DOCSLIB.ORG

Mouse Reep2 Knockout Project (CRISPR/Cas9)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mouse Reep2 Knockout Project (CRISPR/Cas9) https://www.alphaknockout.com Mouse Reep2 Knockout Project (CRISPR/Cas9) Objective: To create a Reep2 knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Reep2 gene (NCBI Reference Sequence: NM_144865 ; Ensembl: ENSMUSG00000038555 ) is located on Mouse chromosome 18. 8 exons are identified, with the ATG start codon in exon 1 and the TGA stop codon in exon 8 (Transcript: ENSMUST00000043484). Exon 1~8 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Exon 1 starts from about 0.13% of the coding region. Exon 1~8 covers 100.0% of the coding region. The size of effective KO region: ~5711 bp. The KO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 2 3 4 5 6 7 8 Legends Exon of mouse Reep2 Knockout region Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section upstream of start codon is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix. The gRNA site is selected outside of these tandem repeats. Overview of the Dot Plot (down) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section downstream of stop codon is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Page 3 of 8 https://www.alphaknockout.com Overview of the GC Content Distribution (up) Window size: 300 bp Sequence 12 Summary: Full Length(2000bp) | A(26.1% 522) | C(22.85% 457) | T(25.15% 503) | G(25.9% 518) Note: The 2000 bp section upstream of start codon is analyzed to determine the GC content. Significant high GC-content regions are found. The gRNA site is selected outside of these high GC-content regions. Overview of the GC Content Distribution (down) Window size: 300 bp Sequence 12 Summary: Full Length(2000bp) | A(26.0% 520) | C(25.6% 512) | T(19.9% 398) | G(28.5% 570) Note: The 2000 bp section downstream of stop codon is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Page 4 of 8 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 2000 1 2000 2000 100.0% chr18 + 34838757 34840756 2000 browser details YourSeq 135 1 158 2000 96.0% chr16 + 48369589 48369752 164 browser details YourSeq 32 734 806 2000 66.7% chr1 - 65478532 65478576 45 browser details YourSeq 32 1910 1951 2000 97.2% chr11 + 102206715 102206757 43 browser details YourSeq 31 1196 1263 2000 61.8% chr8 + 25559728 25559761 34 browser details YourSeq 26 109 140 2000 96.5% chr13 - 58992174 58992206 33 browser details YourSeq 25 1193 1225 2000 87.9% chr8 + 34303514 34303546 33 browser details YourSeq 23 1193 1220 2000 92.6% chr2 - 106441999 106442031 33 browser details YourSeq 23 1193 1216 2000 100.0% chr9 + 85695991 85696018 28 browser details YourSeq 23 616 638 2000 100.0% chr15 + 44398361 44398383 23 browser details YourSeq 22 161 182 2000 100.0% chr9 + 97590360 97590381 22 browser details YourSeq 22 427 448 2000 100.0% chr1 + 119173097 119173118 22 browser details YourSeq 21 1032 1052 2000 100.0% chr17 - 34426311 34426331 21 browser details YourSeq 21 1198 1218 2000 100.0% chr16 - 39843365 39843385 21 browser details YourSeq 21 1198 1218 2000 100.0% chr1 - 63074080 63074100 21 browser details YourSeq 21 424 446 2000 95.7% chr1 - 57953541 57953563 23 browser details YourSeq 21 1031 1051 2000 100.0% chr5 + 100570766 100570786 21 browser details YourSeq 20 1479 1498 2000 100.0% chr1 - 23872105 23872124 20 browser details YourSeq 20 1195 1218 2000 91.7% chr13 + 88741106 88741129 24 Note: The 2000 bp section upstream of start codon is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 2000 1 2000 2000 100.0% chr18 + 34846468 34848467 2000 browser details YourSeq 129 1803 1977 2000 88.8% chr13 - 87007464 87007636 173 browser details YourSeq 128 1815 1977 2000 88.9% chr3 - 110341671 110341829 159 browser details YourSeq 124 1807 1977 2000 84.7% chr2 - 7786074 7786234 161 browser details YourSeq 121 1805 1957 2000 92.4% chr5 + 113697026 113697178 153 browser details YourSeq 119 1741 1923 2000 91.1% chr1 - 165169037 165169549 513 browser details YourSeq 118 1801 1940 2000 92.9% chr4 - 130517974 130518117 144 browser details YourSeq 113 1805 1930 2000 95.3% chr4 + 151987331 151987604 274 browser details YourSeq 113 1814 1977 2000 83.6% chr10 + 35119020 35119175 156 browser details YourSeq 112 1805 1929 2000 95.2% chr6 + 95206682 95206808 127 browser details YourSeq 111 1801 1930 2000 93.8% chr11 - 53514886 53515016 131 browser details YourSeq 111 1805 1930 2000 94.5% chr10 - 75969549 75969676 128 browser details YourSeq 110 1800 1930 2000 92.4% chrX + 71370627 71370759 133 browser details YourSeq 108 1800 1930 2000 91.7% chr9 - 108335788 108335920 133 browser details YourSeq 106 1807 1949 2000 88.4% chr9 + 95730511 95730653 143 browser details YourSeq 106 1805 1930 2000 92.8% chr17 + 37030965 37031093 129 browser details YourSeq 106 1813 1930 2000 95.8% chr11 + 53467886 53468006 121 browser details YourSeq 105 1805 1929 2000 93.4% chr8 - 93062465 93062591 127 browser details YourSeq 105 1813 1930 2000 95.0% chr10 - 109984337 109984456 120 browser details YourSeq 104 1786 1930 2000 91.3% chr12 - 111033296 111033740 445 Note: The 2000 bp section downstream of stop codon is BLAT searched against the genome. No significant similarity is found. Page 5 of 8 https://www.alphaknockout.com Gene and protein information: Reep2 receptor accessory protein 2 [ Mus musculus (house mouse) ] Gene ID: 225362, updated on 12-Aug-2019 Gene summary Official Symbol Reep2 provided by MGI Official Full Name receptor accessory protein 2 provided by MGI Primary source MGI:MGI:2385070 See related Ensembl:ENSMUSG00000038555 Gene type protein coding RefSeq status VALIDATED Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Expression Biased expression in cerebellum adult (RPKM 71.0), testis adult (RPKM 55.4) and 9 other tissuesS ee more Orthologs human all Genomic context Location: 18; 18 B1 See Reep2 in Genome Data Viewer Exon count: 8 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 18 NC_000084.6 (34840589..34847463) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 18 NC_000084.5 (35000312..35007109) Chromosome 18 - NC_000084.6 Page 6 of 8 https://www.alphaknockout.com Transcript information: This gene has 1 transcript Gene: Reep2 ENSMUSG00000038555 Description receptor accessory protein 2 [Source:MGI Symbol;Acc:MGI:2385070] Location Chromosome 18: 34,840,589-34,847,463 forward strand. GRCm38:CM001011.2 About this gene This gene has 1 transcript (splice variant), 200 orthologues, 5 paralogues and is a member of 1 Ensembl protein family. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Reep2-201 ENSMUST00000043484.7 1926 254aa ENSMUSP00000036065.7 Protein coding CCDS29135 Q8VCD6 TSL:1 GENCODE basic APPRIS P1 26.88 kb Forward strand 34.835Mb 34.840Mb 34.845Mb 34.850Mb 34.855Mb Genes (Comprehensive set... Kdm3b-201 >protein coding Reep2-201 >protein coding Kdm3b-206 >nonsense mediated decay Kdm3b-202 >lncRNA Contigs < AC114820.4 Regulatory Build 34.835Mb 34.840Mb 34.845Mb 34.850Mb 34.855Mb Reverse strand 26.88 kb Regulation Legend CTCF Open Chromatin Promoter Promoter Flank Gene Legend Protein Coding merged Ensembl/Havana Ensembl protein coding Non-Protein Coding processed transcript RNA gene Page 7 of 8 https://www.alphaknockout.com Transcript: ENSMUST00000043484 6.88 kb Forward strand Reep2-201 >protein coding ENSMUSP00000036... Transmembrane heli... MobiDB lite Low complexity (Seg) Pfam TB2/DP1/HVA22-related protein PANTHER TB2/DP1/HVA22-related protein PTHR12300:SF29 All sequence SNPs/i... Sequence variants (dbSNP and all other sources) Variant Legend missense variant splice region variant synonymous variant Scale bar 0 40 80 120 160 200 254 We wish to acknowledge the following valuable scientific information resources: Ensembl, MGI, NCBI, UCSC. Page 8 of 8.
Load more

Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Hereditary Spastic Paraplegia: from Genes, Cells and Networks to Novel Pathways for Drug Discovery
    brain sciences Review Hereditary Spastic Paraplegia: From Genes, Cells and Networks to Novel Pathways for Drug Discovery Alan Mackay-Sim Griffith Institute for Drug Discovery, Griffith University, Brisbane, QLD 4111, Australia; a.mackay-sim@griffith.edu.au Abstract: Hereditary spastic paraplegia (HSP) is a diverse group of Mendelian genetic disorders affect- ing the upper motor neurons, specifically degeneration of their distal axons in the corticospinal tract. Currently, there are 80 genes or genomic loci (genomic regions for which the causative gene has not been identified) associated with HSP diagnosis. HSP is therefore genetically very heterogeneous. Finding treatments for the HSPs is a daunting task: a rare disease made rarer by so many causative genes and many potential mutations in those genes in individual patients. Personalized medicine through genetic correction may be possible, but impractical as a generalized treatment strategy. The ideal treatments would be small molecules that are effective for people with different causative mutations. This requires identification of disease-associated cell dysfunctions shared across geno- types despite the large number of HSP genes that suggest a wide diversity of molecular and cellular mechanisms. This review highlights the shared dysfunctional phenotypes in patient-derived cells from patients with different causative mutations and uses bioinformatic analyses of the HSP genes to identify novel cell functions as potential targets for future drug treatments for multiple genotypes. Keywords: neurodegeneration; motor neuron disease; spastic paraplegia; endoplasmic reticulum; Citation: Mackay-Sim, A. Hereditary protein-protein interaction network Spastic Paraplegia: From Genes, Cells and Networks to Novel Pathways for Drug Discovery. Brain Sci. 2021, 11, 403.
    [Show full text]
  • A Conserved Amphipathic Helix Is Required for Membrane Tubule Formation by Yop1p
    A conserved amphipathic helix is required for PNAS PLUS membrane tubule formation by Yop1p Jacob P. Brady, Jolyon K. Claridge, Peter G. Smith, and Jason R. Schnell1 Department of Biochemistry, University of Oxford, Oxford OX1 3QU, United Kingdom Edited by William F. DeGrado, School of Pharmacy, University of California, San Francisco, CA, and approved December 31, 2014 (received for review August 18, 2014) The integral membrane proteins of the DP1 (deleted in polyposis) C-terminal tubulin binding domains providing a link between ER and reticulon families are responsible for maintaining the high morphology and the cytoskeleton (19). membrane curvature required for both smooth endoplasmic retic- The RHDs are proposed to form hydrophobic hairpins too ulum (ER) tubules and the edges of ER sheets, and mutations in short to traverse the membrane fully, leading to greater dis- these proteins lead to motor neuron diseases, such as hereditary placement of lipids from the outer leaflet than from the in- spastic paraplegia. Reticulon/DP1 proteins contain reticulon ho- ner leaflet. By this mechanism, a combination of hydrophobic mology domains (RHDs) that have unusually long hydrophobic wedging and oligomeric scaffolding could lead to the stabiliza- segments and are proposed to adopt intramembrane helical hair- tion of the tubular ER membrane. However, there is currently pins that stabilize membrane curvature. We have characterized no structural information available for these intramembrane the secondary structure and dynamics of the DP1 family protein domains, and the exact mechanism of curvature generation and produced from the YOP1 gene (Yop1p) and identified a C-termi- stabilization remains unknown. The mechanism for exclusive nal conserved amphipathic helix (APH) that, on its own, interacts localization of RHD proteins to highly curved membranes also strongly with negatively charged membranes and is necessary remains unclear; however, the transmembrane domains have for membrane tubule formation.
    [Show full text]
  • The Transcriptome of Pig Spermatozoa, and Its Role in Fertility
    International Journal of Molecular Sciences Article The Transcriptome of Pig Spermatozoa, and Its Role in Fertility Manuel Alvarez-Rodriguez 1,* , Cristina Martinez 1, Dominic Wright 2, Isabel Barranco 3, Jordi Roca 4 and Heriberto Rodriguez-Martinez 1 1 Department of Biomedical & Clinical Sciences (BKV), BKH/Obstetrics & Gynaecology, Faculty of Medicine and Health Sciences, Linköping University, SE-58185 Linköping, Sweden; [email protected] (C.M.); [email protected] (H.R.-M.) 2 Department of Physics, Chemistry and Biology, Faculty of Science and Engineering, Linköping University, SE-58183 Linköping, Sweden; [email protected] 3 Biotechnology of Animal and Human Reproduction (TechnoSperm), Department of Biology, Institute of Food and Agricultural Technology, University of Girona, 17003 Girona, Spain; [email protected] 4 Department of Medicine and Animal Surgery, Faculty of Veterinary Medicine, International Campus for Higher Education and Research “Campus Mare Nostrum”, University of Murcia, 30100 Murcia, Spain; [email protected] * Correspondence: [email protected]; Tel.: +46-(0)729427883 Received: 6 February 2020; Accepted: 24 February 2020; Published: 25 February 2020 Abstract: In the study presented here we identified transcriptomic markers for fertility in the cargo of pig ejaculated spermatozoa using porcine-specific micro-arrays (GeneChip® miRNA 4.0 and GeneChip® Porcine Gene 1.0 ST). We report (i) the relative abundance of the ssc-miR-1285, miR-16, miR-4332, miR-92a, miR-671-5p, miR-4334-5p, miR-425-5p, miR-191, miR-92b-5p and miR-15b miRNAs, and (ii) the presence of 347 up-regulated and 174 down-regulated RNA transcripts in high-fertility breeding boars, based on differences of farrowing rate (FS) and litter size (LS), relative to low-fertility boars in the (Artificial Insemination) AI program.
    [Show full text]
  • Variation in Protein Coding Genes Identifies Information Flow
    bioRxiv preprint doi: https://doi.org/10.1101/679456; this version posted June 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Animal complexity and information flow 1 1 2 3 4 5 Variation in protein coding genes identifies information flow as a contributor to 6 animal complexity 7 8 Jack Dean, Daniela Lopes Cardoso and Colin Sharpe* 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Institute of Biological and Biomedical Sciences 25 School of Biological Science 26 University of Portsmouth, 27 Portsmouth, UK 28 PO16 7YH 29 30 * Author for correspondence 31 [email protected] 32 33 Orcid numbers: 34 DLC: 0000-0003-2683-1745 35 CS: 0000-0002-5022-0840 36 37 38 39 40 41 42 43 44 45 46 47 48 49 Abstract bioRxiv preprint doi: https://doi.org/10.1101/679456; this version posted June 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Animal complexity and information flow 2 1 Across the metazoans there is a trend towards greater organismal complexity. How 2 complexity is generated, however, is uncertain. Since C.elegans and humans have 3 approximately the same number of genes, the explanation will depend on how genes are 4 used, rather than their absolute number.
    [Show full text]
  • Hereditary Spastic Paraplegias: Clinical Spectrum in Sudan, Further Deciphering of the Molecular Bases of Autosomal Recessive Forms and New Genes Emerging
    Hereditary spastic paraplegias : clinical spectrum in Sudan, further deciphering of the molecular bases of autosomal recessive forms and new genes emerging Liena Elbaghir Omer Elsayed To cite this version: Liena Elbaghir Omer Elsayed. Hereditary spastic paraplegias : clinical spectrum in Sudan, further deciphering of the molecular bases of autosomal recessive forms and new genes emerging. Neurons and Cognition [q-bio.NC]. Université Pierre et Marie Curie - Paris VI; University of Khartoum, 2016. English. NNT : 2016PA066056. tel-01438739 HAL Id: tel-01438739 https://tel.archives-ouvertes.fr/tel-01438739 Submitted on 18 Jan 2017 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Université Pierre et Marie Curie University of Khartoum Cerveau-Cognition-Comportement (ED3C) Institut du Cerveau et de la Moelle Epinière / Equipe Bases Moléculaires, Physiopathologie Et Traitement Des Maladies Neurodégénératives Hereditary spastic paraplegias: clinical spectrum in Sudan, further deciphering of the molecular bases of autosomal recessive forms and new genes emerging
    [Show full text]
  • Copy Number Variation, Chromosome Rearrangement, and Their Association with Recombination During Avian Evolution
    Downloaded from genome.cshlp.org on October 1, 2021 - Published by Cold Spring Harbor Laboratory Press Research Copy number variation, chromosome rearrangement, and their association with recombination during avian evolution Martin Vo¨lker,1 Niclas Backstro¨m,2 Benjamin M. Skinner,1,3 Elizabeth J. Langley,1,4 Sydney K. Bunzey,1 Hans Ellegren,2 and Darren K. Griffin1,5 1School of Biosciences, University of Kent, Canterbury, Kent CT2 7NJ, United Kingdom; 2Department of Evolutionary Biology, Evolutionary Biology Centre, Uppsala University, Norbyva¨gen 18D, SE-752 36 Uppsala, Sweden Chromosomal rearrangements and copy number variants (CNVs) play key roles in genome evolution and genetic disease; however, the molecular mechanisms underlying these types of structural genomic variation are not fully understood. The availability of complete genome sequences for two bird species, the chicken and the zebra finch, provides, for the first time, an ideal opportunity to analyze the relationship between structural genomic variation (chromosomal and CNV) and recombination on a genome-wide level. The aims of this study were therefore threefold: (1) to combine bioinformatics, physical mapping to produce comprehensive comparative maps of the genomes of chicken and zebra finch. In so doing, this allowed the identification of evolutionary chromosomal rearrangements distinguishing them. The previously reported interchromosomal conservation of synteny was confirmed, but a larger than expected number of intrachromosomal rearrangements were reported; (2) to hybridize zebra finch genomic DNA to a chicken tiling path microarray and identify CNVs in the zebra finch genome relative to chicken; 32 interspecific CNVs were identified; and (3) to test the hypothesis that there is an association between CNV, chromosomal rearrangements, and recombination by correlating data from (1) and (2) with recombination rate data from a high-resolution genetic linkage map of the zebra finch.
    [Show full text]
  • Agricultural University of Athens
    ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΤΩΝ ΖΩΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ ΖΩΙΚΗΣ ΠΑΡΑΓΩΓΗΣ ΕΡΓΑΣΤΗΡΙΟ ΓΕΝΙΚΗΣ ΚΑΙ ΕΙΔΙΚΗΣ ΖΩΟΤΕΧΝΙΑΣ ΔΙΔΑΚΤΟΡΙΚΗ ΔΙΑΤΡΙΒΗ Εντοπισμός γονιδιωματικών περιοχών και δικτύων γονιδίων που επηρεάζουν παραγωγικές και αναπαραγωγικές ιδιότητες σε πληθυσμούς κρεοπαραγωγικών ορνιθίων ΕΙΡΗΝΗ Κ. ΤΑΡΣΑΝΗ ΕΠΙΒΛΕΠΩΝ ΚΑΘΗΓΗΤΗΣ: ΑΝΤΩΝΙΟΣ ΚΟΜΙΝΑΚΗΣ ΑΘΗΝΑ 2020 ΔΙΔΑΚΤΟΡΙΚΗ ΔΙΑΤΡΙΒΗ Εντοπισμός γονιδιωματικών περιοχών και δικτύων γονιδίων που επηρεάζουν παραγωγικές και αναπαραγωγικές ιδιότητες σε πληθυσμούς κρεοπαραγωγικών ορνιθίων Genome-wide association analysis and gene network analysis for (re)production traits in commercial broilers ΕΙΡΗΝΗ Κ. ΤΑΡΣΑΝΗ ΕΠΙΒΛΕΠΩΝ ΚΑΘΗΓΗΤΗΣ: ΑΝΤΩΝΙΟΣ ΚΟΜΙΝΑΚΗΣ Τριμελής Επιτροπή: Aντώνιος Κομινάκης (Αν. Καθ. ΓΠΑ) Ανδρέας Κράνης (Eρευν. B, Παν. Εδιμβούργου) Αριάδνη Χάγερ (Επ. Καθ. ΓΠΑ) Επταμελής εξεταστική επιτροπή: Aντώνιος Κομινάκης (Αν. Καθ. ΓΠΑ) Ανδρέας Κράνης (Eρευν. B, Παν. Εδιμβούργου) Αριάδνη Χάγερ (Επ. Καθ. ΓΠΑ) Πηνελόπη Μπεμπέλη (Καθ. ΓΠΑ) Δημήτριος Βλαχάκης (Επ. Καθ. ΓΠΑ) Ευάγγελος Ζωίδης (Επ.Καθ. ΓΠΑ) Γεώργιος Θεοδώρου (Επ.Καθ. ΓΠΑ) 2 Εντοπισμός γονιδιωματικών περιοχών και δικτύων γονιδίων που επηρεάζουν παραγωγικές και αναπαραγωγικές ιδιότητες σε πληθυσμούς κρεοπαραγωγικών ορνιθίων Περίληψη Σκοπός της παρούσας διδακτορικής διατριβής ήταν ο εντοπισμός γενετικών δεικτών και υποψηφίων γονιδίων που εμπλέκονται στο γενετικό έλεγχο δύο τυπικών πολυγονιδιακών ιδιοτήτων σε κρεοπαραγωγικά ορνίθια. Μία ιδιότητα σχετίζεται με την ανάπτυξη (σωματικό βάρος στις 35 ημέρες, ΣΒ) και η άλλη με την αναπαραγωγική
    [Show full text]
  • Loss of Association of REEP2 with Membranes Leads to Hereditary Spastic Paraplegia
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector REPORT Loss of Association of REEP2 with Membranes Leads to Hereditary Spastic Paraplegia Typhaine Esteves,1,2,3,4 Alexandra Durr,1,2,3,5 Emeline Mundwiller,6 Jose´ L. Loureiro,7 Maxime Boutry,1,2,3 Michael A. Gonzalez,8 Julie Gauthier,9,12 Khalid H. El-Hachimi,1,2,3,4 Christel Depienne,1,2,3,5 Marie-Paule Muriel,1,2,3 Rafael F. Acosta Lebrigio,8 Marion Gaussen,1,2,3,4 Anne Noreau,9 Fiorella Speziani,8 Alexandre Dionne-Laporte,9 Jean-Franc¸ois Deleuze,10 Patrick Dion,9 Paula Coutinho,7 Guy A. Rouleau,9 Stephan Zuchner,8 Alexis Brice,1,2,3,5,6 Giovanni Stevanin,1,2,3,4,6,11,* and Fre´de´ric Darios1,2,3,11,* Hereditary spastic paraplegias (HSPs) are clinically and genetically heterogeneous neurological conditions. Their main pathogenic mech- anisms are thought to involve alterations in endomembrane trafficking, mitochondrial function, and lipid metabolism. With a combi- nation of whole-genome mapping and exome sequencing, we identified three mutations in REEP2 in two families with HSP: a missense variant (c.107T>A [p.Val36Glu]) that segregated in the heterozygous state in a family with autosomal-dominant inheritance and a missense change (c.215T>A [p.Phe72Tyr]) that segregated in trans with a splice site mutation (c.105þ3G>T) in a family with auto- somal-recessive transmission. REEP2 belongs to a family of proteins that shape the endoplasmic reticulum, an organelle that was altered in fibroblasts from an affected subject.
    [Show full text]
  • Massive Sequencing of 70 Genes Reveals a Myriad of Missing Genes Or Mechanisms to Be Uncovered in Hereditary Spastic Paraplegias
    European Journal of Human Genetics (2017) 25, 1217–1228 Official journal of The European Society of Human Genetics www.nature.com/ejhg ARTICLE Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias Sara Morais1,2,3,4,5,6,7,8, Laure Raymond4,5,6,7,8, Mathilde Mairey4,5,6,7,8, Paula Coutinho1,2, Eva Brandão9, Paula Ribeiro9, José Leal Loureiro1,2,9, Jorge Sequeiros1,2,3, Alexis Brice4,5,6,7,10, Isabel Alonso*,1,2,3,11 and Giovanni Stevanin4,5,6,7,8,10,11 Hereditary spastic paraplegias (HSP) are neurodegenerative disorders characterized by lower limb spasticity and weakness that can be complicated by other neurological or non-neurological signs. Despite a high genetic heterogeneity (460 causative genes), 40–70% of the families remain without a molecular diagnosis. Analysis of one of the pioneer cohorts of 193 HSP families generated in the early 1990s in Portugal highlighted that SPAST and SPG11 are the most frequent diagnoses. We have now explored 98 unsolved families from this series using custom next generation sequencing panels analyzing up to 70 candidate HSP genes. We identified the likely disease-causing variant in 20 of the 98 families with KIF5A being the most frequently mutated gene. We also found 52 variants of unknown significance (VUS) in 38% of the cases. These new diagnoses resulted in 42% of solved cases in the full Portuguese cohort (81/193). Segregation of the variants was not always compatible with the presumed inheritance, indicating that the analysis of all HSP genes regardless of the inheritance mode can help to explain some cases.
    [Show full text]
  • Supplementary Table 1. Expression
    Supplementary Table 1. Expression (Mean Standard Deviation of the log2 average expression or transcript detection) of Sus scrofa specific miRNAs detected by the GeneChip™ miRNA 4.0 Array (ThermoFisher Scientific) in spermatozoa retrieved from the SRF of the ejaculate of healthy mature boars (n=3). The miRNA is designed to interrogate all mature miRNA sequences in miRBase v20. The array includes 30.424 mature miRNA (all organisms) and we select specifically the 326 Sus scrofa- specific miRNAs included in the array. Expression Mean ± Standard Deviation Sequence Transcript ID (log2) Accession Length Sequence ssc-miR-1285 13.98 ± 0.13 MIMAT0013954 24 CUGGGCAACAUAGCGAGACCCCGU ssc-miR-16 12.6 ± 0.74 MIMAT0007754 22 UAGCAGCACGUAAAUAUUGGCG ssc-miR-4332 12.32 ± 0.29 MIMAT0017962 20 CACGGCCGCCGCCGGGCGCC ssc-miR-92a 12.06 ± 0.09 MIMAT0013908 22 UAUUGCACUUGUCCCGGCCUGU ssc-miR-671-5p 11.73 ± 0.54 MIMAT0025381 24 AGGAAGCCCUGGAGGGGCUGGAGG ssc-miR-4334-5p 11.31 ± 0.05 MIMAT0017966 19 CCCUGGAGUGACGGGGGUG ssc-miR-425-5p 10.99 ± 0.15 MIMAT0013917 23 AAUGACACGAUCACUCCCGUUGA ssc-miR-191 10.57 ± 0.22 MIMAT0013876 23 CAACGGAAUCCCAAAAGCAGCUG ssc-miR-92b-5p 10.53 ± 0.18 MIMAT0017377 24 AGGGACGGGACGCGGUGCAGUGUU ssc-miR-15b 10.01 ± 0.9 MIMAT0002125 22 UAGCAGCACAUCAUGGUUUACA ssc-miR-30d 9.89 ± 0.36 MIMAT0013871 24 UGUAAACAUCCCCGACUGGAAGCU ssc-miR-26a 9.62 ± 0.47 MIMAT0002135 22 UUCAAGUAAUCCAGGAUAGGCU ssc-miR-484 9.55 ± 0.14 MIMAT0017974 20 CCCAGGGGGCGACCCAGGCU ssc-miR-103 9.53 ± 0.22 MIMAT0002154 23 AGCAGCAUUGUACAGGGCUAUGA ssc-miR-296-3p 9.41 ± 0.26 MIMAT0022958
    [Show full text]
  • Mitotic Checkpoints and Chromosome Instability Are Strong Predictors of Clinical Outcome in Gastrointestinal Stromal Tumors
    MITOTIC CHECKPOINTS AND CHROMOSOME INSTABILITY ARE STRONG PREDICTORS OF CLINICAL OUTCOME IN GASTROINTESTINAL STROMAL TUMORS. Pauline Lagarde1,2, Gaëlle Pérot1, Audrey Kauffmann3, Céline Brulard1, Valérie Dapremont2, Isabelle Hostein2, Agnès Neuville1,2, Agnieszka Wozniak4, Raf Sciot5, Patrick Schöffski4, Alain Aurias1,6, Jean-Michel Coindre1,2,7 Maria Debiec-Rychter8, Frédéric Chibon1,2. Supplemental data NM cases deletion frequency. frequency. deletion NM cases Mand between difference the highest setswith of theprobe a view isdetailed panel Bottom frequently. sorted totheless deleted theprobe are frequently from more and thefrequency deletion represent Yaxes inblue. are cases (NM) metastatic for non- frequencies Corresponding inmetastatic (red). probe (M)cases sets figureSupplementary 1: 100 100 20 40 60 80 20 40 60 80 0 0 chr14 1 chr14 88 chr14 175 chr14 262 chr9 -MTAP 349 chr9 -MTAP 436 523 chr9-CDKN2A 610 Histogram presenting the 2000 more frequently deleted deleted frequently the 2000 more presenting Histogram chr9-CDKN2A 697 chr9-CDKN2A 784 chr9-CDKN2B 871 chr9-CDKN2B 958 chr9-CDKN2B 1045 chr22 1132 chr22 1219 chr22 1306 chr22 1393 1480 1567 M NM 1654 1741 1828 1915 M NM GIST14 GIST2 GIST16 GIST3 GIST19 GIST63 GIST9 GIST38 GIST61 GIST39 GIST56 GIST37 GIST47 GIST58 GIST28 GIST5 GIST17 GIST57 GIST47 GIST58 GIST28 GIST5 GIST17 GIST57 CDKN2A Supplementary figure 2: Chromosome 9 genomic profiles of the 18 metastatic GISTs (upper panel). Deletions and gains are indicated in green and red, respectively; and color intensity is proportional to copy number changes. A detailed view is given (bottom panel) for the 6 cases presenting a homozygous 9p21 deletion targeting CDKN2A locus (dark green).
    [Show full text]