Hereditary Spastic Paraplegia: from Genes, Cells and Networks to Novel Pathways for Drug Discovery
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Targeted Genes and Methodology Details for Neuromuscular Genetic Panels
Targeted Genes and Methodology Details for Neuromuscular Genetic Panels Reference transcripts based on build GRCh37 (hg19) interrogated by Neuromuscular Genetic Panels Next-generation sequencing (NGS) and/or Sanger sequencing is performed Motor Neuron Disease Panel to test for the presence of a mutation in these genes. Gene GenBank Accession Number Regions of homology, high GC-rich content, and repetitive sequences may ALS2 NM_020919 not provide accurate sequence. Therefore, all reported alterations detected ANG NM_001145 by NGS are confirmed by an independent reference method based on laboratory developed criteria. However, this does not rule out the possibility CHMP2B NM_014043 of a false-negative result in these regions. ERBB4 NM_005235 Sanger sequencing is used to confirm alterations detected by NGS when FIG4 NM_014845 appropriate.(Unpublished Mayo method) FUS NM_004960 HNRNPA1 NM_031157 OPTN NM_021980 PFN1 NM_005022 SETX NM_015046 SIGMAR1 NM_005866 SOD1 NM_000454 SQSTM1 NM_003900 TARDBP NM_007375 UBQLN2 NM_013444 VAPB NM_004738 VCP NM_007126 ©2018 Mayo Foundation for Medical Education and Research Page 1 of 14 MC4091-83rev1018 Muscular Dystrophy Panel Muscular Dystrophy Panel Gene GenBank Accession Number Gene GenBank Accession Number ACTA1 NM_001100 LMNA NM_170707 ANO5 NM_213599 LPIN1 NM_145693 B3GALNT2 NM_152490 MATR3 NM_199189 B4GAT1 NM_006876 MYH2 NM_017534 BAG3 NM_004281 MYH7 NM_000257 BIN1 NM_139343 MYOT NM_006790 BVES NM_007073 NEB NM_004543 CAPN3 NM_000070 PLEC NM_000445 CAV3 NM_033337 POMGNT1 NM_017739 CAVIN1 NM_012232 POMGNT2 -
NIH Public Access Author Manuscript Science
NIH Public Access Author Manuscript Science. Author manuscript; available in PMC 2014 September 08. NIH-PA Author ManuscriptPublished NIH-PA Author Manuscript in final edited NIH-PA Author Manuscript form as: Science. 2014 January 31; 343(6170): 506–511. doi:10.1126/science.1247363. Exome Sequencing Links Corticospinal Motor Neuron Disease to Common Neurodegenerative Disorders A full list of authors and affiliations appears at the end of the article. # These authors contributed equally to this work. Abstract Hereditary spastic paraplegias (HSPs) are neurodegenerative motor neuron diseases characterized by progressive age-dependent loss of corticospinal motor tract function. Although the genetic basis is partly understood, only a fraction of cases can receive a genetic diagnosis, and a global view of HSP is lacking. By using whole-exome sequencing in combination with network analysis, we identified 18 previously unknown putative HSP genes and validated nearly all of these genes functionally or genetically. The pathways highlighted by these mutations link HSP to cellular transport, nucleotide metabolism, and synapse and axon development. Network analysis revealed a host of further candidate genes, of which three were mutated in our cohort. Our analysis links HSP to other neurodegenerative disorders and can facilitate gene discovery and mechanistic understanding of disease. Hereditary spastic paraplegias (HSPs) are a group of genetically heterogeneous neurodegenerative disorders with prevalence between 3 and 10 per 100,000 individuals (1). Hallmark features are axonal degeneration and progressive lower limb spasticity resulting from a loss of corticospinal tract (CST) function. HSP is classified into two broad categories, uncomplicated and complicated, on the basis of the presence of additional clinical features such as intellectual disability, seizures, ataxia, peripheral neuropathy, skin abnormalities, and visual defects. -
HOOK3 Is a Scaffold for the Opposite-Polarity Microtubule-Based
bioRxiv preprint doi: https://doi.org/10.1101/508887; this version posted December 31, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. HOOK3 is a scaffold for the opposite-polarity microtubule-based motors cytoplasmic dynein and KIF1C Agnieszka A. Kendrick1, William B. Redwine1,2†, Phuoc Tien Tran1‡, Laura Pontano Vaites2, Monika Dzieciatkowska4, J. Wade Harper2, and Samara L. Reck-Peterson1,3,5 1Department of Cellular and Molecular Medicine, University of California San Diego, La Jolla, CA, 92093. 2 Department of Cell Biology, Harvard Medical School, Boston, MA 02115. 3Section of Cell and Developmental Biology, Division of Biological Sciences, University of California San Diego, La Jolla, CA 92093. 4Department of Biochemistry and Molecular Genetics, University of Colorado Denver, Aurora, CO 80045. 5Howard Hughes Medical Institute †Present address: Stowers Institute for Medical Research, Kansas City, MO 64110 ‡Present address: Department of Molecular and Cellular Biology, Harvard University, Cambridge, MA 02138. *Correspondence to: Samara Reck-Peterson 9500 Gilman Drive, Leichtag 482 La Jolla CA, 92093 [email protected]; https://orcid.org/0000-0002-1553-465X 1 bioRxiv preprint doi: https://doi.org/10.1101/508887; this version posted December 31, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. -
The N-Cadherin Interactome in Primary Cardiomyocytes As Defined Using Quantitative Proximity Proteomics Yang Li1,*, Chelsea D
© 2019. Published by The Company of Biologists Ltd | Journal of Cell Science (2019) 132, jcs221606. doi:10.1242/jcs.221606 TOOLS AND RESOURCES The N-cadherin interactome in primary cardiomyocytes as defined using quantitative proximity proteomics Yang Li1,*, Chelsea D. Merkel1,*, Xuemei Zeng2, Jonathon A. Heier1, Pamela S. Cantrell2, Mai Sun2, Donna B. Stolz1, Simon C. Watkins1, Nathan A. Yates1,2,3 and Adam V. Kwiatkowski1,‡ ABSTRACT requires multiple adhesion, cytoskeletal and signaling proteins, The junctional complexes that couple cardiomyocytes must transmit and mutations in these proteins can cause cardiomyopathies (Ehler, the mechanical forces of contraction while maintaining adhesive 2018). However, the molecular composition of ICD junctional homeostasis. The adherens junction (AJ) connects the actomyosin complexes remains poorly defined. – networks of neighboring cardiomyocytes and is required for proper The core of the AJ is the cadherin catenin complex (Halbleib and heart function. Yet little is known about the molecular composition of the Nelson, 2006; Ratheesh and Yap, 2012). Classical cadherins are cardiomyocyte AJ or how it is organized to function under mechanical single-pass transmembrane proteins with an extracellular domain that load. Here, we define the architecture, dynamics and proteome of mediates calcium-dependent homotypic interactions. The adhesive the cardiomyocyte AJ. Mouse neonatal cardiomyocytes assemble properties of classical cadherins are driven by the recruitment of stable AJs along intercellular contacts with organizational and cytosolic catenin proteins to the cadherin tail, with p120-catenin β structural hallmarks similar to mature contacts. We combine (CTNND1) binding to the juxta-membrane domain and -catenin β quantitative mass spectrometry with proximity labeling to identify the (CTNNB1) binding to the distal part of the tail. -
Seq2pathway Vignette
seq2pathway Vignette Bin Wang, Xinan Holly Yang, Arjun Kinstlick May 19, 2021 Contents 1 Abstract 1 2 Package Installation 2 3 runseq2pathway 2 4 Two main functions 3 4.1 seq2gene . .3 4.1.1 seq2gene flowchart . .3 4.1.2 runseq2gene inputs/parameters . .5 4.1.3 runseq2gene outputs . .8 4.2 gene2pathway . 10 4.2.1 gene2pathway flowchart . 11 4.2.2 gene2pathway test inputs/parameters . 11 4.2.3 gene2pathway test outputs . 12 5 Examples 13 5.1 ChIP-seq data analysis . 13 5.1.1 Map ChIP-seq enriched peaks to genes using runseq2gene .................... 13 5.1.2 Discover enriched GO terms using gene2pathway_test with gene scores . 15 5.1.3 Discover enriched GO terms using Fisher's Exact test without gene scores . 17 5.1.4 Add description for genes . 20 5.2 RNA-seq data analysis . 20 6 R environment session 23 1 Abstract Seq2pathway is a novel computational tool to analyze functional gene-sets (including signaling pathways) using variable next-generation sequencing data[1]. Integral to this tool are the \seq2gene" and \gene2pathway" components in series that infer a quantitative pathway-level profile for each sample. The seq2gene function assigns phenotype-associated significance of genomic regions to gene-level scores, where the significance could be p-values of SNPs or point mutations, protein-binding affinity, or transcriptional expression level. The seq2gene function has the feasibility to assign non-exon regions to a range of neighboring genes besides the nearest one, thus facilitating the study of functional non-coding elements[2]. Then the gene2pathway summarizes gene-level measurements to pathway-level scores, comparing the quantity of significance for gene members within a pathway with those outside a pathway. -
Product Datasheet KIF1C Antibody NB100-57510
Product Datasheet KIF1C Antibody NB100-57510 Unit Size: 0.1 ml Store at 4C. Do not freeze. Reviews: 1 Publications: 1 Protocols, Publications, Related Products, Reviews, Research Tools and Images at: www.novusbio.com/NB100-57510 Updated 3/16/2021 v.20.1 Earn rewards for product reviews and publications. Submit a publication at www.novusbio.com/publications Submit a review at www.novusbio.com/reviews/destination/NB100-57510 Page 1 of 3 v.20.1 Updated 3/16/2021 NB100-57510 KIF1C Antibody Product Information Unit Size 0.1 ml Concentration 0.2 mg/ml Storage Store at 4C. Do not freeze. Clonality Polyclonal Preservative 0.09% Sodium Azide Isotype IgG Purity Immunogen affinity purified Buffer TBS and 0.1% BSA Product Description Host Rabbit Gene ID 10749 Gene Symbol KIF1C Species Human, Mouse Immunogen The immunogen recognized by this antibody maps to a region between residue 1053 and the C-terminus (residue 1103) of human kinesin family member 1C (lethal toxin sensitivity 1) using the numbering given in entry NP_006603.2 (GeneID 10749). Product Application Details Applications Western Blot, Immunoprecipitation Recommended Dilutions Western Blot 1:2000-1:10000, Immunoprecipitation 2 - 5 ug/mg lysate Page 2 of 3 v.20.1 Updated 3/16/2021 Images Western Blot: KIF1C Antibody [NB100-57510] - KIF1C is a novel HOOK3 -interacting protein.sfGFP-3xFLAG and full length (FL) HOOK3, HOOK3 (1-552), and HOOK3 (553-718) all tagged with sfGFP and 3xFLAG were immunoprecipitated with alpha-FLAG antibodies from transiently transfected HEK-293T cells. Western blots with alpha-HC, alpha- FAM160A2, alpha-KIF1C, and alpha-FLAG antibodies were used to determine which proteins co-immunoprecipitated with each HOOK3 construct.DOI:http://dx.doi.org/10.7554/eLife.28257.015 Image collected and cropped by CiteAb from the following publication (https://elifesciences.org/articles/28257), licensed under a CC-BY licence. -
WO 2Ull/13162O Al
(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date Χ 1 / A 1 27 October 2011 (27.10.2011) WO 2Ull/13162o Al (51) International Patent Classification: AO, AT, AU, AZ, BA, BB, BG, BH, BR, BW, BY, BZ, C12N 9/02 (2006.01) A61K 38/44 (2006.01) CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, DO, A61K 38/17 (2006.01) DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KM, KN, KP, (21) International Application Number: KR, KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, PCT/EP20 11/056142 ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, (22) International Filing Date: NO, NZ, OM, PE, PG, PH, PL, PT, RO, RS, RU, SC, SD, 18 April 201 1 (18.04.201 1) SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every (26) Publication Langi English kind of regional protection available): ARIPO (BW, GH, (30) Priority Data: GM, KE, LR, LS, MW, MZ, NA, SD, SL, SZ, TZ, UG, 10160368.6 19 April 2010 (19.04.2010) EP ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, (71) Applicants (for all designated States except US): MEDI- EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, FT, LT, LU, ZINISCHE UNIVERSITAT INNSBRUCK [AT/AT]; LV, MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, Christoph-Probst-Platz, Innrain 52, A-6020 Innsbruck SM, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, (AT). -
ARCHAEAL EVOLUTION Evolutionary Insights from the Vikings
RESEARCH HIGHLIGHTS Nature Reviews Microbiology | Published online 16 Jan 2017; doi:10.1038/nrmicro.2016.198 ARCHAEAL EVOLUTION Evolutionary insights from the Vikings The emergence of the eukaryotic cell ASGARD — after the invisible the closest known homologue of during evolution gave rise to all com- ‘Gods of Asgard’ in Norse mythology. eukaryotic epsilon DNA polymerases primordial plex life forms on Earth, including The superphylum consists of the identified thus far. eukaryotic multicellular organisms such as ani- previously identified Lokiarchaeota Members of the ASGARD super- mals, plants and fungi. However, the and Thorarchaeota phyla, and the phylum were particularly enriched vesicular and origin of eukaryotes and their char- newly identified Odinarchaeota and for eukaryotic signature proteins trafficking acteristic structural complexity has Heimdallarchaeota phyla. Using that are involved in intracellular components remained a mystery. The most recent phylogenomics, they discovered trafficking and secretion. Several are derived insights into eukaryogenesis support a strong phylogenetic association proteins contained domain signatures the endosymbiotic theory, which between ASGARD lineages and of eukaryotic transport protein from our proposes that the first eukaryotic eukaryotes that placed the eukaryote particle (TRAPP) complexes, which archaeal cell arose from archaea through the lineage in close proximity to the are involved in transport from the ancestor acquisition of an alphaproteobacterial ASGARD superphylum. endoplasmic -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Genome-Wide Parent-Of-Origin DNA Methylation Analysis Reveals The
Downloaded from genome.cshlp.org on September 25, 2021 - Published by Cold Spring Harbor Laboratory Press Research Genome-wide parent-of-origin DNA methylation analysis reveals the intricacies of human imprinting and suggests a germline methylation-independent mechanism of establishment Franck Court,1,15 Chiharu Tayama,2,15 Valeria Romanelli,1,15 Alex Martin-Trujillo,1,15 Isabel Iglesias-Platas,3 Kohji Okamura,4 Naoko Sugahara,2 Carlos Simo´n,5 Harry Moore,6 Julie V. Harness,7 Hans Keirstead,7 Jose Vicente Sanchez-Mut,8 Eisuke Kaneki,9 Pablo Lapunzina,10 Hidenobu Soejima,11 Norio Wake,9 Manel Esteller,8,12,13 Tsutomu Ogata,14 Kenichiro Hata,2 Kazuhiko Nakabayashi,2,16,17 and David Monk1,16,17 1–14[Author affiliations appear at the end of the paper.] Differential methylation between the two alleles of a gene has been observed in imprinted regions, where the methylation of one allele occurs on a parent-of-origin basis, the inactive X-chromosome in females, and at those loci whose methylation is driven by genetic variants. We have extensively characterized imprinted methylation in a substantial range of normal human tissues, reciprocal genome-wide uniparental disomies, and hydatidiform moles, using a combination of whole- genome bisulfite sequencing and high-density methylation microarrays. This approach allowed us to define methylation profiles at known imprinted domains at base-pair resolution, as well as to identify 21 novel loci harboring parent-of-origin methylation, 15 of which are restricted to the placenta. We observe that the extent of imprinted differentially methylated regions (DMRs) is extremely similar between tissues, with the exception of the placenta. -
Conserved and Novel Properties of Clathrin-Mediated Endocytosis in Dictyostelium Discoideum" (2012)
Rockefeller University Digital Commons @ RU Student Theses and Dissertations 2012 Conserved and Novel Properties of Clathrin- Mediated Endocytosis in Dictyostelium Discoideum Laura Macro Follow this and additional works at: http://digitalcommons.rockefeller.edu/ student_theses_and_dissertations Part of the Life Sciences Commons Recommended Citation Macro, Laura, "Conserved and Novel Properties of Clathrin-Mediated Endocytosis in Dictyostelium Discoideum" (2012). Student Theses and Dissertations. Paper 163. This Thesis is brought to you for free and open access by Digital Commons @ RU. It has been accepted for inclusion in Student Theses and Dissertations by an authorized administrator of Digital Commons @ RU. For more information, please contact [email protected]. CONSERVED AND NOVEL PROPERTIES OF CLATHRIN- MEDIATED ENDOCYTOSIS IN DICTYOSTELIUM DISCOIDEUM A Thesis Presented to the Faculty of The Rockefeller University in Partial Fulfillment of the Requirements for the degree of Doctor of Philosophy by Laura Macro June 2012 © Copyright by Laura Macro 2012 CONSERVED AND NOVEL PROPERTIES OF CLATHRIN- MEDIATED ENDOCYTOSIS IN DICTYOSTELIUM DISCOIDEUM Laura Macro, Ph.D. The Rockefeller University 2012 The protein clathrin mediates one of the major pathways of endocytosis from the extracellular milieu and plasma membrane. Clathrin functions with a network of interacting accessory proteins, one of which is the adaptor complex AP-2, to co-ordinate vesicle formation. Disruption of genes involved in clathrin-mediated endocytosis causes embryonic lethality in multicellular animals suggesting that clathrin-mediated endocytosis is a fundamental cellular process. However, loss of clathrin-mediated endocytosis genes in single cell eukaryotes, such as S.cerevisiae (yeast), does not cause lethality, suggesting that clathrin may convey specific advantages for multicellularity.