The Transcriptome of Pig Spermatozoa, and Its Role in Fertility
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
ACVR1 Antibody Cat
ACVR1 Antibody Cat. No.: 4791 Western blot analysis of ACVR1 in A549 cell lysate with ACVR1 antibody at 1 μg/mL in (A) the absence and (B) the presence of blocking peptide. Specifications HOST SPECIES: Rabbit SPECIES REACTIVITY: Human, Mouse HOMOLOGY: Predicted species reactivity based on immunogen sequence: Bovine: (100%), Rat: (93%) ACVR1 antibody was raised against a 14 amino acid synthetic peptide near the amino terminus of the human ACVR1. IMMUNOGEN: The immunogen is located within the first 50 amino acids of ACVR1. TESTED APPLICATIONS: ELISA, WB ACVR1 antibody can be used for detection of ACVR1 by Western blot at 1 μg/mL. APPLICATIONS: Antibody validated: Western Blot in human samples. All other applications and species not yet tested. At least four isoforms of ACVR1 are known to exist. This antibody is predicted to have no SPECIFICITY: cross-reactivity to ACVR1B or ACVR1C. POSITIVE CONTROL: 1) Cat. No. 1203 - A549 Cell Lysate Properties October 1, 2021 1 https://www.prosci-inc.com/acvr1-antibody-4791.html PURIFICATION: ACVR1 Antibody is affinity chromatography purified via peptide column. CLONALITY: Polyclonal ISOTYPE: IgG CONJUGATE: Unconjugated PHYSICAL STATE: Liquid BUFFER: ACVR1 Antibody is supplied in PBS containing 0.02% sodium azide. CONCENTRATION: 1 mg/mL ACVR1 antibody can be stored at 4˚C for three months and -20˚C, stable for up to one STORAGE CONDITIONS: year. As with all antibodies care should be taken to avoid repeated freeze thaw cycles. Antibodies should not be exposed to prolonged high temperatures. Additional Info OFFICIAL SYMBOL: ACVR1 ACVR1 Antibody: FOP, ALK2, SKR1, TSRI, ACTRI, ACVR1A, ACVRLK2, Activin receptor type-1, ALTERNATE NAMES: Activin receptor type I, ACTR-I ACCESSION NO.: NP_001096 PROTEIN GI NO.: 4501895 GENE ID: 90 USER NOTE: Optimal dilutions for each application to be determined by the researcher. -
Identification of the Binding Partners for Hspb2 and Cryab Reveals
Brigham Young University BYU ScholarsArchive Theses and Dissertations 2013-12-12 Identification of the Binding arP tners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non- Redundant Roles for Small Heat Shock Proteins Kelsey Murphey Langston Brigham Young University - Provo Follow this and additional works at: https://scholarsarchive.byu.edu/etd Part of the Microbiology Commons BYU ScholarsArchive Citation Langston, Kelsey Murphey, "Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins" (2013). Theses and Dissertations. 3822. https://scholarsarchive.byu.edu/etd/3822 This Thesis is brought to you for free and open access by BYU ScholarsArchive. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of BYU ScholarsArchive. For more information, please contact [email protected], [email protected]. Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston A thesis submitted to the faculty of Brigham Young University in partial fulfillment of the requirements for the degree of Master of Science Julianne H. Grose, Chair William R. McCleary Brian Poole Department of Microbiology and Molecular Biology Brigham Young University December 2013 Copyright © 2013 Kelsey Langston All Rights Reserved ABSTRACT Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactors and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston Department of Microbiology and Molecular Biology, BYU Master of Science Small Heat Shock Proteins (sHSP) are molecular chaperones that play protective roles in cell survival and have been shown to possess chaperone activity. -
Acinar Cell Apoptosis in Serpini2-Deficient Mice Models Pancreatic Insufficiency
Acinar Cell Apoptosis in Serpini2-Deficient Mice Models Pancreatic Insufficiency Stacie K. Loftus1*, Jennifer L. Cannons1, Arturo Incao1, Evgenia Pak1, Amy Chen1, Patricia M. Zerfas2, Mark A. Bryant2, Leslie G. Biesecker1, Pamela L. Schwartzberg1, William J. Pavan1 1 Genetic Disease Research Branch, National Human Genome Research Institute, National Institutes of Health, Bethesda, Maryland, United States of America, 2 Division of Veterinary Resources, Office of Research Services, National Institutes of Health, Bethesda, Maryland, United States of America Pancreatic insufficiency (PI) when left untreated results in a state of malnutrition due to an inability to absorb nutrients. Frequently, PI is diagnosed as part of a larger clinical presentation in cystic fibrosis or Shwachman–Diamond syndrome. In this study, a mouse model for isolated exocrine PI was identified in a mouse line generated by a transgene insertion. The trait is inherited in an autosomal recessive pattern, and homozygous animals are growth retarded, have abnormal immunity, and have reduced life span. Mice with the disease locus, named pequen˜o (pq), exhibit progressive apoptosis of pancreatic acinar cells with severe exocrine acinar cell loss by 8 wk of age, while the islets and ductal tissue persist. The mutation in pq/pq mice results from a random transgene insertion. Molecular characterization of the transgene insertion site by fluorescent in situ hybridization and genomic deletion mapping identified an approximately 210-kb deletion on Chromosome 3, deleting two genes. One of these genes, Serpini2, encodes a protein that is a member of the serpin family of protease inhibitors. Reintroduction of only the Serpini2 gene by bacterial artificial chromosome transgenic complementation corrected the acinar cell defect as well as body weight and immune phenotypes, showing that deletion of Serpini2 causes the pequen˜o phenotype. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Saracatinib Is an Efficacious Clinical Candidate for Fibrodysplasia Ossificans Progressiva
RESEARCH ARTICLE Saracatinib is an efficacious clinical candidate for fibrodysplasia ossificans progressiva Eleanor Williams,1 Jana Bagarova,2 Georgina Kerr,1 Dong-Dong Xia,2 Elsie S. Place,3 Devaveena Dey,2 Yue Shen,2 Geoffrey A. Bocobo,2 Agustin H. Mohedas,2 Xiuli Huang,4 Philip E. Sanderson,4 Arthur Lee,4 Wei Zheng,4 Aris N. Economides,5 James C. Smith,3 Paul B. Yu,2 and Alex N. Bullock1 1Centre for Medicines Discovery, University of Oxford, Oxford, United Kingdom. 2Department of Medicine, Cardiovascular Division, Brigham and Women’s Hospital, Harvard Medical School, Boston, Massachusetts, USA. 3Developmental Biology Laboratory, Francis Crick Institute, London, United Kingdom. 4National Center for Advancing Translational Sciences, NIH, Bethesda, Maryland, USA. 5Regeneron Pharmaceuticals Inc., Tarrytown, New York, USA. Currently, no effective therapies exist for fibrodysplasia ossificans progressiva (FOP), a rare congenital syndrome in which heterotopic bone is formed in soft tissues owing to dysregulated activity of the bone morphogenetic protein (BMP) receptor kinase ALK2 (also known as ACVR1). From a screen of known biologically active compounds, we identified saracatinib as a potent ALK2 kinase inhibitor. In enzymatic and cell-based assays, saracatinib preferentially inhibited ALK2, compared with other receptors of the BMP/TGF-β signaling pathway, and induced dorsalization in zebrafish embryos consistent with BMP antagonism. We further tested the efficacy of saracatinib using an inducible ACVR1Q207D-transgenic mouse line, which provides a model of heterotopic ossification (HO), as well as an inducible ACVR1R206H-knockin mouse, which serves as a genetically and physiologically faithful FOP model. In both models, saracatinib was well tolerated and potently inhibited the development of HO, even when administered transiently following soft tissue injury. -
ACVR1C Antibody Cat
ACVR1C Antibody Cat. No.: 4795 ACVR1C Antibody Specifications HOST SPECIES: Rabbit SPECIES REACTIVITY: Human, Mouse, Rat ACVR1C antibody was raised against a 15 amino acid synthetic peptide near the amino terminus of the human ACVR1C. IMMUNOGEN: The immunogen is located within amino acids 130 - 180 of ACVR1C. TESTED APPLICATIONS: ELISA, WB ACVR1C antibody can be used for detection of ACVR1C by Western blot at 1 and 2 μg/mL. APPLICATIONS: Antibody validated: Western Blot in human samples. All other applications and species not yet tested. SPECIFICITY: This antibody is predicted to have no cross-reactivity to ACVR1 or ACVR1B. POSITIVE CONTROL: 1) Cat. No. 1309 - Human Placenta Tissue Lysate Properties PURIFICATION: ACVR1C Antibody is affinity chromatography purified via peptide column. CLONALITY: Polyclonal September 25, 2021 1 https://www.prosci-inc.com/acvr1c-antibody-4795.html ISOTYPE: IgG CONJUGATE: Unconjugated PHYSICAL STATE: Liquid BUFFER: ACVR1C Antibody is supplied in PBS containing 0.02% sodium azide. CONCENTRATION: 1 mg/mL ACVR1C antibody can be stored at 4˚C for three months and -20˚C, stable for up to one STORAGE CONDITIONS: year. As with all antibodies care should be taken to avoid repeated freeze thaw cycles. Antibodies should not be exposed to prolonged high temperatures. Additional Info OFFICIAL SYMBOL: ACVR1 ACVR1C Antibody: FOP, ALK2, SKR1, TSRI, ACTRI, ACVR1A, ACVRLK2, Activin receptor ALTERNATE NAMES: type-1, Activin receptor type I, ACTR-I ACCESSION NO.: Q8NER5 PROTEIN GI NO.: 4501895 GENE ID: 90 USER NOTE: Optimal dilutions for each application to be determined by the researcher. Background and References ACVR1C Antibody: Activins are dimeric growth and differentiation factors which belong to the transforming growth factor-beta (TGF-beta) superfamily of structurally related signaling proteins. -
Human ALK-7 / ACVR1C Protein (ECD, Fc Tag)
Human ALK-7 / ACVR1C Protein (ECD, Fc Tag) Catalog Number: 10869-H02H General Information SDS-PAGE: Gene Name Synonym: ACVRLK7; ALK7 Protein Construction: A DNA sequence encoding the human ACVR1C (NP_660302.2) (Met1- Glu113) was expressed with the Fc region of human IgG1 at the C- terminus. Source: Human Expression Host: HEK293 Cells QC Testing Purity: > 95 % as determined by SDS-PAGE. Endotoxin: Protein Description < 1.0 EU per μg protein as determined by the LAL method. ALK-7, also known as ALK7 and ACVR1C, belongs to the ALK family. It is a type I receptor for the TGFB family of signaling molecules. TGF-β is the Stability: prototype of a protein superfamily which, in humans, contains at least 35 members, including activins, inhibins, bone morphogenetic proteins, Samples are stable for up to twelve months from date of receipt at -70 ℃ growth/differentiation factors, and Müllerian inhibiting substance. ALK-7 is a serine-threonine kinase that can cause the activation of one of the SMAD Predicted N terminal: Leu 22 signal transducers, SMAD2. ALK-7 has a ligand known as Nodal. Nodal Molecular Mass: stimulates the secretion of TIMP-1 and inhibits matrix metalloproteinases MMP-2 and MMP-9 activity. The overexpression of Nodal or constitutively The recombinant human ACVR1C consists 330 amino acids and predicts active ALK-7 decreases cell migration and invasion, whereas knock-down a molecular mass of 36.6 kDa. of Nodal and ALK-7 has the opposite effects. Formulation: References Lyophilized from sterile PBS, pH 7.4. 1.Lin YY, et al. (2012) Functional dissection of lysine deacetylases reveals that HDAC1 and p300 regulate AMPK. -
Downloaded from Bioscientifica.Com at 10/03/2021 07:38:50PM Via Free Access
229 3 <V>:<Iss> X ZHOU and others Gonadotrope-specific Bmpr1a 229229:3:3 331–341 Research knockout mice Normal gonadotropin production and fertility in gonadotrope- specific Bmpr1a knockout mice Xiang Zhou1,2, Ying Wang1,2, Luisina Ongaro1,2, Ulrich Boehm3, Vesa Kaartinen4, Yuji Mishina4 and Daniel J Bernard1,2 1Department of Pharmacology and Therapeutics, McGill University, Montreal, Québec, Canada 2Centre for Research in Reproduction and Development, McGill University, Montreal, Québec, Canada Correspondence 3Department of Pharmacology and Toxicology, University of Saarland School of Medicine, Homburg, Germany should be addressed 4Department of Biologic and Materials Sciences, School of Dentistry, University of Michigan, Ann Arbor, to D J Bernard Michigan, USA Email [email protected] Abstract Pituitary follicle-stimulating hormone (FSH) synthesis is regulated by transforming Key Words growth factor β superfamily ligands, most notably the activins and inhibins. Bone f pituitary morphogenetic proteins (BMPs) also regulate FSHβ subunit (Fshb) expression in f FSH immortalized murine gonadotrope-like LβT2 cells and in primary murine or ovine f bone morphogenetic Endocrinology primary pituitary cultures. BMP2 signals preferentially via the BMP type I receptor, protein of BMPR1A, to stimulate murine Fshb transcription in vitro. Here, we used a Cre–lox f activin receptor-like kinase approach to assess BMPR1A’s role in FSH synthesis in mice in vivo. Gonadotrope- Journal f Cre-lox specific Bmpr1a knockout animals developed normally and had reproductive organ weights comparable with those of controls. Knockouts were fertile, with normal serum gonadotropins and pituitary gonadotropin subunit mRNA expression. Cre-mediated recombination of the floxed Bmpr1a allele was efficient and specific, as indicated by PCR analysis of diverse tissues and isolated gonadotrope cells. -
Identification of Novel Chemotherapeutic Strategies For
www.nature.com/scientificreports OPEN Identification of novel chemotherapeutic strategies for metastatic uveal melanoma Received: 17 November 2016 Paolo Fagone1, Rosario Caltabiano2, Andrea Russo3, Gabriella Lupo1, Accepted: 09 February 2017 Carmelina Daniela Anfuso1, Maria Sofia Basile1, Antonio Longo3, Ferdinando Nicoletti1, Published: 17 March 2017 Rocco De Pasquale4, Massimo Libra1 & Michele Reibaldi3 Melanoma of the uveal tract accounts for approximately 5% of all melanomas and represents the most common primary intraocular malignancy. Despite improvements in diagnosis and more effective local therapies for primary cancer, the rate of metastatic death has not changed in the past forty years. In the present study, we made use of bioinformatics to analyze the data obtained from three public available microarray datasets on uveal melanoma in an attempt to identify novel putative chemotherapeutic options for the liver metastatic disease. We have first carried out a meta-analysis of publicly available whole-genome datasets, that included data from 132 patients, comparing metastatic vs. non metastatic uveal melanomas, in order to identify the most relevant genes characterizing the spreading of tumor to the liver. Subsequently, the L1000CDS2 web-based utility was used to predict small molecules and drugs targeting the metastatic uveal melanoma gene signature. The most promising drugs were found to be Cinnarizine, an anti-histaminic drug used for motion sickness, Digitoxigenin, a precursor of cardiac glycosides, and Clofazimine, a fat-soluble iminophenazine used in leprosy. In vitro and in vivo validation studies will be needed to confirm the efficacy of these molecules for the prevention and treatment of metastatic uveal melanoma. Uveal melanoma is the most common primary intraocular cancer, and after the skin, the uveal tract is the second most common location for melanoma1. -
Pi4k2a (BC022127) Mouse Tagged ORF Clone – MG207674 | Origene
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MG207674 Pi4k2a (BC022127) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Pi4k2a (BC022127) Mouse Tagged ORF Clone Tag: TurboGFP Symbol: Pi4k2a Synonyms: MGC37783, Pi4k2 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 Pi4k2a (BC022127) Mouse Tagged ORF Clone – MG207674 ORF Nucleotide >MG207674 representing BC022127 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGACGAGACGAGCCCGCTAGTGTCCCCCGAGCGGGCCCAACCCCCGGAGTACACCTTCCCGTCGGGCT CCGGAGCTCACTTTCCGCAAGTACCGGGGGGCGCGGTCCGCGTGGCGGCGGCGGCCGGCTCCGGCCCGTC ACCGCCGTGCTCGCCCGGCCACGACCGGGAGCGGCAGCCCCTGCTGGACCGGGCCCGGGGCGCGGCGGCG CAGGGCCAGACCCACACGGTGGCGGTGCAGGCCCAGGCCCTGGCCGCCCAGGCGGCCGTGGCGGCGCACG CCGTTCAGACCCACCGCGAGCGGAACGACTTCCCGGAGGACCCCGAGTTCGAGGTGGTGGTGCGGCAGGC CGAGGTTGCCATCGAGTGCAGCATCTATCCCGAGCGCATCTACCAGGGCTCCAGTGGAAGCTACTTCGTC AAGGACTCTCAGGGGAGAATCGTTGCTGTCTTCAAACCCAAGAATGAAGAGCCATATGGGCACCTTAACC CTAAGTGGACCAAGTGGCTGCAGAAGCTATGCTGCCCCTGCTGCTTCGGCCGAGACTGCCTTGTTCTCAA CCAGGGCTATCTCTCAGAGGCAGGGGCTAGCCTGGTGGACCAAAAACTGGAACTCAACATTGTACCACGT -
Mouse Models for Hereditary Spastic Paraplegia Uncover a Role Of
University of Dundee Mouse models for hereditary spastic paraplegia uncover a role of PI4K2A in autophagic lysosome reformation Khundadze, Mukhran; Ribaudo, Federico; Hussain, Adeela; Stahlberg, Henry; Brocke- Ahmadinejad, Nahal; Franzka, Patricia Published in: Autophagy DOI: 10.1080/15548627.2021.1891848 Publication date: 2021 Licence: CC BY Document Version Publisher's PDF, also known as Version of record Link to publication in Discovery Research Portal Citation for published version (APA): Khundadze, M., Ribaudo, F., Hussain, A., Stahlberg, H., Brocke-Ahmadinejad, N., Franzka, P., Varga, R-E., Zarkovic, M., Pungsrinont, T., Kokal, M., Ganley, I. G., Beetz, C., Sylvester, M., & Hübner, C. A. (2021). Mouse models for hereditary spastic paraplegia uncover a role of PI4K2A in autophagic lysosome reformation. Autophagy. https://doi.org/10.1080/15548627.2021.1891848 General rights Copyright and moral rights for the publications made accessible in Discovery Research Portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. • Users may download and print one copy of any publication from Discovery Research Portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain. • You may freely distribute the URL identifying the publication in the public portal. Take down policy If you believe that this document breaches -
Analysis of Dynamic Molecular Networks for Pancreatic Ductal
Pan et al. Cancer Cell Int (2018) 18:214 https://doi.org/10.1186/s12935-018-0718-5 Cancer Cell International PRIMARY RESEARCH Open Access Analysis of dynamic molecular networks for pancreatic ductal adenocarcinoma progression Zongfu Pan1†, Lu Li2†, Qilu Fang1, Yiwen Zhang1, Xiaoping Hu1, Yangyang Qian3 and Ping Huang1* Abstract Background: Pancreatic ductal adenocarcinoma (PDAC) is one of the deadliest solid tumors. The rapid progression of PDAC results in an advanced stage of patients when diagnosed. However, the dynamic molecular mechanism underlying PDAC progression remains far from clear. Methods: The microarray GSE62165 containing PDAC staging samples was obtained from Gene Expression Omnibus and the diferentially expressed genes (DEGs) between normal tissue and PDAC of diferent stages were profled using R software, respectively. The software program Short Time-series Expression Miner was applied to cluster, compare, and visualize gene expression diferences between PDAC stages. Then, function annotation and pathway enrichment of DEGs were conducted by Database for Annotation Visualization and Integrated Discovery. Further, the Cytoscape plugin DyNetViewer was applied to construct the dynamic protein–protein interaction networks and to analyze dif- ferent topological variation of nodes and clusters over time. The phosphosite markers of stage-specifc protein kinases were predicted by PhosphoSitePlus database. Moreover, survival analysis of candidate genes and pathways was per- formed by Kaplan–Meier plotter. Finally, candidate genes were validated by immunohistochemistry in PDAC tissues. Results: Compared with normal tissues, the total DEGs number for each PDAC stage were 994 (stage I), 967 (stage IIa), 965 (stage IIb), 1027 (stage III), 925 (stage IV), respectively. The stage-course gene expression analysis showed that 30 distinct expressional models were clustered.