DOCSLIB.ORG

Egr3-Dependent Muscle Spindle Stretch Receptor Intrafusal Muscle Fiber Differentiation and Fusimotor Innervation Homeostasis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Egr3-Dependent Muscle Spindle Stretch Receptor Intrafusal Muscle Fiber Differentiation and Fusimotor Innervation Homeostasis 5566 • The Journal of Neuroscience, April 8, 2015 • 35(14):5566–5578 Development/Plasticity/Repair Egr3-Dependent Muscle Spindle Stretch Receptor Intrafusal Muscle Fiber Differentiation and Fusimotor Innervation Homeostasis Michelle Oliveira Fernandes1,3 and Warren G. Tourtellotte1,2,3 1Department of Pathology (Division of Neuropathology), 2Department of Neurology, and 3Northwestern University Driskill Graduate Program, Feinberg School of Medicine, Northwestern University, Chicago, Illinois 60611 Muscle stretch proprioceptors (muscle spindles) are required for stretch reflexes and locomotor control. Proprioception abnormalities are observed in many human neuropathies, but the mechanisms involved in establishing and maintaining muscle spindle innervation and function are still poorly understood. During skeletal muscle development, sensory (Ia-afferent) innervation induces contacted myotubes to transform into intrafusal muscle fibers that form the stretch receptor core. The transcriptional regulator Egr3 is induced in Ia-afferent contacted myotubes by Neuregulin1 (Nrg1)/ErbB receptor signaling and it has an essential role in spindle morphogenesis and function. Because Egr3 is widely expressed during development and has a pleiotropic function, whether Egr3 functions primarily in skeletal muscle, Ia-afferent neurons, or in SchwanncellsthatmyelinateIa-afferentaxonsremainsunresolved.Inthepresentstudies,cell-specificablationofEgr3inmiceshowedthatithas a skeletal muscle autonomous function in stretch receptor development. Moreover, using genetic tracing, we found that Ia-afferent contacted Egr3-deficientmyotubeswereinducedinnormalnumbers,buttheirdevelopmentwasblockedtogenerateonetotwoshortenedfibersthatfailed to express some characteristic myosin heavy chain (MyHC) proteins. These “spindle remnants” persisted into adulthood, remained innervated by Ia-afferents, and expressed neurotrophin3 (NT3), which is required for Ia-afferent neuron survival. However, they were not innervated by fusimotor axons and they did not express glial derived neurotrophic factor (GDNF), which is essential for fusimotor neuron survival. These results demonstrate that Egr3 has an essential role in regulating gene expression that promotes normal intrafusal muscle fiber differentiation and fusimotor innervation homeostasis. Key words: Egr3; GDNF; intrafusal muscle fiber; muscle spindle; NT3; proprioception Introduction gene expression that drives spindle morphogenesis (Andrechek Muscle spindles are stretch-sensitive mechanoreceptors embed- et al., 2002; Hippenmeyer et al., 2002; Leu et al., 2003). Although ded within skeletal muscles that mediate limb and axial body downstream gene regulation engaged by Nrg1/ErbB signaling in position sensation (proprioception), the myotatic stretch reflex Ia-afferent contacted myotubes is only partially characterized, it and locomotor patterning (Poppele and Terzuolo, 1968; Good- induces spindle development and stretch reflex morphogenetic win et al., 1972; Akay et al., 2014). Spindles consist of encapsu- programs, in part by upregulating transcriptional regulators such lated intrafusal muscle fibers that are innervated by specialized as Egr3, ER81, Pea3, and Erm (Tourtellotte and Milbrandt, 1998; group Ia-afferents that relay muscle stretch sensation to the CNS Arber et al., 2000; Hippenmeyer et al., 2002; Jacobson et al., and fusimotor efferents that maintain spindle stretch sensitivity 2004). In addition, developing intrafusal muscle fibers upregu- as muscles stretch and contract. During skeletal muscle develop- late retrograde feedback signaling mediators that are essential for ment, Ia-afferents make contact with myotubes and release Neu- normal proprioceptive neuron survival and innervation, such as regulin1 (Nrg1) to engage myotube ErbB2/B4 receptor-mediated neurotrophin3 (NT3) (Ernfors et al., 1994; Oakley et al., 1995) and for fusimotor neuron survival and innervation, such as glial derived neurotrophic factor (GDNF) (Whitehead et al., 2005; Received Jan. 19, 2015; revised Feb. 23, 2015; accepted March 2, 2015. Gould et al., 2008; Shneider et al., 2009b). Authorcontributions:M.O.-F.andW.G.T.designedresearch;M.O.-F.andW.G.T.performedresearch;M.O.-F.and Egr3 expression is essential for normal spindle morphogene- W.G.T. analyzed data; M.O.-F. and W.G.T. wrote the paper. sis, proprioception, and coordinated locomotor function (Tour- This work was supported by the National Institutes of Health (Grants R01-NS040748, K02-NS046468, and K26- tellotte et al., 2001; Akay et al., 2014), but the extent to which it OD026099). We thank K. Gruner in the Tourtellotte laboratory and L. Li and members of the Mouse Histology and Pheno- typing Laboratory (MHPL) for technical assistance. Dr. Tourtellotte is the Director of the Mouse Histology and Phenotyping has an essential role within developing intrafusal muscle fibers is Laboratory, which is supported by Grant P30-CA060553-20-7341 from the National Institutes of Health. not clear because it is widely expressed and has a highly pleiotro- The authors declare no competing financial interests. pic function (Tourtellotte and Milbrandt, 1998; Li et al., 2005; Correspondence should be addressed to Warren G. Tourtellotte, MD, PhD, FCAP, Northwestern University, Fein- Carter et al., 2007; Gao et al., 2007; Eldredge et al., 2008). To berg School of Medicine, Department of Pathology, Ward Bldg., Rm. 3-240, 303 E. Chicago Ave., Chicago, IL 60611. E-mail: [email protected]. examine the cell autonomous role of Egr3 in spindle morphogen- DOI:10.1523/JNEUROSCI.0241-15.2015 esis, we generated Egr3 conditional knock-out mice and system- Copyright © 2015 the authors 0270-6474/15/355566-13$15.00/0 atically ablated Erg3 in proprioceptive sensory neurons, Schwann Oliveira Fernandes and Tourtellotte • Egr3-Mediated Muscle Spindle Morphogenesis J. Neurosci., April 8, 2015 • 35(14):5566–5578 • 5567 cells that thickly myelinate proprioceptive axons and skeletal through graded alcohols (30–100%), and infiltrated with graded 100% muscle. Whereas Egr3 ablation in proprioceptive neurons and propylene oxide and 100% Embed-812 resin (Electron Microscopy Sci- Schwann cells had no effect on spindle morphogenesis or propri- ences) before polymerization at 60°C. The resin blocks were sectioned at ␮ oception, Egr3 ablation in skeletal muscle resulted in abnormal 1 m and stained with 1% toluidine blue. spindle development and function. Moreover, we generated Egr3 Ventral root axon morphometry. Toluidine-blue-stained, resin- embedded cross-sections of ventral roots were photomicrographed using Cre-recombinase knock-in mice that made it possible to trace the a digital camera (Spot Imaging RT slider) with 100ϫ oil-immersion fate of Egr3-deficient Ia-afferent contacted myotubes. Although optics and the photographs were assembled into composites using Adobe Ia-afferents appeared to engage early spindle development in the Photoshop software. The calibrated composite images of high- absence of Egr3, intrafusal-like muscle fibers failed to differenti- resolution nerve root cross-sections were analyzed with image analy- ate beyond one to two shortened fibers and failed to express some sis software (MetaMorph) using Feret analysis to calculate the characteristic intrafusal muscle fiber proteins. Although they diameter of a cylinder having similar cross-sectional area. For each expressed NT3 and maintained their Ia-afferent innervation, ventral root, small-diameter, thickly myelinated axons Ͻ3.5 ␮min they failed to express the fusimotor neuron survival factor diameter were classified as fusimotor axons and counted as a percent- GDNF and were never found to have motor endplates or age of the total number of thickly myelinated axons within the entire fusimotor innervation. root as described previously (Tourtellotte and Milbrandt, 1998; Tour- Together, these results indicate that Ia-afferent innervation in tellotte et al., 2001). Immunohistochemistry. Fixed or fresh-frozen tissue sections were air- developing skeletal muscle can initiate spindle morphogenetic dried for 20 min and blocked with PBS/0.3% Triton X-100 (PBST) and signaling, but it is not sufficient to drive normal spindle develop- 5% serum for1hatroom temperature (RT). Primary antibody incuba- ment or function in the absence of Egr3. Egr3 appears to be a tion was performed overnight in PBST/5% serum at RT using the follow- master regulator of intrafusal muscle fiber differentiation and ing antibodies: ATP1␣3 (rabbit anti-ATP1␣3, 1:1000; Millipore), GDNF expression required for establishing and maintaining ␤-galactosidase (␤-gal; chicken anti-␤-gal, 1:1000; Abcam or goat anti- their fusimotor innervation. ␤-gal, 1:500; ABD Serotec or rabbit anti-␤-gal, 1:500; ICN), Egr3 (rabbit anti-Egr3, 1:1000; Santa Cruz Biotechnology), GDNF (rabbit anti- Materials and Methods GDNF, 1:250; LSBio), laminin (chicken anti-laminin, 1:5000; Sigma or Animals. Egr3-flx (Egr3 ϩ/flx) and Egr3-Cre (Egr3 ϩ/Cre) mice were gen- rabbit anti-Laminin, 1:1000; Sigma), NT3 (rabbit anti-NT3, 1:500; erated and genotyped as described previously (Quach et al., 2013). Pre- LSBio), Pv (goat anti-Pv, 1:1000; Swant), s100␤ (goat anti-s100␤, 1:100; viously characterized Cre recombinase-driver mice were used for Santa Cruz Biotechnology) and TrkC (goat anti-TrkC, 1:1000; R&D Sys- cell-lineage-specific Egr3 ablation. We used P0-Cre for Schwann cells, a tems). The following antibodies from the Developmental Studies Hy- generous gift from L. Wrabetz, SUNY Buffalo (Feltri et al., 1999), Parv- bridoma Bank were
Load more

Recommended publications
  • VIEW Open Access Muscle Spindle Function in Healthy and Diseased Muscle Stephan Kröger* and Bridgette Watkins
    Kröger and Watkins Skeletal Muscle (2021) 11:3 https://doi.org/10.1186/s13395-020-00258-x REVIEW Open Access Muscle spindle function in healthy and diseased muscle Stephan Kröger* and Bridgette Watkins Abstract Almost every muscle contains muscle spindles. These delicate sensory receptors inform the central nervous system (CNS) about changes in the length of individual muscles and the speed of stretching. With this information, the CNS computes the position and movement of our extremities in space, which is a requirement for motor control, for maintaining posture and for a stable gait. Many neuromuscular diseases affect muscle spindle function contributing, among others, to an unstable gait, frequent falls and ataxic behavior in the affected patients. Nevertheless, muscle spindles are usually ignored during examination and analysis of muscle function and when designing therapeutic strategies for neuromuscular diseases. This review summarizes the development and function of muscle spindles and the changes observed under pathological conditions, in particular in the various forms of muscular dystrophies. Keywords: Mechanotransduction, Sensory physiology, Proprioception, Neuromuscular diseases, Intrafusal fibers, Muscular dystrophy In its original sense, the term proprioception refers to development of head control and walking, an early im- sensory information arising in our own musculoskeletal pairment of fine motor skills, sensory ataxia with un- system itself [1–4]. Proprioceptive information informs steady gait, increased stride-to-stride variability in force us about the contractile state and movement of muscles, and step length, an inability to maintain balance with about muscle force, heaviness, stiffness, viscosity and ef- eyes closed (Romberg’s sign), a severely reduced ability fort and, thus, is required for any coordinated move- to identify the direction of joint movements, and an ab- ment, normal gait and for the maintenance of a stable sence of tendon reflexes [6–12].
    [Show full text]
  • Ultrastructural Cardiac Muscle and Cardiac Microvasculature Changes in Experimental Murine Infections Acta Scientiae Veterinariae, Vol
    Acta Scientiae Veterinariae ISSN: 1678-0345 [email protected] Universidade Federal do Rio Grande do Sul Brasil Tejero, Felix; Arias-Mota, Lourdes Lorena; Roschman-González, Antonio; Aso, Pedro María; Finol, Héctor José Trypanosoma evansi: Ultrastructural Cardiac Muscle and Cardiac Microvasculature Changes in Experimental Murine Infections Acta Scientiae Veterinariae, vol. 38, núm. 3, 2010, pp. 279-285 Universidade Federal do Rio Grande do Sul Porto Alegre, Brasil Available in: http://www.redalyc.org/articulo.oa?id=289021902008 How to cite Complete issue Scientific Information System More information about this article Network of Scientific Journals from Latin America, the Caribbean, Spain and Portugal Journal's homepage in redalyc.org Non-profit academic project, developed under the open access initiative Acta Scientiae Veterinariae. 38(3): 279-285, 2010. ORIGINAL ARTICLE ISSN 1679-9216 (Online) Pub. 910 Trypanosoma evansi: Ultrastructural Cardiac Muscle and Cardiac Microvasculature Changes in Experimental Murine Infections* Felix Tejero1, Lourdes Lorena Arias-Mota1, Antonio Roschman-González2, Pedro María Aso3 & Héctor José Finol2 ABSTRACT Background: Trypanosoma evansi is the etiologic agent of the equine trypanosomosis, a disease related to the detriment of the extensive bovine farming in the Venezuelan grasslands. Even though macroscopic pathologies such as anemia, pale mucosa, icteric tissues, generalized edema, splenomegaly, liver and renal hypertrophy, abortion, anoestrus, emaciation, lymphadenopathies, striated muscle atrophy as well as epicardiac and endocardiac hemorrhages have been described for infections with the agent, no reports of any heart ultrastructural change in experimental or natural infections induced by Venezuelan T. evansi isolates are available. So, a transmission electron microscopic approach to the problem was needed. This work describes cell features of the cardiac myocyte and the cardiac microvasculature ultrastructure in mice experimentally infected with an equine local isolate of T.
    [Show full text]
  • Multifactorial Erβ and NOTCH1 Control of Squamous Differentiation and Cancer
    Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks, … , Karine Lefort, G. Paolo Dotto J Clin Invest. 2014;124(5):2260-2276. https://doi.org/10.1172/JCI72718. Research Article Oncology Downmodulation or loss-of-function mutations of the gene encoding NOTCH1 are associated with dysfunctional squamous cell differentiation and development of squamous cell carcinoma (SCC) in skin and internal organs. While NOTCH1 receptor activation has been well characterized, little is known about how NOTCH1 gene transcription is regulated. Using bioinformatics and functional screening approaches, we identified several regulators of the NOTCH1 gene in keratinocytes, with the transcription factors DLX5 and EGR3 and estrogen receptor β (ERβ) directly controlling its expression in differentiation. DLX5 and ERG3 are required for RNA polymerase II (PolII) recruitment to the NOTCH1 locus, while ERβ controls NOTCH1 transcription through RNA PolII pause release. Expression of several identified NOTCH1 regulators, including ERβ, is frequently compromised in skin, head and neck, and lung SCCs and SCC-derived cell lines. Furthermore, a keratinocyte ERβ–dependent program of gene expression is subverted in SCCs from various body sites, and there are consistent differences in mutation and gene-expression signatures of head and neck and lung SCCs in female versus male patients. Experimentally increased ERβ expression or treatment with ERβ agonists inhibited proliferation of SCC cells and promoted NOTCH1 expression and squamous differentiation both in vitro and in mouse xenotransplants. Our data identify a link between transcriptional control of NOTCH1 expression and the estrogen response in keratinocytes, with implications for differentiation therapy of squamous cancer. Find the latest version: https://jci.me/72718/pdf Research article Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks,1,2 Paola Ostano,3 Seung-Hee Jo,1,2 Jun Dai,1,2 Spiro Getsios,4 Piotr Dziunycz,5 Günther F.L.
    [Show full text]
  • Supplementary Materials
    Supplementary Materials: Supplemental Table 1 Abbreviations FMDV Foot and Mouth Disease Virus FMD Foot and Mouth Disease NC Non-treated Control DEGs Differentially Expressed Genes RNA-seq High-throughput Sequencing of Mrna RT-qPCR Quantitative Real-time Reverse Transcriptase PCR TCID50 50% Tissue Culture Infective Doses CPE Cytopathic Effect MOI Multiplicity of Infection DMEM Dulbecco's Modified Eagle Medium FBS Fetal Bovine Serum PBS Phosphate Buffer Saline QC Quality Control FPKM Fragments per Kilo bases per Million fragments method GO Gene Ontology KEGG Kyoto Encyclopedia of Genes and Genomes R Pearson Correlation Coefficient NFKBIA NF-kappa-B Inhibitor alpha IL6 Interleukin 6 CCL4 C-C motif Chemokine 4 CXCL2 C-X-C motif Chemokine 2 TNF Tumor Necrosis Factor VEGFA Vascular Endothelial Growth Gactor A CCL20 C-C motif Chemokine 20 CSF2 Macrophage Colony-Stimulating Factor 2 GADD45B Growth Arrest and DNA Damage Inducible 45 beta MYC Myc proto-oncogene protein FOS Proto-oncogene c-Fos MCL1 Induced myeloid leukemia cell differentiation protein Mcl-1 MAP3K14 Mitogen-activated protein kinase kinase kinase 14 IRF1 Interferon regulatory factor 1 CCL5 C-C motif chemokine 5 ZBTB3 Zinc finger and BTB domain containing 3 OTX1 Orthodenticle homeobox 1 TXNIP Thioredoxin-interacting protein ZNF180 Znc Finger Protein 180 ZNF36 Znc Finger Protein 36 ZNF182 Zinc finger protein 182 GINS3 GINS complex subunit 3 KLF15 Kruppel-like factor 15 Supplemental Table 2 Primers for Verification of RNA-seq-detected DEGs with RT-qPCR TNF F: CGACTCAGTGCCGAGATCAA R:
    [Show full text]
  • Interpretation of Sensory Information from Skeletal Muscle Receptors for External Control Milan Djilas
    Interpretation of Sensory Information From Skeletal Muscle Receptors For External Control Milan Djilas To cite this version: Milan Djilas. Interpretation of Sensory Information From Skeletal Muscle Receptors For External Control. Automatic. Université Montpellier II - Sciences et Techniques du Languedoc, 2008. English. tel-00333530 HAL Id: tel-00333530 https://tel.archives-ouvertes.fr/tel-00333530 Submitted on 23 Oct 2008 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. UNIVERSITE MONTPELLIER II SCIENCES ET TECHNIQUES DU LANGUEDOC T H E S E pour obtenir le grade de DOCTEUR DE L'UNIVERSITE MONTPELLIER II Formation doctorale: SYSTEMES AUTOMATIQUES ET MICROELECTRONIQUES Ecole Doctorale: INFORMATION, STRUCTURES ET SYSTEMES présentée et soutenue publiquement par Milan DJILAS le 13 octobre 2008 Titre: INTERPRETATION DES INFORMATIONS SENSORIELLES DES RECEPTEURS DU MUSCLE SQUELETTIQUE POUR LE CONTROLE EXTERNE INTERPRETATION OF SENSORY INFORMATION FROM SKELETAL MUSCLE RECEPTORS FOR EXTERNAL CONTROL JURY Jacques LEVY VEHEL Directeur de Recherches, INRIA Rapporteur
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • A Web-Platform for Analysis of Host Factors Involved in Viral Infections Discovered by Genome Wide Rnai Screen
    Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is © The Royal Society of Chemistry 2017 vhfRNAi: A web-platform for analysis of host factors involved in viral infections discovered by genome wide RNAi screen Anamika Thakur#, Abid Qureshi# and Manoj Kumar* Bioinformatics Centre, Institute of Microbial Technology, Council of Scientific and Industrial Research, Sector 39A, Chandigarh-160036, India #Equal contribution * To whom correspondence should be addressed. Tel, 91-172-6665453; Fax, 91-172- 2690585; 91-172-2690632; Email, [email protected] Supplementary Tables Table S1: Statistics of unique and duplicate host factors in each virus Table S2: Table denoting genes common among different viruses Table S3: Statistics of GWAS analysis Table S1. Statistics of unique and duplicate host factors in each virus S. No. Virus Unique-Entries Duplicate-Entries 1. Adeno-associated virus (AAV) 926 533 2. Avian influenza virus (AIV) 0 11 3. Borna disease virus (BDV) 14 20 4. Dengue virus 2 (DEN-2) 27 13 5. Hepatitis C virus (HCV) 236 213 6. Human immunodeficiency virus 1 (HIV) 1388 857 7. Human parainfluenza virus 3 (HPIV-3) 0 27 8. Human herpesvirus 1 (HSV-1) 34 38 9. Influenza A virus (IAV) 700 513 10. Lymphocytic choriomeningitis virus (LCMV) 0 54 11. Marburgvirus (MARV) 0 11 12. Poliovirus (PV) 3340 1035 13. Rotavirus (RV) 347 175 14. Sendai virus (SeV) 32 27 15. Sindbis virus (SIV) 70 41 16. Vaccinia virus (VACV) 482 296 17. Vesicular stomatitis virus (VSV) 9 78 18. West Nile virus (WNV) 313 137 Table S1. Statistics of unique host factors for each virus having overlapping and unique factors in different viruses Non-overlap – Overall- S.
    [Show full text]
  • (7E) Powerpoint Lecture Outline Chapter 8: Control of Movement
    Carlson (7e) PowerPoint Lecture Outline Chapter 8: Control of Movement This multimedia product and its contents are protected under copyright law. The following are prohibited by law: •any public performance or display, including transmission of any image over a network; •preparation of any derivative work, including extraction, in whole or in part, of any images; •any rental, lease, or lending of the program. Copyright 2001 by Allyn & Bacon Skeletal Muscle n Movements of our body are accomplished by contraction of the skeletal muscles l Flexion: contraction of a flexor muscle draws in a limb l Extension: contraction of extensor muscle n Skeletal muscle fibers have a striated appearance n Skeletal muscle is composed of two fiber types: l Extrafusal: innervated by alpha-motoneurons from the spinal cord: exert force l Intrafusal: sensory fibers that detect stretch of the muscle u Afferent fibers: report length of intrafusal: when stretched, the fibers stimulate the alpha-neuron that innervates the muscle fiber: maintains muscle tone u Efferent fibers: contraction adjusts sensitivity of afferent fibers. 8.2 Copyright 2001 by Allyn & Bacon Skeletal Muscle Anatomy n Each muscle fiber consists of a bundle of myofibrils l Each myofibril is made up of overlapping strands of actin and myosin l During a muscle twitch, the myosin filaments move relative to the actin filaments, thereby shortening the muscle fiber 8.3 Copyright 2001 by Allyn & Bacon Neuromuscular Junction n The neuromuscular junction is the synapse formed between an alpha motor neuron
    [Show full text]
  • Tissue Engineered Myelination and the Stretch Reflex Arc Sensory Circuit: Defined Medium Ormulation,F Interface Design and Microfabrication
    University of Central Florida STARS Electronic Theses and Dissertations, 2004-2019 2009 Tissue Engineered Myelination And The Stretch Reflex Arc Sensory Circuit: Defined Medium ormulation,F Interface Design And Microfabrication John Rumsey University of Central Florida Part of the Biology Commons Find similar works at: https://stars.library.ucf.edu/etd University of Central Florida Libraries http://library.ucf.edu This Doctoral Dissertation (Open Access) is brought to you for free and open access by STARS. It has been accepted for inclusion in Electronic Theses and Dissertations, 2004-2019 by an authorized administrator of STARS. For more information, please contact [email protected]. STARS Citation Rumsey, John, "Tissue Engineered Myelination And The Stretch Reflex Arc Sensory Circuit: Defined Medium Formulation, Interface Design And Microfabrication" (2009). Electronic Theses and Dissertations, 2004-2019. 3826. https://stars.library.ucf.edu/etd/3826 TISSUE ENGINEERED MYELINATION AND THE STRETCH REFLEX ARC SENSORY CIRCUIT: DEFINED MEDIUM FORMULATION, INTERFACE DESIGN AND MICROFABRICATION by JOHN WAYNE RUMSEY B.S. University of Florida, 2001 M.S. University of Central Florida, 2004 A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Burnett School of Biomedical Sciences in the College of Medicine at the University of Central Florida Orlando, Florida Fall Term 2009 Major Professor: James J. Hickman ABSTRACT The overall focus of this research project was to develop an in vitro tissue- engineered system that accurately reproduced the physiology of the sensory elements of the stretch reflex arc as well as engineer the myelination of neurons in the systems. In order to achieve this goal we hypothesized that myelinating culture systems, intrafusal muscle fibers and the sensory circuit of the stretch reflex arc could be bioengineered using serum-free medium formulations, growth substrate interface design and microfabrication technology.
    [Show full text]
  • Identification of Hair Shaft Progenitors That Create a Niche for Hair Pigmentation
    Downloaded from genesdev.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press Identification of hair shaft progenitors that create a niche for hair pigmentation Chung-Ping Liao,1 Reid C. Booker,1 Sean J. Morrison,2,3,4,5,6 and Lu Q. Le1,4,5 1Department of Dermatology, 2Department of Pediatrics, 3Children’s Research Institute, 4Simmons Comprehensive Cancer Center, 5Hamon Center for Regenerative Science and Medicine, 6Howard Hughes Medical Institute, University of Texas Southwestern Medical Center, Dallas, Texas 75390, USA Hair differentiates from follicle stem cells through progenitor cells in the matrix. In contrast to stem cells in the bulge, the identities of the progenitors and the mechanisms by which they regulate hair shaft components are poorly understood. Hair is also pigmented by melanocytes in the follicle. However, the niche that regulates follicular melanocytes is not well characterized. Here, we report the identification of hair shaft progenitors in the matrix that are differentiated from follicular epithelial cells expressing transcription factor KROX20. Depletion of Krox20 lin- eage cells results in arrest of hair growth, confirming the critical role of KROX20+ cells as antecedents of structural cells found in hair. Expression of stem cell factor (SCF) by these cells is necessary for the maintenance of differen- tiated melanocytes and for hair pigmentation. Our findings reveal the identities of hair matrix progenitors that regulate hair growth and pigmentation, partly by creating an SCF-dependent niche for follicular melanocytes. [Keywords: stem cell factor (SCF); hair pigmentation; hair shaft progenitor cell; hair follicle stem cell; hair matrix; KROX20] Supplemental material is available for this article.
    [Show full text]
  • THE MUSCLE SPINDLE Anatomical Structures of the Spindle Apparatus
    56 Chapter Three Figure 3-2. Organization of muscle from macro- scopic to microscopic levels. Reprinted with permis- sion from Oatis CA. Kinesiology: The Mechanics and Pathomechanics of Human Movement. Philadelphia, Pa: Lippincott Williams & Wilkins; 2004:46. which contains only actin (thin) filaments. The darker area is the A-band, which contains alternating actin and myosin (thick) filaments. The Z-line consists of a connective tissue network that bisects the I-band, anchors the thin filaments, and provides structural integrity to the sarcomere. The H- Figure 3-1. Successive connective tissue sheaths with- zone, located in the middle of the A-band, is the region of in muscle. Reprinted with permission from Oatis thick filaments not overlapped by thin filaments. The M- CA. Kinesiology: The Mechanics and Pathomechanics band bisects the H-zone and represents the middle of the of Human Movement. Philadelphia, Pa: Lippincott sarcomere. The M-band consists of protein structures that Williams & Wilkins; 2004:47. support the arrangement of the myosin filaments. During muscle contraction, the sarcomere I-band and H-zone decrease in length while the length of the A-band remains constant.2,3 THE MUSCLE SPINDLE The muscle spindle is a long, thin structure located adjacent and parallel to muscle fibers and is composed of multiple components that have both afferent and efferent innervation (Figures 3-4a and 3-4b). The muscle spindle functions as a stretch receptor and responds to static and dynamic length changes of skeletal muscle.4-6 This complex receptor is found in all muscles, primarily in extremity, inter- costal, and cervical muscles.
    [Show full text]
  • Be Able to Describe a Stretch Reflex
    be able to describe a stretch reflex .(1) (2) Define muscle tone (3) be able to explain what is muscle tone (4) describe the structure , innervations and function of the muscle spindle . (5) explain what is meant by static and dynamic stretch reflex . (6) describe the spinal and supraspinal regulation of the stretch reflex . (7) describe the inverse stretch reflex and its function Stretch reflex: Whenever a muscle is stretched suddenly, excitation of the muscle spindle causes reflex contraction of the large muscle fiber (See the pictures). It is deep and monosynaptic reflex. Stretch response is produced by co-activation of alpha & gamma motor neurons. But it is maintained mainly by the tonic ( continuous) discharge of Gamma Efferent neurons. Muscle spindle: It is a sensory receptors which are distributed throughout the muscle and it sends information to nervous system about muscle length or rate of change in muscle length. - Each spindle is built around 3-12 intrafusal muscle fibers. - Muscle spindles are parallel to extrafusal muscle fibers and they are attached to them or to the tendon. Types of Intrafusal fibers Each intrafusal fiber consists of: (1) Central non-contractile area (receptor 2) Nuclear chain fibers: area). thinner and shorter 1) Nuclear bag fibers: than nuclear bag fibers (2) Peripheral contractile area. contain many nuclei in , and have one line of a dilated central area ( “ nuclei spread in a chain bag ” ) . Typically there along the receptor area are 2 nuclear bag fibers . There are 4 – 9 per spindle . nuclear chain
    [Show full text]