene (EP0999282A) were amplified. chloramphenicol. The culture medium after the overnight US 2009/0286290 A1 Nov. 19, 2009

culture was inoculated to 100 mL of the L medium containing 0279 (3) Evaluation of L-Glutamic Acid Producing Abil 25 mg/L of chloramphenicol and 1 mM isopropyl-f-D- ity of schA-Deficient Strain and sucAsdh A Double Deficient thiogalactopyranoside in 1/100 Volume, and culture was per Strain formed at 34°C. for 3 hours. The cells prepared as described 0280. Then, in order to evaluate the L-glutamic acid pro above were collected, washed three times with ice-cooled ducing ability of the sdh A-deficient strain and the sucAsdh A 10% glycerol, and finally suspended in 0.5 mL of 10% glyc double deficient strain obtained as described above, these erol. The Suspended cells were used as competent cells, and strains were each inoculated into 5 mL of a medium having 100 ng of the PCR fragment prepared as described above was the composition shown below contained in a test tube, and introduced into the cells using GENEPULSER II (produced culture was performed for 18 hours. Whereas the NA1 strain by BioRad) under the conditions of a field strength of 18 which is the SucA single deficient strain hardly grew in the kV/cm, capacitor capacity of 25 uF and resistance of 20092. medium, and showed L-glutamic acid accumulation of only Ice-cooled SOC medium (20 g/L of Bacto tryptone, 5 g/L of about 3.3 g/L, the sdh A single deficient strain showed 13.2 yeast extract, 0.5 g/L of NaCl, and 10 g/L of glucose) was g/L of L-glutamic acid accumulation, which markedly added to the cell Suspension, and culture was performed at exceeded the result of the sucA single deficient strain. On the 34°C. for 2 hours with shaking. The culture was applied to a other hand, the sucAsdhA double deficient strain showed 14.7 medium prepared by adding ingredients of minimal medium g/L of L-glutamic acid accumulation, and was confirmed to (medium containing 5 g of glucose, 2 mM magnesium Sulfate, have L-glutamic acid producing ability higher than those of 3 g of monopotassium phosphate, 0.5g of sodium chloride, 1 the strains deficient in one of SucA and Sdh A, and show g of ammonium chloride and 6 g of disodium phosphate in 1 markedly improved growth. L) and 40 mg/L of kanamycin to the L. medium (medium 0281 Composition of Medium for Evaluation of containing 10g of Bacto tryptone, 5g of yeast extract, 5g of L-Glutamic Acid Production: NaCl and 15 g of agar in 1 L of pure water, pH 7.0). The colonies which emerged were purified with the same medium, and then it was confirmed that the SdhA gene was replaced with the kanamycin resistance gene by PCR. part A: 0277 From this schA gene-deficient strain, the chromo Sucrose 30 g/L some was extracted using Bacterial Genomic DNA Purifica MgSO4·7H2O 0.5 g/L tion Kit produced by Edge Biosystems. Separately, the NA1 part B: strain was cultured overnight on an agar medium obtained by (NH4)2SO 20 g/L adding the ingredients of the minimal medium described KH2PO 2 g/L FeSO4·7H2O 20 mg/L. above and 12.5 mg/L of tetracycline to the L medium. The MnSO 5H2O 20 mg/L. cells were scraped with a loop, washed three times with Yeast Extract (Difco) 2 g/L ice-cooled 10% glycerol, and finally suspended in 10% glyc Calcium pantothenate 18 mg/L. erol so as to have a final volume of 500 uL. The suspended part C: cells were used as competent cells, and 600 ng of the afore mentioned chromosome DNA was introduced into the cells Calcium carbonate 20 g/L using GENE PULSER II (produced by BioRad) under the conditions of a field strength of 17.5 kV/cm, capacitor capac 0282. The ingredients of the parts A and B were sterilized ity of 25 LF and resistance of 20092. Ice-cooled SOC medium at 115°C. for 10 minutes by autoclaving, and the ingredient of was added to the cell Suspension, and culture was performed the part C was sterilized at 180°C. for 3 hours with dry heat. at 34° C. for 2 hours with shaking. Then, the culture was After the ingredients of the three parts were cooled to room applied to an agar medium prepared by adding ingredients of temperature, they were mixed and used. the minimal medium described above, 12.5 mg/L of tetracy cline and 40 mg/L of kanamycin to the L. medium. The colo TABLE 1 nies which emerged were purified with the same medium, and then it was confirmed that the sdh A gene had been replaced OD620 mm Glu RS Yield with the kanamycin resistance gene by PCR. (x1/51) (gL) (gL) (%) NA1 O.O34 3.3 17.1 27.1 0278. The NA1 strain is deficient in the sucA gene encod NA1 schA O439 13.2 O.O 45.3 ing the E1 subunit of C-KGDH. On the other hand, no muta NA1 sucAsdhA O482 14.7 O.1 50.7 tion is contained in the sucA gene of the SC17(0)/RSF-Red TER strain. The Sdh A gene and the SucA gene are located at RS: Residual Sugar positions extremely close to each other, and the wild-type SucA gene is also transferred at a certain ratio together with the mutated schA at the time of the transformation with the Example 2 chromosomal DNA of the sdha gene-deficient strain. There Effect of odh A Gene and schA Gene Disruption in fore, the obtained schA-deficient NA1 strains include two Coryneform Bacterium types of strains, one deficient in the SucA gene and one returned to the wild-type. Therefore, regions corresponding 0283 (1) Construction of odha Gene-Disrupted Strain to the mutation site of the sucA gene of NA1 were amplified (0284. From the Brevibacterium flavum ATCC 14067 by PCR, and it was confirmed whether they were deficient in strain (currently classified into Corynebacterium sucA or whether the sucA gene returned to the wild-type on glutamicum), a strain deficient in the odha gene, in which G the basis of whether they could be digested with the restric at position 837 of the yggB gene (SEQ ID NO: 56) was tion enzyme BglII to obtain an Sdha single deficient strain replaced with A, and the promoter of the gdh gene was modi and an SucASdh A double deficient strain. fied, was constructed. Although the B. flavum ATCC 14067 US 2009/0286290 A1 Nov. 19, 2009

strain was used as the parent strain in this example, strains was performed using the synthetic DNA shown in SEQ ID having similar properties can be constructed using the C. NO: 60 and the synthetic DNA shown in SEQID NO: 61 as glutamicum ATCC 13032 strain or the B. lactofermentum primers and chromosomal DNA of the B. lactofermentum ATCC 13869 strain as parent strain. ATCC 13869 strain as the template to obtain an N-terminal 0285 First, a plasmid pPS3 ASucA47 for deleting odha side fragment. In a similar manner, a C-terminal side frag was constructed. PCR was performed using the synthetic ment was prepared using the synthetic DNAs of SEQ ID DNA shown in SEQID NO:48 and the synthetic DNA shown NOS: 62 and 63 as primers. Then, PCR was performed using in SEQID NO: 49 as primers and the chromosomal DNA of a mixture of equal amounts of the N-terminal and C-terminal B. flavum ATCC 14067 as the template to prepare an N-ter side fragments as the template and the synthetic DNAs of minal side fragment. In a similar manner, a C-terminal side SEQ ID NOS: 64 and 65 (SmaI sequence was added) as fragment was prepared using the synthetic DNAs of SEQID primers to obtain a fragment of the gdh gene in which a NOS: 50 and 51 as primers. Then, PCR was performed using mutation was introduced into the promoter region. The a mixture of equal amounts of the N-terminal and C-terminal side fragments as the template and the synthetic DNAs of obtained mutant gah fragment was treated with SmaI, and SEQID NOS:52 and 53 (BamHI sequence was added) as the inserted into pBS4S (International Patent Publication primers to obtain a fragment of the odha from which coding WO2006/070944) at the SmaI site, and the obtained plasmid region was deleted. The obtained mutant odh Afragment was was designated as pBS4gdh3. treated with BamHI, and inserted into pBS3 (International (0289 pBS4gdh3 was introduced into the 8L3 strain by the Patent Publication WO2006/070944) at the BamHI site, and electric pulse method, and the cells were applied to the CM the obtained plasmid was designated as pBS3ASucA47. Dex agar medium containing 25 ug/ml of kanamycin. The 0286 pBS3AsucA47 was introduced into the B. flavum strain which grew after the culture performed at 31.5°C. for ATCC 14067 strain by the electric pulse method, and the cells three days was isolated as 8L3-p3S4gdh3 strain in which were applied to the CM-Dex agar medium (5 g/l of glucose, pBS4gdh3 was inserted into the chromosome. Then, the 8L3 10 g/l of polypeptone, 10 g/l of yeast extract, 1 g/l of KHPO, pBS4gdh3 strain was cultured overnight in the CM-Dex liq 0.4 g/l of MgSO.7H2O, 0.01 g/l of FeSO.7H2O, 0.01 g/l of uid medium, the obtained suspension was applied on the S10 MnSO4-5HO, 3 g/l of urea, 1.2 g/l of soy protein hydroly agar medium, and culture was performed at 31.5°C. Among sis solution, and 20 g/l of agar, adjusted to pH 7.5 with NaOH, the colonies which emerged, strains having kanamycin sen autoclaved at 120° C. for 20 minutes) containing 25 ug/ml of sitivity were selected, and further purified on the CM-Dex kanamycin. The strain which grew after the culture per agar medium. Chromosomal DNAs were prepared from these formed at 31.5° C. for two days was designated as strains, and an upstream coding region sequence of godh was ATCC14067-pBS3AsucA strainin which pBS3ASucA47 was determined. A strain having the sequence shown in SEQ ID inserted into the chromosome. Then, the ATCC 14067 NO: 66 was designated as 8L3G strain. pBS3AsucA strain was cultured overnight in the CM-Dex 0290 (2) Construction of SDH-Deficient Strain liquid medium, the obtained Suspension was applied on the 0291. A plasmid p3S3Asdh47 for deleting sdha was con S10 agar medium (100 g/l of sucrose, 10 g/l of polypeptone, structed. PCR was performed using the synthetic DNA shown 10 g/l of yeast extract, 1 g/l of KHPO, 0.4 g/l of MgSO. in SEQID NO: 67 and the synthetic DNA shown in SEQ ID 7H2O, 0.01 g/l of FeSO.7H2O, 0.01 g/l of MnSO4-5H2O, NO: 68 as primers and the chromosomal DNA of B. flavum 3 g/l of urea, 1.2 g/l of soy protein hydrolysis solution, and 20 ATCC 14067 as the template to prepare an N-terminal side g/l of agar, adjusted to pH 7.5 with NaOH, autoclaved at 120° fragment. In a similar manner, a C-terminal side fragment C. for 20 minutes), and culture was performed at 31.5° C. was prepared using the synthetic DNAs of SEQID NOS: 69 Among the emerged colonies, strains that were kanamycin and 70 as primers. Then, PCR was performed using a mixture sensitive were selected, and further purified on the CM-Dex of equal amounts of the N-terminal and C-terminal side frag agar medium. Chromosomal DNAs were prepared from these ments as the template and the synthetic DNAs of SEQ ID strains, PCR was performed with the synthetic DNAs of SEQ NOS: 71 and 72 as primers to obtain a fragment of the sdh A ID NOS: 52 and 53 as primers, and a strain for which an from which coding region was deleted. The obtained mutant amplification fragment of about 1.9 kb was confirmed was sdhA fragment was treated with BamHI, and inserted into designated as 8L3 strain. pBS3 (International Patent Publication WO2006/070944) at 0287 PCR was performed using chromosomal DNA of the BamHI site, and the obtained plasmid was designated as the 8L3 strain as the template and the synthetic DNAs of SEQ pBS3AsdhA47. ID NOS: 54 and 55 (SacI sequence was added) as primers, 0292 pBS3AsdhA47 was introduced into the 8L3G strain and the sequence of the obtained amplification fragment was by the electric pulse method, and the cells were applied to the determined. As a result, it was revealed that the alanine at CM-DeX agar medium containing 25 ug/ml of kanamycin. position 111 of SEQID NO: 57 was replaced with threonine. The strain which grew after the culture performed at 31.5°C. That is, 8L3 was a double-mutant strain in which the above for two days was designated as 8L3G-pBS3Asdh Astrain in mutation was inadvertently introduced at the time of the which pBS3Asdha47 was inserted into the chromosome. introduction of the odha deficiency. As a strain having the Then, the 8L3G-pBS3Asdha strain was cultured overnight in same yggB mutation as that of 8L3, the ATCC 14067yggB8 the CM-Dex liquid medium, the obtained suspension was strain is known (International Patent Publication WO2006/ applied on the S10 agar medium, and culture was performed 070944). By introducing pBS3AsucA47 into the at 31.5°C. Among the colonies which emerged, strains that ATCC 14067yggB strain and performing the aforementioned were kanamycin sensitive were selected, and further purified steps, an odha-deficient Strain having the same yggB muta on the CM-Dex agar medium. Chromosomal DNAs were tion as that of 8L3 can be constructed. prepared from these strains, PCR was performed with the 0288 Then, a plasmid pBS4gdh3 for introducing a muta synthetic DNAs of SEQ ID NOS: 71 and 72 (BamHI tion into the promoter region of godh was constructed. PCR sequence was added) as primers, and a strain for which an US 2009/0286290 A1 Nov. 19, 2009

amplification fragment of about 1 kb was confirmed was (0307 SEQID NO: 6: Amino acid sequence of SDHC designated as 8L3GASDH strain. (0308 SEQID NO: 7: Nucleotide sequences of C-KGDH 0293 (6) Evaluation of L-Glutamic Acid-Producing Abil Subunit genes and neighboring genes of Pantoea anamatis ity of schA Deficient Strain and sucAsdh A Double Deficient 0309 schB: 2-121 Strain 0310 sucA: 322-3129 0294 Then, in order to evaluate L-glutamic acid-produc 0311 sucB: 3145-4368 ing ability of the 8L3G strain and the SDH-deficient strain 0312 sucC: 4437-4556 thereof obtained as described above, the 8L3GASDH strain, 0313 SEQID NO: 8: Amino acid sequence of succinate each of these strains was cultured overnight on one CM-Dex dehydrogenase iron-sulfur protein (part) plate medium, and then the total amount of the cells were 0314 SEQID NO: 9: Amino acid sequence of C-KGDH scraped, inoculated into 300 mL of a medium having the Elo subunit composition shown below contained in a jar, and cultured at 0315 SEQID NO: 10: Amino acid sequence of C-KGDH 31.5° C. pH was controlled to be 7.2 using ammonia gas E2o subunit during the culture, and stirring for aeration was controlled so 0316 SEQID NO: 11: Part of succinyl-CoA synthetase B that dissolved oxygen concentration is maintained to be 5% or subunit higher. As shown in Table 2, the results were that the sucAS 0317 SEQID NO: 12: Nucleotide sequence of odh A gene dha double deficient strain, 8L3GASDH, showed a higher of Brevibacterium lactofermentum production rate of glutamic acid as compared to the SucA 0318 SEQID NO: 13: Amino acid sequence of Elo sub single deficient Strain, 8L3G, and the L-glutamic acid accu unit encoded by odha mulation obtained with the 8L3GASDH strain after the cul 0319 SEQ ID NO: 14: Nucleotide sequence of gene ture for 12.5 hours was 19 g/L, which markedly exceeded encoding E2O subunit of Brevibacterium lactofermentum 16.5 g/L obtained with the sucA single deficient strain, the (NCg 12126 of GenBank Accession No. NC 003450) 8L3G strain. These results demonstrated that deficiency of 0320 SEQID NO: 15: Amino acid sequence of E20 sub both sucA and schA is effective for L-glutamic acid produc unit encoded by NCg 12126 tion also in coryneform bacteria. 0321 SEQID NO: 16: Nucleotide sequence of hisD gene 0295 Composition of Medium for Evaluation of of Pantoea anamatis L-Glutamic Acid Production: 0322 SEQ ID NO: 17: Primer for amplification of frag ment for integration of Kim' gene into hisD gene 0323 SEQ ID NO: 18: Primer for amplification of frag ment for integration of Kim' gene into hisD gene Glucose 60 g/L 0324 SEQID NO: 19: Primer for cat gene amplification HPO 1.54 g/L 0325 SEQID NO:20: Primer for cat gene amplification KOH 1.45 g/L 0326 SEQID NO: 21: Primer for sacB gene amplification FeSO4·7HO 10 mg/L. 0327 SEQID NO:22: Primer for sacB gene amplification Soybean hydrolysate 1.54 g (as nitrogen), L. Biotin 3.2 mg/L. 0328 SEQID NO. 23: Primer for amplification of DNA VB1 0.67 mg/L fragment containing Pits promoter DL-Methionine 0.28 g/L 0329 SEQID NO: 24: Primer for amplification of DNA fragment containing Pits promoter 0330 SEQID NO: 25: Primer for amplification of DNA 0296. The medium was adjusted to pH 4.0 with aqueous fragment containing WRedO?3y genes and tL3 ammonia, then sterilized at 120° C. for 15 minutes, further 0331 SEQID NO: 26: Primer for amplification of DNA adjusted to pH 7.2 with ammonia gas immediately before the fragment containing WRedO?3y genes and tL3 culture, and used for the culture. 0332 SEQID NO: 27: Primer for amplification of DNA fragment containing Prs promoter and TrrnB TABLE 2 0333 SEQID NO: 28: Primer for amplification of DNA OD620 mm Glu (gL) fragment containing Prs promoter and TrrnB 0334 SEQID NO: 29: Primer for attLamplification 8L3G 36.4 16.5 0335i SEQID NO:30: Primer for attLamplification 8L3GASDH 43.4 19.0 0336 SEQID NO:31: Nucleotide sequence of attl 0337 SEQID NO:32: Primer for attRamplification 0297 Explanation of Sequence Listing: 0338 SEQID NO:33: Primer for attRamplification 0298 SEQID NO: 1: Nucleotide sequence of sah operon 0339 SEQID NO:34: Nucleotide sequence of attR of Pantoea ananatis (amino acid sequences of SDHD, SDHA (0340 SEQID NO:35: Primer for amplification of DNA and SDHB are also shown) fragment containing bla gene 0299 schC:527-913 (0341 SEQID NO:36: Primer for amplification of DNA 0300 schl): 910-1254 fragment containing bla gene 0301 schA: 1258-3021 (0342 SEQID NO:37: Primer for amplification of DNA 0302) schB:3039-3752 fragment containing ter rrnB 0303 SEQID NO: 2: Amino acid sequence of SDHD (0343 SEQID NO:38: Primer for amplification of DNA 0304 SEQID NO:3: Amino acid sequence of SDHA fragment containing ter rrnB 0305 SEQID NO: 4: Amino acid sequence of SDHB (0344 SEQID NO:39: Nucleotide sequence of DNA frag (0306 SEQID NO: 5: Nucleotide sequence of sah operon ment containing ter thrI terminator of Pantoea anamatis (amino acid sequence of SDHC is also (0345 SEQID NO: 40: Primer for amplification of DNA shown) fragment containing ter thrI terminator US 2009/0286290 A1 Nov. 19, 2009 20

(0346 SEQ ID NO: 41: Primer for amplification of DNA 0371 SEQID NO: 66: Nucleotide sequence of upstream fragment containing ter thrL terminator coding region of mutant godh gene (0347 SEQ ID NO: 42: Primer for amplification of moi 0372 SEQID NO: 67: Primer for amplification of schA eties of gltA gene other than ORF gene upstream region (0348 SEQ ID NO: 43: Primer for amplification of moi 0373 SEQID NO: 68: Primer for amplification of schA eties of gltA gene other than ORF gene upstream region (mutation is introduced) (0349 SEQID NO:44: Primer for prpC gene amplification 0374 SEQID NO: 69: Primer for amplification of schA 0350 SEQID NO:45: Primer for prpC gene amplification gene downstream region 0351 SEQ ID NO: 46: Primer for amplification of DNA 0375 SEQID NO: 70: Primer for amplification of schA fragment for SdhA disruption gene downstream region (mutation is introduced) 0352 SEQ ID NO: 47: Primer for amplification of DNA 0376 SEQID NO: 71: Primer for sdhA gene amplification fragment for SdhA disruption 0377 SEQID NO: 72: Primer for sdhA gene amplification 0353 SEQ ID NO: 48: Primer for amplification of sucA 0378 SEQID NO: 73: Nucleotide sequence of sah operon gene upstream fragment of C. glutamicum ATCC 13032 (amino acid sequences of 0354 SEQ ID NO: 49: Primer for amplification of sucA SDHC, SDHA and SDHB are also shown) gene upstream fragment 0379 schC: 449-1219 0355 SEQ ID NO: 50: Primer for amplification of sucA 0380 schA: 1239-3257 gene downstream fragment 0381 schB: 3260-4006 0356 SEQ ID NO. 51: Primer for amplification of sucA (0382 SEQID NO: 74: Amino acid sequence of SDHC gene downstream fragment (0383 SEQID NO: 75: Amino acid sequence of SDHA 0357 SEQID NO:52: Primer for sucA gene amplification (0384 SEQID NO: 76: Amino acid sequence of SDAB 0358 SEQID NO:53: Primer for sucA gene amplification (0385 SEQID NO: 77: Nucleotide sequence of sah operon 0359 SEQ ID NO:54: Primer for yggB gene amplifica of B. lactofermentum ATCC 13869 (amino acid sequences of tion SDHC, SDHA and SDHB are also shown) 0360 SEQ ID NO: 55: Primer for yggB gene amplifica 0386 schC: 449-1219 tion 0387 schA: 1239-3257 0361 SEQID NO:56: Nucleotide sequence of yggB gene 0388 schB: 3260-4006 0362 SEQID NO:57: Amino acid sequence of YggB (0389 SEQID NO: 78: Amino acid sequence of SDHC 0363 SEQ ID NO: 58: Nucleotide sequence of mutant 0390 SEQID NO: 79: Amino acid sequence of SDHA yggB gene 0391 SEQID NO: 80: Amino acid sequence of SDHB 0364 SEQ ID NO. 59: Amino acid sequence of mutant YggB INDUSTRIAL APPLICABILITY 0365 SEQ ID NO: 60: Primer for amplification of gcdh gene upstream region (mutation is introduced) 0392 According to the method of the present invention, 0366 SEQ ID NO: 61: Primer for amplification of gcdh L-amino acids such as L-glutamic acid can be efficiently gene upstream region produced by fermentation. 0367 SEQ ID NO: 62: Primer for amplification of gcdh 0393 While the invention has been described in detail gene downstream region with reference to exemplary embodiments thereof, it will be 0368 SEQ ID NO: 63: Primer for amplification of gcdh apparent to one skilled in the art that various changes can be gene downstream region (mutation is introduced) made, and equivalents employed, without departing from the 0369 SEQID NO: 64: Primer forgdh gene amplification scope of the invention. Each of the aforementioned docu 0370 SEQID NO: 65: Primer forgdh gene amplification ments is incorporated by reference herein in its entirety.

SEQUENCE LISTING

<16 Oc NUMBER OF SEO ID NOS: 8O

<210 SEQ ID NO 1 <211 LENGTH: 3944 &212> TYPE: DNA <213> ORGANISM: Pantoea ananatis &220s FEATURE: <221 NAME/KEY: CDS <222> LOCATION: (910 ) . . (1254) &220s FEATURE: <221 NAME/KEY: CDS <222> LOCATION: (1258) ... (3021) &220s FEATURE: <221 NAME/KEY: CDS <222> LOCATION: (3039) ... (3752)

<4 OO SEQUENCE: 1

tataagcagt galaggg taca gagtgagagg cycgttccac aggaaatgta aagc.cgtgac 60

US 2009/0286290 A1 Nov. 19, 2009 25

- Continued Trp Gly Val 115

<210 SEQ ID NO 3 <211 LENGTH: 588 &212> TYPE: PRT <213> ORGANISM: Pantoea ananatis

<4 OO SEQUENCE: 3 Met Ser Lieu Pro Val Arg Glu Phe Asp Ala Val Val Ile Gly Ala Gly 1. 5 1O 15 Gly Ala Gly Met Arg Ala Ala Lieu. Glin Ile Ser Glin Ser Gly Glin Thr 2O 25 3O Cys Ala Leu Lleu Ser Lys Val Phe Pro Thr Arg Ser His Thr Val Ser 35 4 O 45 Ala Glin Gly Gly Ile Thr Val Ala Lieu. Gly Asn. Thir His Asp Asp Asn SO 55 6 O Trp. Glu Trp His Met Tyr Asp Thr Val Lys Gly Ser Asp Tyr Ile Gly 65 70 7s 8O Asp Glin Asp Ala Ile Glu Tyr Met Cys His Val Gly Pro Glu Ala Ile 85 90 95 Lieu. Glu Lieu. Glu. His Met Gly Lieu Pro Phe Ser Arg Lieu. Asp Asp Gly 1OO 105 11 O Arg Val Tyr Glin Arg Pro Phe Gly Gly Glin Ser Lys Asn Phe Gly Gly 115 12 O 125 Glu Glin Ala Ala Arg Thr Ala Ala Ala Ala Asp Arg Thr Gly His Ala 13 O 135 14 O Lieu. Lieu. His Thir Lieu. Tyr Glin Glin Asn Lieu Lys Asn Llys Thir Thir Ile 145 150 155 160 Phe Ser Glu Trp Tyr Ala Lieu. Asp Lieu Val Lys Asn Asp Asp Gly Ala 1.65 17O 17s Ile Val Gly Cys Thr Ala Ile Cys Met Glu Thr Gly Glu Thr Val Tyr 18O 185 19 O Phe Lys Ala Lys Ala Thir Ile Lieu Ala Thr Gly Gly Ala Gly Arg Ile 195 2OO 2O5 Tyr Glin Ser Thr Thr Asn Ala His Ile Asn Thr Gly Asp Gly Val Gly 21 O 215 22O Met Ala Lieu. Arg Ala Gly Val Pro Val Glin Asp Met Glu Met Trp Glin 225 23 O 235 24 O Phe His Pro Thr Gly Ile Ala Gly Ala Gly Val Lieu Val Thr Glu Gly 245 250 255 Cys Arg Gly Glu Gly Gly Tyr Lieu. Lieu. Asn Llys His Gly Glu Arg Phe 26 O 265 27 O Met Glu Arg Tyr Ala Pro Asn Ala Lys Asp Lieu Ala Gly Arg Asp Wall 27s 28O 285 Val Ala Arg Ser Met Met Val Glu Ile Arg Glu Gly Arg Gly Cys Asp 29 O 295 3 OO Gly Pro Trp Gly Pro His Ile Llys Lieu Lys Lieu. Asp His Lieu. Gly Ala 3. OS 310 315 32O Glu Val Lieu. Glu Ser Arg Lieu Pro Gly Ile Lieu. Glu Lieu. Ser Arg Thr 3.25 330 335 Phe Ala His Val Asp Pro Ile Lys Glu Pro Ile Pro Val Ile Pro Thr 34 O 345 35. O US 2009/0286290 A1 Nov. 19, 2009 26

- Continued

Cys His Tyr Met Met Gly Gly Val Pro Thr Llys Val Thr Gly Glin Ala 355 360 365 Lieu. Arg Val Asn. Glu Glin Gly Glu Asp Glu Val Ile Pro Gly Lieu. Phe 37 O 375 38O Ala Val Gly Glu Ile Ala Cys Val Ser Val His Gly Ala Asn Arg Lieu 385 390 395 4 OO Gly Gly Asn. Ser Lieu. Lieu. Asp Lieu Val Val Phe Gly Arg Ala Ala Gly 4 OS 41O 415 Val His Lieu. Lieu. Glu. Cys Lieu. Glu Glu Glin Gly Glu Lieu. Arg Glu Ala 42O 425 43 O Ser Glin Glu Asn. Ile Asp Ala Ala Met Ala Arg Phe Asn Arg Trp Glu 435 44 O 445 Asn Asn. Thir Thr Gly Glu Asp Pro Val Glu Ile Arg Lys Ala Lieu. Glin 450 45.5 460 Arg Cys Met Glin Asn. Asn. Phe Ser Val Phe Arg Glu Gly Asp Ala Met 465 470 47s 48O Arg Glu Gly Lieu Ala Glu Lieu Lys Glu Ile Arg Glu Arg Lieu Lys Ser 485 490 495 Ala Arg Lieu. Asp Asp Arg Ser Pro Asp Phe Asn Thr Glin Arg Ile Glu SOO 505 51O Cys Lieu. Glu Lieu. Asp Asn Lieu Met Glu Thir Ala Tyr Ala Thir Ala Val 515 52O 525 Ala Ala Asn Tyr Arg Thr Glu Ser Arg Gly Ala His Ser Arg Phe Asp 53 O 535 54 O Tyr Pro Glu Arg Asp Asp Ala Asn Trp Lieu. Cys His Ser Lieu. Tyr Val 5.45 550 555 560 Pro Gln Thr Glu Ser Met Thr Arg Arg Glu Val Asn Met Glin Pro Llys 565 st O sts Lieu. Arg Ala Ala Phe Pro Pro Lys Ala Arg Thr Tyr 58O 585

<210 SEQ ID NO 4 <211 LENGTH: 238 &212> TYPE: PRT <213> ORGANISM: Pantoea ananatis

<4 OO SEQUENCE: 4 Met Arg Lieu. Glu Phe Ser Ile Tyr Arg Tyr Asn Pro Asp Wall Asp Asp 1. 5 1O 15 Llys Pro Arg Met Glin Asp Tyr Thr Lieu. Glu Ala Glu Asp Gly Arg Asp 2O 25 3O Met Met Lieu. Lieu. Asp Ala Lieu. Ile Arg Lieu Lys Glu Lys Asp Pro Thr 35 4 O 45 Lieu Ala Phe Arg Arg Ser Cys Arg Glu Gly Val Cys Gly Ser Asp Gly SO 55 6 O Lieu. Asn Met Asin Gly Lys Asn Gly Lieu Ala Cys Ile Thr Pro Val Ser 65 70 7s 8O Ala Lieu. Gly Asn Gly Lys Glin Lys Ile Val Ile Arg Pro Lieu Pro Gly 85 90 95 Lieu Pro Val Val Arg Asp Lieu Val Val Asp Met Gly Glin Phe Tyr Ala 1OO 105 11 O Glin Tyr Glu Lys Ile Llys Pro Phe Lieu. Lieu. Asn. Asn Gly Glu Asn Pro

US 2009/0286290 A1 Nov. 19, 2009 35

- Continued atgaac tta cac gaa tac cag gct aaa cag citg titt gca cqg tat 4 481 Met Asn Lieu. His Glu Tyr Glin Ala Lys Glin Lieu. Phe Ala Arg Tyr 1385 1390 1395 ggc atg cca gca ccg acc ggc tac gcc tit act aca cca cqt gaa 4526 Gly Met Pro Ala Pro Thr Gly Tyr Ala Cys Thr Thr Pro Arg Glu 14 OO 14 Os 1410 gca gala gala gcg gCatcg aaa atc ggit gca 4556 Ala Glu Glu Ala Ala Ser Lys Ile Gly Ala 1415 142O

<210 SEQ ID NO 8 <211 LENGTH: 39 &212> TYPE: PRT <213> ORGANISM: Pantoea ananatis

<4 OO SEQUENCE: 8 Ala Phe Ser Val Phe Arg Cys His Ser Ile Met Asn Cys Val Ser Val 1. 5 1O 15 Cys Pro Lys Gly Lieu. ASn Pro Thr Arg Ala Ile Gly His Ile Llys Ser 2O 25 3O Met Lieu. Lieu. Glin Arg Ser Ala 35

<210 SEQ ID NO 9 <211 LENGTH: 935 &212> TYPE: PRT <213> ORGANISM: Pantoea ananatis

<4 OO SEQUENCE: 9 Met Glin Asn. Ser Ala Met Llys Pro Trp Lieu. Asp Ser Ser Trp Lieu Ala 1. 5 1O 15 Gly Ala Asn Glin Ser Tyr Ile Glu Gln Lieu. Tyr Glu Asp Phe Lieu. Thir 2O 25 3O Asp Pro Asp Ser Val Asp Ala Val Trp Arg Ser Met Phe Glin Glin Lieu 35 4 O 45 Pro Gly Thr Gly Val Llys Pro Glu Glin Phe His Ser Ala Thr Arg Glu SO 55 6 O Tyr Phe Arg Arg Lieu Ala Lys Asp Ala Ser Arg Tyr Thr Ser Ser Val 65 70 7s 8O Thir Asp Pro Ala Thr Asn. Ser Lys Glin Val Llys Val Lieu. Glin Lieu. Ile 85 90 95 Asn Ala Phe Arg Phe Arg Gly His Glin Glu Ala Asn Lieu. Asp Pro Lieu 1OO 105 11 O Gly Lieu. Trp Llys Glin Asp Arg Val Ala Asp Lieu. Asp Pro Ala Phe His 115 12 O 125 Asp Lieu. Thir Asp Ala Asp Phe Glin Glu Ser Phe Asn Val Gly Ser Phe 13 O 135 14 O Ala Ile Gly Lys Glu Thir Met Lys Lieu Ala Asp Lieu. Phe Asp Ala Lieu 145 150 155 160 Lys Glin Thr Tyr Cys Gly Ser Ile Gly Ala Glu Tyr Met His Ile Asn 1.65 17O 17s Asn Thr Glu Glu Lys Arg Trp Ile Glin Glin Arg Ile Glu Ser Gly Ala 18O 185 19 O Ser Glin Thr Ser Phe Ser Gly Glu Glu Lys Lys Gly Phe Leu Lys Glu 195 2OO 2O5 US 2009/0286290 A1 Nov. 19, 2009 36

- Continued Lieu. Thir Ala Ala Glu Gly Lieu. Glu Lys Tyr Lieu. Gly Ala Lys Phe Pro 21 O 215 22O Gly Ala Lys Arg Phe Ser Lieu. Glu Gly Gly Asp Ala Lieu Val Pro Met 225 23 O 235 24 O Lieu. Arg Glu Met Ile Arg His Ala Gly Lys Ser Gly Thr Arg Glu Val 245 250 255 Val Lieu. Gly Met Ala His Arg Gly Arg Lieu. Asn Val Lieu. Ile Asin Val 26 O 265 27 O Lieu. Gly Llys Llys Pro Glin Asp Lieu. Phe Asp Glu Phe Ser Gly Llys His 27s 28O 285 Lys Glu. His Leu Gly Thr Gly Asp Val Lys Tyr His Met Gly Phe Ser 29 O 295 3 OO Ser Asp Ile Glu Thr Glu Gly Gly Lieu Val His Lieu Ala Lieu Ala Phe 3. OS 310 315 32O Asn Pro Ser His Lieu. Glu Ile Val Ser Pro Val Val Met Gly Ser Val 3.25 330 335 Arg Ala Arg Lieu. Asp Arg Lieu Ala Glu Pro Val Ser Asn Llys Val Lieu 34 O 345 35. O Pro Ile Thr Ile His Gly Asp Ala Ala Val Ile Gly Glin Gly Val Val 355 360 365 Glin Glu Thir Lieu. Asn Met Ser Glin Ala Arg Gly Tyr Glu Val Gly Gly 37 O 375 38O Thr Val Arg Ile Val Ile Asn Asn Glin Val Gly Phe Thr Thr Ser Asn 385 390 395 4 OO Pro Lys Asp Ala Arg Ser Thr Pro Tyr Cys Thr Asp Ile Gly Lys Met 4 OS 41O 415 Val Lieu Ala Pro Ile Phe His Val Asn Ala Asp Asp Pro Glu Ala Val 42O 425 43 O Ala Phe Val Thr Arg Lieu Ala Lieu. Asp Tyr Arg Asn. Thir Phe Lys Arg 435 44 O 445 Asp Val Phe Ile Asp Lieu Val Cys Tyr Arg Arg His Gly His Asn. Glu 450 45.5 460 Ala Asp Glu Pro Ser Ala Thr Glin Pro Lieu Met Tyr Gln Lys Ile Llys 465 470 47s 48O Llys His Pro Thr Pro Arg Lys Ile Tyr Ala Asp Arg Lieu. Glu Gly Glu 485 490 495 Gly Val Ala Ser Glin Glu Asp Ala Thr Glu Met Val Asn Lieu. Tyr Arg SOO 505 51O Asp Ala Lieu. Asp Ala Gly Glu. Cys Val Val Pro Glu Trp Arg Pro Met 515 52O 525 Ser Lieu. His Ser Phe Thir Trp Ser Pro Tyr Lieu. Asn His Glu Trp Asp 53 O 535 54 O Glu Pro Tyr Pro Ala Glin Val Asp Met Lys Arg Lieu Lys Glu Lieu Ala 5.45 550 555 560 Lieu. Arg Ile Ser Glin Val Pro Glu Glin Ile Glu Val Glin Ser Arg Val 565 st O sts Ala Lys Ile Tyr Asn Asp Arg Llys Lieu Met Ala Glu Gly Glu Lys Ala 58O 585 59 O Phe Asp Trp Gly Gly Ala Glu Asn Lieu Ala Tyr Ala Thr Lieu Val Asp 595 6OO 605 Glu Gly Ile Pro Val Arg Lieu. Ser Gly Glu Asp Ser Gly Arg Gly. Thir US 2009/0286290 A1 Nov. 19, 2009 37

- Continued

610 615 62O Phe Phe His Arg His Ala Val Val His Asn Glin Ala Asn Gly Ser Thr 625 630 635 64 O Tyr Thr Pro Leu. His His Ile His Asn Ser Glin Gly Glu Phe Llys Val 645 650 655 Trp Asp Ser Val Lieu. Ser Glu Glu Ala Val Lieu Ala Phe Glu Tyr Gly 660 665 67 O Tyr Ala Thr Ala Glu Pro Arg Val Lieu. Thir Ile Trp Glu Ala Glin Phe 675 68O 685 Gly Asp Phe Ala Asn Gly Ala Glin Val Val Ile Asp Glin Phe Ile Ser 69 O. 695 7 OO Ser Gly Glu Gln Llys Trp Gly Arg Met Cys Gly Lieu Val Met Lieu. Lieu. 7 Os 71O 71s 72O Pro His Gly Tyr Glu Gly Glin Gly Pro Glu. His Ser Ser Ala Arg Lieu. 72 73 O 73 Glu Arg Tyr Lieu. Glin Lieu. Cys Ala Glu Glin Asn Met Glin Val Cys Val 740 74. 7 O Pro Ser Thr Pro Ala Glin Val Tyr His Met Leu Arg Arg Glin Ala Leu 7ss 760 765 Arg Gly Met Arg Arg Pro Lieu Val Val Met Ser Pro Llys Ser Lieu. Lieu 770 775 78O Arg His Pro Lieu. Ala Ile Ser Ser Lieu. Asp Glu Lieu. Ala ASn Gly Ser 78s 79 O 79. 8OO Phe Glin Pro Ala Ile Gly Glu Ile Asp Asp Lieu. Asp Pro Glin Gly Val 805 810 815 Lys Arg Val Val Lieu. Cys Ser Gly Llys Val Tyr Tyr Asp Lieu. Lieu. Glu 82O 825 83 O Glin Arg Arg Lys Asp Glu Lys Thr Asp Wall Ala Ile Val Arg Ile Glu 835 84 O 845 Glin Lieu. Tyr Pro Phe Pro His Glin Ala Val Glin Glu Ala Lieu Lys Ala 850 855 860 Tyr Ser His Val Glin Asp Phe Val Trp Cys Glin Glu Glu Pro Leu. Asn 865 87O 87s 88O Gln Gly Ala Trp Tyr Cys Ser Gln His His Phe Arg Asp Val Val Pro 885 890 895 Phe Gly Ala Thir Lieu. Arg Tyr Ala Gly Arg Pro Ala Ser Ala Ser Pro 9 OO 905 91 O Ala Val Gly Tyr Met Ser Val His Glin Glin Glin Glin Glin Asp Leu Val 915 92 O 925 Asn Asp Ala Lieu. Asn Val Asn 93 O 935

<210 SEQ ID NO 10 <211 LENGTH: 4. Of &212> TYPE: PRT <213> ORGANISM: Pantoea ananatis

<4 OO SEQUENCE: 10 Met Ser Ser Val Asp Ile Lieu Val Pro Asp Lieu Pro Glu Ser Val Ala 1. 5 1O 15 Asp Ala Thr Val Ala Thir Trp His Llys Llys Pro Gly Asp Ala Val Ser 2O 25 3O US 2009/0286290 A1 Nov. 19, 2009 38

- Continued Arg Asp Glu Val Ile Val Glu Ile Glu Thir Asp Llys Val Val Lieu. Glu 35 4 O 45 Val Pro Ala Ser Ala Asp Gly Val Lieu. Glu Ala Val Lieu. Glu Asp Glu SO 55 6 O Gly Ala Thr Val Thir Ser Arg Glin Ile Lieu. Gly Arg Lieu Lys Glu Gly 65 70 7s 8O Asn Ser Ala Gly Lys Glu Ser Ser Ala Lys Ala Glu Ser Asn Asp Thr 85 90 95 Thr Pro Ala Glin Arg Glin Thr Ala Ser Lieu. Glu Glu Glu Ser Ser Asp 1OO 105 11 O Ala Lieu. Ser Pro Ala Ile Arg Arg Lieu. Ile Ala Glu. His Asn Lieu. Asp 115 12 O 125 Ala Ala Glin Ile Lys Gly Thr Gly Val Gly Gly Arg Lieu. Thir Arg Glu 13 O 135 14 O Asp Val Glu Lys His Lieu Ala Asn Llys Pro Glin Ala Glu Lys Ala Ala 145 150 155 160 Ala Pro Ala Ala Gly Ala Ala Thr Ala Glin Glin Pro Wall Ala Asn Arg 1.65 17O 17s Ser Glu Lys Arg Val Pro Met Thr Arg Lieu. Arg Lys Arg Val Ala Glu 18O 185 19 O Arg Lieu. Lieu. Glu Ala Lys Asn. Ser Thr Ala Met Lieu. Thir Thr Phe Asn 195 2OO 2O5 Glu Ile Asn Met Llys Pro Ile Met Asp Lieu. Arg Lys Glin Tyr Gly Asp 21 O 215 22O Ala Phe Glu Lys Arg His Gly Val Arg Lieu. Gly Phe Met Ser Phe Tyr 225 23 O 235 24 O Ile Lys Ala Val Val Glu Ala Lieu Lys Arg Tyr Pro Glu Val Asn Ala 245 250 255 Ser Ile Asp Gly Glu Asp Val Val Tyr His Asn Tyr Phe Asp Val Ser 26 O 265 27 O Ile Ala Val Ser Thr Pro Arg Gly Lieu Val Thr Pro Val Lieu. Arg Asp 27s 28O 285 Val Asp Ala Lieu. Ser Met Ala Asp Ile Glu Lys Lys Ile Lys Glu Lieu 29 O 295 3 OO Ala Wall Lys Gly Arg Asp Gly Lys Lieu. Thr Val Asp Asp Lieu. Thr Gly 3. OS 310 315 32O Gly Asin Phe Thr Ile Thr Asn Gly Gly Val Phe Gly Ser Leu Met Ser 3.25 330 335 Thr Pro Ile Ile Asn Pro Pro Glin Ser Ala Ile Leu Gly Met His Ala 34 O 345 35. O Ile Lys Asp Arg Pro Met Ala Val Asin Gly Glin Val Val Ile Lieu Pro 355 360 365 Met Met Tyr Lieu Ala Lieu. Ser Tyr Asp His Arg Lieu. Ile Asp Gly Arg 37 O 375 38O Glu Ser Val Gly Tyr Lieu Val Ala Wall Lys Glu Met Lieu. Glu Asp Pro 385 390 395 4 OO Ala Arg Lieu. Lieu. Lieu. Asp Wall 4 OS

<210 SEQ ID NO 11 <211 LENGTH: 4 O &212> TYPE: PRT

US 2009/0286290 A1 Nov. 19, 2009 44

- Continued Arg Val Pro Ala Val Ser Ser Ala Ser Thr Phe Gly Glin Asn Ala Trp 35 4 O 45 Lieu Val Asp Glu Met Phe Glin Glin Phe Glin Lys Asp Pro Llys Ser Val SO 55 6 O Asp Llys Glu Trp Arg Glu Lieu. Phe Glu Ala Glin Gly Gly Pro Asn Ala 65 70 7s 8O Thr Pro Ala Thr Thr Glu Ala Glin Pro Ser Ala Pro Lys Glu Ser Ala 85 90 95 Llys Pro Ala Pro Lys Ala Ala Pro Ala Ala Lys Ala Ala Pro Arg Val 1OO 105 11 O Glu Thir Lys Pro Ala Ala Lys Thr Ala Pro Lys Ala Lys Glu Ser Ser 115 12 O 125 Val Pro Glin Gln Pro Llys Lieu Pro Glu Pro Gly Glin Thr Pro Ile Arg 13 O 135 14 O Gly Ile Phe Llys Ser Ile Ala Lys Asn Met Asp Ile Ser Lieu. Glu Ile 145 150 155 160 Pro Thr Ala Thr Ser Val Arg Asp Met Pro Ala Arg Lieu Met Phe Glu 1.65 17O 17s Asn Arg Ala Met Val Asn Asp Gln Lieu Lys Arg Thr Arg Gly Gly Lys 18O 185 19 O Ile Ser Phe Thr His Ile Ile Gly Tyr Ala Met Val Lys Ala Val Met 195 2OO 2O5 Ala His Pro Asp Met Asn. Asn. Ser Tyr Asp Val Ile Asp Gly Llys Pro 21 O 215 22O Thir Lieu. Ile Val Pro Glu. His Ile Asn Lieu. Gly Lieu Ala Ile Asp Lieu. 225 23 O 235 24 O Pro Glin Lys Asp Gly Ser Arg Ala Lieu Val Val Ala Ala Ile Lys Glu 245 250 255 Thr Glu Lys Met Asn. Phe Ser Glu Phe Lieu Ala Ala Tyr Glu Asp Ile 26 O 265 27 O Val Thr Arg Ser Arg Lys Gly Lys Lieu. Thir Met Asp Asp Tyr Glin Gly 27s 28O 285 Val Thr Val Ser Lieu. Thr Asn Pro Gly Gly Ile Gly Thr Arg His Ser 29 O 295 3 OO Val Pro Arg Lieu. Thir Lys Gly Glin Gly Thr Ile Ile Gly Val Gly Ser 3. OS 310 315 32O Met Asp Tyr Pro Ala Glu Phe Glin Gly Ala Ser Glu Asp Arg Lieu Ala 3.25 330 335 Glu Lieu. Gly Val Gly Lys Lieu Val Thir Ile Thir Ser Thr Tyr Asp His 34 O 345 35. O Arg Val Ile Glin Gly Ala Val Ser Gly Glu Phe Lieu. Arg Thr Met Ser 355 360 365 Arg Lieu. Lieu. Thir Asp Asp Ser Phe Trp Asp Glu Ile Phe Asp Ala Met 37 O 375 38O Asn Val Pro Tyr Thr Pro Met Arg Trp Ala Glin Asp Val Pro Asn Thr 385 390 395 4 OO Gly Val Asp Lys Asn. Thir Arg Val Met Glin Lieu. Ile Glu Ala Tyr Arg 4 OS 41O 415 Ser Arg Gly. His Lieu. Ile Ala Asp Thr Asn Pro Lieu. Ser Trp Val Glin 42O 425 43 O Pro Gly Met Pro Val Pro Asp His Arg Asp Lieu. Asp Ile Glu. Thir His US 2009/0286290 A1 Nov. 19, 2009 45

- Continued

435 44 O 445 Ser Lieu. Thir Ile Trp Asp Lieu. Asp Arg Thr Phe Ser Val Gly Gly Phe 450 45.5 460 Gly Gly Lys Glu Thir Met Thr Lieu. Arg Glu Val Lieu. Ser Arg Lieu. Arg 465 470 47s 48O Ala Ala Tyr Thr Lieu Lys Val Gly Ser Glu Tyr Thr His Ile Lieu. Asp 485 490 495 Arg Asp Glu Arg Thir Trp Lieu. Glin Asp Arg Lieu. Glu Ala Gly Met Pro SOO 505 51O Llys Pro Thr Glin Ala Glu Gln Lys Tyr Ile Lieu. Glin Llys Lieu. Asn Ala 515 52O 525 Ala Glu Ala Phe Glu Asn. Phe Lieu. Glin Thir Lys Tyr Val Gly Glin Lys 53 O 535 54 O Arg Phe Ser Lieu. Glu Gly Ala Glu Ala Lieu. Ile Pro Lieu Met Asp Ser 5.45 550 555 560 Ala Ile Asp Thir Ala Ala Gly Glin Gly Lieu. Asp Glu Val Val Ile Gly 565 st O sts Met Pro His Arg Gly Arg Lieu. Asn Val Lieu. Phe Asn. Ile Val Gly Lys 58O 585 59 O Pro Leu Ala Ser Ile Phe Asn Glu Phe Glu Gly Gln Met Glu Gln Gly 595 6OO 605 Glin Ile Gly Gly Ser Gly Asp Val Lys Tyr His Lieu. Gly Ser Glu Gly 610 615 62O Gln His Leu Gln Met Phe Gly Asp Gly Glu Ile Llys Val Ser Lieu. Thr 625 630 635 64 O Ala Asn Pro Ser His Lieu. Glu Ala Val Asin Pro Wal Met Glu Gly Ile 645 650 655 Val Arg Ala Lys Glin Asp Tyr Lieu. Asp Llys Gly Val Asp Gly Lys Thr 660 665 67 O Val Val Pro Lieu Lleu Lieu. His Gly Asp Ala Ala Phe Ala Gly Lieu. Gly 675 68O 685 Ile Val Pro Glu Thir Ile Asn Lieu Ala Lys Lieu. Arg Gly Tyr Asp Val 69 O. 695 7 OO Gly Gly. Thir Ile His Ile Val Val Asn Asn Glin Ile Gly Phe Thr Thr 7 Os 71O 71s 72O Thr Pro Asp Ser Ser Arg Ser Met His Tyr Ala Thr Asp Tyr Ala Lys 72 73 O 73 Ala Phe Gly Cys Pro Val Phe His Val Asin Gly Asp Asp Pro Glu Ala 740 74. 7 O Val Val Trp Val Gly Glin Lieu Ala Thr Glu Tyr Arg Arg Arg Phe Gly 7ss 760 765 Lys Asp Val Phe Ile Asp Lieu Val Cys Tyr Arg Lieu. Arg Gly His Asn 770 775 78O Glu Ala Asp Asp Pro Ser Met Thr Glin Pro Llys Met Tyr Glu Lieu. Ile 78s 79 O 79. 8OO Thr Gly Arg Glu Thr Val Arg Ala Glin Tyr Thr Glu Asp Lieu. Lieu. Gly 805 810 815 Arg Gly Asp Lieu. Ser Asn. Glu Asp Ala Glu Ala Val Val Arg Asp Phe 82O 825 83 O His Asp Gln Met Glu Ser Val Phe Asn. Glu Val Lys Glu Gly Gly Lys 835 84 O 845 US 2009/0286290 A1 Nov. 19, 2009 46

- Continued

Lys Glin Ala Glu Ala Glin Thr Gly Ile Thr Gly Ser Glin Llys Lieu Pro 850 855 860 His Gly Lieu. Glu Thir Asn. Ile Ser Arg Glu Glu Lieu. Lieu. Glu Lieu. Gly 865 87O 87s 88O Glin Ala Phe Ala Asn Thr Pro Glu Gly Phe Asn Tyr His Pro Arg Val 885 890 895 Ala Pro Val Ala Lys Lys Arg Val Ser Ser Val Thr Glu G Gly Ile 9 OO 905 9 Asp Trp Ala Trp Gly Glu Lieu. Lieu Ala Phe Gly Ser Lieu Ala Asn. Ser 915 92 O 925 Gly Arg Lieu Val Arg Lieu Ala Gly Glu Asp Ser Arg Arg Gly Thr Phe 93 O 935 94 O Thr Glin Arg His Ala Val Ala Ile Asp Pro Ala Thr Ala Glu Glu Phe 945 950 955 96.O Asn Pro Lieu. His Glu Lieu Ala Glin Ser Lys Gly Asn. Asn Gly Llys Phe 965 97O 97. Lieu Val Tyr Asn Ser Ala Lieu. Thr Glu Tyr Ala Gly Met Gly Phe Glu 98O 985 99 O Tyr Gly Tyr Ser Val Gly Asn. Glu Asp Ser Val Val Ala Trp Glu Ala 995 1OOO 1005 Glin Phe Gly Asp Phe Ala Asn Gly Ala Glin Thir Ile Ile Asp Glu O1O O15 O2O Tyr Val Ser Ser Gly Glu Ala Lys Trp Gly Glin Thr Ser Lys Lieu. O25 O3 O O35 Ile Lieu Lleu Lleu Pro His Gly Tyr Glu Gly Glin Gly Pro Asp His O4 O O45 OSO Ser Ser Ala Arg Ile Glu Arg Phe Lieu. Glin Lieu. Cys Ala Glu Gly O55 O6 O O65

Ser Met Thir Wall Ala Glin Pro Ser Thr Pro Ala Asn His Phe His Of O O7 O8O Lieu. Lieu. Arg Arg His Ala Lieu. Ser Asp Lieu Lys Arg Pro Lieu Val O85 O9 O O95 Ile Phe Thr Pro Llys Ser Met Lieu. Arg Asn Lys Ala Ala Ala Ser OO O5 10 Ala Pro Glu Asp Phe Thr Glu Val Thr Llys Phe Glin Ser Val Ile

Asp Asp Pro Asn Val Ala Asp Ala Ala Lys Wall Lys Llys Val Met

Lieu Val Ser Gly Llys Lieu. Tyr Tyr Glu Lieu Ala Lys Arg Lys Glu

Lys Asp Gly Arg Asp Asp e Ala Ile Val Arg e Glu Met Leu

His Pro Ile Pro Phe Asin Arg Ile Ser Glu Ala Leu Ala Gly Tyr 7s 8O 85 Pro Asn Ala Glu Glu Val Lieu. Phe Val Glin Asp Glu Pro Ala Asn 90 95 2OO Gln Gly Pro Trp Pro Phe Tyr Glin Glu. His Leu Pro Glu Lieu. Ile 2O5 21 O 215 Pro Asn Met Pro Llys Met Arg Arg Val Ser Arg Arg Ala Glin Ser 22O 225 23 O

US 2009/0286290 A1 Nov. 19, 2009 49

- Continued ttg acc cca gtc att cac gat gct cag gat citc. tcc atc cca gag atc 68O Lieu. Thr Pro Val Ile His Asp Ala Glin Asp Lieu. Ser Ile Pro Glu Ile 5.45 550 555 560 gca aag gca att gtt gac Ctg gCt gat cqt tca cqc aac aac aag ctg 728 Ala Lys Ala Ile Val Asp Lieu Ala Asp Arg Ser Arg Asn. Asn Llys Lieu 565 st O sts aag cca aac gat ctd toc ggt ggc acc titc acc atc acc aac att ggit 776 Llys Pro Asn Asp Leu Ser Gly Gly Thr Phe Thr Ile Thr Asn Ile Gly 58O 585 59 O tct gala ggc gca citg tot gat acc cca at c ctd gtt coa cca cag got 824 Ser Glu Gly Ala Lieu. Ser Asp Thr Pro Ile Leu Val Pro Pro Glin Ala 595 6OO 605 ggc at C titg ggc acc ggc gcg at C gtg aag cqt cca gtt gtC at C acc 872 Gly Ile Leu Gly Thr Gly Ala Ile Val Lys Arg Pro Val Val Ile Thr 610 615 62O gag gat gga att gat tcc atc gcg at C cqt cag atg gtc. ttic ct a cca 92 O Glu Asp Gly Ile Asp Ser Ile Ala Ile Arg Glin Met Val Phe Lieu Pro 625 630 635 64 O

Ctg acc tac gaC cac cag gtt gta gat ggc gca gat gct ggit cqc ttic 96.8 Lieu. Thir Tyr Asp His Glin Val Val Asp Gly Ala Asp Ala Gly Arg Phe 645 650 655

Ctg acc acc at C aag gaC cqc ctt gag acc gct aac ttic gala ggc gat 2O16 Lieu. Thir Thir Ile Lys Asp Arg Lieu. Glu Thir Ala Asn. Phe Glu Gly Asp 660 665 67 O citg cag ct c taa 2O28 Lieu. Glin Lieu. 675

<210 SEQ ID NO 15 <211 LENGTH: 675 &212> TYPE: PRT <213> ORGANISM: Corynebacterium glutamicum

<4 OO SEQUENCE: 15 Met Ala Phe Ser Val Glu Met Pro Glu Lieu. Gly Glu Ser Val Thr Glu 1. 5 1O 15 Gly. Thir Ile Thr Gln Trp Leu Lys Ser Val Gly Asp Thr Val Glu Val 2O 25 3O Asp Glu Pro Lieu. Lieu. Glu Val Ser Thr Asp Llys Val Asp Thr Glu Ile 35 4 O 45 Pro Ser Pro Val Ala Gly Val Ile Lieu. Glu Ile Lys Ala Glu Glu Asp SO 55 6 O Asp Thr Val Asp Val Gly Gly Val Ile Ala Ile Ile Gly Asp Ala Asp 65 70 7s 8O Glu Thr Pro Ala Asn. Glu Ala Pro Ala Asp Glu Ala Pro Ala Pro Ala 85 90 95 Glu Glu Glu Glu Pro Wall Lys Glu Glu Pro Llys Lys Glu Ala Ala Pro 1OO 105 11 O Glu Ala Pro Ala Ala Thr Gly Ala Ala Thir Asp Val Glu Met Pro Glu 115 12 O 125 Lieu. Gly Glu Ser Val Thr Glu Gly Thr Ile Thr Gln Trp Leu Lys Ala 13 O 135 14 O Val Gly Asp Thr Val Glu Val Asp Glu Pro Lieu. Lieu. Glu Val Ser Thr 145 150 155 160 Asp Llys Val Asp Thr Glu Ile Pro Ser Pro Val Ala Gly Thr Ile Val US 2009/0286290 A1 Nov. 19, 2009 50

- Continued

1.65 17O 17s Glu Ile Lieu Ala Asp Glu Asp Asp Thr Val Asp Val Gly Ala Val Ile 18O 185 19 O Ala Arg Ile Gly Asp Ala Asn Ala Ala Ala Ala Pro Ala Glu Glu Glu 195 2OO 2O5 Ala Ala Pro Ala Glu Glu Glu Glu Pro Wall Lys Glu Glu Pro Llys Llys 21 O 215 22O Glu Ala Ala Pro Glu Ala Pro Ala Ala Thr Gly Ala Ala Thr Asp Wall 225 23 O 235 24 O Glu Met Pro Glu Lieu. Gly Glu Ser Val Thr Glu Gly Thr Ile Thr Glin 245 250 255 Trp Lieu Lys Ala Val Gly Asp Thr Val Glu Val Asp Glu Pro Lieu. Lieu. 26 O 265 27 O Glu Val Ser Thr Asp Llys Val Asp Thr Glu Ile Pro Ser Pro Val Ala 27s 28O 285 Gly. Thir Ile Val Glu Ile Lieu Ala Asp Glu Asp Asp Thr Val Asp Wall 29 O 295 3 OO Gly Ala Val Ile Ala Arg Ile Gly Asp Ala Asn Ala Ala Ala Ala Pro 3. OS 310 315 32O Ala Glu Glu Glu Ala Ala Pro Ala Glu Glu Glu Glu Pro Val Lys Glu 3.25 330 335 Glu Pro Llys Lys Glu Glu Pro Llys Lys Glu Glu Pro Llys Lys Glu Ala 34 O 345 35. O Ala Thir Thr Pro Ala Ala Ala Ser Ala Thr Val Ser Ala Ser Gly Asp 355 360 365 Asn Val Pro Tyr Val Thr Pro Lieu Val Arg Llys Lieu Ala Glu Lys His 37 O 375 38O Gly Val Asp Lieu. Asn Thr Val Thr Gly. Thr Gly Ile Gly Gly Arg Ile 385 390 395 4 OO Arg Lys Glin Asp Val Lieu Ala Ala Ala Asn Gly Glu Ala Ala Pro Ala 4 OS 41O 415 Glu Ala Ala Ala Pro Val Ser Ala Trp Ser Thr Lys Ser Val Asp Pro 42O 425 43 O Glu Lys Ala Lys Lieu. Arg Gly. Thir Thr Glin Llys Val Asn Arg Ile Arg 435 44 O 445 Glu Ile Thir Ala Met Llys Thr Val Glu Ala Lieu. Glin Ile Ser Ala Glin 450 45.5 460 Lieu. Thr Glin Lieu. His Glu Val Asp Met Thr Arg Val Ala Glu Lieu. Arg 465 470 47s 48O Llys Lys Asn Llys Pro Ala Phe Ile Glu Lys His Gly Val Asn Lieu. Thir 485 490 495 Tyr Lieu Pro Phe Phe Val Lys Ala Val Val Glu Ala Leu Val Ser His SOO 505 51O Pro Asn Val Asn Ala Ser Phe Asn Ala Lys Thr Lys Glu Met Thr Tyr 515 52O 525 His Ser Ser Val Asn Lieu. Ser Ile Ala Val Asp Thr Pro Ala Gly Lieu. 53 O 535 54 O Lieu. Thr Pro Val Ile His Asp Ala Glin Asp Lieu. Ser Ile Pro Glu Ile 5.45 550 555 560 Ala Lys Ala Ile Val Asp Lieu Ala Asp Arg Ser Arg Asn. Asn Llys Lieu 565 st O sts

US 2009/0286290 A1 Nov. 19, 2009 52

- Continued

<211 LENGTH: 68 &212> TYPE: DNA <213> ORGANISM: Artificial &220s FEATURE: <223> OTHER INFORMATION: primer <4 OO SEQUENCE: 17 c catagcggit toggagat.cgc aatgcattgc tigcatat coc tdaagcc toc titttittatac 6 O taagttgg 68

<210 SEQ ID NO 18 <211 LENGTH: 68 &212> TYPE: DNA <213> ORGANISM: Artificial &220s FEATURE: <223> OTHER INFORMATION: primer <4 OO SEQUENCE: 18 gccc.gc.cagg cactggaaag cagcc.gc.ctg atcgt.cgc.cc cqctcaagtt agtataaaaa 6 O agctgaac 68

<210 SEQ ID NO 19 <211 LENGTH: 33 &212> TYPE: DNA <213> ORGANISM: Artificial &220s FEATURE: <223> OTHER INFORMATION: primer <4 OO SEQUENCE: 19 tagcgagatc. tctgatgtcc ggcggtgctt ttg 33

<210 SEQ ID NO 2 O <211 LENGTH: 32 &212> TYPE: DNA <213> ORGANISM: Artificial &220s FEATURE: <223> OTHER INFORMATION: primer <4 OO SEQUENCE: 2O aaaaagagct cittacgc.ccc gcc ct gccac to 32

<210 SEQ ID NO 21 <211 LENGTH: 34 &212> TYPE: DNA <213> ORGANISM: Artificial &220s FEATURE: <223> OTHER INFORMATION: primer <4 OO SEQUENCE: 21

Caggat.ctag aaggagacat gaacgatgaa catc 34

<210 SEQ ID NO 22 <211 LENGTH: 36 &212> TYPE: DNA <213> ORGANISM: Artificial &220s FEATURE: <223> OTHER INFORMATION: primer <4 OO SEQUENCE: 22 gataaggat.c cgaaataaaa gaaaatgc.ca at agga 36

<210 SEQ ID NO 23 US 2009/0286290 A1 Nov. 19, 2009 53

- Continued

LENGTH: 31 TYPE: DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: primer SEQUENCE: 23

CCtttgagct cqcgggcagt gagcgcaacg C 31

SEQ ID NO 24 LENGTH: 48 TYPE: DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: primer SEQUENCE: 24

Ctagagcggc cqc.cgatcgg gatcct Cotg tdtgaaattgttatc.cgc 48

SEO ID NO 25 LENGTH: 42 TYPE: DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: primer SEQUENCE: 25

Ctctacgatc gaggaggitta taaaaaatgg at attaatac td 42

SEQ ID NO 26 LENGTH: 36 TYPE: DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: primer SEQUENCE: 26 tcaaag.cggc cqcttctitcq t ctdtttcta citggta 36

SEO ID NO 27 LENGTH: 31 TYPE: DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: primer SEQUENCE: 27

CCtttgg tac cycgggcagt gagcgcaacg C 31

SEQ ID NO 28 LENGTH: 34 TYPE: DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: primer SEQUENCE: 28 alacaggaatt Ctttgcctgg C9gcagtagc gcgg 34

SEQ ID NO 29 LENGTH: 4 O TYPE: DNA ORGANISM: Artificial FEATURE: US 2009/0286290 A1 Nov. 19, 2009 54

- Continued <223> OTHER INFORMATION: primer P1 <4 OO SEQUENCE: 29 c tagtaagat cittgaagcct gcttttittat actaagttgg 4 O

<210 SEQ ID NO 3 O <211 LENGTH: 41 &212> TYPE: DNA <213> ORGANISM: Artificial &220s FEATURE: <223> OTHER INFORMATION: primer P2 <4 OO SEQUENCE: 30 atgatcgaat t cqaaatcaa ataatgattt tattittgact g 41

<210 SEQ ID NO 31 <211 LENGTH: 120 &212> TYPE: DNA <213> ORGANISM: Artificial &220s FEATURE: <223> OTHER INFORMATION: DNA fragment containing attL <4 OO SEQUENCE: 31 agat cittgaa gcc togcttitt ttatactaag ttggcattat aaaaaag.cat togctitat caa 6 O tttgttgcaa cqaacagg to act at cagtic aaaataaaat cattatttga titt cqaattic 12 O

<210 SEQ ID NO 32 <211 LENGTH: 41 &212> TYPE: DNA <213> ORGANISM: Artificial &220s FEATURE: <223> OTHER INFORMATION: primer P3 <4 OO SEQUENCE: 32 atgccactgc agt ctdttac aggtolactaa taccatctaa g 41

<210 SEQ ID NO 33 <211 LENGTH: 46 &212> TYPE: DNA <213> ORGANISM: Artificial &220s FEATURE: <223> OTHER INFORMATION: primer P4 <4 OO SEQUENCE: 33 accottaa.gc tittctagacg citcaagttag tataaaaaag ctgaac 46

<210 SEQ ID NO 34 <211 LENGTH: 184 &212> TYPE: DNA <213> ORGANISM: Artificial &220s FEATURE: <223> OTHER INFORMATION: DNA fragment containing attR <4 OO SEQUENCE: 34 ctgcagtctg ttacaggit ca ctaataccat ctaagtagtt gatt catagt gactgcatat 6 O gttgttgttitt acagtatt at gtagt ctdtt ttt tatgcaa aatctaattit aatatattga 12 O tatttatat c attittacgtt tot cqttcag ctitttittata ctaacttgag cqtctagaaa 18O gctt 184

<210 SEQ ID NO 35

US 2009/0286290 A1 Nov. 19, 2009 57

- Continued

<210 SEQ ID NO 44 <211 LENGTH: 56 &212> TYPE: DNA <213> ORGANISM: Artificial &220s FEATURE: <223> OTHER INFORMATION: primer 3 <4 OO SEQUENCE: 44 ggaagatcta aggaga cctt aaatgagcga cacaacgatc Ctgcaaaac a gtaccC 56

<210 SEQ ID NO 45 <211 LENGTH: 39 &212> TYPE: DNA <213> ORGANISM: Artificial &220s FEATURE: <223> OTHER INFORMATION: primer 4 <4 OO SEQUENCE: 45 cgggg tacct cqtagaggitt tactggcgct tat coagcg 39

<210 SEQ ID NO 46 <211 LENGTH: 8O &212> TYPE: DNA <213> ORGANISM: Artificial &220s FEATURE: <223> OTHER INFORMATION: primer <4 OO SEQUENCE: 46 gcatatgt at gacaccgt.ca aaggttc.cga Ctacatcggit gaccaggacg tdaagcctgc 6 O ttttittatac taagttggca

<210 SEQ ID NO 47 <211 LENGTH: 8O &212> TYPE: DNA <213> ORGANISM: Artificial &220s FEATURE: <223> OTHER INFORMATION: primer <4 OO SEQUENCE: 47 tccagcticaa ggcact caat acgctgtgta ttgaagt cag gtgagcggtc. c9ctcaagtt 6 O agtataaaaa agctgaacga

<210 SEQ ID NO 48 <211 LENGTH: 2O &212> TYPE: DNA <213> ORGANISM: Artificial &220s FEATURE: <223> OTHER INFORMATION: primer <4 OO SEQUENCE: 48 cCaggc actic gtcCtcggitt

<210 SEQ ID NO 49 <211 LENGTH: 48 &212> TYPE: DNA <213> ORGANISM: Artificial &220s FEATURE: <223> OTHER INFORMATION: primer <4 OO SEQUENCE: 49 aggctagtgc aggactataa agaccagttc. tcc taaaaat aacgtgtc. 48 US 2009/0286290 A1 Nov. 19, 2009 58

- Continued

<210 SEQ ID NO 50 <211 LENGTH: 2O &212> TYPE: DNA <213> ORGANISM: Artificial &220s FEATURE: <223> OTHER INFORMATION: primer <4 OO SEQUENCE: 5 O tccatcgtgg ccaccgatcc

<210 SEQ ID NO 51 <211 LENGTH: 48 &212> TYPE: DNA <213> ORGANISM: Artificial &220s FEATURE: <223> OTHER INFORMATION: primer <4 OO SEQUENCE: 51 gacacgittat ttittaggaga actggtctitt atagt cctogc act agcct 48

<210 SEQ ID NO 52 <211 LENGTH: 25 &212> TYPE: DNA <213> ORGANISM: Artificial &220s FEATURE: <223> OTHER INFORMATION: primer <4 OO SEQUENCE: 52 cgggat.cc cc accggcgtact cqtg 25

<210 SEQ ID NO 53 <211 LENGTH: 28 &212> TYPE: DNA <213> ORGANISM: Artificial &220s FEATURE: <223> OTHER INFORMATION: primer <4 OO SEQUENCE: 53 ccacggat.cc titccaatgct attggttg 28

<210 SEQ ID NO 54 <211 LENGTH: 28 &212> TYPE: DNA <213> ORGANISM: Artificial &220s FEATURE: <223> OTHER INFORMATION: primer <4 OO SEQUENCE: 54 gggagct cqa ctittctggct c ctitt act 28

<210 SEQ ID NO 55 <211 LENGTH: 28 &212> TYPE: DNA <213> ORGANISM: Artificial &220s FEATURE: <223> OTHER INFORMATION: primer <4 OO SEQUENCE: 55 gggagctcgc cgatgact aa taatgaga 28

<210 SEQ ID NO 56 <211 LENGTH: 2432 &212> TYPE: DNA

US 2009/0286290 A1 Nov. 19, 2009 61

- Continued

Glu Thir Thir Ala Ser Glin. Thir Glin Ser Pro Ala Thir Ala Wall Glin Glu 510 515 52O aca gtt gcg ccg acg tcc acc cct tag gacgctgatt acagacgtgt 2116 Thir Wall Ala Pro Thir Ser Thr Pro 525 cc catttctt tact actatt ggaaattatgagttcagacg cagaaaaggc atc.cgtggag 2176 ctitt cogalaa aattitcaccc agaacgcacc catattittgg gcgc.cgttgt ttittggcctg 2236 atct catt at tagt catcgg cqcagc.ccct cagtacctgt tittggctgct cqcgctic cct 2296 gtcatctt cq gttactgggit totaaaatca tocacgatcg ttgatgaac a gggcatcacc 23.56 gcaaactacg cct tca aggg caaaaaggitt gtggcctggg alagacct cqc aggaatcgga 2416 ttcaagggtg ccc.gca 2.432

<210 SEQ ID NO 57 <211 LENGTH: 529 &212> TYPE: PRT <213> ORGANISM: Corynebacterium glutamicum

<4 OO SEQUENCE: 57 Met Ile Leu Gly Val Pro Ile Glin Tyr Lieu. Leu Tyr Ser Leu Trp Asn 1. 5 1O 15 Trp Ile Val Asp Thr Gly Phe Asp Val Ala Ile Ile Lieu Val Lieu Ala 2O 25 3O Phe Lieu. Ile Pro Arg Ile Gly Arg Lieu Ala Met Arg Ile Ile Lys Arg 35 4 O 45 Arg Val Glu Ser Ala Ala Asp Ala Asp Thir Thr Lys Asn. Glin Lieu Ala SO 55 6 O Phe Ala Gly Val Gly Val Tyr Ile Ala Glin Ile Val Ala Phe Phe Met 65 70 7s 8O Lieu Ala Val Ser Ala Met Glin Ala Phe Gly Phe Ser Lieu Ala Gly Ala 85 90 95 Ala Ile Pro Ala Thir Ile Ala Ser Ala Ala Ile Gly Lieu. Gly Ala Glin 1OO 105 11 O Ser Ile Val Ala Asp Phe Lieu Ala Gly Phe Phe Ile Lieu. Thr Glu Lys 115 12 O 125 Glin Phe Gly Val Gly Asp Trp Val Arg Phe Glu Gly Asn Gly Ile Val 13 O 135 14 O Val Glu Gly Thr Val Ile Glu Ile Thr Met Arg Ala Thr Lys Ile Arg 145 150 155 160 Thir Ile Ala Glin Glu Thr Val Ile Ile Pro Asn Ser Thr Ala Lys Val 1.65 17O 17s Cys Ile Asn. Asn. Ser Asn. Asn Trp Ser Arg Ala Val Val Val Ile Pro 18O 185 19 O Ile Pro Met Lieu. Gly Ser Glu Asn. Ile Thr Asp Val Ile Ala Arg Ser 195 2OO 2O5 Glu Ala Ala Thr Arg Arg Ala Lieu. Gly Glin Glu Lys Ile Ala Pro Glu 21 O 215 22O Ile Leu Gly Glu Lieu. Asp Val His Pro Ala Thr Glu Val Thr Pro Pro 225 23 O 235 24 O Thr Val Val Gly Met Pro Trp Met Val Thr Met Arg Phe Leu Val Glin 245 250 255 Val Thir Ala Gly Asn Gln Trp Lieu Val Glu Arg Ala Ile Arg Thr Glu US 2009/0286290 A1 Nov. 19, 2009 62

- Continued

26 O 265 27 O

Ile Ile Asn Glu Phe Trp Glu Glu Gly Ser Ala Thir Thir Thir Ser 27s 28O 285

Gly Thir Luell Ile Asp Ser Lell His Wall Glu His Glu Glu Pro Lys Thr 29 O 295 3 OO

Ser Luell Ile Asp Ala Ser Pro Glin Ala Luell Lys Glu Pro Pro Glu 3. OS 310 315 32O

Ala Ala Ala Thir Wall Ala Ser Luell Ala Ala Ser Ser Asn Asp Asp Ala 3.25 330 335

Asp Asn Ala Asp Ala Ser Ala Ile Asn Ala Gly Asn Pro Glu Lys Glu 34 O 345 35. O

Lell Asp Ser Asp Val Lell Glu Glin Glu Luell Ser Ser Glu Glu Pro Glu 355 360 365

Glu Thir Ala Llys Pro Asp His Ser Luell Arg Gly Phe Phe Arg Thir Asp 37 O 375

Tyr Pro Asn Arg Trp Glin Ile Luell Ser Phe Gly Gly Arg Val 385 390 395 4 OO

Arg Met Ser Thir Ser Lell Lell Luell Gly Ala Luell Lell Lell Luell Ser Luell 4 OS 415

Phe Wall Met Thir Wall Glu Pro Ser Glu ASn Trp Glin Asn Ser Ser 42O 425 43 O

Gly Trp Luell Ser Pro Ser Thir Ala Thir Ser Thir Ala Wall Thir Thir Ser 435 44 O 445

Glu Thir Ser Ala Pro Wall Ser Thir Ser Ser Met Thir Wall Pro Th Thr 450 45.5 460

Wall Glu Glu Thir Pro Thir Met Glu Ser Ser Wall Glu Thir Glin Glin Glu 465 470

Thir Ser Thir Pro Ala Thir Ala Thir Pro Glin Arg Ala Asp Thir Ile Glu 485 490 495

Pro Thir Glu Glu Ala Thir Ser Glin Glu Glu Thir Thir Ala Ser Gn. Thir SOO 505

Glin Ser Pro Ala Thr Ala Wall Glin Glu Thir Wall Ala Pro Thir Ser Thr 515 52O 525

Pro

SEO ID NO 58 LENGTH: 2432 TYPE: DNA ORGANISM: Corynebacterium glutamicum FEATURE: NAME/KEY: CDS LOCATION: (507) . . (2 O96)

<4 OO SEQUENCE: 58 aggggcgg.cg gatcgaCCaC ggcttgcaac cgtgg.cggga gtgggctgtt gagaa.gctgc 6 O cacatt cacg actittctggc t cott tact a aataaggatt ttcacaggac ccgt.ccaagc 12 O caag.ccgatt t caact cago ctaaagacaa agc cct catt taaaattgtt ccgacgcgga 18O

cgcagtgcga Cagatgtctg ttgcaaagtt ggct acttgg gtcataacca 24 O acaagaaagc cct cqttcca acactgtggit gagtgttgtc. gaggg.cgctt gacgaga.cga 3OO

Cttggaaggc cgttacggca ggittact act acaagttcgaa taatggit cat 360 ggtgttgtcat gctacacaca tcq agttt co aattic Cacala cgcacgaaaa t to coaccco

US 2009/0286290 A1 Nov. 19, 2009 65

- Continued <210 SEQ ID NO 59 <211 LENGTH: 529 &212> TYPE: PRT <213> ORGANISM: Corynebacterium glutamicum

<4 OO SEQUENCE: 59 Met Ile Leu Gly Val Pro Ile Glin Tyr Lieu. Leu Tyr Ser Leu Trp Asn 1. 5 1O 15 Trp Ile Val Asp Thr Gly Phe Asp Val Ala Ile Ile Lieu Val Lieu Ala 2O 25 3O Phe Lieu. Ile Pro Arg Ile Gly Arg Lieu Ala Met Arg Ile Ile Lys Arg 35 4 O 45 Arg Val Glu Ser Ala Ala Asp Ala Asp Thir Thr Lys Asn. Glin Lieu Ala SO 55 6 O Phe Ala Gly Val Gly Val Tyr Ile Ala Glin Ile Val Ala Phe Phe Met 65 70 7s 8O Lieu Ala Val Ser Ala Met Glin Ala Phe Gly Phe Ser Lieu Ala Gly Ala 85 90 95 Ala Ile Pro Ala Thir Ile Ala Ser Ala Ala Ile Gly Lieu. Gly Ala Glin 1OO 105 11 O Ser Ile Val Ala Asp Phe Lieu Ala Gly Phe Phe Ile Lieu. Thr Glu Lys 115 12 O 125 Glin Phe Gly Val Gly Asp Trp Val Arg Phe Glu Gly Asn Gly Ile Val 13 O 135 14 O Val Glu Gly Thr Val Ile Glu Ile Thr Met Arg Ala Thr Lys Ile Arg 145 150 155 160 Thir Ile Ala Glin Glu Thr Val Ile Ile Pro Asn Ser Thr Ala Lys Val 1.65 17O 17s Cys Ile Asn. Asn. Ser Asn. Asn Trp Ser Arg Ala Val Val Val Ile Pro 18O 185 19 O Ile Pro Met Lieu. Gly Ser Glu Asn. Ile Thr Asp Val Ile Ala Arg Ser 195 2OO 2O5 Glu Ala Ala Thr Arg Arg Ala Lieu. Gly Glin Glu Lys Ile Ala Pro Glu 21 O 215 22O Ile Leu Gly Glu Lieu. Asp Val His Pro Ala Thr Glu Val Thr Pro Pro 225 23 O 235 24 O Thr Val Val Gly Met Pro Trp Met Val Thr Met Arg Phe Leu Val Glin 245 250 255 Val Thir Ala Gly Asn Gln Trp Lieu Val Glu Arg Ala Ile Arg Thr Glu 26 O 265 27 O Ile Ile Asin Glu Phe Trp Glu Glu Tyr Gly Ser Ala Thr Thir Thr Ser 27s 28O 285 Gly Thr Lieu. Ile Asp Ser Lieu. His Val Glu. His Glu Glu Pro Llys Thr 29 O 295 3 OO Ser Lieu. Ile Asp Ala Ser Pro Glin Ala Lieu Lys Glu Pro Llys Pro Glu 3. OS 310 315 32O Ala Ala Ala Thr Val Ala Ser Lieu Ala Ala Ser Ser Asn Asp Asp Ala 3.25 330 335 Asp Asn Ala Asp Ala Ser Ala Ile Asn Ala Gly ASn Pro Glu Lys Glu 34 O 345 35. O Lieu. Asp Ser Asp Val Lieu. Glu Glin Glu Lieu. Ser Ser Glu Glu Pro Glu 355 360 365 US 2009/0286290 A1 Nov. 19, 2009 66

- Continued Glu Thir Ala Lys Pro Asp His Ser Lieu. Arg Gly Phe Phe Arg Thr Asp 37 O 375 38O Tyr Tyr Pro Asn Arg Trp Gln Lys Ile Leu Ser Phe Gly Gly Arg Val 385 390 395 4 OO Arg Met Ser Thir Ser Lieu Lleu Lieu. Gly Ala Lieu Lleu Lleu Lieu. Ser Lieu 4 OS 41O 415 Phe Llys Val Met Thr Val Glu Pro Ser Glu Asn Trp Glin Asn Ser Ser 42O 425 43 O Gly Trp Leu Ser Pro Ser Thr Ala Thr Ser Thr Ala Val Thir Thr Ser 435 44 O 445

Glu Thir Ser Ala Pro Wal Ser Thir Ser Ser Met Thir Wall Pro Thir Thr 450 45.5 460

Wall Glu Glu Thir Pro Thir Met Glu Ser Ser Wall Glu. Thir Glin Glin Glu 465 470 47s 48O Thir Ser Thr Pro Ala Thr Ala Thr Pro Glin Arg Ala Asp Thir Ile Glu 485 490 495

Pro Thr Glu Glu Ala Thir Ser Glin Glu Glu Thir Thir Ala Ser Glin. Thir SOO 505 51O

Glin Ser Pro Ala Thir Ala Wall Glin Glu. Thir Wall Ala Pro Thir Ser Thr 515 52O 525

Pro

<210 SEQ ID NO 60 <211 LENGTH: 22 &212> TYPE: DNA <213> ORGANISM: Artificial &220s FEATURE: <223> OTHER INFORMATION: primer <4 OO SEQUENCE: 60 Cagttgttggc tigatcgc.caa gg 22

<210 SEQ ID NO 61 <211 LENGTH: 52 &212> TYPE: DNA <213> ORGANISM: Artificial &220s FEATURE: <223> OTHER INFORMATION: primer <4 OO SEQUENCE: 61 t caattatag cagtgtc.gca cagatatggc cacaaagaat taaaattgtt td 52

<210 SEQ ID NO 62 <211 LENGTH: 23 &212> TYPE: DNA <213> ORGANISM: Artificial &220s FEATURE: <223> OTHER INFORMATION: primer <4 OO SEQUENCE: 62 c catgcgacg gtagtggc.ca aac 23

<210 SEQ ID NO 63 <211 LENGTH: 52 &212> TYPE: DNA <213> ORGANISM: Artificial &220s FEATURE: <223> OTHER INFORMATION: primer US 2009/0286290 A1 Nov. 19, 2009 67

- Continued <4 OO SEQUENCE: 63 ttgttggc.cat atctgtgcga cactgctata attgaacgtg agcatttacc ag 52

<210 SEQ ID NO 64 <211 LENGTH: 31 &212> TYPE: DNA <213> ORGANISM: Artificial &220s FEATURE: <223> OTHER INFORMATION: primer <4 OO SEQUENCE: 64 cgcc.ccgggt gaccgcgt.ct gcgatcaaaa C 31

<210 SEQ ID NO 65 <211 LENGTH: 28 &212> TYPE: DNA <213> ORGANISM: Artificial &220s FEATURE: <223> OTHER INFORMATION: primer <4 OO SEQUENCE: 65 cgatcc.cggg gccaccaact c catgtc. 28

<210 SEQ ID NO 66 <211 LENGTH: 440 &212> TYPE: DNA <213> ORGANISM: Artificial &220s FEATURE: <223> OTHER INFORMATION: mutant promoter of gah

<4 OO SEQUENCE: 66 cgaaaagg to ggaaagtgcc caatgtgcg ttgttctago tag cct cqgg agctcCagga 6 O gattgttgaaa aacggcticaa atttct coga tigtagcgcct ataaaagttcg caccalatticc 12 O atttgagggc gct Caagtgt ggcCaggitta tatalaccagt cagt caact g g tot catt.cg 18O

Ctggtcggat gaatttaatt aaagaagaga Ctt catgcag ttaccgc.gcg ttittggcgat 24 O acaaaattga taalacctaaa gaaattitt ca aacaattitta attctttgttg gcc at atctg 3OO tgcgacactg ctataattga acgtgagcat ttaccagcct aaatgtc.cgc agtgagttaa 360 gtct caaag.c aagaagttgc tictittagggc atc.cgtagtt taaaactatt aaccottagg 42O tatgacaa.gc cqgttgatgt 44 O

<210 SEQ ID NO 67 <211 LENGTH: 2O &212> TYPE: DNA <213> ORGANISM: Artificial &220s FEATURE: <223> OTHER INFORMATION: primer <4 OO SEQUENCE: 67 t cct cocaca cqgcticagtic 2O

<210 SEQ ID NO 68 <211 LENGTH: 42 &212> TYPE: DNA <213> ORGANISM: Artificial &220s FEATURE: <223> OTHER INFORMATION: primer <4 OO SEQUENCE: 68

US 2009/0286290 A1 Nov. 19, 2009 73

- Continued cga ggc aaa gac gac tagt ctittaa to Caagtaag taccggttca gacagttaaa 4 O46 Arg Gly Lys Asp Asp 1175 ccagaaagac gagtgaacac catgtc.ct Co gcgaaaaaga aaccc.gc acc ggagcgt atg 4106 cact acatca agggctatgt acctgtggcg tatagotct c cacact catc cct cqagcgc 41.66 agcgcaacct ggttgggcat gggatticctic ctica 42OO

<210 SEQ ID NO 74 <211 LENGTH: 257 &212> TYPE: PRT <213> ORGANISM: Corynebacterium glutamicum

<4 OO SEQUENCE: 74 Met Thr Val Arg Asn Pro Asp Arg Glu Ala Ile Arg His Gly Lys Ile 1. 5 1O 15 Thir Thr Glu Ala Lieu. Arg Glu Arg Pro Ala Tyr Pro Thr Trp Ala Met 2O 25 3O Lys Lieu. Thr Met Ala Ile Thr Gly Lieu Met Phe Gly Gly Phe Val Lieu. 35 4 O 45 Val His Met Ile Gly Asn Lieu Lys Ile Phe Met Pro Asp Tyr Ala Ala SO 55 6 O Asp Ser Ala His Pro Gly Glu Ala Glin Val Asp Val Tyr Gly Glu Phe 65 70 7s 8O Lieu. Arg Glu Ile Gly Ser Pro Ile Lieu Pro His Gly Ser Val Lieu. Trp 85 90 95 Ile Lieu. Arg Ile Ile Lieu. Lieu Val Ala Lieu Val Lieu. His Ile Tyr Cys 1OO 105 11 O Ala Phe Ala Lieu. Thr Gly Arg Ser His Glin Ser Arg Gly Llys Phe Arg 115 12 O 125 Arg Thr Asn Lieu Val Gly Gly Phe Asin Ser Phe Ala Thr Arg Ser Met 13 O 135 14 O Lieu Val Thr Gly Ile Val Lieu. Leu Ala Phe Ile Ile Phe His Ile Leu 145 150 155 160 Asp Lieu. Thir Met Gly Val Ala Pro Ala Ala Pro Thr Ser Phe Glu. His 1.65 17O 17s Gly Glu Val Tyr Ala Asn Met Val Ala Ser Phe Ser Arg Trp Pro Val 18O 185 19 O Ala Ile Trp Tyr Ile Ile Ala Asn Lieu Val Lieu. Phe Wal His Lieu. Ser 195 2OO 2O5 His Gly Ile Trp Lieu Ala Val Ser Asp Lieu. Gly Ile Thr Gly Arg Arg 21 O 215 22O Trp Arg Ala Ile Lieu. Lieu Ala Val Ala Tyr Ile Val Pro Ala Lieu Val 225 23 O 235 24 O Lieu. Ile Gly Asn Ile Thir Ile Pro Phe Ala Ile Ala Val Gly Trp Ile 245 250 255

Ala

<210 SEQ ID NO 75 <211 LENGTH: 673 &212> TYPE: PRT <213> ORGANISM: Corynebacterium glutamicum

<4 OO SEQUENCE: 75 US 2009/0286290 A1 Nov. 19, 2009 74

- Continued

Met Ser Thr His Ser Glu Thir Thr Arg Pro Glu Phe Ile His Pro Val

Ser Val Lieu Pro Glu Val Ser Ala Gly Thr Val Lieu. Asp Ala Ala Glu 2O 25 3O Pro Ala Gly Val Pro Thr Lys Asp Met Trp Glu Tyr Gln Lys Asp His 35 4 O 45 Met Asn Lieu Val Ser Pro Lieu. Asn Arg Arg Llys Phe Arg Val Lieu Val SO 55 6 O Val Gly Thr Gly Lieu. Ser Gly Gly Ala Ala Ala Ala Ala Lieu. Gly Glu 65 70 7s 8O Lieu. Gly Tyr Asp Wall Lys Ala Phe Thr Tyr His Asp Ala Pro Arg Arg 85 90 95 Ala His Ser Ile Ala Ala Glin Gly Gly Val Asn. Ser Ala Arg Gly Lys 1OO 105 11 O Llys Val Asp Asn Asp Gly Ala Tyr Arg His Val Lys Asp Thr Val Lys 115 12 O 125 Gly Gly Asp Tyr Arg Gly Arg Glu Ser Asp Cys Trp Arg Lieu Ala Val 13 O 135 14 O Glu Ser Val Arg Val Ile Asp His Met Asn Ala Ile Gly Ala Pro Phe 145 150 155 160 Ala Arg Glu Tyr Gly Gly Ala Lieu Ala Thr Arg Ser Phe Gly Gly Val 1.65 17O 17s Glin Val Ser Arg Thr Tyr Tyr Thr Arg Gly Glin Thr Gly Glin Glin Leu 18O 185 19 O Glin Lieu. Ser Thr Ala Ser Ala Lieu. Glin Arg Glin Ile His Lieu. Gly Ser 195 2OO 2O5 Val Glu Ile Phe Thr His Asn Glu Met Val Asp Val Ile Val Thr Glu 21 O 215 22O Arg Asn Gly Glu Lys Arg Cys Glu Gly Lieu. Ile Met Arg Asn Lieu. Ile 225 23 O 235 24 O Thr Gly Glu Lieu. Thir Ala His Thr Gly His Ala Val Ile Leu Ala Thr 245 250 255 Gly Gly Tyr Gly Asn Val Tyr His Met Ser Thr Lieu Ala Lys Asn Ser 26 O 265 27 O Asn Ala Ser Ala Ile Met Arg Ala Tyr Glu Ala Gly Ala Tyr Phe Ala 27s 28O 285 Ser Pro Ser Phe Ile Glin Phe His Pro Thr Gly Lieu Pro Val Asn Ser 29 O 295 3 OO Thir Trp Glin Ser Llys Thir Ile Lieu Met Ser Glu Ser Lieu. Arg Asn Asp 3. OS 310 315 32O Gly Arg Ile Trp Ser Pro Llys Glu Pro Asn Asp Asn Arg Asp Pro Asn 3.25 330 335 Thir Ile Pro Glu Asp Glu Arg Asp Tyr Phe Lieu. Glu Arg Arg Tyr Pro 34 O 345 35. O Ala Phe Gly Asn Lieu Val Pro Arg Asp Wall Ala Ser Arg Ala Ile Ser 355 360 365 Glin Glin Ile Asn Ala Gly Lieu. Gly Val Gly Pro Lieu. Asn. Asn Ala Ala 37 O 375 38O Tyr Lieu. Asp Phe Arg Asp Ala Thr Glu Arg Lieu. Gly Glin Asp Thir Ile 385 390 395 4 OO US 2009/0286290 A1 Nov. 19, 2009 75

- Continued Arg Glu Arg Tyr Ser Asn Lieu Phe Thr Met Tyr Glu Glu Ala Ile Gly 4 OS 41O 415 Glu Asp Pro Tyr Ser Ser Pro Met Arg Ile Ala Pro Thr Cys His Phe 42O 425 43 O Thr Met Gly Gly Lieu. Trp Thr Asp Phe Asin Glu Met Thr Ser Leu Pro 435 44 O 445 Gly Lieu. Phe Cys Ala Gly Glu Ala Ser Trp Thr Tyr His Gly Ala Asn 450 45.5 460 Arg Lieu. Gly Ala Asn. Ser Lieu. Lieu. Ser Ala Ser Val Asp Gly Trp Phe 465 470 47s 48O Thr Lieu Pro Phe Thr Ile Pro Asn Tyr Lieu. Gly Pro Leu Lieu. Gly Ser 485 490 495 Glu Arg Lieu. Ser Glu Asp Ala Pro Glu Ala Glin Ala Ala Ile Ala Arg SOO 505 51O Ala Glin Ala Arg Ile Asp Arg Lieu Met Gly Asn Arg Pro Glu Trp Val 515 52O 525 Gly Asp Asn. Wal His Gly Pro Glu Tyr Tyr His Arg Glin Lieu. Gly Asp 53 O 535 54 O Ile Lieu. Tyr Phe Ser Cys Gly Val Ser Arg Asn Val Glu Asp Lieu. Glin 5.45 550 555 560 Asp Gly Ile Asn Lys Ile Arg Ala Lieu. Arg Asp Asp Phe Trp Lys Asn 565 st O sts Met Arg Ile Thr Gly Ser Thr Asp Glu Met Asn Glin Val Lieu. Glu Tyr 58O 585 59 O Ala Ala Arg Val Ala Asp Tyr Ile Asp Lieu. Gly Glu Lieu Met Cys Val 595 6OO 605 Asp Ala Lieu. Asp Arg Asp Glu Ser Cys Gly Ala His Phe Arg Asp Asp 610 615 62O His Lieu. Ser Glu Asp Gly Glu Ala Glu Arg Asp Asp Glu Asn Trp Cys 625 630 635 64 O Phe Val Ser Ala Trp Glu Pro Gly Glu Asin Gly Thr Phe Val Arg His 645 650 655 Ala Glu Pro Leu Phe Phe Glu Ser Val Pro Leu Gln Thr Arg Asn Tyr 660 665 67 O Lys

<210 SEQ ID NO 76 <211 LENGTH: 249 &212> TYPE: PRT <213> ORGANISM: Corynebacterium glutamicum

<4 OO SEQUENCE: 76 Met Lys Lieu. Thir Lieu. Glu Ile Trp Arg Glin Ala Gly Pro Thr Ala Glu 1. 5 1O 15 Gly Llys Phe Glu Thr Val Glin Val Asp Asp Ala Val Ala Glin Met Ser 2O 25 3O Ile Lieu. Glu Lieu. Lieu. Asp His Val Asn. Asn Llys Phe Ile Glu Glu Gly 35 4 O 45 Lys Glu Pro Phe Ala Phe Ala Ser Asp Cys Arg Glu Gly Ile Cys Gly SO 55 6 O Thir Cys Gly Lieu. Lieu Val Asn Gly Arg Pro His Gly Ala Asp Glin Asn 65 70 7s 8O US 2009/0286290 A1 Nov. 19, 2009 76

- Continued Llys Pro Ala Cys Ala Glin Arg Lieu Val Ser Tyr Lys Glu Gly Asp Thr 85 90 95 Lieu Lys Ile Glu Pro Lieu. Arg Ser Ala Ala Tyr Pro Val Ile Lys Asp 1OO 105 11 O Met Val Val Asp Arg Ser Ala Lieu. Asp Arg Val Met Glu Glin Gly Gly 115 12 O 125 Tyr Val Thir Ile Asn Ala Gly Thr Ala Pro Asp Ala Asp Thir Lieu. His 13 O 135 14 O Val Asn His Glu Thir Ala Glu Lieu Ala Lieu. Asp His Ala Ala Cys Ile 145 150 155 160 Gly Cys Gly Ala Cys Val Ala Ala Cys Pro Asn Gly Ala Ala His Lieu. 1.65 17O 17s Phe Thr Gly Ala Lys Lieu Val His Lieu. Ser Lieu Lleu Pro Lieu. Gly Lys 18O 185 19 O Glu Glu Arg Gly Lieu. Arg Ala Arg Llys Met Val Asp Glu Met Glu Thir 195 2OO 2O5 Asn Phe Gly His Cys Ser Lieu. Tyr Gly Glu. Cys Ala Asp Val Cys Pro 21 O 215 22O Ala Gly Ile Pro Lieu. Thir Ala Val Ala Ala Val Thir Lys Glu Arg Ala 225 23 O 235 24 O Arg Ala Ala Phe Arg Gly Lys Asp Asp 245

<210 SEO ID NO 77 <211 LENGTH: 42OO &212> TYPE: DNA <213> ORGANISM: Brevibacterium lactofermentum &220s FEATURE: <221 NAME/KEY: CDS <222> LOCATION: (449) . . (1219) &220s FEATURE: <221 NAME/KEY: CDS <222> LOCATION: (1239).. (3257) &220s FEATURE: <221 NAME/KEY: CDS <222> LOCATION: (326O) ... (4006)

<4 OO SEQUENCE: 77 aggtgttgca aagttgttga ttitt cqcttt t cacgcagc cc.gc.cgc.cat cqggtgc.ccg 6 O gcgtggtcag gcc acatgcg ccc.cgggaac tttittgggca Cctacggtgc aac agttgcg 12 O aaaattgttgt cacctg.cgca aagcc ttgct tctattoggg aaatt cqggit gtctaaactt 18O tittggttgat accaaacggg gttagaaact gttcagat.cg gtatic ctgtg aggaagctica 24 O ccttggittitt agaatgttga aaaagcctica cottt cogca ggtagagcac act caattaa 3OO atgagcgt.ca aacgacaata aagta aggct accctaataa citggggttitt atgcct ctaa 360 acagt cagtt gggggcggta ggggagcgtc. c catgactgg ttaatgcct c gatctgggac 42O gtacagtaac agcgacactg gaggtgcc atg act gtt aga aat coc gac C9t 472 Met Thr Val Arg Asn Pro Asp Arg 1. 5 gag gCa at C cqt cac gga aaa att acg acg gag gog Ctg cgt gag ct 52O Glu Ala Ile Arg His Gly Lys Ile Thir Thr Glu Ala Lieu. Arg Glu Arg 1O 15 2O

CCC gca tac ccg acc tig gca atg aag ctg acc atg gcc at C act ggc 568 Pro Ala Tyr Pro Thr Trp Ala Met Lys Lieu. Thr Met Ala Ile Thr Gly 25 3 O 35 4 O

US 2009/0286290 A1 Nov. 19, 2009 81

- Continued <4 OO SEQUENCE: 78 Met Thr Val Arg Asn Pro Asp Arg Glu Ala Ile Arg His Gly Lys Ile 1. 5 1O 15 Thir Thr Glu Ala Lieu. Arg Glu Arg Pro Ala Tyr Pro Thr Trp Ala Met 2O 25 3O Lys Lieu. Thr Met Ala Ile Thr Gly Lieu. Ile Phe Gly Gly Phe Val Lieu. 35 4 O 45 Val His Met Ile Gly Asn Lieu Lys Ile Phe Met Pro Asp Tyr Ala Ala SO 55 6 O Asp Ser Ala His Pro Gly Glu Ala Glin Val Asp Val Tyr Gly Glu Phe 65 70 7s 8O Lieu. Arg Glu Ile Gly Ser Pro Ile Lieu Pro His Gly Ser Val Lieu. Trp 85 90 95 Ile Lieu. Arg Ile Ile Lieu. Lieu Val Ala Lieu Val Lieu. His Ile Tyr Cys 1OO 105 11 O Ala Phe Ala Lieu. Thr Gly Arg Ser His Glin Ser Arg Gly Llys Phe Arg 115 12 O 125 Arg Thr Asn Lieu Val Gly Gly Phe Asin Ser Phe Ala Thr Arg Ser Met 13 O 135 14 O Lieu Val Thr Gly Ile Val Lieu. Leu Ala Phe Ile Ile Phe His Ile Leu 145 150 155 160 Asp Lieu. Thr Met Gly Val Ala Pro Ala Ala Pro Thr Ser Phe Glu. His 1.65 17O 17s Gly Glu Val Tyr Ala Asn Met Val Ala Ser Phe Ser Arg Trp Pro Val 18O 185 19 O Ala Ile Trp Tyr Ile Ile Ala Asn Lieu Val Lieu. Phe Wal His Lieu. Ser 195 2OO 2O5 His Gly Ile Trp Lieu Ala Val Ser Asp Lieu. Gly Ile Thr Gly Arg Arg 21 O 215 22O Trp Arg Ala Ile Lieu. Lieu Ala Val Ala Tyr Ile Val Pro Ala Lieu Val 225 23 O 235 24 O Lieu. Ile Gly Asn Ile Thir Ile Pro Phe Ala Ile Ala Val Gly Trp Ile 245 250 255

Ala

<210 SEQ ID NO 79 <211 LENGTH: 673 &212> TYPE: PRT <213> ORGANISM: Brevibacterium lactofermentum

<4 OO SEQUENCE: 79 Met Ser Thr His Ser Glu Thir Thr Arg Pro Glu Phe Ile His Pro Val 1. 5 1O 15 Ser Val Lieu Pro Glu Val Ser Ala Gly Thr Val Lieu. Asp Ala Ala Glu 2O 25 3O Pro Ala Gly Val Pro Thr Lys Asp Met Trp Glu Tyr Gln Lys Asp His 35 4 O 45 Met Asn Lieu Val Ser Pro Lieu. Asn Arg Arg Llys Phe Arg Val Lieu Val SO 55 6 O Val Gly Thr Gly Lieu. Ser Gly Gly Ala Ala Ala Ala Ala Lieu. Gly Glu 65 70 7s 8O Lieu. Gly Tyr Asp Wall Lys Ala Phe Thr Tyr His Asp Ala Pro Arg Arg US 2009/0286290 A1 Nov. 19, 2009 82

- Continued

85 90 95 Ala His Ser Ile Ala Ala Glin Gly Gly Val Asn. Ser Ala Arg Gly Lys 1OO 105 11 O Llys Val Asp Asn Asp Gly Ala Tyr Arg His Val Lys Asp Thr Val Lys 115 12 O 125 Gly Gly Asp Tyr Arg Gly Arg Glu Ser Asp Cys Trp Arg Lieu Ala Val 13 O 135 14 O Glu Ser Val Arg Val Ile Asp His Met Asn Ala Ile Gly Ala Pro Phe 145 150 155 160 Ala Arg Glu Tyr Gly Gly Ala Lieu Ala Thr Arg Ser Phe Gly Gly Val 1.65 17O 17s Glin Val Ser Arg Thr Tyr Tyr Thr Arg Gly Glin Thr Gly Glin Glin Leu 18O 185 19 O Glin Lieu. Ser Thr Ala Ser Ala Lieu. Glin Arg Glin Ile His Lieu. Gly Ser 195 2OO 2O5 Val Glu Ile Phe Thr His Asn Glu Met Val Asp Val Ile Val Thr Glu 21 O 215 22O Arg Asn Gly Glu Lys Arg Cys Glu Gly Lieu. Ile Met Arg Asn Lieu. Ile 225 23 O 235 24 O Thr Gly Glu Lieu. Thir Ala His Thr Gly His Ala Val Ile Leu Ala Thr 245 250 255 Gly Gly Tyr Gly Asn Val Tyr His Met Ser Thr Lieu Ala Lys Asn Ser 26 O 265 27 O Asn Ala Ser Ala Ile Met Arg Ala Tyr Glu Ala Gly Ala Tyr Phe Ala 27s 28O 285 Ser Pro Ser Phe Ile Glin Phe His Pro Thr Gly Lieu Pro Val Asn Ser 29 O 295 3 OO Thir Trp Glin Ser Llys Thir Ile Lieu Met Ser Glu Ser Lieu. Arg Asn Asp 3. OS 310 315 32O Gly Arg Ile Trp Ser Pro Llys Val Lys Gly Asp Asp Arg Asp Pro Asn 3.25 330 335 Thir Ile Pro Glu Asp Glu Arg Asp Tyr Phe Lieu. Glu Arg Arg Tyr Pro 34 O 345 35. O Ala Phe Gly Asn Lieu Val Pro Arg Asp Wall Ala Ser Arg Ala Ile Ser 355 360 365 Glin Glin Ile Asn Ala Gly Lieu. Gly Val Gly Pro Lieu. Asn. Asn Ala Ala 37 O 375 38O Tyr Lieu. Asp Phe Arg Asp Ala Thr Glu Arg Lieu. Gly Glin Asp Thir Ile 385 390 395 4 OO Arg Glu Arg Tyr Ser Asn Lieu Phe Thr Met Tyr Glu Glu Ala Ile Gly 4 OS 41O 415 Glu Asp Pro Tyr Ser Ser Pro Met Arg Ile Ala Pro Thr Cys His Phe 42O 425 43 O Thr Met Gly Gly Lieu. Trp Thr Asp Phe Asin Glu Met Thr Ser Leu Pro 435 44 O 445 Gly Lieu. Phe Cys Ala Gly Glu Ala Ser Trp Thr Tyr His Gly Ala Asn 450 45.5 460 Arg Lieu. Gly Ala Asn. Ser Lieu. Lieu. Ser Ala Ser Val Asp Gly Trp Phe 465 470 47s 48O Thr Lieu Pro Phe Thr Ile Pro Asn Tyr Lieu. Gly Pro Leu Lieu. Gly Ala 485 490 495 US 2009/0286290 A1 Nov. 19, 2009 83

- Continued

Glu Arg Lieu Ala Glu Asp Ala Pro Glu Ala Val Glin Ala Ile Glu Arg SOO 505 51O Ala Glin Ala Arg Ile Asp Arg Lieu Met Gly Asn Arg Pro Glu Trp Val 515 52O 525 Gly Asp Asn. Wal His Gly Pro Glu Tyr Tyr His Arg Glin Lieu. Gly Asp 53 O 535 54 O Ile Lieu. Tyr Phe Ser Cys Gly Val Ser Arg Asn. Wall Lys Asp Lieu. Glin 5.45 550 555 560 Asp Gly Ile Asp Llys Ile Arg Ala Lieu. Arg Glu Asp Phe Trp Lys Asn 565 st O sts Met Arg Ile Thr Gly Ser Thr Asp Glu Met Asn Glin Val Lieu. Glu Tyr 58O 585 59 O Ala Ala Arg Val Ala Asp Tyr Ile Asp Lieu. Gly Glu Lieu Met Cys Val 595 6OO 605 Asp Ala Lieu. Asp Arg Asp Glu Ser Cys Gly Ala His Phe Arg Asp Asp 610 615 62O His Lieu. Ser Glu Asp Gly Glu Ala Glu Arg Asp Asp Glu Asn Trp Cys 625 630 635 64 O Phe Val Ser Ala Trp Glu Pro Gly Glu Asin Gly Thr Phe Val Arg His 645 650 655 Ala Glu Pro Leu Phe Phe Glu Ser Val Pro Leu Gln Thr Arg Asn Tyr 660 665 67 O Lys

<210 SEQ ID NO 8O <211 LENGTH: 249 &212> TYPE: PRT <213> ORGANISM: Brevibacterium lactofermentum

<4 OO SEQUENCE: 80 Met Lys Lieu. Thir Lieu. Glu Ile Trp Arg Glin Ala Gly Pro Thr Ala Glu 1. 5 1O 15 Gly Llys Phe Glu Thr Val Glin Val Asp Asp Ala Val Ala Glin Met Ser 2O 25 3O Ile Lieu. Glu Lieu. Lieu. Asp His Val Asn. Asn Llys Phe Ile Glu Glu Gly 35 4 O 45 Lys Glu Pro Phe Ala Phe Ala Ser Asp Cys Arg Glu Gly Ile Cys Gly SO 55 6 O Thir Cys Gly Lieu. Lieu Val Asn Gly Arg Pro His Gly Ala Asp Glin Asn 65 70 7s 8O Llys Pro Ala Cys Ala Glin Arg Lieu Val Ser Tyr Asn. Glu Gly Asp Thr 85 90 95 Lieu Lys Ile Glu Pro Lieu. Arg Ser Ala Ala Tyr Pro Val Ile Lys Asp 1OO 105 11 O Met Val Val Asp Arg Ser Ala Lieu. Asp Arg Val Met Glu Glin Gly Gly 115 12 O 125 Tyr Val Thir Ile Asn Ala Gly Thr Ala Pro Asp Ala Asp Thir Lieu. His 13 O 135 14 O Val Asn His Glu Thir Ala Glu Lieu Ala Lieu. Asp His Ala Ala Cys Ile 145 150 155 160 Gly Cys Gly Ala Cys Val Ala Ala Cys Pro Asn Gly Ala Ala His Lieu. 1.65 17O 17s US 2009/0286290 A1 Nov. 19, 2009

- Continued

Phe Thr Gly Ala Lys Lieu Val His Lieu. Ser Lieu Lleu Pro Lieu Gly Lys 18O 185 19 O

Glu Glu Arg Gly Lieu. Arg Ala Arg Llys Met Val Asp Glu Met Glu Thir 195 2OO 2O5 Asn Phe Gly His Cys Ser Lieu. Tyr Gly Glu. Cys Ala Asp Val Cys Pro 21 O 215 22O Ala Gly Ile Pro Lieu. Thir Ala Val Ala Ala Val Thir Lys Glu Arg Ala 225 23 O 235 24 O Arg Ala Ala Phe Arg Gly Lys Asp Asp 245

What is claimed is: consisting of the SdhA gene, the SdhB gene, the SdhC gene 1. A method for producing an L-amino acid, the method and the SdhD gene, and combinations thereof. comprising: 4. The method according to claim 2, wherein the gene culturing in a medium a microorganism which has an encoding O-ketoglutaratedehydrogenase is selected from the L-amino acid producing ability and has been modified group consisting of SucA gene, the odh A gene and the Such So that Succinate dehydrogenase activity and O-ketoglu gene, and combinations thereof. 5. The method according to claim 1, wherein the microor tarate dehydrogenase activity are decreased, and ganism is a bacterium belonging to the family Enterobacte collecting the L-amino acid from the medium or cells of the riaceae or a coryneform bacterium. microorganism. 6. The method according to claim 1, wherein the L-amino 2. The method according to claim 1, wherein the Succinate acid is L-glutamic acid or an L-amino acid which is biosyn dehydrogenase activity or the C.-ketoglutarate dehydrogenase thesized via L-glutamic acid as a precursor. activity is decreased by reducing expression of a gene encod 7. The method according to claim 6, wherein the L-amino ing Succinate dehydrogenase or C-ketoglutarate dehydroge acid is selected from the group consisting of L-arginine, nase or disrupting the gene. L-proline, L-ornithine, L-citrulline, and L-glutamine. 3. The method according to claim 2, wherein the gene encoding Succinate dehydrogenase is selected from the group c c c c c