Downloaded from Bioscientifica.Com at 09/26/2021 09:08:04PM Via Free Access
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Supplemental Table S1
Entrez Gene Symbol Gene Name Affymetrix EST Glomchip SAGE Stanford Literature HPA confirmed Gene ID Profiling profiling Profiling Profiling array profiling confirmed 1 2 A2M alpha-2-macroglobulin 0 0 0 1 0 2 10347 ABCA7 ATP-binding cassette, sub-family A (ABC1), member 7 1 0 0 0 0 3 10350 ABCA9 ATP-binding cassette, sub-family A (ABC1), member 9 1 0 0 0 0 4 10057 ABCC5 ATP-binding cassette, sub-family C (CFTR/MRP), member 5 1 0 0 0 0 5 10060 ABCC9 ATP-binding cassette, sub-family C (CFTR/MRP), member 9 1 0 0 0 0 6 79575 ABHD8 abhydrolase domain containing 8 1 0 0 0 0 7 51225 ABI3 ABI gene family, member 3 1 0 1 0 0 8 29 ABR active BCR-related gene 1 0 0 0 0 9 25841 ABTB2 ankyrin repeat and BTB (POZ) domain containing 2 1 0 1 0 0 10 30 ACAA1 acetyl-Coenzyme A acyltransferase 1 (peroxisomal 3-oxoacyl-Coenzyme A thiol 0 1 0 0 0 11 43 ACHE acetylcholinesterase (Yt blood group) 1 0 0 0 0 12 58 ACTA1 actin, alpha 1, skeletal muscle 0 1 0 0 0 13 60 ACTB actin, beta 01000 1 14 71 ACTG1 actin, gamma 1 0 1 0 0 0 15 81 ACTN4 actinin, alpha 4 0 0 1 1 1 10700177 16 10096 ACTR3 ARP3 actin-related protein 3 homolog (yeast) 0 1 0 0 0 17 94 ACVRL1 activin A receptor type II-like 1 1 0 1 0 0 18 8038 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 1 0 0 0 0 19 8751 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 1 0 0 0 0 20 8728 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 1 0 0 0 0 21 81792 ADAMTS12 ADAM metallopeptidase with thrombospondin type 1 motif, 12 1 0 0 0 0 22 9507 ADAMTS4 ADAM metallopeptidase with thrombospondin type 1 -
TMEM50A Shrna (M) Lentiviral Particles: Sc-154474-V
SANTA CRUZ BIOTECHNOLOGY, INC. TMEM50A shRNA (m) Lentiviral Particles: sc-154474-V BACKGROUND PRODUCT TMEM50A (transmembrane protein 50A), also known as small membrane pro- TMEM50A shRNA (m) Lentiviral Particles is a pool of concentrated, trans- tein 1, is a 157 amino acid protein encoded by a gene mapping to human duction-ready viral particles containing 3 target-specific constructs that chromosome 1. Chromosome 1 is the largest human chromosome spanning encode 19-25 nt (plus hairpin) shRNA designed to knock down gene expres- about 260 million base pairs and making up 8% of the human genome. There sion. Each vial contains 200 µl frozen stock containing 1.0 x 106 infectious are about 3,000 genes on chromosome 1, and considering the great number units of virus (IFU) in Dulbecco’s Modified Eagle’s Medium with 25 mM of genes there are also a large number of diseases associated with chromo- HEPES pH 7.3. Suitable for 10-20 transductions. Also see TMEM50A some 1. Notably, the rare aging disease Hutchinson-Gilford progeria is asso- siRNA (m): sc-154474 and TMEM50A shRNA Plasmid (m): sc-154474-SH as ciated with the LMNA gene which encodes Lamin A. When defective, the alternate gene silencing products. LMNA gene product can build up in the nucleus and cause characteristic nuclear blebs. The mechanism of rapidly enhanced aging is unclear and is APPLICATIONS a topic of continuing exploration. The MUTYH gene is located on chromo- TMEM50A shRNA (m) Lentiviral Particles is recommended for the inhibition some 1 and is partially responsible for familial adenomatous polyposis. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Multivariate Meta-Analysis of Differential Principal Components Underlying Human Primed and Naive-Like Pluripotent States
bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347666; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. This article is a US Government work. It is not subject to copyright under 17 USC 105 and is also made available for use under a CC0 license. October 20, 2020 To: bioRxiv Multivariate Meta-Analysis of Differential Principal Components underlying Human Primed and Naive-like Pluripotent States Kory R. Johnson1*, Barbara S. Mallon2, Yang C. Fann1, and Kevin G. Chen2*, 1Intramural IT and Bioinformatics Program, 2NIH Stem Cell Unit, National Institute of Neurological Disorders and Stroke, National Institutes of Health, Bethesda, Maryland 20892, USA Keywords: human pluripotent stem cells; naive pluripotency, meta-analysis, principal component analysis, t-SNE, consensus clustering *Correspondence to: Dr. Kory R. Johnson ([email protected]) Dr. Kevin G. Chen ([email protected]) 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347666; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. This article is a US Government work. It is not subject to copyright under 17 USC 105 and is also made available for use under a CC0 license. ABSTRACT The ground or naive pluripotent state of human pluripotent stem cells (hPSCs), which was initially established in mouse embryonic stem cells (mESCs), is an emerging and tentative concept. To verify this important concept in hPSCs, we performed a multivariate meta-analysis of major hPSC datasets via the combined analytic powers of percentile normalization, principal component analysis (PCA), t-distributed stochastic neighbor embedding (t-SNE), and SC3 consensus clustering. -
4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4). -
A Bayesian Approach to Mediation Analysis Predicts 206 Causal Target Genes in Alzheimer’S Disease
bioRxiv preprint first posted online Nov. 14, 2017; doi: http://dx.doi.org/10.1101/219428. The copyright holder for this preprint (which was not peer-reviewed) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Title A Bayesian approach to mediation analysis predicts 206 causal target genes in Alzheimer’s disease Authors Yongjin Park+;1;2, Abhishek K Sarkar+;3, Liang He+;1;2, Jose Davila-Velderrain1;2, Philip L De Jager2;4, Manolis Kellis1;2 +: equal contribution. 1: Computer Science and Artificial Intelligence Laboratory, Massachusetts Institute of Technology, Cambridge, MA, USA 2: Broad Institute of MIT and Harvard, Cambridge, MA, USA 3: Department of Human Genetics, University of Chicago, Chicago, IL, USA 4: Department of Neurology, Columbia University Medical Center, New York, NY, USA MK: [email protected] Abstract Characterizing the intermediate phenotypes, such as gene expression, that mediate genetic effects on complex dis- eases is a fundamental problem in human genetics. Existing methods utilize genotypic data and summary statistics to identify putative disease genes, but cannot distinguish pleiotropy from causal mediation and are limited by overly strong assumptions about the data. To overcome these limitations, we develop Causal Multivariate Mediation within Extended Linkage disequilibrium (CaMMEL), a novel Bayesian inference framework to jointly model multiple medi- ated and unmediated effects relying only on summary statistics. We show in simulation that CaMMEL accurately distinguishes between mediating and pleiotropic genes unlike existing methods. We applied CaMMEL to Alzheimer’s disease (AD) and found 206 causal genes in sub-threshold loci (p < 10−4). -
Chloride Channels Regulate Differentiation and Barrier Functions
RESEARCH ARTICLE Chloride channels regulate differentiation and barrier functions of the mammalian airway Mu He1†*, Bing Wu2†, Wenlei Ye1, Daniel D Le2, Adriane W Sinclair3,4, Valeria Padovano5, Yuzhang Chen6, Ke-Xin Li1, Rene Sit2, Michelle Tan2, Michael J Caplan5, Norma Neff2, Yuh Nung Jan1,7,8, Spyros Darmanis2*, Lily Yeh Jan1,7,8* 1Department of Physiology, University of California, San Francisco, San Francisco, United States; 2Chan Zuckerberg Biohub, San Francisco, United States; 3Department of Urology, University of California, San Francisco, San Francisco, United States; 4Division of Pediatric Urology, University of California, San Francisco, Benioff Children’s Hospital, San Francisco, United States; 5Department of Cellular and Molecular Physiology, Yale University School of Medicine, New Heaven, United States; 6Department of Anesthesia and Perioperative Care, University of California, San Francisco, San Francisco, United States; 7Department of Biochemistry and Biophysics, University of California, San Francisco, San Francisco, United States; 8Howard Hughes Medical Institute, University of California, San Francisco, San Francisco, United States *For correspondence: Abstract The conducting airway forms a protective mucosal barrier and is the primary target of [email protected] (MH); [email protected] airway disorders. The molecular events required for the formation and function of the airway (SD); mucosal barrier, as well as the mechanisms by which barrier dysfunction leads to early onset airway [email protected] (LYJ) diseases, -
Chicken Linkage Disequilibrium Is Much More Complex Over Much Longer Distance Than Previously Appreciated
Look Over the Horizon - Chicken Linkage Disequilibrium is Much More Complex Over Much Longer Distance than Previously Appreciated Ehud Lipkin ( [email protected] ) Hebrew University of Jerusalem Janet E. Fulton Hy-Line (United States) Jacqueline Smith University of Edinburgh David W. Burt University of Edinburgh Morris Soller Hebrew University of Jerusalem Research Article Keywords: Chicken, long-range linkage disequilibrium, QTL, F6, LD blocks Posted Date: June 17th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-598396/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/23 Abstract Background Appreciable Linkage Disequilibrium (LD) is commonly found between pairs of loci close to one another, decreasing rapidly with distance between the loci. This provides the basis studies to map Quantitative Trait Loci Regions (QTLRs), where it is custom to assume that the closest sites to a signicant markers are the prime candidate to be the causative mutation. Nevertheless, Long-Range LD (LRLD) can also be found among well-separated sites. LD blocks are runs of genomic sites all having appreciable LD with one another. High LD and LRLD are often separated by genomic sites with which they have practically no LD. Thus, not only can LD be found among distant loci, but also its pattern may be complex, comprised of fragmented blocks. Here, chicken LRLD and LD blocks, and their relationship with previously described Marek’s Disease (MD) QTLRs, were studied in an F6 population from a full-sib advanced intercross line, and in eight commercial pure layer lines. -
Literature Mining Sustains and Enhances Knowledge Discovery from Omic Studies
LITERATURE MINING SUSTAINS AND ENHANCES KNOWLEDGE DISCOVERY FROM OMIC STUDIES by Rick Matthew Jordan B.S. Biology, University of Pittsburgh, 1996 M.S. Molecular Biology/Biotechnology, East Carolina University, 2001 M.S. Biomedical Informatics, University of Pittsburgh, 2005 Submitted to the Graduate Faculty of School of Medicine in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Pittsburgh 2016 UNIVERSITY OF PITTSBURGH SCHOOL OF MEDICINE This dissertation was presented by Rick Matthew Jordan It was defended on December 2, 2015 and approved by Shyam Visweswaran, M.D., Ph.D., Associate Professor Rebecca Jacobson, M.D., M.S., Professor Songjian Lu, Ph.D., Assistant Professor Dissertation Advisor: Vanathi Gopalakrishnan, Ph.D., Associate Professor ii Copyright © by Rick Matthew Jordan 2016 iii LITERATURE MINING SUSTAINS AND ENHANCES KNOWLEDGE DISCOVERY FROM OMIC STUDIES Rick Matthew Jordan, M.S. University of Pittsburgh, 2016 Genomic, proteomic and other experimentally generated data from studies of biological systems aiming to discover disease biomarkers are currently analyzed without sufficient supporting evidence from the literature due to complexities associated with automated processing. Extracting prior knowledge about markers associated with biological sample types and disease states from the literature is tedious, and little research has been performed to understand how to use this knowledge to inform the generation of classification models from ‘omic’ data. Using pathway analysis methods to better understand the underlying biology of complex diseases such as breast and lung cancers is state-of-the-art. However, the problem of how to combine literature- mining evidence with pathway analysis evidence is an open problem in biomedical informatics research. -
Mouse Dppa3 Conditional Knockout Project (CRISPR/Cas9)
https://www.alphaknockout.com Mouse Dppa3 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Dppa3 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Dppa3 gene (NCBI Reference Sequence: NM_139218 ; Ensembl: ENSMUSG00000046323 ) is located on Mouse chromosome 6. 4 exons are identified, with the ATG start codon in exon 1 and the TAG stop codon in exon 4 (Transcript: ENSMUST00000049644). Exon 2 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Dppa3 gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP24-68I7 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Female mice homozygous for a disruption in this gene are infertile or have reduced fertility due to a failure in embryonic development at or before implantation. Exon 2 starts from about 19.78% of the coding region. The knockout of Exon 2 will result in frameshift of the gene. The size of intron 1 for 5'-loxP site insertion: 1966 bp, and the size of intron 2 for 3'-loxP site insertion: 491 bp. The size of effective cKO region: ~728 bp. The cKO region does not have any other known gene. Page 1 of 7 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele gRNA region 5' gRNA region 3' 1 2 3 4 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Homology arm Exon of mouse Dppa3 cKO region loxP site Page 2 of 7 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats. -
WO 2012/174282 A2 20 December 2012 (20.12.2012) P O P C T
(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2012/174282 A2 20 December 2012 (20.12.2012) P O P C T (51) International Patent Classification: David [US/US]; 13539 N . 95th Way, Scottsdale, AZ C12Q 1/68 (2006.01) 85260 (US). (21) International Application Number: (74) Agent: AKHAVAN, Ramin; Caris Science, Inc., 6655 N . PCT/US20 12/0425 19 Macarthur Blvd., Irving, TX 75039 (US). (22) International Filing Date: (81) Designated States (unless otherwise indicated, for every 14 June 2012 (14.06.2012) kind of national protection available): AE, AG, AL, AM, AO, AT, AU, AZ, BA, BB, BG, BH, BR, BW, BY, BZ, English (25) Filing Language: CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, DO, Publication Language: English DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KM, KN, KP, KR, (30) Priority Data: KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, ME, 61/497,895 16 June 201 1 (16.06.201 1) US MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, 61/499,138 20 June 201 1 (20.06.201 1) US OM, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SC, SD, 61/501,680 27 June 201 1 (27.06.201 1) u s SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, 61/506,019 8 July 201 1(08.07.201 1) u s TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. -
Supplementary Tables S1-S3
Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse)