Biochemical and Genetic Characterization of Rubber Production In

Home , Biological oxidizer, Lactuca, Lactuca canadensis, Lactuca serriola

BIOCHEMICAL AND GENETIC CHARACTERIZATION OF RUBBER PRODUCTION IN

PRICKLY LETTUCE (Lactuca serriola L.)

JARED L. BELL

A dissertation submitted in partial fulfillment of the requirements for the degree of

DOCTOR OF PHILOSOPHY

WASHINGTON STATE UNIVERSITY Molecular Plant Sciences Graduate Program

MAY 2013

To the Faculty of Washington State University:

The members of the Committee appointed to examine the dissertation of JARED LARS BELL find it satisfactory and recommend that it be accepted.

______Ian C. Burke, Ph.D., Chair

______Michael M. Neff, Ph.D., Co-Chair

______Kimberly A. Garland-Campbell, Ph.D.

______John K. Fellman, Ph.D.

ii ACKNOWLEDGMENTS

The collaborators of this research are grateful for funding provided by the United States

Department of Agriculture Aegilops cylindrica – Biomass for Biofuels and Bioproducts from

Weedy Plants (NIFA/USDA special grant) special grant. Work on this project has also been made possible by the technical support and expertise of the following people: Lydia Baxter-

Potter, Nick Boydston, Arron Carter, Madeline Jacobson, Misha Manuchehri, Dennis Pittmann,

Alan Raeder, Dilpreet Riar, Sachin Rustgi, Sherri Rynearson, Deven See, Jamin Smitchger,

Randy Stevens all of the Crop and Soil Science Department, Washington State University.

Assistance with NMR analysis was given by Bill Hiscox at the Washington State University

NMR Center. NMR equipment was supported by NIH grants RR0631401 and RR12948, NSF grants CHE-9115282 and DBI-9604689 and the Murdock Charitable Trust. Rubber physical property analysis was performed with the guidance and support of Dr. Armando McDonald and

Liqing Wei at the University of Idaho, Renewable Materials Program, College of Natural

Resources. The authors would finally like to thank the staff, particularly Valerie Lynch-Holm, at the Franceschi Microscopy and Imaging Center, Washington State University for their technical assistance.

iii BIOCHEMICAL AND GENETIC CHARACTERIZATION OF RUBBER PRODUCTION IN

PRICKLY LETTUCE ( Lactuca serriola L.)

Abstract

by Jared L. Bell, Ph.D. Washington State University May 2013

Chair: Ian C. Burke

Co-Chair: Michael M. Neff

Natural rubber ( cis -1,4-polyisoprene) is one of the most important plant derived biopolymers used in the manufacture of thousands of products. Plant originated rubber is unique in that the physical properties such as tensile strength, heat and impact resistance have yet to be reproduced by synthetic polyisoprene. While many plants are able to make rubber polymers, few can synthesize high molecular weight molecules. Prickly lettuce ( Lactuca serriola L.), a common weed, is one of the few. The following studies were conducted to assess the diversity, genetics, the chemical and physical properties as well as the microscopic elements related to prickly lettuce rubber production. Rubber from a collection of eastern Washington prickly lettuce biotypes revealed variation in rubber content and quality, although all biotypes synthesized high molecular weight rubber. Two distinct biotypes were crossed and selfed to generate an F2 segregating population. Plant phenotypes and genetic segregation of markers (EST-SSRs) were collected to discover marker-trait associations or quantitative trait loci (QTL). Four main QTL were discovered corresponding to the following traits; rubber molecular weight, leaf perimeter and leaf lobing, stem counts and growth habit, and herbivory. A single marker association was

iv observed with the trait rubber polymer dispersity. Rubber extraction methods were evaluated and found that chemical extraction of dried, ground whole plant material yielded little rubber of low quality. Direct rubber extraction from tapped latex was the best extraction method. Rubber polymers were confirmed as cis -1,4-polyisoprene by nuclear magnetic resonance spectroscopy with little to no trans -polyisoprene detected. Physical property analysis showed that prickly lettuce rubber has properties equal to or better than rubber derived from Brazilian rubber tree.

Prickly lettuce is a potential source of natural rubber having the desired physical properties for end-use production. Production feasibility will rely on rubber trait selection and extraction optimization to increase yield. Prickly lettuce can also serve as a model species to understand rubber biosynthesis as it is highly amenable to genetic and biochemical experimentation. These studies have extended the foundation of understanding towards the biosynthesis and utilization of rubber in prickly lettuce.

v TABLE OF CONTENTS

Page

ACKNOWLEDGEMENTS ...... iii

ABSTRACT ...... iv

LIST OF TABLES ...... xi

LIST OF FIGURES ...... xii

LIST OF FIGURES APPENDIX A ...... xiii

CHAPTER 1: Prickly Lettuce as an Alternative Source of Natural Rubber

1. LITERATURE REVIEW ...... 1

Natural Rubber Production ...... 1

Prickly Lettuce Rubber Production ...... 4

Botanical Characteristics of Prickly Lettuce ...... 5

Herbicide Resistance in Prickly Lettuce ...... 7

Agronomic and Climatic Requirements of Prickly Lettuce ...... 7

Lettuce Genetic Resources ...... 8

Rubber History ...... 10

Rubber Properties...... 11

Anatomy and Biochemistry of Polyisoprene Synthesis ...... 13

Rubber Extraction Methods ...... 16

Research Objectives ...... 18

LITERATURE CITED ...... 19

CHAPTER 2: Rubber Content and Quality Screen of Twenty Eastern Washington Prickly Lettuce Biotypes

1. ABSTRACT ...... 34

2. INTRODUCTION ...... 35

3. MATERIALS AND METHODS ...... 39

Plant Material and Latex Component Isolation ...... 40

Rubber Analysis ...... 41

Statistical Analysis ...... 42

4. RESULTS AND DISCUSSION ...... 42

5. CONCLUSIONS...... 46

Acknowledgements ...... 47

LITERATURE CITED ...... 48

CHAPTER 3: Quantitative Trait Loci Associated with Rubber Production in Prickly Lettuce

1. ABSTRACT ...... 55

2. INTRODUCTION ...... 56

3. MATERIALS AND METHODS ...... 58

Plant Material and Population Development ...... 58

Phenotypic Evaluation ...... 59

Prickly Lettuce Genetic Map ...... 61

Segregation Analysis/ Linkage Maps ...... 63

Polymorphism ...... 63

Trait Genetic Markers/ QTL Analysis ...... 64

4. RESULTS AND DISCUSSION ...... 64

Phenotypic Assessment ...... 64

vii Linkage Maps...... 65

Rubber Trait QTL ...... 66

Other Beneficial Traits ...... 67

5. CONCLUSIONS...... 71

Acknowledgements ...... 71

LITERATURE CITED ...... 73

CHAPTER 4: Post-Harvest Content, Quality and Physical Properties of Rubber Derived from Prickly Lettuce

1. ABSTRACT ...... 92

2. INTRODUCTION ...... 92

3. MATERIALS AND METHODS ...... 99

Plant Material Origin ...... 99

Plant Material for Latex Extraction ...... 99

Plant Material for Whole Plant Extraction...... 100

Latex Extraction ...... 101

Whole Plant Rubber Extraction and Yield...... 102

Rubber Molecular Weight, Physical Properties and NMR ...... 104

4. RESULTS AND DISCUSSION ...... 106

Latex Rubber Extraction and Yield ...... 106

Whole Plant Rubber Extraction and Yield...... 106

NMR Analysis ...... 108

Physical Properties ...... 108

5. CONCLUSIONS...... 109

Acknowledgements ...... 110

viii

LITERATURE CITED ...... 111

CHAPTER 5: Microscopic Characterization of Rubber Particles in Prickly Lettuce

1. ABSTRACT ...... 123

2. INTRODUCTION ...... 123

3. MATERIALS AND METHODS ...... 124

Isolation of Washed Rubber Particles ...... 124

Fixing and Viewing of Rubber Particles ...... 125

4. RESULTS AND DISCUSSION ...... 125

5. CONCLUSIONS...... 127

Acknowledgements ...... 127

LITERATURE CITED ...... 128

Chapter 6: Future Directions

Introduction ...... 134

Rubber Biosynthesis and Utilization ...... 134

Identified QTL and Candidate Genes ...... 135

Conclusion ...... 136

CHAPTER 7: Philosophical Musings of a Would-be Scientist

1. INTRODUCTION ...... 137

What it Means to be a Scientist ...... 137

Academia or Industry ...... 140

The Prospect of Becoming ...... 142

Impact Factor ...... 143

Science and Religion...... 145

Concluding Remarks ...... 147

LITERATURE CITED ...... 149

APPENDIX A

Preface...... 151

A. Uptake, Translocation and Metabolism of Aminocyclopyrachlor in Prickly Lettuce, Rush Skeletonweed, and Yellow Starthistle

1. ABSTRACT ...... 152

2. INTRODUCTION ...... 153

3. MATERIALS AND METHODS ...... 156

Plant Material ...... 156

Absorption and Translocation of DPX-MAT28 and DPX-KJM44 ...... 157

Metabolism of DPX-MAT28 and DPX-KJM44 ...... 158

Autoradiography ...... 160

Statistical Analysis ...... 161

4. RESULTS ...... 163

Absorption and Translocation of DPX-MAT28 and DPX-KJM44 ...... 163

Metabolism ...... 164

Autoradiography ...... 165

5. DISCUSSION ...... 165

6. CONCLUSIONS...... 169

Acknowledgements ...... 169

LITERATURE CITED ...... 170

x LIST OF TABLES

1. Location of collected prickly lettuce biotypes and their averaged rubber qualities and

quantity...... 53

2. Chi square analysis of potential prickly lettuce single gene traits derived from F2 population

of cross between eastern Washington biotypes 6-9/13 x 4-10/6...... 82

3. Polymorphic EST-SSR markers used for map development and QTL analysis of an F2

population derived from a cross of the eastern Washington prickly lettuce biotypes 6-9/13 x

4-10/6...... 83

4. QTL and associated markers ...... 90

5. Location of collected prickly lettuce biotypes and their averaged rubber qualities, quantity,

and physical properties found in extracted latex...... 116

6. Amount of extractable material and rubber M W using different extraction methods from

whole, freeze dried and ground prickly lettuce plants on a percent wt/wt basis ...... 118

xi LIST OF FIGURES

1. Average percentages of components found in tapped prickly lettuce latex from twenty

eastern Washington prickly lettuce biotypes...... 54

2. Leaf morphologies of the parents selected for generation of F2 segregating population...... 81

3. Distribution of selected traits showing QTL on Grp 4 and Grp 8 from an F2 population

derived from a cross of eastern Washington prickly lettuce biotypes 6-9/13 x 4-10/6...... 88

4. Distribution of phenotypic traits from an F2 population derived from a cross of eastern

Washington prickly lettuce biotypes 6-9/13 x 4-10/6...... 89

5. Linkage groups and QTL from eastern Washington prickly lettuce biotype cross (6-9/13 x 4-

10/6)...... 91

6. Proton ( 1H) NMR spectra for latex extracted acetone washed, combined and precipitated

prickly lettuce rubber from biotype 6-10/6...... 119

7. Carbon ( 13 C) NMR spectra for latex extracted acetone washed, combined and precipitated

prickly lettuce rubber from biotype 6-10/6...... 120

8. Dynamic mechanical analysis of green strength on acetone washed, precipitated prickly

lettuce natural rubber...... 121

9. Differential scanning calorimetry curves of synthetic isoprene rubber and prickly lettuce

natural rubber...... 122

10. WRPs from prickly lettuce and indian rubber tree ( Ficus elastica) prior to fixation

procedure...... 130

11. Progressive magnification of fixed, gold coated prickly lettuce WRPs...... 131

12. Larger sized prickly lettuce rubber particles viewed using FESEM at various

magnifications...... 132

xii 13. Prickly lettuce rubber particles viewed using FESEM at 100,000x magnification...... 133

LIST OF FIGURES APPENDIX A

1. Chemical structures of (1) aminocyclopyrachlor acid and (2) aminocyclopyrachlor methyl

ester...... 175

2. Absorption of foliar applied 14 C-DPX-KJM44 and 14 C-DPX-MAT28 into rush

skeletonweed, yellow starthistle, and prickly lettuce, expressed as % of applied...... 176

3. Total translocation of foliar applied 14 C-DPX-KJM44 and 14 C-DPX-MAT28 out of the

treated leaf of rush skeletonweed, yellow starthistle, and prickly lettuce, expressed as % of

applied...... 177

4. Translocation of foliar applied 14 C-DPX-KJM44 and 14 C-DPX-MAT28 to the above ground

portion of each species, expressed as % of applied...... 178

5. Translocation of foliar applied 14 C-DPX-KJM44 and 14 C-DPX-MAT28 to the below ground

portion of each species, expressed as % of applied...... 179

6. TLC plates of extracted leaf tissue from 14 C treated leaf portions of six plants at 2 and 72

HAT harvest intervals...... 180

7. De-esterification rate of DPX-KJM44 in rush skeletonweed...... 181

8. Autoradiographs of prickly lettuce, rush skeletonweed, and yellow starthistle, 24 HAT with

foliar applied aminocyclopyrachlor methyl ester...... 182

xiii Dedication

This dissertation is dedicated to my wife Camille Bell, my three children Dexter, Evelyn and

Miles who have been along on this adventure; guys it’s almost time to get a dog.

To my parents William and Kathleen Bell who laid the foundation of faith and work.

xiv Chapter 1

Prickly Lettuce as an Alternative Source of Natural Rubber

Literature Review

Most rubber products used globally are petroleum-based. In 2011, 57.8% of total worldwide rubber production and consumption was synthetically made (International Rubber

Study Group). Synthetic rubber (predominantly a styrene-butadiene polymer) lacks many desirable end use characteristics, therefore synthetic polymers cannot completely substitute natural rubber. Natural rubber products have tensile strength, resilience, elasticity, abrasion and impact resistance, efficient heat dispersion, and malleability at cold temperatures, all of which are essential attributes in high performance applications such as medical devices and airplane tires. Because synthetic-based products are derived from a non-renewable resource, natural rubber will be needed to supplement and eventually replace synthetic productions as oil supplies are exhausted. Domestication and commercialization of a rubber-producing crop is the best short and long-term solution to the future decline in synthetic rubber products, especially for developed countries such as the United States, the second largest consumer of natural rubber

(Hayashi 2009).

Natural Rubber Production

Natural rubber ( cis -1,4-polyisoprene) is an important plant derived bioproduct essential in the manufacture of over 40,000 products (Mooibroek and Cornish 2000). Brazilian rubber tree

[Hevea brasiliensis (Willd. ex A. Juss.) Müll. Arg.], a tropically endemic species is the source of industrialized natural rubber production. Harvest of natural rubber has steadily increases since it was first discovered and commercially produced. Worldwide manufacture of natural rubber reached 10,978,000 t with consumption at 10,919,000 t in 2011. Yearly production is at demand

1 levels with minimal surpluses reported. In 2010, there was a 377,000 t deficit in consumption versus production (International Rubber Study Group). Natural rubber has strategic importance as that the current source of natural rubber is endemic to tropical regions. Security of supply chains for countries were the rubber tree cannot be cultivated is a high priority. The search continues for plant species that are able to efficiently generate the quantity and quality of natural rubber as their tropical counterparts.

Currently all natural rubber used in large scale production comes from a single species, the rubber tree. Native to the Amazon basin, the rubber tree has been propagated and cultivated in many tropical regions throughout the world, most notably the south Pacific region. Thailand,

Indonesia and Malaysia are the top three leading world exporters of natural rubber (Hayashi

2009). Reliance on a single plant species has foreseeable disadvantages and potential dangers.

The current crop of plantation-grown trees is almost entirely made up of cloned individuals. The lack of genetic variability renders entire plantations susceptible to pathogen attack as observed on cultivated trees in South America damaged by leaf blight (Davis 1997; Le Guen et al. 2004).

As rubber trees can only be cultivated in tropical climates, countries in temperate regions are dependent upon the few producing countries for the entire supplies of natural rubber. Economic and political instabilities in many of these developing countries could jeopardize imports. In addition, supplies could diminish as growers switch to more valuable crops such as oil palm and rattan (Belcher, Rujehan, and Achdiawan 2004).

Furthermore, latex from the rubber tree causes latex allergies. Proteins present in rubber tree latex products, most notably hevein, induce allergic reactions in >7 % of the population

(Rolland, Drew, and O’Hehir 2005). Health care workers and patients requiring repeated medical procedures or long-term hospitalization are at increased risk of developing latex hypersensitivity

2 (Lai et al. 1997; Tosi et al. 1993). The allergic response is an immunoglobulin E (IgE)-mediated

Type 1 reaction which in serious cases leads to life-threatening anaphylaxis (Slater 1989).

Esau (1965) identified 12,500 plant species across twenty families and 900 genera that produce latex. Of these, rubber could be produced from the latex of 1800 of the species across eight families and 300 genera (Metcalfe 1967). While there have been attempts to identify various temperate or tropical plant species as a source of natural rubber, success has been limited

(Buchanan et al. 1978; Carr and Bagby 1987; Hall and Goodspeed 1919; Mitchell, Rice, and

Roderick 1942; Polhamus 1958). Very few plant species produce latex that can be used to produce durable high molecular weight rubber or simply cannot efficiently produce enough latex on a per hectare basis as the rubber tree (Mooibroek and Cornish 2000). Currently, only

Parthenium argentatum Gray., commonly known as guayule, is used for commercial production of hypoallergenic latex products and only on a small scale (Cornish 2001). Production of rubber products from guayule may meet the demands of medical markets; however, guayule will not produce sufficient amounts to supply larger markets such as tire production (Cornish 2001).

Guayule does not tolerate cold winters experienced by much of the temperate regions of the world and more importantly it cannot be harvested as an annual crop as rubber is produced in bark parenchyma cells. One seasons growth yields little bark parenchyma and rubber. Additional rubber-producing crops that are fast growing and harvested annually are needed to fill the larger non-medical market.

Russian dandelion ( Taraxacum kok-saghyz L.E. Rodin.) is a temperate annual from

Kazakhstan identified in the 1930s as a producer of latex (Ulmann 1951). In terms of research resources spent, Russian dandelion closely follows guayule and has promise as an alternative rubber source. Rubber from this plant was used to make various products during WWII when

3 supply lines to the tropics were cut off (Polhamus 1962; Whaley and Bowen 1947). Latex is produced in the tap root and has molecular weight rubber similar to or greater than that of the rubber tree. For rubber production to be economical, yields must be increased and biorefinery methods employed where all plant components are utilized (Van Beilen and Poirier 2007).

Prickly Lettuce Rubber Production

The best rubber-producing crop for temperate regions will be a fast growing annual that produces large amounts of biomass. Annual crops are more easily incorporated into crop rotation systems and can be planted or removed in response to market fluctuations and independent grower requirements (Van Beilen and Poirier 2007). Perennial plant species such as trees or shrubs often have higher starting costs, have a lag from input to harvest and remain in place for several growing seasons, making them less suited to changing market demands. Preferably, the rubber producing species will also be tolerant and well adapted to cultivation on marginal land, alleviating competition with food crops, as seen in corn-ethanol production (Babcock and

Fabiosa 2011). The required tolerance and adaptability traits are often present in weedy species.

Weeds are well adapted to the region they infest, require low production inputs, have high water- use efficiency, and are largely resistant to disease and insect pests. Many of these species have high photosynthetic efficiency and consequently high biomass yields or are drought resistant. In some cases, populations of herbicide resistant weeds may provide production options for their development as a crop. Weedy plants could provide value-added bioproducts that increase the economic feasibility of establishing them as crops for biomass and bioproducts. Prickly lettuce

(Lactuca serriola L.) is one such weed, and has been identified as a plant species able to produce high molecular weight rubber (Bushman et al. 2006).

4 Interestingly, the genus Lactuca , of which prickly lettuce is a prominent member, has long been recognized as a potential source of rubber (Bushman et al. 2006). In 1913, a report detailed the analysis of latex from two lettuce species, Lactuca canadensis L. and L. scariola L.

(Fox 1913). Both species secreted latex from all areas of the plant. Rubber content of the latex was measured at 2.2 % in L. canadensis and 1.6 % in L. scariola . The variability of rubber content and the ability to produce rubber among lettuce genotypes was also described by the

Clemson Agriculture Center (Mitchell, Rice, and Roderick 1942) and the US Department of

Agriculture (Polhamus1958). The reports described differences in latex rubber content of several lettuce species with negligible differences in percent rubber extracted from whole plants. None of these reports discussed the purity or composition of the latex, the molecular weights of the rubber in the latex, or the condition of the tissues previous to extraction – that work was completed by Bushman et al. in 2006.

Bushman et al. (2006) examined prickly lettuce, accession UG92G488, and a cultivated lettuce cultivar ( Lactuca sativa L. cv. Salinas) accession UC96US23 to determine characteristics of natural rubber in those two lettuce species. They demonstrated that both species produce latex containing desirable high molecular weight (>1 million g mol -1) cis -1,4-polyisoprene with very narrow dispersity that should lead to excellent product characteristics after vulcanization.

Bushman et al. (2006) also concluded that genetic, developmental, or environmental influences could impact latex molecular weight and suggested optimizing the genetic, physiological, and environmental conditions for the synthesis of higher molecular weight rubber for prickly lettuce.

In order to consider the potential prickly lettuce has as an alternative source for latex and rubber bioproducts, continued research and development must be conducted.

Botanical Characteristics of Prickly Lettuce

5 Prickly lettuce, a native of Europe, is a winter/spring annual that grows as a basal rosette during the vegetative phase. Upon bolt initiation, one or more stems grow to 2 m in height. A deep tap-root with external branching 5 cm below the soil surface facilitates water uptake under drought conditions (Gallardo et al. 1996; Jackson 1995). Leaves are alternate and clasping with bristles on the undersurface along the mid-vein and are irregularly-pinnately toothed (Weaver and Downs 2003). Under certain environmental condition, prickly lettuce has the ability to orient cauline leaves in a north-south direction perpendicular to the soil surface coining the designation

“compass plant”. Modified leaf orientation affects the diurnal pattern of solar irradiance in turn affecting leaf temperature and total transpirational water loss enhancing photosynthetic output and reproductive ability late in the growing season (Werk and Ehleringer 1984, 1986). The stems contain a milky sap, hence the generic name- lacta , for "milk," referring to the milky latex sap in stem and leaf tissue. Bolting is facilitated by a long-day photoperiod, however, multiple partially dominant early flower (Ef) genes (Ryder and Milligan 2005) and a flowering locus (FT) gene

(Fukuda et al. 2011) derived from cultivated lettuce experiments contribute to a wide range of bolting phenotypes. Flowers are mainly self pollinated yet out-crossing events occur and are dependent on climatic conditions and pollinator abundance (Watts 1958; D’Andrea, Felber, and

Guadagnuolo 2008). Mature pappus bearing achenes are primarily wind disseminated and remain viable in the seed bank from 1 to 3 years (Marks and Prince 1981; 1982; Alcocer-Ruthling, Thill, and Shafii 1992). Maximum reproductive capacity is predicted to be 200,000 seeds per plant

(Weaver and Downs 2003) depending on growth conditions. Prickly lettuce is an abundant and widespread weed in meadows, woodlands, stream channels, and waste places throughout most of the United States, even in areas with very low rainfall, blooming from May to September

(Weaver and Downs 2003). Prickly lettuce has become one of the most common and

6 troublesome weeds in the inland Pacific Northwest (Burke et al. 2009). It is well suited to the dryland areas of eastern Washington and is capable of producing abundant above ground biomass, although its growth characteristics haven’t been fully studied.

Herbicide Resistance in Prickly Lettuce

In 1987, a sulfonylurea herbicide-resistant prickly lettuce biotype was identified in a no- till, continuous winter wheat field that had been treated with sulfonylurea herbicides for 5 years

(Mallory-Smith, Thill, and Dial 1990). Sulfonylurea herbicides inhibit acetolactate synthase

(ALS), a key enzyme in the production of the branched-chain amino acids. That resistance was controlled by a single nuclear gene with incomplete dominance (Mallory-Smith et al. 1990).

Since that discovery in Idaho, four other biotypes of ALS–resistant prickly lettuce have been reported (Heap 2012). In preliminary research, more than 55% of sampled biotypes from eastern

Washington were found resistant to ALS herbicides (Stevens and Burke 2009). More recently,

2,4-D resistance was confirmed in eastern Washington (Burke et al. 2009). Prickly lettuce 2,4-D resistance appears to be controlled by a single codominant gene with resistant biotypes showing reduced 2,4-D absorption and translocation compared to susceptible biotypes (Riar et al. 2011).

These traits would readily lend themselves to cultivation of prickly lettuce and closely related cultivated lettuce.

Agronomic and Climatic Requirements of Prickly Lettuce

Prickly lettuce is a native to a summer-dry Mediterranean climate (Gallardo et al. 1996) and is considered a drought-tolerant species (Werk and Ehleringer 1985; 1986). Prickly lettuce can be found in many different communities that have some disturbance, particularly crops grown with reduced tillage (Reed 1970; Schoennagel and Waller 1999). As a native of a

Mediterranean climate and a ruderal, prickly lettuce is adapted to the production practices of the

7 inland Pacific Northwest and is particularly adapted to the dryland production regions of eastern

Washington. Germination, which is largely controlled by temperature and the quality of light

(Marks and Prince 1979), occurs soon after the seeds are shed. Prickly lettuce seed is readily viable when it is shed. However, dormancy can be induced by allowing the seeds to imbibe prior to withholding water. The main period of germination in Washington appears to be in early spring, although germination can occur in late autumn and early winter and can continue well into summer as conditions permit. Thus, the life cycle in a single colony can range from winter annual to summer annual (Marks and Prince 1981).

Prince et al. (1978) noted that prickly lettuce is found primarily between latitudes 30 and

55 in the northern hemisphere. Rousseau (1968) observed that the distribution of prickly lettuce in Quebec was limited to areas with more than 3000 degree days. Although prickly lettuce is thought to prefer dry soils (Reed 1970; Hanf 1983), it tolerates a wide range of soil types. Prickly lettuce can be found growing on anything from rocky outcrops to fertile rich loams. Although no production information is available for prickly lettuce, it is reasonable to expect that if production was attempted, many of the practices currently used in cultivated lettuce would be applicable.

Lettuce Genetic Resources

Prickly lettuce is closely related to, and most likely the progenitor of cultivated lettuce. It is believed the two species are conspecific (Koopman et al. 2001) and are easily crossed to produce viable offspring. Cultivated lettuce is grown throughout the world and consumed for its nutritious foliage (Mou 2012; Nicolle et al. 2004). Cultivated lettuce has 9 chromosomes and a genome size of approximately 2600 Mb. Prickly lettuce also has 9 chromosomes and presumably a similar genome size. The Compositae Genome Project (CGPDB;

8 http://compgenomics.ucdavis.edu) is the most comprehensive genetic resource for study of the

Compositae family including cultivated lettuce and four closely related lettuce species, L. serriola L., L. saligna L., L. virosa L. and L. perennis L., ordered in proposed phylogenetic relatedness to cultivated lettuce. The genetic and genomic architecture of cultivated lettuce and its relatives has been well documented and includes a large inventory of molecular markers.

Variable marker types include RFLPs (Kesseli et al. 1991; 1994), RAPDs (Waycott and Fort

1994), ISSRs (Vicente et al. 2008), genomic/EST-SSRs (Riar et al. 2011; Simko 2009; Van de

Wiel et al. 2010), AFLPs (Jansen et al. 2005; Jeuken et al. 2001; Koopman et al. 2001), TRAPs

(Hu et al. 2005), SNPs (Moreno-Vázquez et al. 2003) and SFPs (Van Leeuwen et al. 2009). The developed molecular markers have been effectively utilized for linkage mapping (Truco et al.

2007), gene-tagging, QTL mapping (Jeuken et al. 2001) and genetic diversity studies (Kuang et al. 2008; Riar et al. 2011). Although cultivated lettuce is the main research focus, many of the molecular markers are transferable and have been used between lettuce species. Most recently the cultivated lettuce genome has been released (www.lgr.genomecenter.ucdavis.edu/) and will become a valuable asset in cultivated lettuce research as well as close lettuce relatives through sytenic genetic comparisons.

Prickly lettuce is important in cultivated lettuce breeding as donors of resistance genes

(Lebeda 1998; Lebeda et al. 2002; Reinink 1999; Ryder 1999; Sicard et al. 1999; Zohary 1991).

On the basis of the gene-pool concept (Harlan and Wet 1971), Lactuca species were categorized into three gene pools based on their relationship to cultivated lettuce (McGuire et al. 1993). The primary gene pool is represented by numerous cultivars of cultivated lettuce, primitive landraces, and wild species where crossing barriers do not exist. Prickly lettuce is the primary

9 representative as the progenitor species of this gene pool (de Vries 1997) and is a primary beneficiary of the resources devoted to the development of cultivated lettuce genetic resources.

Rubber History

The first documented uses of plant derived rubber were made by ancient Mesoamerican peoples as early as the 1600s B.C. (Hosler et al. 1999). The latex from the Panama rubber tree

(Castilla elastica Sesse.) was mixed with juice from the morning glory vine ( Ipomoea alba L.) producing a coagulated rubber material which could be molded into the desired shape (Hosler et al. 1999). The Mesoamerican name for this material is cauchu meaning “weeping wood”. The invention of coagulated rubber gave rise to its application as a material to make human figurines, and in tool preparation by wrapping handles or hafting stone heads to wooden handles. Aztecs and Mayans used rubber to waterproof clothing (Evans 2008), while Mexicans used it to cover feet in a waterproof form of a primitive shoe (Wolf and Wolf 1936). Sixteenth century Spanish conquistadors observed “the ball game”, the first team sport complete with court, spectator stands and solid rubber ball (Herrera y Tordesillas et al. 1725). In addition to religious significance, ball game contenders also gambled for land, slaves, and valuables (Hosler et al.

1999).

Although several European observers saw rubber as a curious and interesting material, two hundred years passed before any mention of rubber uses were suggested. Samples of India rubber were used in France as erasers in 1752 (Porritt 1927). British intellectual Joseph Priestly is often referenced as the inventor of the eraser by citing a 1770 note that he had “seen a substance excellently adapted to the purpose of wiping from paper the marks of a black lead pencil” (Priestley 1770) however Priestly never claimed the discovery. Another seventy years would lapse before real manufacturing efforts of rubber-derived goods was undertaken.

10 By 1823 Charles Mackintosh of England began making double-textured rubberized cloth by spreading naptha-dissolved rubber solutions over fabric with the intention of waterproofing the material (Levitt 1986). His raincoats forever became known as ‘mackintoshes’. At the same time Thomas Hancock developed rubber manufacturing machinery such as the mastication mill and calendar sheet roller. His factory also produced rubberized fabrics as well as rubber hoses, bumpers, carriage tires and other goods (Hancock 1857). Manufacturing was at full swing yet products were met with dissatisfaction because of their sensitivity to temperature extremes and horrible smell. At low temperatures the rubber became hard and brittle while in hot weather, sticky and soft. A processing invention discovered in 1839 would alleviate these flaws and revolutionize the rubber goods industry.

Vulcanization, named after the ancient Roman god of fire Vulcan, would be the saving grace of rubber manufacturing. The American Charles Goodyear is credited with the invention, a process of heating rubber with sulfur. Much of Goodyear’s career was met with failure and misfortune, yet he had invested himself in solving the problems associated with rubber properties. Many of his experiments were conducted in a make-shift home laboratory where he experimented with numerous rubber additives (Anon. 1958). In 1838 he met rubber factory owner Nathaniel Hayward who was using sulfur as a rubber drying agent. Goodyear tried sulfur as an additive and found that after heating at high temperature, some of the rubber charred but most had cured (New Haven Colony Historical Society 1975). Vulcanization of rubber created a chemical resistance, temperature and pressure resilient material that had elastic properties never before encountered. Upon further perfection of the process, Goodyear took out a patent on the method in 1844 (Goodyear 1844).

Rubber Properties

11 Rubber is an elastomer that possesses unique chemical and physical properties.

Polyisoprene in its original state is elastic, waterproof, and moldable. Yet native polyisoprene has limited use capabilities. At low ambient temperatures it becomes brittle, while at high temperatures tackiness and increased malleability becomes problematic. The basis for these properties is independent movement of the isoprene polymers in relation to one another. Polymer chain entanglements are the only interacting junctures to hold shape (Mark and Erman 1994). It was not until the discovery of vulcanization that the true potential of rubber was realized.

Vulcanization introduces cross-linkages of the isoprene polymers mainly through sulfur bridges.

Sulfur cross-linking is achieved when rubber dienes react with sulfur in the presence a catalyst, under heat and pressure. Numerous vulcanization methods have been developed depending on the end-use requirements of the material. The most important vulcanization techniques are press, open, continuous, and cold vulcanization (Nagdi 1993). Vulcanization increases the retractile force of distorted polymer chains when under mechanical stress and reduces the amount of permanent deformity remaining when deforming force is removed (Mark and Erman 1994).

Prolonged vulcanization with high sulfur produces a very hard, durable material known as ebonite or vulcanite (Kemp and Malm 1935).

Once vulcanized, rubber exhibits exceptional viscoelastic properties. The theory of rubber elasticity states that the retractile force to resist deformation is proportional to the number of network-supporting polymer chains per unit volume of elastomer (Flory 1953; Mark and

Erman 1994). In short, the amount and type of cross-links imparts the physical properties of the polymer in its changed state. There is a correlation between plasticity and elasticity that is directly related to the amount cross-linking. Hysteresis, a ratio measure of this relationship, decreases as cross-link density increases. Rubber polymers become more plastic-like and hard

12 with high cross-linking. Optimal cross-link densities maximize tear strength, fatigue life, toughness and tensile strength. Vulcanization beyond the optimal region diminishes these properties (Mark and Erman 1994).

To make high-quality, high performance vulcanized rubber products the natural rubber starting material must meet certain criteria. Polymer chain length or molecular weight and molecular weight distribution (dispersity) have a direct relationship to the processability of the rubber (Swanson, Buchanan, and Otey 1979). In general, longer polymer chains with narrow ð, give the best end-use performance.

Anatomy and Biochemistry of Polyisoprene Synthesis

Rubber consists of long chains of isoprene configured in a cis -1,4 orientation, otherwise known as polyisoprene. Natural rubber refers to the coagulated or precipitated polyisoprene isolated from the latex of rubber producing organisms. In plants, isoprene is synthesized via two independent and non-homologous cellular pathways. In the cytosol the well characterized mevalonate pathway (MVA) prevails. This pathway was first described in the 1950s and, for a time, was believed to be the only means of isoprene biosynthesis (McGarvey and Croteau 1995) although it was not present in most bacteria (Zhou and White 1991). More recently another plastidal pathway was discovered and described as the non-mevalonate, 2C-methyl-D-erythritol-

4-phosphate or 1-deoxy-D-xylulose-5-phosphate pathway (MEP/DOXP) (Rohmer et al. 1993).

The products generated from both pathways are isopentyl pyrophosphate (IPP) and its isomer dimethylallyl pyrophosphate (DMAPP), the precursors for all isoprenoid derived compounds.

Brazilian rubber tree rubber biosynthesis indicates MVA pathway as the source of isoprene subunits while isoprene from the MEP/DOXP is incorporated into diterpenoids and carotenoids

(Sando et al. 2008).

13 Prickly lettuce has the same or similar anatomical features as other rubber producing plants. Rubber is made and stored in specialized vascular cells called laticifers. Laticifer producing plants have either articulated laticifers where cells are connected via anastomoses, as with prickly lettuce, or are non-articulated (Kekwick 2001). Guayule does not possess laticifers but rather produces latex in specialized bark parenchyma cells (Ross 1908). Within the cytoplasm of laticifers cells are found spherically shaped, organelle-like, rubber particles. Rubber particles are surrounded by a fatty-acid mono layer membrane imbedded with the enzymatic machinery necessary for isoprene transfer and polymer elongation within the hydrophobic core of the particle (Cornish 2001). The protein and lipid components found in laticifer membranes are species specific. Within species, the lipid membranes are composed of the same lipid components of the cells from which they are derived suggesting the absence of a highly conserved structural and chemical composition of particle membranes (Cornish 2001). Particle associated proteins between species are also highly variable, differing in overall quantities and structure of the polymer producing enzyme(s). Rubber tree rubber is the most protein complex to date with over 80 particle associated proteins (Cornish 2001), while guayule has less than ten

(Siler et al. 1997).

Multiple studies have implicated several potentially important enzymes that are necessary for isoprene polymerization from various species. Because particle associated proteins do not have solubilized activity, conclusive evidence of specific rubber transferase protein(s) remains elusive. Current studies rely on isolation of enzymatically active washed rubber particles

(WRPs). In all cases polymer elongation requires a short trans -allylic diphosphate primer molecule such as farnesyl pyrophosphate (FPP), geranyl pyrophosphate (GPP), or geranyl– geranyl pyrophosphate (GGPP) to serve as initiators upon which monomers of IPP are

14 sequentially added (Archer and Audley 1987; Cornish 1993; Puskas et al. 2006). FPP is the substrate of choice for in vivo polymerization (da Costa, Keasling, and Cornish 2005; Espy et al.

2006). Divalent metal ion cofactors such as Mg 2+ or Mn 2+ are also requisite for enzymatic activity (Scott et al. 2003). Rubber cis -polyprenylcistransferase enzyme (EC 2.5.1.20), a rubber particle membrane-bound cis -prenyltransferase (CPT) is thought to be able to switch newly condensed IPP units from trans to cis configuration during polymer elongation (Tanaka 1989).

Rubber tree CPT identity and characterized function has been reported several times (Archer and

Cockbain 1969; Cornish 1993; Light and Dennis 1989). Similar CPT activities have been identified in other rubber bearing plants such as Ficus elastica Roxb. ex Hornem. and Ficus carica L. (Cornish and Siler 1996; Kang et al. 2000), guayule (Madhavan and Benedict 1984),

Russian dandelion (Schmidt et al. 2010) and lettuce (Bushman et al. 2006). Other particle membrane associated proteins implicated in cis -polyisoprene biosynthesis including rubber elongation factor (REF) (Dennis et al. 1989; Dennis and Light 1989) and small rubber particle protein (SRPP) (Kim et al. 2004; Oh et al. 1999; Schmidt et al. 2009). Interestingly, immunological studies from three rubber producing species, Ficus carica L., Ficus benghalensis

L. , and Brazilian rubber tree , found that CPT was not localized on particle surfaces of any of the three studied species. Rubber tree SRPP was found on the rubber tree particles but was not found on either F. carica , or F. benghalensis particles (Singh et al. 2003) suggesting that CPT is not part of the rubber transferase complex and SRPP is not required for polymer elongation. Further studies of the protein(s) or protein complex responsible for polymer elongation and chain length determination are needed. Because prickly lettuce is one of the few latex bearing species that produces long chain polyisoprene, it is an excellent model species for further elucidation of high molecular weight rubber biosynthesis.

15 Rubber Extraction Methods

To utilize plant synthesized rubber, intact particles or freed polymers must be tapped or extracted from the plant. In larger woody tree species such as Brazilian rubber tree, tapping is the method of choice. Tapping of rubber tree latex is usually done once every 2-3 days for 9 months of the year. Collection is made by cutting a thin layer of bark just above the cambial layer and collecting drips of latex into a cup. Anti-coagulating agents, usually ammonia, are added during collection to preserve the latex in liquid form or formic acid is added to the latex to coagulate the suspended rubber particles and collected as cup lump rubber (Sakdapipanich and Rojruthai

2012). Other rubber producing species under commercial investigation are not amenable to tapping procedures therefore more destructive methods must be used to release then isolate rubber particles or polymers from plant tissue. Plant processing in this manner presents challenges in maintaining rubber integrity throughout the extraction process. Processing of bulk rubber from guayule has been challenging due to low bulk viscosity and entrained co-extracted resin causing oxidative and thermal polymer degradation (Schloman 2005). The chemical and physical properties of rubber isolated from plant tissue is an artifact of the polymer structure within the latex-bearing cells and the method of polymer extraction as noted in guayule extractions (Schloman 2005).

In general there are two main methods of rubber extraction, solvent extraction and floatation. Chemical extraction of rubber involves isolation of rubber polymers from plant material and other metabolites using selective solvents after grinding of plant material. Solvents can be added sequentially or simultaneously. In sequential solvent extraction a polar organic solvent such as acetone is first used to extract pigments, polar lipids, resins, and other polar metabolites while leaving non-polar hydrocarbons. A second, non-polar dissolving solvent such

16 as hexane, cyclohexane, toluene or benzene is used to then solubilize rubber. All other non-polar compounds such as waxes and lipids could be present as impurities in the rubber fraction.

Simultaneous solvent extraction includes addition of a single solvent such as xylene (Wagner and Parma 1988) or an azeotropic mixed solvent system (Beinor and Cole 1986). Simultaneous extraction produces a mixture of dissolved resin and rubber. Precipitation of the rubber by addition of acetone or alcohol is a means of further purifying the rubber polymers. For most small scale analytical purposes, chemical extraction has been the method of choice. Researchers have used various chemical extraction methods to analyze rubber from diverse plant derived sources (De Rodriguez and Kuruvadi 1991; Hammond and Polhamus 1965; Mekkriengkrai et al.

2004; Nurthen et al. 1986; Pearson et al. 2010; Pearson, Cornish, and Rath 2013; Spanò et al.

2012). However, on a large scale, chemical extraction is not the method of choice due to costs associated with solvent purchase and recovery and flammability hazards. Rubber from guayule has been extracted for bulk rubber production through chemical extraction methods

(Hamerstrand and Montgomery 1984; Schloman 2005).

Floatation extraction methods have also been used in lab scale experiments and bulk rubber production. This method usually involves milling and centrifugation steps in an aqueous buffer, the addition of acid to coagulate rubber or creaming agents to float the rubber particles is a common practice (Buranov and Elmuradov 2010; Cornish and Backhaus 1990). Direct water milling and floatation methods have been developed for application to fleshy plants (Eskew and

Edwards 1946; Stamberger, Koenig, and Hanslick 1946)

17 performed by hand, decreasing efficiency, and latex stability must be maintained by addition of anti-coagulants and anti-oxidants. Plants that must be destroyed to harvest rubber must have optimized extraction procedures that increase rubber yield and decrease rubber degradation.

Efficient, non-degradative extraction of rubber from prickly lettuce will be a major hurdle to overcome to produce high quality bulk rubber.

Research Objectives

The objective of this dissertation was to study the rubber making potential of a prevalent, well adapted, troublesome weed in eastern Washington. The goal was to characterize rubber production between various prickly lettuce biotypes and further identify molecular markers that would be useful in development of this weed as a crop plant. The findings of this dissertation are divided into five chapters that summarize: 1) Rubber content and quality screen of eastern

Washington prickly lettuce biotypes; 2) Genetic map development and marker association with rubber producing traits; 3) Rubber extraction methods and physical properties of rubber extracted from prickly lettuce biotypes; and 4) Microscopic description of prickly lettuce rubber particles; and 5) Future direction from this research. Additionally, a chapter on science and philosophy as seen by this scientist concludes the chapter sections.

18 Literature Cited

Alcocer-Ruthling, M., D. C. Thill, and B. Shafii. 1992. Seed biology of sulfonylurea-resistant

and -susceptible biotypes of prickly lettuce ( Lactuca serriola ). Weed Technol 6:858–864.

Anon. The Charles Goodyear story and the strange story of rubber. 1958. Readers Digest ,

January. http://www.goodyear.com/corporate/history/history_story.html. (Accessed

November 6, 2012).

Archer, B. L., and B. G. Audley. 1987. New aspects of rubber biosynthesis. Botanical Journal of

the Linnean Society 94 (1-2): 181–196.

Archer, B. L., and E.G. Cockbain. 1969. Rubber transferase from Hevea brasiliensis latex. In

Methods in Enzymology , ed. R. B. Clayton, Volume 15:476–480. Academic Press.

Babcock, B. A., and J. F. Fabiosa. 2011. The impact of ethanol and ethanol subsidies on corn

prices: Revisiting history. CARD Policy Brief 11.

Beinor, R. T., and W. M. Cole. 1986. Solvent fractionation of guayule rubber. U.S. Pat.

4,623,713.

Belcher, B., N. I. Rujehan, and R. Achdiawan. 2004. Rattan, rubber, or oil palm: Cultural and

financial considerations for farmers in Kalimantan. Economic Botany 58:S77–S87.

Bowers, J. E., 1990. Natural rubber-producing plants for the United States. Beltsville, Md.:

National Agricultural Library.

Buchanan, R. A., I. M. Cull, F. H. Otey, and C. R. Russell. 1978. Hydrocarbon- and rubber-

producing crops: Evaluation of 100 U.S. plant species. Economic Botany 32:146–153.

Buranov, A. U., and B. J. Elmuradov. 2010. Extraction and characterization of latex and natural

rubber from rubber-bearing Plants. Journal of Agricultural and Food Chemistry 58:734–

743.

19 Burke, I. C., J. P. Yenish, D. Pittmann, and R. S. Gallagher. 2009. Resistance of a prickly lettuce

(Lactuca serriola ) biotype to 2,4-D. Weed Technology 23:586–591.

Bushman, B. S., A. A. Scholte, K. Cornish, D. J. Scott, J. L. Brichta, J. C. Vederas, O. Ochoa, R.

W. Michelmore, D. K. Shintani, and S. J. Knapp. 2006. Identification and comparison of

natural rubber from two Lactuca species. Phytochemistry 67:2590–2596.

Carr, M. E., and M. O. Bagby. 1987. Tennessee plant species screened for renewable energy

sources. Economic Botany 41:78–85.

Compositae Genome Project Database, CGPDB; http://compgenomics.ucdavis.edu/. (Accessed

November 24, 2012)

Cornish, K., 1993. The separate roles of plant cis and trans prenyl transferases in cis-1,4-

polyisoprene biosynthesis. European Journal of Biochemistry 218:267–271.

Cornish, K., 2001. Similarities and differences in rubber biochemistry among plant species.

Phytochemistry 57:1123–1134.

Cornish, K., and D. J. Siler. 1996. Characterization of cis-prenyl transferase activity localised in

a buoyant fraction of rubber particles from Ficus elastica latex. Plant Physiology and

Biochemistry 34:377-384.

Cornish, K., and R. A. Backhaus. 1990. Rubber transferase activity in rubber particles of

guayule. Phytochemistry 29:3809–3813.

D’Andrea, L., F. Felber, and R. Guadagnuolo. 2008. Hybridization rates between lettuce

(Lactuca sativa ) and its wild relative ( L. serriola ) under field conditions. Environmental

Biosafety Research 7:61–71.

20 da Costa, B. M. T., J. D. Keasling, and K. Cornish. 2005. Regulation of rubber biosynthetic rate

and molecular weight in Hevea brasiliensis by metal cofactor. Biomacromolecules

6:279–289.

Davis, W., 1997. The rubber industry’s biological nightmare. Fortune , August 4.

De Rodriguez, D. J., and S. Kuruvadi. 1991. Comparison of soxhlet and homogenizer extraction

methods to determine rubber and resin content of Mexican guayule plants. Bioresource

Technology 35:179–183. de Vries, I.M. 1997. Origin and domestication of Lactuca sativa L. Genetic Resources and Crop

Evolution 44:165–174.

Dennis, M. S., and D. R. Light. 1989. Rubber elongation factor from Hevea brasiliensis :

Identification, characterization, and role in rubber biosynthesis. Journal of Biological

Chemistry 264:18608–18617.

Dennis, M. S., W. J. Henzel, J. Bell, W. Kohr, and D. R. Light. 1989. Amino acid sequence of

rubber elongation factor protein associated with rubber particles in Hevea latex. Journal

of Biological Chemistry 264:18618–18626.

Esau, K., 1965. Plant Anatomy . 2nd ed. New York: Wiley.

Eskew, R. K., and P. W. Edwards. 1946. Process for recovering rubber from fleshy plants. U.S.

Pat. 2,393,035.

Espy, S. C., J. D. Keasling, J. Castillón, and K. Cornish. 2006. Initiator-independent and

initiator-dependent rubber biosynthesis in Ficus elastica . Archives of Biochemistry and

Biophysics 448:13–22.

Evans, S. T., 2008. Ancient Mexico & Central America: Archaeology and Culture History .

Thames & Hudson.

21 Flory, P. J. 1953. Principles of Polymer Chemistry . Cornell University Press.

Fox, C. P., 1913. Wild Lettuce Rubber. J. Ind. Eng. Chem. 5:477–478.

Fukuda, M., S. Matsuo, K. Kikuchi, Y. Kawazu, R. Fujiyama, and I. Honda. 2011. Isolation and

functional characterization of the FLOWERING LOCUS T homolog, the LsFT Gene, in

lettuce. Journal of Plant Physiology 168:1602–1607.

Gallardo, M., L. E. Jackson, and R. B. Thompson. 1996. Shoot and root physiological responses

to localized zones of soil moisture in cultivated and wild lettuce ( Lactuca spp. ). Plant,

Cell & Environment 19:1169–1178.

Goodyear, C. 1844. Improvements in India-rubber fabrics. New York, N.Y. U.S. Pat. 3633.

Hall, H. M., and T. H. Goodspeed. 1919. The Occurrence of Rubber in Certain West American

Shrubs . Univ. of California Press.

Hamerstrand, G. E., and R. R. Montgomery. 1984. Pilot-scale guayule processing using

countercurrent solvent extraction equipment. Rubber Chemistry and Technology 57:344–

350.

Hammond, B. L., and L. G. Polhamus. 1965. Research on Guayule (Parthenium argentatum),

1942-1959 . U.S. Dept. of Agriculture.

Hancock, T. 1857. Personal narrative of the origin and progress of the caoutchouc or india-

rubber manufacture in England. London: Longman, Brown, Green, Longmans, &

Roberts.

Hanf, M. 1983. The arable weeds of Europe with their seedlings and seeds. BASF.

Harlan, J. R., and J. M. J. de Wet. 1971. Toward a rational classification of cultivated plants.

Taxon 20:509–517.

22 Hayashi, Y. 2009. Production of natural rubber from para rubber tree. Plant Biotechnology

70:67–70.

Heap, I. International Survey of Herbicide Resistant Weeds. http://www.weedscience.org/

(Accessed November 6, 2012).

Herrera y Tordesillas, Antonio de., J.Stevens, T. Heye, Heye Foundation Museum of the

American Indian, and Huntington Free Library. 1725. The general history of the vast

continent and islands of America: commonly call’d the West-Indies, from the first

discovery thereof: with the best accounts the people could give of their antiquities .

London: Printed for J. Batley.

Hosler, D., S. L. Burkett, and M. J. Tarkanian. 1999. Prehistoric polymers: Rubber processing in

ancient Mesoamerica. Science 284:1988–1991.

Hu, J., O. Ochoa, M. Truco, and B. Vick. 2005. Application of the TRAP technique to lettuce

(Lactuca sativa L.) genotyping. Euphytica 144:225–235.

International Rubber Study Group. International Rubber Study Group - Home Page.

http://www.rubberstudy.com/ (Accessed October 24, 2012)

Jackson, L. E. 1995. Root architecture in cultivated and wild lettuce ( Lactuca spp. ). Plant, Cell

& Environment 18:885–894.

Jansen, J., H. Verbakel, J. Peleman, and Th. J. L. Hintum. 2005. A note on the measurement of

genetic diversity within genebank accessions of lettuce ( Lactuca sativa L.) Using AFLP

markers. Theoretical and Applied Genetics 112:554–561.

Jeuken, M., R. Van Wijk, J. Peleman, and P. Lindhout. 2001. An integrated interspecific AFLP

map of lettuce (Lactuca) based on two L. Saligna x L. sativa F2-populations. Theoretical

and Applied Genetics 4:638-647.

23 Kang, H., M.Y. Kang, and K.-H. Han. 2000. Identification of natural rubber and characterization

of rubber biosynthetic activity in fig tree. Plant Physiology 123:1133–1142.

Kekwick, R. GO. 2001. Latex and Laticifers. In eLS .

http://onlinelibrary.wiley.com/doi/10.1038/npg.els.0000913/full. John Wiley & Sons,

Ltd.

Kemp, A. R., and F. S. Malm. 1935. Hard rubber (ebonite). Industrial & Engineering Chemistry

27:141–146.

Kesseli, R. V., I. Paran, and R. W. Michelmore. 1994. Analysis of a detailed genetic linkage map

of Lactuca sativa (lettuce) constructed from RFLP and RAPD markers. Genetics

136:1435 –1446.

Kesseli, R., O. Ochoa, and R. Michelmore. 1991. Variation at RFLP loci in Lactuca spp. and

origin of cultivated lettuce ( L. sativa ). Genome 34:430–436.

Kim, I. J., S. B. Ryu, Y. S. Kwak, and H. Kang. 2004. A novel cDNA from Parthenium

argentatum Gray enhances the rubber biosynthetic activity in vitro. Journal of

Experimental Botany. 55:377–385.

Koopman, W. J. M., M. J. Zevenbergen, and R. G. Van den Berg. 2001. Species relationships in

Lactuca s.l. (Lactuceae, Asteraceae) inferred from AFLP fingerprints. American Journal

of Botany. 88:1881–1887.

Kuang, H., H. J. Van Eck, D. Sicard, R. Michelmore, and E. Nevo. 2008. Evolution and genetic

population structure of prickly lettuce ( Lactuca serriola ) and its RGC2 resistance gene

cluster. Genetics 178:1547–1558.

24 Lai, C. C., D. C. Yan, J. Yu, C. C. Chou, B. L. Chiang, and K. H. Hsieh. 1997. Latex Allergy in

Hospital Employees. Journal of the Formosan Medical Association = Taiwan Yi Zhi.

96:266–271.

Le Guen, V., M. Rodier ‐Goud, V. Troispoux, T. C. Xiong, P. Brottier, C. Billot, and M. Seguin.

2004. Characterization of polymorphic microsatellite markers for Microcyclus ulei ,

causal agent of South American leaf blight of rubber trees. Molecular Ecology Notes

4:122–124.

Lebeda, A. 1998. Biodiversity of the Interactions Between Germplasms of Wild Lactuca Spp. and

Related Genera and Lettuce Downy Mildew (Bremia Lactucae) . Report on research

programme OECD Biological Resource Management for Sustainable Agricultural

Systems. HRI Wellesbourne (UK).

Lebeda, A., D. A. C. Pink, and D. Astley. 2002. Aspects of the interactions between wild

Lactuca spp. and related genera and lettuce downy mildew ( Bremia lactucae ). In

Advances in Downy Mildew Research , ed. P. T. N. Spencer-Phillips, U. Gisi, and A.

Lebeda, 85–117. Springer Netherlands.

Lettuce Genome Resource. https://lgr.genomecenter.ucdavis.edu/ (Accessed September 17,

2012).

Levitt, S. 1986. Manchester Mackintoshes: A History of the Rubberized Garment Trade in

Manchester . 17th ed. Vol. Textile History.

Light, D. R., and M. S. Dennis. 1989. Purification of a prenyltransferase that elongates cis-

polyisoprene rubber from the latex of Hevea brasiliensis . Journal of Biological

Chemistry 264:18589–18597.

25 Madhavan, S., and C. R. Benedict. 1984. Isopentenyl pyrophosphate cis-1,4-polyisoprenyl

transferase from guayule ( Parthenium argentatum Gray). Plant Physiology 75:908–913.

Mallory-Smith, C. A., D. C. Thill, and M. J. Dial. 1990. Identification of sulfonylurea herbicide-

resistant prickly lettuce ( Lactuca serriola ). Weed Technology 4:163–168.

Mallory-Smith, C. A., D. C. Thill, M. J. Dial, and R. S. Zemetra. 1990. Inheritance of

sulfonylurea herbicide resistance in Lactuca spp. Weed Technology 4:787–790.

Mark, J. E., and B. Erman. 1994. Science and Technology of Rubber . Academic Press.

Marks, M. K., and S. D. Prince. 1979. Induction of flowering in wild lettuce ( Lactuca serriola

L.). II. Devernalization. New Phytologist 82:357–363.

Marks, M., and S. Prince. 1981. Influence of germination date on survival and fecundity in wild

lettuce Lactuca serriola . Oikos 36:326–330.

McGarvey, D J, and R Croteau. 1995. Terpenoid metabolism. The Plant Cell 7:1015–1026.

McGuire, P.E., E. J. Ryder, R. Michelmore, R.L. Clark, R. Antle, E. Emery, R.M. Hannan, R. V.

Kesseli, E. A. Kurtz, O. Ochoa, E. Rubatzky, W. William. 1993. Genetic Resources of

Lettuce and Lactuca Species in California: An Assessment of the USDA and UC

Collections and Recommendations for Long-term Security. Report 12. Davis: Univ. of

California Genetic Resources Conservation Program.

Mekkriengkrai, D., K. Ute, E. Swiezewska, T. Chojnacki, Y. Tanaka, and J. T. Sakdapipanich.

2004. Structural characterization of rubber from jackfruit and Euphorbia as a model of

natural rubber. Biomacromolecules 5:2013–2019.

Metcalfe, C. R. 1967. Distribution of latex in the plant kingdom. Economic Botany 21:115–127.

Mitchell, J. H., M. A. Rice, and D. B. Roderick. 1942. Rubber analysis of plants in South

Carolina. Rubber Chemistry and Technology 15:978.

26 Mooibroek, H., and K. Cornish. 2000. Alternative sources of natural rubber. Applied

Microbiology and Biotechnology 53:355–365.

Moreno-Vázquez, S., O. E. Ochoa, N. Faber, S. Chao, J. M. E. Jacobs, B. Maisonneuve, R. V.

Kesseli, and R. W. Michelmore. 2003. SNP-based codominant markers for a recessive

gene conferring resistance to corky root rot ( Rhizomonas suberifaciens ) in lettuce

(Lactuca sativa). Genome 46:1059–1069.

Mou, B. 2012. Nutritional quality of lettuce. Current Nutrition & Food Science 8:177–187.

Nagdi, K. 1993. Rubber as an Engineering Material: Guideline for Users . Hanser Verlag.

New Haven Colony Historical Society, New Haven. 1975. The Completion of Independence in

New Haven: Pioneers of Culture and Industry . The Society.

Nicolle, C., N. Cardinault, E. Gueux, L. Jaffrelo, E. Rock, A. Mazur, P. Amouroux, and C.

Rémésy. 2004. Health effect of vegetable-based diet: Lettuce consumption improves

cholesterol metabolism and antioxidant status in the rat. Clinical Nutrition 23:605–614.

Nurthen, E. J., B. V. McCleary, P. L. Milthorpe, and J. W. Whitworth. 1986. Modified soxhlet

procedure for the quantification of resin and rubber content of guayule. Anal. Chem.

58:448–453.

Oh, S. K., H. Kang, D. H. Shin, J. Yang, K. S. Chow, H. Y. Yeang, B. Wagner, H. Breiteneder,

and K. H. Han. 1999. Isolation, characterization, and functional analysis of a novel

cDNA clone encoding a small rubber particle protein from Hevea brasiliensis . The

Journal of Biological Chemistry 274:17132–17138.

Pearson, C.H., K. Cornish, and D.J. Rath. 2013. Extraction of natural rubber and resin from

guayule using an accelerated solvent extractor. Industrial Crops and Products 43:506–

510.

27 Pearson, C.H., K. Cornish, C.M. McMahan, D.J. Rath, and M. Whalen. 2010. Natural rubber

quantification in sunflower using an automated solvent extractor. Industrial Crops and

Products 31:469–475.

Polhamus, L. 1958. Rubber content of miscellaneous plants, production research report No. 10.

Agricultural Research Service, U.S. Dept. of Agriculture.

Polhamus, L. 1962. Rubber: botany, production, and utilization . London; New York: L. Hill;

Interscience Publishers.

Porritt, B. D. 1927. The Early History of the Rubber Industry . Rubber Growers’ Association.

Priestley, J. 1770. A familiar introduction to the theory and practice of perspective . London,

Printed for J. Johnson and J. Payne.

Prince, S. D., and M. K. Marks. 1982. Induction of flowering in wild lettuce ( Lactuca serriola

L.). III. Vernalization-devernalization cycles in buried seeds. New Phytologist 91:661–

668.

Prince, S. D., M. K. Marks, and R. N. Carter. 1978. Induction of flowering in wild lettuce

(Lactuca serriola L.). New Phytologist 81:265–277.

Puskas, J. E., E. Gautriaud, A. Deffieux, and J. P. Kennedy. 2006. Natural rubber biosynthesis—

A living carbocationic polymerization? Progress in Polymer Science 31:533–548.

Reed, C. F. 1970. Selected Weeds of the United States . Agriculture Handbook 336. U.S.

Agricultural Research Service.

Reinink, K. 1999. Lettuce resistance breeding. Proceedings of the Eucarpia meeting on leafy

vegetables genetics and breeding, Olomouc (Czech Republic).

28 Riar, D. S., I. C. Burke, J. P. Yenish, J. L. Bell, and K. Gill. 2011. Inheritance and physiological

basis for 2,4-D resistance in prickly lettuce ( Lactuca serriola L.). Journal of Agricultural

and Food Chemistry 59:9417–9423.

Riar, D. S., S. Rustgi, I. C. Burke, K. S. Gill, and J. P. Yenish. 2011. EST-SSR development

from 5 Lactuca species and their use in studying genetic diversity among L. serriola

biotypes. Journal of Heredity 102:17 –28.

Rohmer, M., M. Knani, P. Simonin, B. Sutter, and H. Sahm. 1993. Isoprenoid biosynthesis in

bacteria: A novel pathway for the early steps leading to isopentenyl diphosphate.

Biochemical Journal 295:517–524.

Rolland, J. M., A. C. Drew, and R. E. O’Hehir. 2005. Advances in development of

hypoallergenic latex immunotherapy. Current Opinion in Allergy and Clinical

Immunology 5:544–551.

Ross, H. 1908. Der anatomische bau der Mexikanischen kautschukpflanze ‘guayule’,

Parthenium argentatum Gray. Berichte Der Deutsche Botanischen Gesellschaft

26A:248–263.

Rousseau, C. 1968. Histoire, habitat et distribution de 220 plantes introduites au Québec .

Ludoviciana; 5. Herbier Louis-Marie.

Ryder, E. J. 1999. Lettuce, Endive, and Chicory . CABI Pub.

Ryder, E. J., and D. C. Milligan. 2005. Additional genes controlling flowering time in Lactuca

sativa and L. serriola . Journal of the American Society for Horticultural Science 130:448

–453.

29 Sakdapipanich, J. T., and P. Rojruthai. 2012. Molecular Structure of Natural Rubber and Its

Characteristics Based on Recent Evidence. In Biotechnology - Molecular Studies and

Novel Applications for Improved Quality of Human Life , ed. Reda Sammour. InTech.

Sando, T., S. Takeno, N. Watanabe, H. Okumoto, T. Kuzuyama, A. Yamashita, M. Hattori, N.

Ogasawara, E. Fukusaki, and A. Kobayashi. 2008. Cloning and characterization of the 2-

Methyl-d-erythritol 4-phosphate (MEP) pathway genes of a natural-rubber producing

plant, Hevea brasiliensis . Bioscience, Biotechnology, and Biochemistry 72:2903–2917.

Schloman Jr., W. W. 2005. Processing guayule for latex and bulk rubber. Industrial Crops and

Products 22:41–47.

Schmidt, T., A. Hillebrand, D. Wurbs, D. Wahler, M. Lenders, C. S. Gronover, and D. Prüfer.

2009. Molecular cloning and characterization of rubber biosynthetic genes from

Taraxacum koksaghyz . Plant Molecular Biology Reporter 28:277–284.

Schmidt, T., M. Lenders, A. Hillebrand, N. Van Deenen, O. Munt, R. Reichelt, W. Eisenreich, R.

Fischer, D. Prüfer, and C. Gronover. 2010. Characterization of rubber particles and

rubber chain elongation in Taraxacum koksaghyz . BMC Biochemistry 11:11.

Schoennagel, T. L., and D. M. Waller. 1999. Understory responses to fire and artificial seeding

in an eastern Cascades Abies grandis forest. USA Can. J. For. Res. 29:1393–1401.

Scott, D. J., B. M. T. da Costa, S. C. Espy, J. D. Keasling, and K. Cornish. 2003. Activation and

inhibition of rubber transferases by metal cofactors and pyrophosphate substrates.

Phytochemistry 64:123–134.

Sicard, D., S.-S. Woo, R. Arroyo-Garcia, O. Ochoa, D. Nguyen, A. Korol, E. Nevo, and R.

Michelmore. 1999. Molecular diversity at the major cluster of disease resistance genes in

cultivated and wild Lactuca spp . Theoretical and Applied Genetics 99:405–418.

30 Siler, D. J., M. Goodrich-Tanrikulu, K. Cornish, A. E. Stafford, and T. A. Mckeon. 1997.

Composition of rubber particles of Hevea brasiliensis , Parthenium argentatum , Ficus

elastica , and Euphorbia lactiflua indicates unconventional surface structure. Plant

physiology and biochemistry 35: 881–889.

Simko, I. 2009. Development of EST-SSR markers for the study of population structure in

lettuce ( Lactuca sativa L.). Journal of Heredity 100:256 –262.

Singh, A. P., S. G. Wi, G. C. Chung, Y. S. Kim, and H. Kang. 2003. The micromorphology and

protein characterization of rubber particles in Ficus carica , Ficus benghalensis and

Hevea brasiliensis . Journal of Experimental Botany 54:985 –992.

Slater, J. E. 1989. Rubber anaphylaxis. The New England Journal of Medicine 320:1126–1130.

Spanò, D., F. Pintus, C. Mascia, M. A. Scorciapino, M. Casu, G. Floris, and R. Medda. 2012.

Extraction and characterization of a natural rubber from Euphorbia characias latex.

Biopolymers 97:589–594.

Stamberger, P., E. R. Koenig, and R. S. Hanslick. 1946. Treatment of rubber. U.S. Pat.

2,399,156.

Stevens, R., and I. C. Burke. 2009. Field response of prickly lettuce accessions to application s of

2,4-D, glyphosate, pyrasulfotole plus bromoxynil, and thifensulfuron. In Proc. West Soc.

Weed Sci. 62:26. Albuquerque, New Mexico.

Swanson, C. L., R. A. Buchanan, and F. H. Otey. 1979. Molecular weights of natural rubbers

from selected temperate zone plants. J Appl Polym Sci 23:743–748.

Tanaka, Y. 1989. Structure and biosynthesis mechanism of natural polyisoprene. Progress in

Polymer Science 14:339–371.

31 Tosi, L. L., J. E. Slater, C. Shaer, and L. A. Mostello. 1993. Latex allergy in spina bifida

patients: prevalence and surgical implications. Journal of Pediatric Orthopedics 13:709–

712.

Truco, M. J., R. Antonise, D. Lavelle, O. Ochoa, A. Kozik, H. Witsenboer, S. B. Fort, M. J. W.

Jeuken, R.V. Kesseli, P. Lindhout, R.W. Michelmore, J. Peleman. 2007. A high-density,

integrated genetic linkage map of lettuce ( Lactuca spp. ). Theoretical and Applied

Genetics 115:735–746.

Ulmann, M. 1951. Wertvolle kautschukpflanzen des gema ssigten klimas: Dargestellt auf grund

sowjetischer forschungsarbeiten. Akademie-Verlag.

Van Beilen, J. B., and Y. Poirier. 2007. Establishment of new crops for the production of natural

rubber. Trends in Biotechnology 25: 522–529.

Van de Wiel, C. C. M., T. Sretenovi ć Raji čić, R. Van Treuren, K. J. Dehmer, C. G. Van der

Linden, and Th. J. L. Van Hintum. 2010. Distribution of genetic diversity in wild

European populations of prickly lettuce ( Lactuca serriola ): Implications for plant genetic

resources management. Plant Genetic Resources 8:171–181.

Van Leeuwen, H., K. Stoffel, A. Kozik, X. Cui, H. Ashrafi, L. McHale, D. Lavelle, G. Wong, F.

Chen, M. Truco, A. Van Deynze, R. Michelmore. 2009. High-density mapping of the

lettuce genome with SFP markers in over 15,000 unigenes. Plant & Animal Genomes

XVII Conference, San Diego, CA.

Vicente, M. J., E. Conesa, J.A. Franco, J. Esteva, and J.J. Martinez-Sanchez. 2008. Genetic

variability in lettuce ( Lactuca sativa ) germplasm using morphologic and molecular

analyses. Acta Hort . 782:59-66.

32 Wagner, J. P., and D. G. Parma. 1988. Continuous solvent extraction process for recovery of

natural rubber from guayule. Polymer-Plastics Technology and Engineering 27:335–350.

Watts, L. E. 1958. Natural cross-pollination in lettuce, Lactuca sativa L. Nature 181:1084

Waycott, W., and S. B. Fort. 1994. Differentiation of nearly identical germplasm accessions by a

combination of molecular and morphologic analyses. Genome / National Research

Council Canada = Génome / Conseil National De Recherches Canada 37:577–583.

Weaver, S. E., and M. P. Downs. 2003. The biology of Canadian weeds. 122. Lactuca serriola L.

Canadian Journal of Plant Science 83:619–628.

Werk, K. S., and J. Ehleringer. 1984. Non-random leaf orientation in Lactuca serriola L. Plant,

Cell & Environment 7:81–87.

Werk, K. S., and J. Ehleringer. 1985. Photosynthetic characteristics of Lactuca serriola L. Plant,

Cell & Environment 8:345–350.

Werk, K. S., and J. Ehleringer. 1986. Effect of nonrandom leaf orientation on reproduction in

Lactuca serriola L. Evolution 40:1334–1337.

Werk, K. S., and J. Ehleringer. 1986. Field water relations of a compass plant, Lactuca serriola

L. Plant, Cell & Environment 9:681–683.

Whaley, W. G., and J. S. Bowen. 1947. Russian dandelion (kok-saghyz): An emergency source of

natural rubber . Washington, D.C.: U.S. Dept. of Agriculture.

Wolf, H., and R. F. Wolf. 1936. Rubber: a Story of Glory and Greed . Covici, Friede.

Zhou, D., and R. H. White. 1991. Early steps of isoprenoid biosynthesis in Escherichia coli .

Biochemical Journal 273:627–634.

Zohary, D. 1991. The wild genetic resources of cultivated lettuce ( Lactuca sativa L.). Euphytica

53:31–35.

33 Chapter 2

Rubber Content and Quality Screen of Twenty Eastern Washington Prickly

Lettuce Biotypes

Abstract

To explore the potential of prickly lettuce ( Lactuca serriola L.) as an alternative source of natural rubber, twenty eastern Washington biotypes were collected and grown in common greenhouse and field gardens. The biotypes were morphological variable and many were Group

2 herbicide resistant. Prickly lettuce latex was tapped from stems of both greenhouse and field grown plants. Collected latex was dried under vacuum for 48 h at 35 ºC and solvent extracted to yield percent latex components by weight. ANOVA indicated that latex composition was similar among environments. Prickly lettuce latex composition, averaged over environment, was composed of water (61.7 %), insoluble (23.2 %), acetone soluble (13.8 %), and hexane soluble material (3.2 %). The amount of extractable rubber material ranged from 2.2 % to 4.9 % by weight between biotypes. The rubber fraction was further analyzed by gel permeation chromatography (GPC) HPLC, with refractive index detector to evaluate rubber ( cis -1,4- polyisoprene) polymer chain length. GPC software was used in conjunction with polystyrene standards to give an estimation of average molecular weight (Mn), weighted average molecular weight (M W), and ð. All collected biotypes have an average polymer MW considered high quality (>1x10 6 g mol -1) with several producing polymers greater than 2x106 g mol -1. Average polymer ð was 2.91 and ranged from 2.31 to 3.99 between biotypes. Identification of prickly lettuce biotypes with favorable rubber producing traits will support further studies on rubber synthesis control mechanisms and assist in selection of rubber lettuce cultivars

34 Introduction

Weeds are potential sources of plant derived bio-products and biomass. Weeds are well adapted to grow with little water and nutrients, and are usually resistant to disease and insect pests. Many weed species have high biomass yields due to photosynthetic efficiency. The use of herbicides and their inherent selection pressure has contributed to the development of herbicide resistant weed populations, a trait that could be used in their development as a crop. Weedy plants could provide value-added bioproducts that increase the economic feasibility of establishing them as crops for biomass and bioproducts. One such weed, prickly lettuce ( Lactuca serriola L.), has been long been recognized as a plant species able to produce high molecular weight rubber (Bushman et al. 2006), an important plant bioproduct.

Demand for natural rubber continues to rise. Since natural rubber was first discovered and commercialized, production has steadily increased (International Rubber Study Group 2012).

Natural rubber is used to manufacture over 40,000 products including 400 medical devices

(Mooibroek and Cornish 2000) and is an important constituent of 600 components of a single passenger car (Dick 2003). In 2011, worldwide manufacture of natural rubber reached

10,978,000 t with consumption at 10,919,000 t. Yearly production is at demand levels with minimal surpluses reported. In 2010, there was a 377,000 t deficit in consumption versus production (International Rubber Study Group 2012). Natural rubber has strategic importance given that the single current source of natural rubber for large scale production, the Brazilian rubber tree [Hevea brasiliensis (Willd. ex A. Juss.) Müll. Arg.], is endemic to tropical regions.

Security of supply chains to countries were rubber cannot be produced is a high priority. The

Brazilian rubber tree is native to the Amazon basin yet has been propagated and cultivated in many tropical regions throughout the world, most notably the south Pacific. Thailand, Indonesia

35 and Malaysia are the top three leading world exporters of natural rubber (Hayashi 2009).

Reliance on a single plant species has foreseeable drawbacks and real potential dangers. The current crop of plantation-grown trees is almost entirely made up of cloned individuals. The lack of genetic variability renders entire plantations susceptible to pathogen attack as observed on cultivated trees in South America, damaged by leaf blight (Davis 1997; Le Guen et al. 2004). As rubber trees can only be cultivated in tropical climates, countries in temperate regions are dependent upon those few producing countries for the entire supplies of natural rubber.

Economic and political instabilities in many of these developing countries could jeopardize imports. In addition, supplies could diminish as growers switch to more valuable crops such as oil palm and rattan (Belcher, Rujehan, and Achdiawan 2004). Therefore alternative plant species that are able to efficiently generate the quantity and quality of natural rubber as their tropical counterparts are of high demand.

Additionally, latex from the rubber tree causes latex allergies. Proteins present in rubber tree latex products, most notably hevein, induce allergic reactions in > 7 % of the population

(Rolland, Drew, and O’Hehir 2005). Health care workers and patients requiring repeated medical procedures or long-term hospitalization are at increased risk of developing latex hypersensitivity

(Tosi et al. 1993; Lai et al. 1997). The allergic response is an immunoglobulin E (IgE)-mediated

Type 1 reaction which in serious cases leads to life-threatening anaphylaxis.

Most rubber products used globally are petroleum-based. In 2011, 57.8 % of total worldwide rubber production and consumption was synthetically made (International Rubber

Study Group 2012). Synthetic rubber (predominantly a styrene-butadiene polymer) has not entirely replaced natural rubber because synthetic manufactures have yet to reproduce the desirable characteristics present in natural rubber. Natural rubber products have high tensile

36 strength, resilience, elasticity, abrasion and impact resistance, efficient heat dispersion, and malleability at cold temperatures, all of which are essential attributes in high performance applications. As synthetic-based products are derived from a non-renewable resource, natural rubber will be needed to supplement and eventually replace synthetic productions as oil supplies are exhausted. Domestication and commercialization of rubber-producing crops is the best short and long-term solution to the future decline in synthetic rubber supply, especially for developed countries such as the United States, the second largest consumer of natural rubber (Hayashi

2009). Esau (1965) identified 12,500 plant species across twenty families and 900 genera that produce latex. Of these, rubber could be produced from the latex of 1800 of the species across eight families and 300 genera (Metcalfe 1967). While there have been attempts to identify various temperate or tropical plant species as a source of natural rubber, success has been limited

(Bowers 1990; Buchanan et al. 1978; Carr and Bagby 1987; Hall and Goodspeed 1919; Mitchell,

Rice, and Roderick 1942; Polhamus 1958). Very few plant species can produce latex for use in the production of durable high molecular weight rubber or simply cannot efficiently produce enough latex per hectare as the rubber tree (Mooibroek and Cornish 2000). Currently, only

Parthenium argentatum (Gray), commonly known as guayule, is used for commercial production of hypoallergenic latex products and only on a small scale (Cornish 2001), and there is considerable interest in Russian dandelion ( Taraxacum koksaghyz L.E. Rodin) (Van Beilen and

Poirier 2007). Production of rubber products from guayule may meet the demands of medical markets. However, guayule will not produce sufficient amounts to supply larger markets such as tire production (Cornish 2001). Guayule does not tolerate cold winters experienced by much of the temperate regions of the world and more importantly it cannot be harvested as an annual crop as rubber is produced in bark parenchyma cells. One season of growth yields little bark

37 parenchyma and rubber. Russian dandelion is a temperate annual from Kazakhstan identified in the 1930s as a producer of latex (Ulmann 1951). In terms of research resources spent, Russian dandelion closely follows guayule and has promise as an alternative rubber source. Rubber from this plant was used to make various products during WWII when supply lines to the tropics were cut off (Polhamus 1962; Whaley and Bowen 1947). Latex is produced in the tap root and has molecular weight rubber similar to or greater than that of the Brazilian rubber tree. For rubber production to be economical, yields must be increased and biorefinery methods employed where all plant components are utilized (Van Beilen and Poirier 2007). Additional rubber producing crops that are fast growing and harvested annually are needed to fill the larger non-medical market.

The ideal rubber producing crop for temperate regions will be a fast growing annual that produces large amounts of biomass. Annual crops are more easily incorporated into crop rotation systems and can be planted or removed in response to market fluctuations and independent grower requirements. Biennial and perennial plant species such as trees or shrubs often have higher starting costs, and have a lag from input to harvest and remain in place for several growing seasons, making them less suited to changing market demands. Preferably, the rubber producing species will also be tolerant and well adapted to cultivation on marginal land so as to alleviate competition with food crops, as seen in corn-ethanol production (Babcock and Fabiosa

2011). The attributes described for the ideal temperate rubber producing plant are present in prickly lettuce.

The genus Lactuca , of which prickly lettuce is a prominent member, has long been recognized as a potential source of rubber (Bushman et al. 2006). In 1913, a report detailed the analysis of latex from two lettuce species, Lactuca canadensis L. and L. scariola L. (Fox 1913).

38 Both species secreted latex from all areas of the plant. Rubber content of the latex was measured at 2.2 % in L. canadensis and 1.6 % in L. scariola . The variability of rubber content and the ability to produce rubber among lettuce genotypes was also described by the Clemson

Agriculture Center (Mitchell, Rice, and Roderick 1942) and the US Department of Agriculture

(Polhamus 1958). The reports described differences in latex rubber content of several lettuce species with negligible differences in percent rubber extracted from whole plants. None of these reports discussed the purity or composition of the latex, the molecular weights of the rubber in the latex, or the condition of the tissues previous to extraction – that work was completed by

Bushman et al. in 2006.

Bushman et al. (2006) examined prickly lettuce, accession UG92G488, and cultivated lettuce ( L. sativa L. cv. Salinas) accession UC96US23 to determine characteristics of natural rubber in those two lettuce species. They demonstrated that both species produce latex containing desirable high molecular weight (>1x10 6 g mol -1) cis -1,4-polyisoprene with very narrow ð that should lead to excellent product characteristics after vulcanization. Bushman et al.

(2006) also concluded that genetic, developmental, or environmental influences could impact latex molecular weight and suggested optimizing the genetic, physiological, and environmental conditions for the synthesis of higher molecular weight rubber for prickly lettuce.

In order to consider the potential prickly lettuce has as an alternative source for latex and rubber bioproducts, continued research and development must be conducted. The objectives of this research were 1) to compare rubber content and quality found in regional eastern

Washington prickly lettuce biotypes and 2) to compare rubber content and quality of greenhouse verses field grown prickly lettuce plants.

Materials and Methods

39 Plant Material and Latex Component Isolation

Studies were conducted in 2009 at Washington State University’s Cook Agronomy Farm near Pullman, WA (GPS coordinates 46° 47' 3.555" N, -117° 5' 26.379" W) and concurrently in a greenhouse located on campus to evaluate the latex and rubber composition of 20 prickly lettuce biotypes. Seed of twenty eastern Washington prickly lettuce biotypes were collected in the fall of 2006 (Table 1). Plants were highly variable in growth habit and leaf morphology as determined by phenotypic evaluation published in previous work on the same biotypes (Riar et al. 2011). A single seed from each field collection was propagated in greenhouse conditions to obtain working stock seed collections from each biotype. Plants for the field and greenhouse studies were both started in greenhouse conditions by seeding working stock collections in 10 cm square plastic pots with potting media (LC1 Mix. Sun Gro Horticulture Distribution Inc.,

Bellevue, WA) and kept at 26 °C daytime and 22 °C night time ( ± 3 °C) temperatures. Natural light was supplemented with sodium vapor lighting to give a 14 h photoperiod that coincided with the daytime portion of the temperature profile. Plants were sub-irrigated as needed. Plants for the field study were transplanted to the Cook Agronomy Farm field site on May 3, 2009.

Greenhouse grown plants were transplanted to larger 16 cm round plastic pots. No other inputs were used in the cultivation of either greenhouse or field plants.

The field trial area was prepared by fall chisel plowing followed by late-April cultivation and harrowing prior to transplanting. Latex samples were collected from non-treated plots in an unrelated field experiment studying herbicide tolerance which was arranged in a randomized complete block design. Plants were spaced 1 m from each other and from plants in the adjacent plot. Soil type was classified as Palouse silt loam (fine, silty, mixed, mesic, Pachic Ultic

Haploxerolls). Soil pH was 5.2, and organic matter was 3.5%. Latex was collected twice from

40 greenhouse grown plants and four times from field grown plants. Because of the laborious nature of harvesting latex samples, collection was made over time rather than in space and each sampling time was treated as a replicate. Latex collections began once stems had developed through seed set. To collect latex, multiple diagonal cuts to plant stems were made with a razor blade and the resulting latex was collected into a tared micro-centrifuge tube. Tubes were capped and chilled, then re-weighed to obtain weight of initial latex collection. The latex collections were dried for 48 h under vacuum at 35 °C to remove all water. Tubes were re-weighed to acquire total water content. Dried samples were extracted three times with acetone by addition of one mL acetone, vortexing, centrifugation for five min at 6822 g, and collection of supernatant into a clean, tared vial. Acetone was dried under a stream of air and vials re-weighed to yield the total contained acetone soluble fraction (resin). Following acetone extraction, samples were extracted with hexane to dissolve rubber. One mL hexane was added to each tube followed by vortexing and hand stirring with a spatula to dislodge rubber pellet. Samples were centrifuged and supernatant collected into a clean tared vial. Rubber was extracted three times with hexane, the third hexane addition being allowed to sit 8-10 h before supernatant collection. Hexane was dried under air and vials weighed for total contained rubber. Original collection tubes containing insoluble latex material were dried and weighed to find the percentage of insoluble material.

Rubber Analysis

The rubber fraction was analyzed by gel permeation/size exclusion chromatography

(GPC/SEC) HPLC, with refractive index detector to evaluate rubber (polyisoprene) polymer chain length. Dried rubber fractions were re-eluted in tetrahydrofuran (THF) to a concentration of approximately 2 mg mL -1. Rubber was allowed to dissolve at room temperature overnight. A

200 µL portion of the dissolved rubber solution was removed from the top, without disturbing

41 any non-dissolved material at the bottom of the vial, and transferred to an HPLC vial with a 250

µL glass insert. 100 µL of the solution was injected by an autosampler. Samples were analyzed with an Agilent 1100 series HPLC equipped with an Agilent G1362A refractive index detector.

Polyisoprene polymers were separated with a Phenogel Linear/Mixed Guard Column (10 µM

7.5x50 mm), and a PLgel Mixed-B size exclusion column (10 µM 7.5x300 mm) using THF as mobile phase. Run time was 17 min with a flow rate of 1 mL min -1. Column and detector were maintained at 40 °C. Molecular weights were extrapolated using polystyrene standards from

Varian (EasiVial) to create a semi-logarithmic standard curve. A single standard of 1,4- polyisoprene (Mw 999,000 g mol -1) (Polymer Standards Service) was added to the standard curve as a check against the polystyrene polymers. Agilent GPC software was used together with standards to generate a standard curve and estimate average molecular weight (Mn), weighted average molecular weight (M W), and ð.

Statistical Analysis

Data were expressed as percent of total extract by weight and were subjected to ANOVA using PROC MIXED procedure in SAS (Version 9.2. SAS Institute, Inc., Cary, NC; SAS 2008).

Type III statistics were used to test for significance (P ≤ 0.05) of site, biotype, and their interactions for latex composition including water, insoluble, acetone soluble, and hexane soluble components. Data were pooled across sites when no significant effects for site were detected.

Comparison of pooled means for M W, ð, and percent rubber were subjected to ANOVA using

PROC GLM procedure in SAS.

Results and Discussion

Latex was observed in all prickly lettuce biotypes collected for this study. Exuding latex was found in cambial regions located near the outer portions of stems and leaf veins from bolting

42 plants. Lactuca spp. laticifers are described as articulated, with an anastomosing vascular network developing initially in the procambium and later associating with the vascular cambium

(Kekwick 2001; Hagel, Yeung, and Facchini 2008). Latex component analysis, calculated on a w/w basis, of the twenty biotypes revealed that on average, prickly lettuce latex is composed of

61.7% water, 23.3% insolubles, 13.8% acetone soluble (resin), and 3.2% hexane soluble material

(rubber) (Figure 1). The amount of extractable rubber material between biotypes ranged from

2.2% to 4.9% contained by weight and had significant variation ( P 0.0198) (Table 1). By comparison, Brazilian rubber tree latex is composed of 30 to 50% rubber; guayule 3 to 12% rubber and Russian dandelion latex varies from trace amounts to 30% rubber (Van Beilen and

Poirier 2007). The latter two species continue to see improvements in extractable rubber due to intensive breeding strategies. Lettuce breeding has generated numerous cultivars selected mainly for palatability with no consideration of rubber producing traits. Prickly lettuce rubber content is also subject to improvement through rubber attribute screening and selection.

Analysis of variance (ANOVA) indicated no significant differences in the rubber collected under greenhouse conditions and field conditions of 2010. Rubber was collected at bolting stages in both environments, suggesting that rubber production may be more closely linked to growth stage than to specific environmental influences. Field condition in 2010 may have closely resembled those of the greenhouse environment, confounding observation of any potential environmental differences. Guayule, a perennial shrub, had greater accumulation of rubber when harvested after winter then after summer (Downes and Tonnet 1985). Analysis of prickly lettuce rubber in the bolting stage, grown under various environmental regimes would elucidate the influence environment has on rubber production and quality. Field assessments in a

43 variety of locations would also indicate the importance environment has on prickly lettuce rubber.

Molecular weight of the cis -1,4-polyisoprene isolated from rubber producing plants is an indicator of its end-use potential. To produce high performance rubber products with the desired elasticity, tensile strength, and abrasion resistance, the molecular weight must meet or exceed

3x10 5 g mol -1 (Swanson, Buchanan, and Otey 1979). Commercial grade rubber tree rubber exceeds 1x10 6 g mol -1. Molecular weight analysis of the twenty biotypes was performed on two latex collections of greenhouse grown plants and four collections of field grown plants (Table 1).

Results were similar to that found by Bushman (2006) who compared prickly lettuce accession

(UG92G488) to cultivated lettuce cv. Salinas (UC96US23) and found that both species produce high molecular weight rubber in bolting plants. In this study, all biotypes had an average polymer molecular weight suggesting high quality natural rubber (>1x10 6 g mol -1). Additionally, several biotypes were found that consistently produce polymers in excess of 2x10 6 g mol -1 (Table

1). These biotypes would hypothetically have the highest quality rubber for manufacturing purposes. Statistical comparison of M W between biotypes revealed that there was significant variability between the biotypes collected ( P 0.0018). Lettuce in general appears to have the biochemical mechanisms in place to consistently produce high molecular weight rubber as verified in this study and that of Bushman et al. (2006). Bushman described transgressive molecular weight values from a recombinant inbreed line (RIL) population of cultivated lettuce cv. Salinas x prickly lettuce (Argyris et al. 2005; Bushman et al. 2006). Transgressive molecular weight values observed in the RIL population were suggested to be due to genetic, developmental, or environmental influences. Biotypes with high molecular weight rubber found in this study may be genetic variants, containing a favorable allele set. Alternatively, it may be

44 that the high Mw Washington biotypes are trending towards optimal environmental conditions for high Mw rubber biosynthesis. However, because there were no differences in the rubber collected in greenhouse versus field grown plants, genetic controls as opposed to environmental cues appear to have a more significant influence on rubber production in prickly lettuce. Further studies must be conducted to determine if resultant molecular weight is due to genetic factors, environmental factors or a combination of such.

Polydispersity index (PDI), officially termed dispersity ( ð) (Stepto 2009), is another determinant of rubber quality. The value estimates overall dispersion of macromolecular species in the sample matrix. Dispersity is determined as a ratio of the weighted average molecular weight divided by the number average molecular weight (M W/Mn). The closer the ratio is to one, the more homogeneous the polymer mixture. Average ð for all biotypes and collections in this experiment was 2.91 (Table 1). Between biotypes, ð ranged from 2.31 to 3.99, however

ANOVA suggested ð was not significantly different ( P 0.062) (Table 1). Previous ð values for cultivated lettuce and prickly lettuce were reported to be 1.1, indicating that the rubber polymers analyzed were nearly all the same length (Bushman et al. 2006). Differences between the studies may be due to the nature of collection and rubber processing methods. Bushman extracted and analyzed rubber from washed rubber particles, while in this study whole latex was directly extracted. Collection and washing of rubber particles may have stabilized the particles or enriched for a certain particle size and Mw whereas extracting from whole dried latex may have captured all potential polymers present or introduced degradation. In either case, ð values for the rubber collected would be considered acceptable for the production of high-quality products.

Brazilian rubber tree ð values range from 2-11 and increase over the lifetime of the tree

(Kovuttikulrangsie and Sakdapipanich 2004)

45 Conclusions

Prickly lettuce is a well-adapted weed that has potential as a source of natural rubber.

Molecular weights of isolated cis -1,4-polyisoprene indicates this species has the ability to synthesize rubber ideal for high quality products. Overall content of rubber in latex is low compared to other species studied however improvements are expected with concerted breeding efforts, as seen in other species. Continued research will determine the utility of prickly lettuce as a rubber source. Development of plant harvest methods, rubber extraction methods, yield per hectare values, and rubber end-use quality assessment, will all need to be addressed in order to validate prickly lettuce as an economic rubber crop.

Although significantly studied, the mechanism of polyisoprene polymerization and chain length determination is not understood. Prickly lettuce and closely related cultivated lettuce are excellent model organisms for the study of rubber biosynthesis. Lettuce is easily transformed

(Michelmore et al. 1987; Mazier et al. 2004; Lelivelt et al. 2005; Kanamoto et al. 2006) is amenable to gene-tagging (Mazier et al. 2007) and is a diploid, facultative self-pollinator that can be easily out-crossed (Nagata 1992). Recently, the lettuce genome has been released and is, to this author’s knowledge, the first released genome of a laticifer bearing, rubber producing plant.

If deemed uneconomical as a rubber source, study of the rubber synthesis mechanisms in prickly lettuce could lead to a better understanding of rubber production in plants. Additionally, genes necessary for prickly lettuce rubber biosynthesis could be incorporated into more tradition crops species or low molecular weight rubber bearing plants.

Acknowledgements

The collaborator of this research are grateful for funding provided by the United States

Department of Agriculture Aegilops cylindrica , WA special grant. Work on this project has also

46 been made possible by the technical support and expertise of the following people: Lydia Baxter-

Potter, Nick Boydston, Madeline Jacobson, Misha Manuchehri, Dennis Pittmann, Randy

Stevens, Jamin Smitchger all of the Crop and Soil Science Department, Washington State

University.

47 Literature Cited

Argyris, J., M. J. Truco, O. Ochoa, S. J. Knapp, D. W. Still, G. M. Lenssen, J. W. Schut, R. W.

Michelmore, and K. J. Bradford. 2005. Quantitative Trait Loci Associated with Seed and

Seedling Traits in Lactuca. Theoretical and Applied Genetics 111:1365–1376.

Babcock, B. A., and J. F. Fabiosa. 2011. The impact of ethanol and ethanol subsidies on corn

prices: Revisiting history. CARD Policy Brief 11.

Belcher, Brian, N. I. Rujehan, and R. Achdiawan. 2004. Rattan, rubber, or oil palm: Cultural and

financial considerations for farmers in Kalimantan. Economic Botany 58:S77–S87.

Bowers, J. E., 1990. Natural rubber-producing plants for the United States. Beltsville, Md.:

National Agricultural Library.

Buchanan, R. A., I. M. Cull, F. H. Otey, and C. R. Russell. 1978. Hydrocarbon- and rubber-

producing crops: Evaluation of 100 U.S. plant species. Economic Botany 32:146–153.

Bushman, Bradley S., A. A. Scholte, K. Cornish, D. J. Scott, J. L. Brichta, J. C. Vederas, O.

Ochoa, R. W. Michelmore, D. K. Shintani, and S. J. Knapp. 2006. Identification and

comparison of natural rubber from two Lactuca species. Phytochemistry 67:2590–2596.

Carr, M. E., and M. O. Bagby. 1987. Tennessee plant species screened for renewable energy

sources. Economic Botany 41:78–85.

Cornish, K., 2001. Similarities and differences in rubber biochemistry among plant species.

Phytochemistry 57:1123–1134.

Davis, W., 1997. The rubber industry’s biological nightmare. Fortune , August 4.

Dick, J. S. 2003. Basic Rubber Testing: Selecting Methods for a Rubber Test Program . ASTM

International.

48 Downes, R. W., and M. L. Tonnet. 1985. Effect of environmental conditions on growth and

rubber production of guayule (Parthenium argentatum). Australian Journal of

Agricultural Research 36:285–294.

Esau, K., 1965. Plant Anatomy . 2nd ed. New York: Wiley.

Fox, C. P., 1913. Wild Lettuce Rubber. J. Ind. Eng. Chem. 5:477–478.

Hagel, J. M., E. C. Yeung, and P. J. Facchini. 2008. Got milk? The secret life of laticifers.

Trends in Plant Science 13:631–639.

Hall, H. M., and T. H. Goodspeed. 1919. The Occurrence of Rubber in Certain West American

Shrubs . Univ. of California Press.

Hayashi, Y. 2009. Production of natural rubber from para rubber tree. Plant Biotechnology

70:67–70.

International Rubber Study Group. International Rubber Study Group - Home Page.

http://www.rubberstudy.com/ (Accessed October 24, 2012)

Kanamoto, H., A. Yamashita, H. Asao, S. Okumura, H. Takase, M. Hattori, A. Yokota, and K.-I.

Tomizawa. 2006. Efficient and stable transformation of Lactuca sativa L. cv. Cisco

(lettuce) plastids. Transgenic Research 15:205–217.

Kekwick, R. GO. 2001. Latex and Laticifers. In eLS .

http://onlinelibrary.wiley.com/doi/10.1038/npg.els.0000913/full. John Wiley & Sons,

Ltd.

Kovuttikulrangsie, S., and J. T. Sakdapipanich. 2004. The molecular weight (MW) and

molecular weight distribution (MWD) of NR from different age and clone Hevea trees.

Songklanakarin J. Sci. Technol 27:337–342.

49 Lai, C. C., D. C. Yan, J. Yu, C. C. Chou, B. L. Chiang, and K. H. Hsieh. 1997. Latex Allergy in

Hospital Employees. Journal of the Formosan Medical Association = Taiwan Yi Zhi

96:266–271.

Le Guen, V., M. Rodier ‐Goud, V. Troispoux, T. C. Xiong, P. Brottier, C. Billot, and M. Seguin.

2004. Characterization of polymorphic microsatellite markers for Microcyclus ulei ,

causal agent of South American leaf blight of rubber trees. Molecular Ecology Notes

4:122–124.

Lelivelt, C. L. C., M. S. McCabe, C. A. Newell, C. B. Desnoo, K. M. P. Van Dun, I. Birch-

Machin, J. C. Gray, K. H. G. Mills, and J. M. Nugent. 2005. Stable plastid transformation

in lettuce ( Lactuca sativa L.). Plant Molecular Biology 58:763–774.

Mazier, M., E. Botton, F. Flamain, J. P. Bouchet, B. Courtial, M. C. Chupeau, Y. Chupeau, B.

Maisonneuve, and H. Lucas. 2007. Successful gene tagging in lettuce using the Tnt1

retrotransposon from tobacco. Plant Physiology 144:18–31.

Mazier, M., S. German-Retana, F. Flamain, V. Dubois, E. Botton, V. Sarnette, O. Le Gall, T.

Candresse, and B. Maisonneuve. 2004. A simple and efficient method for testing lettuce

mosaic virus resistance in in vitro cultivated lettuce. Journal of Virological Methods

116:123–131.

Metcalfe, C. R. 1967. Distribution of latex in the plant kingdom. Economic Botany 21:115–127.

Michelmore, R., E. Marsh, S. Seely, and B. Landry. 1987. Transformation of lettuce ( Lactuca

sativa ) mediated by Agrobacterium tumefaciens . Plant Cell Reports 6:439–442.

Mitchell, J. H., M. A. Rice, and D. B. Roderick. 1942. Rubber analysis of plants in South

Carolina. Rubber Chemistry and Technology 15:978.

50 Mooibroek, H., and K. Cornish. 2000. Alternative sources of natural rubber. Applied

Microbiology and Biotechnology 53:355–365.

Nagata, R. T. 1992. Clip-and-wash method of emasculation for lettuce. Hort. Science 27:907–

908.

Polhamus, L. 1958. Rubber content of miscellaneous plants, production research report No. 10.

Agricultural Research Service, U.S. Dept. of Agriculture.

Polhamus, L. 1962. Rubber: botany, production, and utilization . London; New York: L. Hill;

Interscience Publishers.

Rolland, J. M., A. C. Drew, and R. E. O’Hehir. 2005. Advances in development of

hypoallergenic latex immunotherapy. Current Opinion in Allergy and Clinical

Immunology 5:544–551.

[SAS] Statistical Analysis Systems. 2008. SAS/STAT User’s Guide. Release 9.2. Statistical

Analysis Systems Institute, Cary, NC.

Stepto, R. F. T. 2009. Dispersity in polymer science (IUPAC Recommendations 2009). Pure and

Applied Chemistry 81:351–353.

Swanson, C. L., R. A. Buchanan, and F. H. Otey. 1979. Molecular weights of natural rubbers

from selected temperate zone plants. J Appl Polym Sci 23:743–748.

Tosi, L. L., J. E. Slater, C. Shaer, and L. A. Mostello. 1993. Latex allergy in spina bifida

patients: prevalence and surgical implications. Journal of Pediatric Orthopedics 13:709–

712.

Ulmann, M. 1951. Wertvolle kautschukpflanzen des gema ssigten klimas: Dargestellt auf grund

sowjetischer forschungsarbeiten. Akademie-Verlag.

51 Van Beilen, J. B., and Y. Poirier. 2007. Establishment of new crops for the production of natural

rubber. Trends in Biotechnology 25: 522–529.

Whaley, W.G., and J. S. Bowen. 1947. Russian dandelion (kok-saghyz): an emergency source of

natural rubber . Washington, D.C.: U.S. Dept. of Agriculture.

52 % Collection M (g M ð % Accession no. Geographical location W W ða Rubber site mol -1) SE SE Rubber SE Lactuca serriola N W Cultivated 1-8/31/06 46.79344 -118.73572 1423600 178311 3.11 0.38 2.6 0.35 field Cultivated 3-9/13/06 46.92627 -117.08788 1353307 312230 3.23 0.72 2.6 0.82 field Cultivated 4-9/13/06 46.97620 -117.11992 1728867 179095 3.25 0.45 2.3 0.37 field Cultivated 5-9/13/06 47.08827 -117.16157 1231828 238667 3.45 0.32 2.6 0.88 field Cultivated 6-9/13/06 47.20565 -117.21192 2568600 82826 2.55 0.23 4.9 0.43 field 1-9/21/06 46.40518 -117.25440 Roadside 1605993 262306 2.71 0.23 3.1 0.79 Cultivated 2-9/21/06 46.44550 -117.43108 1359087 295971 3.10 0.48 2.9 0.78 field 3-9/21/06 46.53202 -117.78203 Roadside 1084635 355526 3.04 0.34 2.6 0.57 5-9/21/06 46.69213 -117.79233 Roadside 1883777 397424 3.03 0.56 3.3 0.34 Cultivated 6-9/21/06 46.78925 -117.62885 1840067 261648 3.99 2.55 3.2 0.35 field Cultivated 1-10/4/06 46.72357 -116.76685 1689850 59103 3.17 0.07 4.4 1.38 field 2-10/4/06 46.55337 -116.68963 Roadside 1303901 283793 2.72 0.33 2.4 0.26 3-10/4/06 46.52055 -116.66520 Roadside 1332160 394192 2.31 0.43 2.6 1.09 1-10/6/06 46.80349 -119.07489 Roadside 1854217 176753 3.12 0.39 3.6 0.56 2-10/6/06 46.72285 -119.03190 Roadside 2201283 123491 2.76 0.29 3.9 0.91 Cultivated 3-10/6/06 46.57030 -119.04595 1774617 285291 2.37 0.26 2.5 0.26 field 4-10/6/06 46.32177 -119.08208 Roadside 1053353 337565 2.57 0.11 2.2 0.47 5-10/6/06 46.21169 -118.96343 Roadside 1788660 243413 2.97 0.15 2.8 0.41 6-10/6/06 46.29864 -118.40838 Roadside 1770983 355662 2.37 0.38 4.4 0.69 Cultivated 7-10/6/06 46.35657 -117.95143 2379133 324721 2.51 0.23 4.7 0.62 field P-value 0.0018 0.0620 0.0198

Table 1. Location of collected prickly lettuce biotypes and their averaged rubber qualities and

quantity.

a Dispersity value defined as M W/Mn, Where M W equals the polymer weight average molecular weight and Mn equals the polymer number average molecular weight.

53 120 Latex Extract Constituents

100

80 % Hexane Sol % Acetone Sol 60 % Insolubles %H2O

40 % Latex Component Latex %

6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 - / / / / / / / / / / / / / / / / / / / 1 3 3 3 3 1 1 1 1 1 4 4 4 6 6 6 6 6 6 6 1 1 1 1 2 2 2 2 2 / / / / / / / / / / /3 / / / / / / / / / 0 0 0 0 0 0 0 0 0 0 8 9 9 9 9 9 9 9 9 9 1 1 1 1 1 1 1 1 1 1 ------1 3 4 5 6 1 2 3 5 6 1 2 3 1 2 3 4 5 6 7

Figure 1. Average percentages of components found in tapped prickly lettuce latex from twenty eastern Washington prickly lettuce biotypes. Latex collected from both greenhouse and field grown plants and averaged.

54 Chapter 3

Quantitative Trait Loci Associated with Rubber Production in Prickly Lettuce

Abstract

Alternative sources of natural rubber are of great interest due to economic, biological, and political threats that could diminish supply of this essential resource. Prickly lettuce ( Lactuca serriola L.) synthesized long chain natural rubber. Genotypic analysis was conducted on an F2 segregating prickly lettuce population to discover genetic regions linked to natural rubber production. A total of 461 EST-SSR derived primers were screened against the crossed parents.

Of the screened markers, 89 polymorphic markers were selected and used to create a genetic linkage map. Three markers were not linked to any linkage group and five dominant markers did not map leaving 81 mapped markers in 12 linkage groups. Seventeen phenotypic measurements were taken from four main categories, latex extract components, rubber qualities, leaf measurements, and growth patterns. Interval mapping (IM) and multiple QTL mapping (MQM) identified several QTL in the mapping population that had significance based on LOD score thresholds. The trait, rubber MW, had a QTL on Grp 8 near markers WSULs-21, WSULs-374.2, and WSULs-210. Dispersity had significant linkage to an unmapped marker, WSULs-374.1.

Leaf perimeter and leaf lobing, similar traits, both had QTL on Grp 8 near markers WSULs-102 and WSULs-212. Stem counts and growth habit both had a similar QTL on Grp 4 near marker

WSULs-304. Herbivory which was scored as plants that had been grazed or not grazed, most likely by deer, had a surprising QTL on Grp 8 between markers WSULs-12 and WSULs-21. The discovered QTL and the corresponding local markers are genetic resources for understanding rubber biosynthesis in prickly lettuce and could be used in marker assisted selection (MAS) breeding. Prickly lettuce is an excellent candidate for elucidating rubber synthesis mechanism and has potential as a crop plant for rubber production.

55 Introduction

Natural rubber ( cis -1,4-polyisoprene) is a plant derived bio-product that has strategic importance due the number of products that utilize the polymer. Commercial quantities of natural rubber are supplied by the Brazilian rubber tree [ Hevea brasiliensis (Willd. ex A. Juss.) Müll.

Arg.] a native of the Amazon basin. Yearly rubber harvest has steadily increased since rubber was first commercialized and in 2011, worldwide natural rubber production reached 10,978,000 t with consumption closely following at 10,919,000 t. Alternative sources of natural rubber are being investigated for their utilization in rubber production (Mooibroek and Cornish 2000; Van

Beilen and Poirier 2007) to alleviate the threat of supply shortages. Prickly lettuce ( Lactuca serriola L.), is one of the few rubber bearing plant species able to produce high M W rubber

(Bushman et al. 2006) yet to date, no research has been conducted to identify genetic influences of rubber biosynthesis or molecular markers linked to rubber trait development.

Prickly lettuce is closely related to, and most likely the progenitor of, cultivated lettuce

(Lactuca sativa L.). It is believed the two species are conspecific (Koopman, Zevenbergen, and

Berg 2001) and are easily crossed to produce viable offspring. Cultivated lettuce is grown throughout the world and consumed for its nutritious foliage (Mou 2012; Nicolle et al. 2004).

Cultivated lettuce has 9 chromosomes and a genome size of approximately 2600 Mb. Prickly lettuce also has 9 chromosomes and presumably a similar genome size. The Compositae Genome

Project Database (CGPDB; http://compgenomics.ucdavis.edu) database is the most comprehensive genetic resource for study of the compositae family including cultivated and four closely related lettuce species, L. serriola L., L. saligna L., L. virosa L. and L. perennis L., ordered in proposed phylogenetic relatedness to cultivated lettuce. The genetic and genomic architecture of cultivated lettuce and its relatives has been well documented and includes a large

56 inventory of molecular markers. Variable marker types include RFLPs (Kesseli, Ochoa, and

Michelmore 1991; Kesseli, Paran, and Michelmore 1994), RAPDs (Waycott and Fort 1994),

ISSRs (Vicente et al. 2008), genomic/EST-SSRs (Riar et al. 2011; Simko 2009; Van de Wiel et al. 2010), AFLPs (Jeuken et al. 2001; Jansen et al. 2005; Koopman, Zevenbergen, and Berg

2001) , TRAPs (Hu et al. 2005), SNPs (Moreno-Vázquez et al. 2003) and SFPs (Van Leeuwen et al. 2009). The developed molecular markers have been effectively utilized for linkage mapping

(Truco et al. 2007), gene-tagging, QTL mapping (Jeuken et al. 2001) and genetic diversity studies (Kuang et al. 2008; Riar et al. 2011). Although cultivated lettuce is the main research focus, many of the molecular markers are transferable and have been used between lettuce species. Most recently the lettuce genome has been released

(www.lgr.genomecenter.ucdavis.edu) and will become a valuable asset in lettuce research as well as close lettuce relatives through sytenic genetic comparisons.

Prickly lettuce is important in lettuce breeding as donors of disease resistance genes

(Lebeda 1998; Lebeda, Pink, and Astley 2002; Reinink 1999; Ryder 1999; Sicard et al. 1999;

Zohary 1991) insect resistance (Ellis et al. 2002; Kishaba et al. 1980; Mou and Liu 2004), trait development such as carotenoid content (Mou 2005), bolting time (Ryder and Milligan 2005) and water use efficiency (Johnson et al. 2000). On the basis of the gene-pool concept (Harlan and

Wet 1971), Lactuca species were categorized into three gene pools based on their relationship to cultivated lettuce (McGuire et al. 1993). The primary gene pool is represented by numerous cultivars of cultivated lettuce, primitive landraces, and wild species where crossing barriers do not exist. Prickly lettuce is the primary representative as the progenitor species of this gene pool

(de Vries 1997) and will be the greatest beneficiary of cultivated lettuce genetic advancements.

57 Prickly lettuce is a potential new crop plant for rubber production. Development of this species will require molecular tools that assist in breeding efforts for desired traits. Of equal scientific importance are the general mechanisms controlling rubber biosynthesis in all rubber bearing plants. There are few studies that attempt to find genetic associations to rubber traits and no studies in prickly lettuce. The purpose of these studies were (1) to understand the genetic control of rubber traits in prickly lettuce and (2) identify molecular markers or QTL that would lead to a better understanding of the genes involved in rubber biosynthesis and allow for selection of prickly lettuce biotypes that have increased rubber making potential.

Materials and Methods

Plant Material and Population Development

In 2006, twenty eastern Washington prickly lettuce biotypes were collected and later screened for rubber content and quality. Previous screening of the collected biotypes for herbicide resistance and latex rubber revealed two with distinct rubber content and quality traits as well as contrasting visual phenotypes (Figure 1). Parent 6-9/13 (P1) had lobed leaves, was resistant to acetolactate synthase (ALS) targeting herbicides, was early to bolt, had average

6 -1 rubber M W of 2.5x10 g mol , and contained 4.9 % rubber in the latex on average. Parent 4-10/6

(P2) had non-lobed oblanceolate leaves, no herbicide resistance, was late to bolt, an average

6 -1 rubber M W of 1.1x10 g mol , and contained an average of 2.2 % rubber in the latex. Parental plants were grown in a greenhouse from seed in 16 cm round plastic pots into potting media

(LC1 Mix. Sun Gro Horticulture Distribution Inc., Bellevue, WA) with temperatures kept at 26

°C daytime and 22 °C nighttime ( ± 3 °C). Natural light was supplemented with sodium vapor lighting to give a 14 h photoperiod that coincided with the daytime portion of the temperature profile. Plants were sub-irrigated as needed. At anthesis, flowers were crossed using the clip-and-

58 wash method (Nagata 1992). Reciprocal crosses were made and F1 seed collected. F1 seed were planted and evaluated for potential self-pollination using the differential parental phenotypic traits of bolting time and leaf lobing, semi-dominant and dominant traits respectively.

Successfully crossed F1 plants had an intermediate bolting time between parental phenotypes and inherited leaf lobing traits (lobed in 4-10/6 x 6/9-13 crosses) that allowed for selection of non-selfed individuals. Cross efficiency was 81 % with 13 of 16 successful crosses. One F1 plant with cross 6-9/13 female x 4-10/6 male was selected for creation of an F2 segregating population by collecting seed from the selfed F1 plant.

Phenotypic Evaluation

In total, 250 F2 individuals were grown in a greenhouse from seed for four weeks prior to planting at Washington State University’s Cook Agronomy Farm Pullman near Pullman WA

(GPS coordinates 46° 47' 1.0854", -117° 5' 28.755"). Plants were started May 7, 2010 in a greenhouse under the same conditions as the parental and F1 plants but were planted in smaller

10 cm square plastic pots. Plants were transplanted to the field June 7, at 2 m row spacing with 1 m distance between each plant. Two plants died leaving a total of 248 individuals in the population. Throughout the growing season phenotypic data was collected from four main categories including, latex extract components, rubber qualities, leaf measurements, and growth patterns. Flowering time phenotype was confounded by deer herbivory, however deer appeared to graze preferentially on certain individuals within the population. Plants were scored with either herbivory or no herbivory. Lobing was scored as either lobed or not lobed. Leaf area and leaf perimeter values were calculated by scanning four fully expanded leaves on a flatbed scanner and using the ImageJ (Rasband 1997) convert to mask and wand tool functions to outline each leaf. Stem number was determined by counting the number of stems on each plant at 90 d

59 after planting. Growth habit was scored on a scale of one to five where one represented the 6-

9/13 parental phenotype which consists of early bolting and multiple lateral shoots and five represented 4-10/6 parental phenotype that had a late bolt timing and few lateral shoots.

Latex from each individual was collected from bolting stem for latex component and biochemical analysis. The percent of water, resin, rubber and insoluble material from each plant was determined gravimetrically (% wt/wt). Latex was collected by making multiple diagonal incisions with a razor and catching the drips of latex into a tared microcentrifuge tube. Tubes were capped and re-weighed to obtain weight of initial latex collection. Latex was then dried for

48 h under vacuum at 35 °C to remove all water. Tubes were re-weighed to acquire total contained water. Dried samples were extracted three times with acetone by addition of one mL acetone, vortexing, centrifugation for five min at 6822 g, and collection of supernatant into a clean, tared vial. Acetone was dried under a stream of air and vials re-weighed to determine resin content. Following acetone extraction, samples were extracted with hexane to dissolve rubber.

One mL hexane was added to each tube followed by vortexing and hand stirring with a spatula to dislodge the rubber pellet as needed. Samples were centrifuged and supernatant collected into a clean tared vial. Latex was extracted three times with hexane, the third hexane addition being allowed to sit 8-10 h before supernatant collection. Hexane was dried under air and vials weighed for total contained rubber. Original collection tubes containing insoluble latex material were dried and weighed to find the percentage of insoluble material.

The rubber fraction was further analyzed by high performance liquid chromatography gel permeation/size exclusion chromatography (HPLC GPC/SEC), with refractive index (RI) detection to evaluate rubber (polyisoprene) polymer chain length. Dried rubber fractions were re- eluted in tetrahydrofuran (THF) to a concentration of approximately 5 mg mL -1. Rubber was

60 allowed to dissolve at room temperature overnight. A 100 µL portion of the dissolved rubber solution was removed from the top, without disturbing any non-dissolved material at the bottom of the vial, and transferred to an HPLC vial with a 250 µL glass insert. An autosampler injected

40 µL of the dissolved rubber solution. Samples were analyzed with an Agilent 1100 series

HPLC equipped with an Agilent G1362A refractive index detector. Polyisoprene polymers were separated with a Phenogel Linear/Mixed Guard Column (10 µM 7.5x50 mm), and a PLgel

Mixed-B size exclusion column (10 µM 7.5x300 mm) using THF as mobile phase. Run time was

17 min with a flow rate of 1 mL min -1. Column and detector were maintained at 40 °C.

Molecular weights were extrapolated using polystyrene standards from Varian (EasiVial) to create a semi-logarithmic standard curve. A single standard of 1,4-polyisoprene (M W 999,000 g mol -1) (Polymer Standards Service) was added to the standard curve as a check against the polystyrene polymers. Agilent GPC software was used together with standards to generate a standard curve and estimate average molecular weight (Mn), weighted average molecular weight

(M W), and Ð. The values for polyisoprene characterization were determined by selecting the earliest eluting peak (longest polymer). Low ð, a beneficial trait, is independent of polymer M W but rather reflects the ð of the selected peak. In this study, the earliest eluting peak may have low

MW and low ð.

Phenotypic values for the entire population were plotted verses frequency to generate histograms (Figures 2 and 3). Analysis of phenotypic frequencies over the population determined if traits were single gene controlled having expected ratios of 3:1, 1:2:1 or multi-genic

(quantitative) with a normal distribution. Suspect single gene traits were examined by Chi-square analysis ( X2) and quantitative traits analyzed for QTL (Tables 1 and 3).

Prickly Lettuce Genetic Map

61 DNA from each individual in the F2 population and parents was extracted from young leaves that were frozen (-80 °C) and freeze dried. Extraction was performed on approximately 30 mg dried tissue using a Biosprint 96 DNA Extractor following manufacturer protocols. DNA concentrations were measured with a Nanodrop 2000 spectrophotometer and normalized to 50 ng

µL -1. A total of 400 EST-SSR derived primers that were previously mined from the CGPDB

(CGPDB; http://compgenomics.ucdavis.edu) to analyze prickly lettuce genetic diversity were used for polymorphic screening (Riar et al. 2011). An additional 61 EST-SSR primers developed in 2009 (Simko 2009) were added giving a total of 461 EST-SSR’s available to screen against the crossed parents. Polymorphism of the mined EST-SSR’s was carried out using two genotyping platforms. The first employed 10 % polyacrylamide gel electrophoresis (PAGE) denaturing gels with silver stain to visualize amplified fragments. Polymerase chain reactions

(PCR) were carried out in 20 µL total volume mixtures each containing 100 ng template DNA,

0.5 µm SSR primers, 250 µM dNTPs, 1.5 mM MgCl 2, 0.5x PCR buffer and 1.0 U Taq DNA polymerase (MangoTaq, Bioline USA Inc.). Reactions were carried out on a Techne TC-4000 thermocycler with the following PCR profile: initial denaturation at 95°C for 3 min followed by

40 cycles at 95 °C for 30 sec, 57 °C for 30 sec, 72 °C for 25 sec, and a final extension at 72 °C for 10 min.

Of the 461 primers 380 were further analyzed by a second genotyping platform utilizing an ABI 3730XL DNA analyzer (Applied Biosystems, Foster City, CA). PCR amplifications were carried out in 12 µL reaction mixture each containing 15 ng template DNA, and three PCR primers [M13F primer (5 ′-CACGACGTTGTAAAACGAC-3′) labeled with one of 4 fluorescent dyes (6-FAM, PET, VIC, or NED; Applied Biosystems, Foster City, CA), long forward primer with M13F-tail at its 5 ′ end and a reverse primer]. Primer concentrations were 0.25 µM reverse

62 primer, 0.20 µM M13F and 0.05 µM of the long, M13 tagged, forward primer. Other components included 200 µM dNTPs, 1.0 mM MgCl2, 1.0 x PCR buffer and 1.0 U Taq DNA polymerase (made in-house). PCR amplifications were done on Biorad C1000 or S1000 thermocycler using the following condition: initial denaturation at 95 °C for 3 min followed by

42 cycles at 95 °C for 40 sec, 57 °C for 60 sec, 72 °C for 60 sec, and a final extension at 72 °C for 10 min.

Segregation Analysis/ Linkage Maps

Initially, 89 polymorphic EST-SSR markers were selected and used to create a genetic linkage map (Table 2). Of the 248 individuals in the F2 population 186 were analyzed to facilitate 96 and 384 well formats. Fragment analysis of markers in the F2 population was carried out using an Applied Biosystems 3730XL DNA analyzer and GENE MARKER software version

1.5 (SoftGenetics LLC 2006). PCR conditions were the same as described for the parental screen in the second genotyping platform. Fragments were scored as either parent 1 (a) parent 2 (b) or heterozygous (h). Scored data was analyzed by JoinMap 4.0 (Van Ooijen 2006) using maximum likelihood algorithm with all other parameter set to default. The Haldane mapping function was used to calculate genetic distances. Maps were verified using Mapmaker 3.0b (Lander et al.

1987) at LOD score 3.0. Of the original 89 markers, three were not linked to any linkage group and five dominant markers did not map leaving 81 mapped markers in 12 linkage groups (Figure

4). The traits of leaf lobing and herbivory were scored bimodally as presence or absence phenotypes and analyzed by Chi square (Table 1).

Polymorphism

63 Marker polymorphism was determined as the difference in nucleotide base-pairs between parents as established by the ABI 3730XL DNA analyzer. Fragment sizes were estimated by comparison to a size standard added to each well and tagged with fluorescent dye LIZ.

Trait Genetic Markers/QTL Analysis

F2 genotypic and phenotypic data were analyzed using MapQTL 6.0 (Van Ooijen 2009) to assist in identifying marker-trait correlations. Analysis was done using both interval mapping

(IM) to allow for possible correlations with the unmapped markers and multiple-QTL model

(MQM). Default parameter for IM were used and included: algorithm-regression, test statistic-

LOD, fit dominance for F2-yes, mapping step size-1.0, neighboring markers-5, number of iterations-200, functional tolerance-1.0x10 -08 , permutation-1000. MQM model had the same default parameters. Chromosomes with associated QTL were made using MapChart 2.2

(Voorrips 2002) (Figure 4).

To determine the LOD score significance thresholds a permutation test of 10,000 iterations (p=0.05) was performed over each chromosome (Churchill and Doerge 1994). QTL were considered significant if the output over the chromosome for the trait of interest exceeded the minimum threshold.

Results and Discussion

Phenotypic Assessment

Phenotypes in the F2 population were quantitative in that they did not follow Mendelian segregation ratios with the exceptions of leaf lobing and low M W. These traits segregated at a ratio of 3:1 ( X2=0 df 1) and ( X2=2.6 df 1) respectively (Table 1). Leaf lobing observed in this experiment is consistent with previous reports for inheritance of the trait where lobing was reported as dominant to non-lobed leaves and controlled by a single gene (Durst 1930, Whitaker

64 1950). Leaf area in the F2 population had a normal distribution with the median closer to that of parent 6-9/13 and very few individuals sharing a large leaf area phenotype similar to 4-10/6

(Figure 3). Leaf perimeter also had a less defined normal distribution pattern (Figure 2). The plant growth phenotypes stem number and growth habit had normal distributions with the majority of phenotypes intermediate between parents (Figure 2). Rubber Ð values over the population were normally distributed (Figure 3) and appear eschewed to higher Ð, although values cannot fall below the optimal Ð of one. Normal distributions were observed for all latex components including the amount of rubber, resin, insoluble material, and water contained in the latex (Figure 3). The M W of the rubber from the F2 population was normally distributed however there was an enrichment of individuals with low M W rubber (Figure 2). The reason for the elevated number of extremely low M W phenotypes is unclear. Rubber from these individuals may have degraded at some point during collection, storage, or extraction. Alternatively, the individuals with low M W rubber may have underlying genetic influences affecting polymer stability or determinant polymer length. Just under 25 % of the F2 population had inferior, low

-1 MW rubber (<100000 g mol ) suggesting the low M W phenotype may be a single gene trait

(Table 1). Repeated studies from a recombinant inbreed line (RIL) derived from the cross made for this study will assist in determining whether the low M W phenotype is an artifact of sampling or a defined genetic trait.

Linkage Maps

The assembled linkage map generated from 81 EST-SSR markers produced 12 linkage groups or chromosomes. The chromosome number for lettuce and prickly lettuce is 9 (Babcock et al 1937). Discrepancies in chromosome number are most likely due to the low number of markers used in this study. A few of the markers have been mapped in the CGPDB and were

65 used as anchors for assigning chromosome names for the associated linkage group. Based on maps generated in the CGPDB, some of the linkage groups made by JoinMap 4.0 in this study had distances longer or shorter than would be expected (Figure 4). For example, Grp 1 is anchored by SML-41 and corresponds to chromosome 7 in CGPDB, MAP 2 JMR2.

Chromosome 7 is 126.8 cM in length compared to 332.6 cM in this study. Grp 5 is anchored by markers SML-29 and SML-34 both on chromosome 9 of MAP 2 JMR2. Chromosome 9 is 102.9 cM compared to our 52.8 cM distance. Grp 6 is anchored by SML-26 to chromosome 2 which is

162.1 cM in MAP 2 JMR2, a much closer distance to 158.5 cM of this study; however SML-26 is placed near the middle of MAP 2 JMR2 at 72.0 cM while in our map SML-26 is nearer to the end at 148.7 cM. MapMaker 3.0b was used to verify grouping made by JoinMap. Mapmaker was more stringent in grouping of markers and further divided some of the linkage groups generated in JoinMap. The distinction is noted by bold, red markers designated MM3.0b placed half the distance between the flanking mapped markers in the chromosome groupings. In general,

JoinMap 4.0 and MapMaker 3.0b grouped markers similarly, lending confidence to the map structure.

Rubber Trait QTL

Of particular interest in this study are the markers and QTL linked to rubber traits. One

QTL and one unmapped marker had significant correlations to rubber traits, rubber M W and polymer Ð. Rubber M W had a QTL associated with Grp 8 near markers WSULs-374.2 and

WSULs-21. The rubber M W QTL peaks at marker WSULs-374.2, at LOD 3.24, and accounted for 7.7 % of the phenotypic variation in the population (Figure 4, Table 3). Dispersity is a measure of polymer homogeny as measured by weighted average molecular weight divided by the number average molecular weight (M W/Mn) (Stepto 2009). An optimal ratio of 1.0 signifies

66 uniform polymers. Dispersity is a beneficial trait if the rubber also has high M W. The marker

WSULs-374.1 had significant linkage to Ð with a peak LOD value of 4.79 and explained 11.2 % of the phenotypic variation (Table 3) as determined by IM. It is important to note that the Ð and

MW values were based on the earliest eluting peak by HPLC-SEC/GPC and are therefore not necessarily correlated to one another. Low Ð does not mean high M W. Review of the Ð and M W values reveals that the majority of individuals with low Ð were more closely related to the low

MW individuals in the population. Interpretation of the marker is counter intuitive and suggests that the higher Ð values are representative of a beneficial trait. Although high Ð is less desirable, nearly all of the Ð values collected from the earliest eluting peak would be considered acceptable for production purposes (Kovuttikulrangsie and Sakdapipanich 2004). The WSULs-374 markers are derived from the same primer yet generated distinct PCR products that segregated sufficiently to separate the two at a LOD threshold of 3.0. At LOD 2.0 WSULs-374.1 and

WSULs-374.2 are grouped together; however at this threshold they are separated by 122.1 cM.

Both the rubber M W QTL and Ð marker are derived from 6-9/13 alleles. This single marker could be used for selection and integration of prickly lettuce with acceptable Ð and high M W rubber, the two most important traits in determining rubber end-use potential (Swanson,

Buchanan and Otey 1979).

Other Beneficial Traits

Cultivated lettuce cultivars have been developed to meet consumer and producer needs.

Most have a delayed bolt time and, if allowed to bolt, have only a single stem. They produce copious leaf tissue and little latex during vegetative growth (Mou 2008). Many of these traits are in stark contrast to those desired in a rubber producing cultivar. Anecdotal evidence suggests latex production increases with bolt initiation (Bushman 2006). In this regard, early bolting with

67 multiple stems would both be beneficial traits for rubber lettuce production. A strong growth habit and stem count QTL was identified in our study on Grp 4 that is highly correlated to marker WSULs-304 (Figure 4). The QTL significance continues at a lower level over a group of adjacent markers WSULs-310, WSULs-84, WSULs-204, WSULs-383, WSULs-2 with the highest significance at marker WSULs-383 in this group. The growth habit phenotype was characterized by early bolt time with multiple lateral shoots. The growth habit QTL peaked at

LOD 11.94 near marker WSULs-304 and LOD 2.98 near WSULs-383 and respectively explained 25.6 % and 7.1 % of the population phenotypic variation (Figure 4, Table 3). As expected, stem count is strongly related to growth habit as a numerical reflection of the growth habit phenotype. The stem count QTL also peaked at markers near WSULs-304 and WSULs-383 with respective LOD values 13.84 and 3.43 and phenotypic variances 29.0 % and 8.1 % (Figure

4, Table 3). Growth habit associated markers will assist in selection of rubber lettuce cultivars that bolt early and have many stems. These traits may also facilitate multiple harvests over the season, increasing rubber yields. Alternative to harvesting fast bolting multi-stem plants, crisphead lettuce cultivars that have high latex and rubber content would be ideal for current lettuce cultivation and harvest practices. Many of the head lettuce cultivars have high biomass

(700 to 1000 g head -1), disease resistance, and reduced chlorophyll content (Mou 2008). The crisphead lettuce cv. ‘Salinas’, released in 1975, is the most widely grown lettuce cultivar in the history of lettuce production (Mou 2008). Introgression of alleles that confer high rubber content and M W in non-bolting head lettuce such as ‘Salinas’ lettuce leaf tissue would be perfectly suited for current cultivation practices. The identified markers and QTL are useful tools for MAS and introgression of those traits into new rubber lettuce varieties. Further selection of prickly lettuce

68 weedy traits such as water use efficiency, would allow rubber lettuce to be grown on marginal lands decreasing competition with existing lettuce production areas and other food crops.

In this study additional interesting marker-phenotype associations, not necessarily related to rubber lettuce development, have been identified. Leaf perimeter, a numerical expression of leaf lobing, and herbivory both had significant QTL on Grp 8 (Figure 3). As previously noted lettuce leaf lobing has been identified as a dominant, single gene trait (Durst 1930, Whitaker

1950). Leaf perimeter QTL is associated with markers WSULs-102 and WSULs-212 which had respective peak LOD values of 20.87 and 27.32 and explained 40.3 % and 49.2 % of the phenotypic variation for the population (Figure 4 Table 3). The histogram for leaf perimeter is not normal and may be more indicative of epistatic interaction The QTL for the lobing phenotype was stronger than the perimeter trait with peak LOD values of 29.7 and 45.4 at respective markers WSULs-102 and WSULs-212. Population phenotypic variance for the lobing trait was 52.0 % near marker WSULs-102 and 67.5 % at WSULs-212. Leaf lobing is an important horticultural trait in cultivated lettuce (Michelmore 2009). On an evolutionary level, lobed leaves may impart greater hydraulic efficiency and heat dissipative properties (Nicotra et al. 2012; Sack and Tyree 2005). There are no reports of a leaf lobing gene in lettuce however a single large effect QTL has been identified on chromosome 3 through analysis of the core F7:8

RIL mapping population derived from a cross between L. sativa cv. ‘Salinas’ and L. serriola accession UC96US23 (Michelmore 2009). The QTL found in this study is most likely the same found by Michelmore (2009) placing Grp 8 markers on chromosome 3 of the lettuce map. Based on sequence similarity, the EST related to marker WSULs-102 has resemblance to the

Arabidopsis thaliana cyclin family protein AT5G67260 (CYCD3; 2) (Table 2). In general, cyclin proteins act as transcription factors activating cyclin-dependent kinases during the cell cycle in

69 turn regulating key transitions during mitosis (Jackson 2008). In Arabidopsis, CYCD3; 2 is expressed in the shoot apical meristem and persists in young leaves. CYCD3; 2 functions by determining cell number in developing lateral organs and mediating the effects of cytokinin on apical growth and development (Dewitte et al. 2007). Leaf morphogenesis in tomato was dependent on cytokinin levels and overexpression of a cytokinin biosynthesis gene IPK7 caused increased expression of CYCD3 (Shani et al. 2010). The EST for WSULs-212 has similarity to

AT4G14960 tubulin alpha-6 chain (TUA6) (Table 2). TUA6 encodes an isoform of tubulin necessary for right handed helical growth (Abe and Hashimoto 2005). It is interesting to find that both EST-SSRs markers associated with the leaf perimeter and lobing QTLs are involved in plant organ morphogenesis. Further study of these genes in lettuce would determine if either of the genes is the causal agent for leaf lobing in lettuce. Overexpression of the genes in a non- lobed lettuce background could help identify these candidate genes as the leaf lobing gene in lettuce.

A prickly lettuce herbivory QTL was found on Grp 8 and peaked at LOD 3.25 near marker WSULs-374.2. The population phenotypic variance for the QTL was 7.7 % (Figure 4

Table 3). The phenotype was observed as preferential feeding of bolted stems in the F2 population by white tail deer ( Odocoileus virginianus Zimmermann.). There is considerable evidence suggesting latex is a beneficial adaptation to deter predation (Agrawal and Konno

2009; Konno 2011). One example in lettuce was found where latex from an insect resistant cultivar ‘Valmaine’ prevented Diabrotica balteata (LeConte.) beetles from feeding of latex painted lima bean leaves, however feeding was not inhibited when latex from the susceptible cultivar ‘Tall Guzmaine’ was applied (Huang el al. 2003). A follow-up study showed that differential compounds in the semi-polar latex extract contained the inhibitory element(s) (Sethi

70 et al. 2008). Prickly lettuce contains an abundance of the sesquiterpine lactones lactucin and lactucopicrin (Sessa et al. 2000). Increase in the levels of these compounds was correlated to perceived bitterness by sensory analysis (Price et al. 1990). The compounds also have sedative and analgesic affects (Wesołowska et al. 2006). Chemical analysis of the resin extracts containing the sesquiterpines compared with plant feeding patterns will help determine if these compounds act as a deer herbivory deterrents or stimulants.

Conclusions

In summary, a set of polymorphic EST-SSRs have been used to generate a linkage map from a cross between two distinct eastern Washington prickly lettuce biotypes. Analysis of the map with phenotypic data has led to the discovery of QTL and markers useful in development of rubber lettuce cultivars. The identified QTL and corresponding local markers could be used in a

MAS breeding scheme to find individuals with high MW rubber, and multi-bolting traits or introgression of rubber producing traits into current lettuce cultivars. Importantly, the QTL will allow further investigation of the genes that control these traits now that linked chromosomal regions have been identified. Additional QTL and markers related to lettuce leaf morphology and herbivory could be used in lettuce breeding for horticultural traits and understanding leaf ontogeny or lend evidence to latex herbivory relationships.

Acknowledgements

The authors would like to acknowledge funding for this project through the Aegilops cylindrica – Biomass for Biofuels and Bioproducts from Weedy Plants (NIFA/USDA special grant). Special thanks go to Lydia Baxter, Nicholas Boydston, Madeline Jacobson, Misha

Manuchehri, Dennis Pittman, Alan Raeder, Dilpreet Riar, Sachin Rustgi, Sherri Rynearson,

71 Deven See, Jamin Smitchger and Randall Stevens from Department of Crop and Soil Sciences,

Washington State University for their technical assistance in lab and field studies.

72 Literature Cited

Abe, T., and T. Hashimoto. 2005. Altered microtubule dynamics by expression of modified Α-

tubulin protein causes right-handed helical growth in transgenic Arabidopsis plants. The

Plant Journal 43:191–204.

Agrawal, A. A., and K. Konno. 2009. Latex: A model for understanding mechanisms, ecology,

and evolution of plant defense against herbivory. Annual Review of Ecology, Evolution,

and Systematics 40:311–331

Babcock, E. B., G. L. Stebbins (Jr.), and J. A. Jenkins. Chromosomes and phylogeny in some

genera of the Crepidineae . Cytologia, Fujii Jub. Vol. 188-210.

Bushman, B. S., A. A. Scholte, K. Cornish, D. J. Scott, J. L. Brichta, J. C. Vederas, O. Ochoa, R.

W. Michelmore, D. K. Shintani, and S. J. Knapp. 2006. Identification and comparison of

natural rubber from two Lactuca species. Phytochemistry 67:2590–2596.

Churchill, G. A., and R. W. Doerge. 1994. Empirical Threshold Values for Quantitative Trait

Mapping. Genetics 138:963–971.

Compositae Genome Project Database, CGPDB; http://compgenomics.ucdavis.edu/. (Accessed

November 24, 2012) de Vries, I. M. 1997. Origin and domestication of Lactuca sativa L. Genetic Resources and Crop

Evolution 44:165–174.

Dewitte, W., S. Scofield, A. A. Alcasabas, S. C. Maughan, M. Menges, N. Braun, C. Collins, J.

Nieuwland, E. Prinsen, V. Sundaresan, J.A. Murray. 2007. Arabidopsis CYCD3 D-type

cyclins link cell proliferation and endocycles and are rate-limiting for cytokinin

responses. Proceedings of the National Academy of Sciences 104:14537–14542.

Durst, C.E. 1930 Inheritance in lettuce . Univ. Illinois Agr. Expt. Sta. Bul. 356 :238 –341 .

73 Ellis, P. R., S. J. McClement, P. L. Saw, K. Phelps, W. E. Vice, N. B. Kift, D. Astley, and D. A.

C. Pink. 2002. Identification of sources of resistance in lettuce to the lettuce root aphid,

Pemphigus bursarius . Euphytica 125:305–315.

Harlan, J. R., and J. M. J. de Wet. 1971. Toward a rational classification of cultivated plants.

Taxon 20:509–517.

Hu, J., O. Ochoa, M. Truco, and B. Vick. 2005. Application of the TRAP technique to lettuce

(Lactuca sativa L.) genotyping. Euphytica 144:225–235.

Huang, J., H. J. McAuslane, and G. S. Nuessly. 2003. Resistance in Lettuce to Diabrotica

balteata (Coleoptera: Chrysomelidae): The roles of latex and inducible defense.

Environmental Entomology 32:9–16.

Jackson, P. K. 2008. The hunt for cyclin. Cell 134:199–202.

Jansen, J., H. Verbakel, J. Peleman, and Th. J. L. Hintum. 2005. A note on the measurement of

genetic diversity within genebank accessions of lettuce ( Lactuca sativa L.) Using AFLP

markers. Theoretical and Applied Genetics 112:554–561.

Jeuken, M., R. Van Wijk, J. Peleman, and P. Lindhout. 2001. An integrated interspecific AFLP

map of lettuce ( Lactuca ) based on two L. Saligna x L. sativa F2-populations. Theoretical

and Applied Genetics 4:638-647.

Johnson, W. C., L. E. Jackson, O. Ochoa, R. Van Wijk, J. Peleman, D. A. St. Clair, and R. W.

Michelmore. 2000. Lettuce, a shallow-rooted crop, and Lactuca serriola , its wild

progenitor, differ at QTL determining root architecture and deep soil water exploitation.

Theoretical and Applied Genetics 101:1066–1073.

74 Kesseli, R. V., I. Paran, and R. W. Michelmore. 1994. Analysis of a detailed genetic linkage map

of Lactuca sativa (lettuce) constructed from RFLP and RAPD markers. Genetics

136:1435 –1446.

Kesseli, R., O. Ochoa, and R. Michelmore. 1991. Variation at RFLP loci in Lactuca spp . and

origin of cultivated lettuce ( L. sativa ) Genome 34:430–436.

Kishaba, A. N., J. D. McCreight, D. L. Coudriet, T. W. Whitaker, and G. R. Pesho. 1980. Studies

of ovipositional preference of cabbage looper on progenies from a cross between

cultivated lettuce and prickly lettuce. Journal of the American Society of Horticultural

Science 105:890–892.

Konno, K. 2011. Plant latex and other exudates as plant defense systems: Roles of various

defense chemicals and proteins contained therein. Phytochemistry 72:1510–1530.

Koopman, W. J. M., M. J. Zevenbergen, and R. G. Van den Berg. 2001. Species relationships in

Lactuca s.l. (Lactuceae, Asteraceae) inferred from AFLP fingerprints. American Journal

of Botany 88:1881–1887.

Kovuttikulrangsie, S., and J. T. Sakdapipanich. 2004. The molecular weight (M W) and molecular

weight distribution (MWD) of NR from different age and clone Hevea trees.

Songklanakarin J. Sci. Technol. 27:337–342.

Kuang, H., H. J. Van Eck, D. Sicard, R. Michelmore, and E. Nevo. 2008. Evolution and genetic

population structure of prickly lettuce ( Lactuca serriola ) and its RGC2 resistance gene

cluster. Genetics 178:1547–1558.

Lander, E. S., P. Green, J. Abrahamson, A. B., M. J. Daly, S. E. Lincoln, and L. Newburg. 1987.

MAPMAKER: An interactive computer package for constructing primary genetic linkage

maps of experimental and natural populations. Genomics 1:174–181.

75 Lebeda, A. 1998. Biodiversity of the Interactions Between Germplasms of Wild Lactuca Spp. and

Related Genera and Lettuce Downy Mildew (Bremia Lactucae) . Report on research

programme OECD Biological Resource Management for Sustainable Agricultural

Systems. HRI Wellesbourne (UK).

Lebeda, A., D. A. C. Pink, and D. Astley. 2002. Aspects of the interactions between wild

Lactuca spp . and related genera and lettuce downy mildew ( Bremia lactucae ). In

Advances in Downy Mildew Research , ed. P. T. N. Spencer-Phillips, U. Gisi, and A.

Lebeda, 85–117. Springer Netherlands.

Lettuce Genome Resource. https://lgr.genomecenter.ucdavis.edu/ (Accessed September 17,

2012).

McGuire, P. E., E. J. Ryder, R. Michelmore, R. L. Clark, R. Antle, E. Emery, R. M. Hannan, R.

V. Kesseli, E. A. Kurtz, O. Ochoa, E. Rubatzky, W. William. 1993. Genetic Resources of

Lettuce and Lactuca Species in California: An Assessment of the USDA and UC

Collections and Recommendations for Long-term Security. Report 12. Davis: Univ. of

California Genetic Resources Conservation Program.

Michelmore, R.W., 2009. California leafy greens research program: Genetic variation in

lettuce , University of California, Davis.

http://calgreens.org/control/uploads/Genetic_Variation_in_Lettuce_-_Michelmore.pdf

(Accessed November 26, 2012).

Mooibroek, H., and K. Cornish. 2000. Alternative sources of natural rubber. Applied

Microbiology and Biotechnology 53:355–365.

Moreno-Vázquez, S., O. E. Ochoa, N. Faber, S. Chao, J. M. E. Jacobs, B. Maisonneuve, R. V.

Kesseli, and R. W. Michelmore. 2003. SNP-based codominant markers for a recessive

76 gene conferring resistance to corky root rot ( Rhizomonas suberifaciens ) in lettuce

(Lactuca sativa). Genome 46:1059–1069.

Mou, B. 2005. Genetic variation of beta-carotene and lutein contents in lettuce. Journal of the

American Society for Horticultural Science 130:870–876.

Mou, B. 2008. Lettuce. In Handbook of Plant Breeding, Vol. I, Vegetables I, Asteraceae,

Brassicaceae, Chenopodicaceae, and Cucurbitaceae , ed. J Prohens and F Nuez. Vol. 1.

Springer, New York.

Mou, B. 2012. Nutritional quality of lettuce. Current Nutrition & Food Science 8:177–187.

Mou, B. and Y-B. Liu. 2004. Host plant resistance to leafminers in lettuce. J. Amer. Soc. Hort.

Sci. 129:383–388.

Nagata, R. T. 1992. Clip-and-wash method of emasculation for lettuce. HortScience 27:907–908.

Nicolle, C., N. Cardinault, E. Gueux, L. Jaffrelo, E. Rock, A. Mazur, P. Amouroux, and C.

Rémésy. 2004. Health effect of vegetable-based diet: Lettuce consumption improves

cholesterol metabolism and antioxidant status in the rat. Clinical Nutrition 23:605–614.

Nicotra, A. B., A. Leigh, C. K. Boyce, C. S. Jones, K. J. Niklas, D. L. Royer, and H. Tsukaya.

2012. The evolution and functional signiﬁcance of leaf shape in the angiosperms.

Functional Plant Biology 38:535-552.

Price, K. R, M. S. Dupont, R. Shepherd, H. W-S Chan, and G. R. Fenwick. 1990. Relationship

between the chemical and sensory properties of exotic salad crops—coloured lettuce

(Lactuca sativa ) and chicory ( Cichorium intybus ). Journal of the Science of Food and

Agriculture 53:185–192.

Rasband, W.S. 1997. Image Processing with ImageJ . Bethesda, Maryland, USA: National

Institutes of Health. http://imagej.nih.gov/ij/.

77 Reinink, K. 1999. Lettuce resistance breeding. Proceedings of the Eucarpia meeting on leafy

vegetables genetics and breeding, Olomouc (Czech Republic).

Riar, D. S., S. Rustgi, I. C. Burke, K. S. Gill, and J. P. Yenish. 2011. EST-SSR development

from 5 Lactuca species and their use in studying genetic diversity among L. serriola

biotypes. Journal of Heredity 102:17 –28.

Ryder, E. J. 1999. Lettuce, Endive, and Chicory . CABI Pub.

Ryder, E. J., and D. C. Milligan. 2005. Additional genes controlling flowering time in Lactuca

sativa and L. serriola . Journal of the American Society for Horticultural Science 130:448

–453.

Sack, L., and M. T. Tyree. 2005. Leaf hydraulics and its implications in plant structure and

function. In Vascular Transport in Plants , ed. N. Michelle Holbrook and Maciej A.

Zwieniecki, 93–114. Elsevier Academic Press: Burlington, MA, USA.

Sessa, R. A., M. H. Bennett, M. J. Lewis, J. W. Mansfield, and M. H. Beale. 2000. Metabolite

profiling of sesquiterpene lactones from Lactuca species: Major latex components are

novel oxalate and sulfate conjugates of lactucin and its derivatives. Journal of Biological

Chemistry 275:26877–26884.Sethi, A., H. J. McAuslane, H. T. Alborn, R. T. Nagata, and

G. S. Nuessly. 2008. Romaine lettuce latex deters feeding of banded cucumber beetle: a

vehicle for deployment of biochemical defenses. Entomologia Experimentalis Et

Applicata 128:410–420.

Shani, E., H. Ben-Gera, S. Shleizer-Burko, Y. Burko, D. Weiss, and N. Ori. 2010. Cytokinin

regulates compound leaf development in tomato. The Plant Cell Online 22:3206–3217.

78 Sicard, D., S.-S. Woo, R. Arroyo-Garcia, O. Ochoa, D. Nguyen, A. Korol, E. Nevo, and R.

Michelmore. 1999. Molecular diversity at the major cluster of disease resistance genes in

cultivated and wild Lactuca spp . Theoretical and Applied Genetics 99:405–418.

Simko, I. 2009. Development of EST-SSR markers for the study of population structure in

lettuce ( Lactuca sativa L.). Journal of Heredity 100:256 –262.

SoftGenetics LLC. 2006. GeneMarker . SoftGenetics LLC.

Stepto, R. F. T. 2009. Dispersity in polymer science (IUPAC Recommendations 2009). Pure and

Applied Chemistry 81:351–353.

Swanson, C. L., R. A. Buchanan, and F.H. Otey. 1979. Molecular weights of natural rubbers

from selected temperate zone plants. J Appl Polym Sci 23:743–748.

Truco, M. J., R. Antonise, D. Lavelle, O. Ochoa, A. Kozik, H. Witsenboer, S. B. Fort, M. J. W.

Jeuken, R. V. Kesseli, P. Lindhout, R. W. Michelmore, J. Peleman. 2007. A high-density,

integrated genetic linkage map of lettuce ( Lactuca spp .). Theoretical and Applied

Genetics 115:735–746.

Van Beilen, J. B., and Y. Poirier. 2007. Establishment of new crops for the production of natural

rubber. Trends in Biotechnology 25: 522–529.

Van de Wiel, C. C. M., T. Sretenovi ć Raji čić, R. Van Treuren, K. J. Dehmer, C. G. Van der

Linden, and Th. J. L. Van Hintum. 2010. Distribution of genetic diversity in wild

European populations of prickly lettuce ( Lactuca serriola ): Implications for plant genetic

resources management. Plant Genetic Resources 8:171–181.

Van Leeuwen, H., K. Stoffel, A. Kozik, X. Cui, H. Ashrafi, L. McHale, D. Lavelle, G. Wong, F.

Chen, M. Truco, A. Van Deynze, R. Michelmore. 2009. High-density mapping of the

79 lettuce genome with SFP markers in over 15,000 unigenes. Plant & Animal Genomes

XVII Conference, San Diego, CA.

Van Ooijen, J. W. 2006. JoinMap ® 4, Software for the Calculation of Genetic Linkage Maps in

Experimental Populations. Wageningen, Netherlands: Kyazama B.V.

Van Ooijen, J. W. 2009. MapQTL ® 6, Software for the Mapping of Quantitative Trait Loci in

Experimental Populations of Diploid Species. Wageningen, Netherlands: Kyazama B.V.

Vicente, M. J., E. Conesa, J.A. Franco, J. Esteva, and J.J. Martinez-Sanchez. 2008. Genetic

variability in lettuce ( Lactuca sativa ) germplasm using morphologic and molecular

analyses. Acta Hort . 782:59-66.

Voorrips, R. E. 2002. MapChart: Software for the graphical presentation of linkage maps and

QTLs. The Journal of Heredity 93:77–78.

Waycott, W., and S. B. Fort. 1994. Differentiation of nearly identical germplasm accessions by a

combination of molecular and morphologic analyses. Genome / National Research

Council Canada = Génome / Conseil National De Recherches Canada 37:577–583.

Wesołowska, A., A. Nikiforuk, K. Michalska, W. Kisiel, and E. Chojnacka-Wójcik. 2006.

Analgesic and sedative activities of lactucin and some lactucin-like guaianolides in mice.

Journal of Ethnopharmacology 107:254–258.

Whitaker, T. W. 1950. The genetics of leaf form in cultivated lettuce. I. The inheritance of

lobing. Proceedings. American Society for Horticultural Science 56:389–94.

Zohary, D. 1991. The wild genetic resources of cultivated lettuce ( Lactuca sativa L.). Euphytica

53:31–35.

80 6-9/13 4-10/6

Figure 1. Leaf morphologies of the parents selected for generation of F2 segregating population.

81 Lobing Herbivory Low MW

Lobe No lobe Herb No herb MW >100000 MW <100000 Total Observed 186 62 201 47 197 51 248 Expected (3:1) 186 62 186 62 186 62 Dif 0 0 15 -15 11 -11 Dif 2 0 0 225 225 121 121 Dif 2/Exp 0 0 1.2 3.6 0.7 2.0 X2 0 4.8 2.6

Table 1. Chi square analysis of potential prickly lettuce single gene traits derived from F2 population of cross between eastern Washington biotypes 6-9/13 x 4-10/6. Leaf lobing followed a perfect 3:1

2 2 ratio ( X =0 df 1) herbivory deviated from 3:1 ( X =4.8 df 1), while low M W was statistically within 3:1 ratio ( X2=2.6 df 1).

Expected Polymorphis EST Marker LG Marker Contig name EST-SSR SSR Motif Forward primer (5'-3') Reverse primer (5'-3') product m (BP Putative function in GCPDB GCPDB size Difference)

UC96US23 Salinas ( L. sativa ) (L.serriola ) AT2G36270-bZIP transcription factor family protein / ABA- SML-002 QGH4c05.yg.ab1 (TTC)17 - *GTGATTGCATGCCAAATGAA TTAGTAGCCCGCATGCTTTT 202 4 responsive element-binding protein

SML-003 QGA14A20.yg.ab1 - (GTTTT)5 *CGGGCTGGTTTTGATTTTTA TGTCAAATCGTCACGTGGTT 119 1 Unknown

SML-007 QGG10L02.yg.ab1 (TCACCA)19* - *ACACTTGCCGATTCCTTCAC ACCCGTGTTGAAAATGGAGA 214 80 AT4G28770-expressed protein

SML-010 QGC22L04.yg.ab1 - (GGTTCC)9* *ACTTTGCCTGATTCCGGTTC CCATGATGGAGATGTTGGTTC 201 32 Unknown

XLR1_Contig1293, SML-018 (TGTCA)4 (TGTCA)5 *CAACTGAGGCTGCAGAGATG CAAAACCAAGCCACAAAACA 195, 203 3 AT5G20890-chaperonin XLS1_Contig2272 XLR1_Contig2934, TGTCTTCCAACCAAAACATAC AT4G13930-glycine SML-026 (GAA)6 (GAA)11 *GGGTTCTCATTGGCTGACAT 184, 199 24 LE3093 2 (72) XLS1_Contig2022 A hydroxymethyltransferase XLR1_Contig2761, SML-029 (GAG)7 (GAG)8 *AGCCCAGAAGAGCGTGATTA TGCAGGGCTCCTTGATCTAC 249, 252 3 LK1133 9 (88) Unknown XLS1_Contig3417 QGF21P04.yg.ab1, SML-034 (GCA)4 (GCA)5 *TGGAGGTGAGACTGAAGCAA ATTCATCCCACCATCACCAT 205, 253 2 LE3129 9 (95) Unknown

83 XLS1_Contig4314 AT2G46240-IQ domain-

containing protein / BAG domain-containing protein, CLRX7780.b1_H01.ab1, SML-039 (CCCCTT)1 (CCCCTT)2 *ATTACCCCTGGCCTTATGCT TCGTATCTTGGCTGCTCCAT 229, 235 7 LE1032 3 (30) contains Pfam profiles PF00612: XLS1_Contig1461 IQ calmodulin-binding motif, PF02179: BAG (Apoptosis regulator Bcl-2 protein) domain

AT5G55120-expressed protein, XLR1_Contig3264, (GT)9*…(GT)3 (GT)9*…(GT)3 SML-041 *TGGTTTTGGTGTGTTTGACC TACGTTGGCAACAGCCATTA 182, 179 3 M1981 7 (127) strong similarity to unknown XLS1_Contig2296 (GTT)2 (GTT)1 protein (pir||T04808)

AT3G63030-methyl-CpG- TCCATAATAATATAATCGCACC SML-055 XLR1_Contig788 (TGA)15…(ATG)9 *CTGCGTGTTTTAAGCCGTTT 237 10 binding domain-containing AA protein XLR1_Contig602, CAGCTTAACATACTTTTGTTCA AT2G43810-small nuclear SML-056 (TTA)14 (TTA)3 *GCCTAGTCCAATTGCTTTGC 204, 183 3 XLS1_Contig515 TTCA ribonucleoprotein F, putative

AT2G37410-mitochondrial SML-060 XLR1_Contig541 (TTC)12(GTC)4 *ATGAGTGCACCCCAGAATTT CTTTCCACCACCAAACATCC 192 18 import inner membrane

translocase (TIM17)

WSULs2 CLRY4193.b2_B18.ab1 (AAT)11 *AACAAAACCGTGGTCCCAGA ATTCGAAGTGCTTGCCCAAA 233 9 AT3G13060-expressed protein

AT5G47820-kinesin-like protein WSULs4 CLRX5494.b1_L05.ab1 (TC)23 *ACCCTTTTGCTGCACTCCAC GAAGCCGCTGTTTCCATCAC 226 23 (FRA1)

WSULs11 XLR2_Contig2338 (ATG)9 *CCACCACAAAGCAGCATCAG CAACACCCACCAGCAACAAA 157 3 AT1G22850-expressed protein

*CCTCCATAACCAAAACCTCA AT4G35100-plasma membrane WSULs12 XLR2_Contig848 (AG)22 CAGTTCCCCCATGTCAAGGA 202 11 ACTC intrinsic protein (SIMIP)

AT5G05210-nucleolar matrix protein-related, contains Pfam WSULs14 XLR2_Contig1293 (TGA)11 *CGCCTTGACCCTGAGACATC TGCAATCTCTGGCGTAGCTC 218 3 domain, PF04935: Surfeit locus protein 6 AT1G22450-cytochrome c WSULs16 XLR2_Contig3033 (ATC)13 *CTCTTTGCCCTGGTGAATGG CAATCAGGCATTTTGTCCATGA 217 11 oxidase subunit 6b, putative

(COX6b) AT4G18370-protease HhoA, WSULs18 CLRX6885.b1_J18.ab1 (TCT)13 *GAAGGTGGTGGGTTGCTGTC TGGGCAATTGCAGATTGAGA 222 6 chloroplast (SPPA) (HHOA) *GATCCTCGCAGAAAACCCAA AT2G46680-homeobox-leucine WSULs19 CLRY6175.b1_M07.ab1 (ATG)14 CCGGCGGTGGTTATTATGAA 229 13 T zipper protein 7 (HB-7)

WSULs21 XLR2_Contig1221 (GT)17 *GCCTCACCATCGCTTCTTTC CGACCAGGCACAAGATGGAT 160 6 Unknown

*GCCTTTGCTAAATCCCCAAA WSULs22 CLRY2617.b1_B08.ab1 (AG)13 GCTCTACACCACCAGCCACA 162 6 AT5G17020-exportin1 (XPO1) A AT3G63030-methyl-CpG- WSULs27 XLR2_Contig2300 (TGA)14 *GGTGGCAGCAACAAGAAACC CCATTCCCTGATTCCTACCAA 220 10 binding domain-containing

protein WSULs30 CLRY7192.b1_O22.ab1 (TCT)9 *GTGCTTCTTCTCGCCCTCCT CCATCCGACGAAGCAAAAAC 160 4 AT2G14910-expressed protein .1 WSULs30 6 .2

AT5G05900-UDP- GAACGAAAACCCAGAAGAAGC WSULs36 CLRX2707.b1_E05.ab1 (TCT)16 *TGGCGCTTTACCCTTTTCCT 181 13 glucoronosyl/UDP-glucosyl A transferase family protein

84 *TGGGACAGCTACTCTTGGGA TTTGAGGTAAAGGCAATCACA AT5G55850-similar to nitrate- WSULs37 CLRZ3386.b1_D08.ab1 (ATT)14 244 6 A ACA

responsive NOI protein

WSULs38 XLR2_Contig130 (AG)21 *TGTTTTTGAGCGCGAGTTGA CCGGTTGTGCTTCTTCCATC 206 aD Unknown

AT5G53300-ubiquitin- WSULs46 XLR2_Contig2941 (GAT)8 *CTCTGTTGACCGACCCGAAC AAAAGGTGCCCTTCCTTACCA 195 3 conjugating enzyme 10 (UBC10) AT5G60170-RNA recognition WSULs50 XLR1_Contig2302 (AGA)9 *ACCAATCCCAATCCCAATCC TCTGGATCCCTCAGCCTCTG 194 6 motif (RRM)-containing protein

WSULs52 XLR1_Contig4719 (ATA)11 *AGCCCGCTGTGCATGTTACT GTCTGGCAGCAGCACTAGCA 180 15 Unknown

TGAATGAGAGGAAGGCATAGT WSULs56 QGF16F05.yg.ab1 (CT)16 *CAAGCAGCGTACCACCACAA 183 23 Unknown CAA *CATTCAAAATCTCTCCCATTT T4G03100-rac GTPase activating WSULs58 XLR1_Contig2259 (AG)13 GCACCTCCTCCTTTTGTTGC 173 4 CAA protein

WSULs67 QGF11J19.yg.ab1 (ATC)10 *CGCCATTTCCCATCTTCCTA CCACCGACCAAATCGTCTTC 167 6 AT2G41120-expressed protein

WSULs74 XLR1_Contig3564 (TAT)10 *GCGTTAAGGCCCGTGTAGTG AATGCAAGGGCTGCGATAAA 248 10 Unknown

*GGATGGTGAGCTGGATCCTT AT5G36170-peptide chain WSULs75 XLR1_Contig3635 (TCT)10 AAGTAGCATGGGCGCTGAAG 194 16 T release factor CCGAATCGGAAGAGATATTGG AT4G29080-auxin-responsive WSULs84 XLR1_Contig3574 (TTC)12 *TCGACCAACACCACCATTTC 210 3 A AUX/IAA family protein AT5G48655-zinc finger CAGAAACCGATTTCATATCAA WSULs89 QGE10H13.yg.ab1 (TTC)11 *TGCGGTTCTTTTGTGCTGTG 238 16 (C3HC4-type RING finger) TACCC family protein WSULs10 *TCCTTCCTTTGCTTGTTTATTT TGCAGGGTTTTCAGAACACAC AT5G67260-cyclin family XLR1_Contig2526 (TC)19 239 24 2 TGG ATT protein

AT1G76700-DNAJ heat shock WSULs10 *GTGGTCAATGCCAACGAATG AGAACAACGCAACGATTGGTC XLR1_Contig3276 (TC)17 181 13 N-terminal domain-containing 3 TA A protein WSULs10 *GCTGTTGCTCCCATTCCTGTT AGAGGCACGACTGCCATTTAG XLR1_Contig4723 (AG)11 177 8 AT3G49550-expressed protein 6 T G WSULs11 *TGGCTGTGGTTGTGGTTGTGT CCAACAAGGAACGGAACCTTT XLR1_Contig4056 (AG)10 246 24 Unknown 2 A G BYDK_0 WSULs11 *AGCCTCAAAAAGCATTCGCA TGCTCACTTTAAATTGGCCTCG QGF19B06.yg.ab1 (GA)10 186 aD (2010 SFP 4 (174.3) Unknown 3 AC T Chip) WSULs12 *CCTAGTGCGTTTTGCTGGGTT QGF13N14.yg.ab1 (AG)13 TTGATCCCACGATCATTCCTGA 241 18 Unknown 0 T WSULs13 *TAAACGCCGGAATGACAGAT AT1G70570-anthranilate QGF24P03.yg.ab1 (AC)9 CCTTTTCAGTGTCGAAGGCACA 225 4 2 CA phosphoribosyltransferase WSULs13 *CGGGGCAAGTCTGGTTAATG TGGGCAACTACTCAACCTTCGT XLR1_Contig1058 (AT)8 193 4 AT2G45600-expressed protein 6 AC T WSULs14 *GGACCAAACCCAAGGAGGAG CATGGTCAAACAACACGCTGA XLR1_Contig317 (CA)8 159 6 Unknown 0 A A AT2G30580-zinc finger WSULs14 *CGGGGACGGAGTCTCTCTAC GAGATGGGGATTCTGGATTGT XLR1_Contig3140 (CA)8 196 2 (C3HC4-type RING finger) 1 TG GA family protein WSULs14 *CATCGTCATCTTCGATTCAAA TTGAGGTTCGATGCTGAGAAG AT3G60600-vesicle-associated XLR1_Contig1473 (TC)8 204 12 8 AACA C membrane protein WSULs16 *ACTTTTGACAGCTTTGAGACT AT5G57330-aldose 1-epimerase XLR2_Contig1938 (GA)15 AGGCCATTGATGCCTTTAGTGA 194 6 3 CG family protein AFEQ_0 85 WSULs16 *CCCTTTGCCTTGTTGATTTTC GTAGATCGGAGCAACGGTGGA CLRY1587.b1_E13.ab1 (GA)12 185 aD (2010 SFP 9 (154.5) Unknown 7 G T Chip) WSULs17 *GGAGTCTTCGCTGCCAAACC CCACACCCATGAACCTGAAAA CLRX1536.b2_P24.ab1 (TC)11 215 4 Unknown 1 TA A WSULs17 *GGCACATACCAACTCTTCCAT TCAAAAGGTGCCGGTGTTATG CLRY7707.b1_E07.ab1 (AC)10 187 8 Unknown 2 CC A WSULs17 *TTAACCTCGCCGGAAACCCT ACCTAGAACCCGCACGCATAA AT5G38630-ACYB-1, CYB-1 | CLRY4253.b1_I07.ab1 (TG)10 152 2 6 AT G cytochrome B561-1 WSULs17 *GCGGGGGAGAAGAAGAGTG CLRZ3919.b1_M19.ab1 (AG)9 TCCCACATTTTCCCTTTTGGTT 176 5 Unknown 8 AG WSULs19 *GGTGACCCAACTACAGACGG TGGATTAACTAACCCCGGTGG CLRY2240.b1_P08.ab1 (GA)8 150 aD Unknown 3 AAT A AT1G66680.1-S-adenosyl-L- WSULs19 *GCAGTACGTTCCCATCACTCT TCAATATCTTCCGGAGGCAAC methionine-dependent CLRX2684.b1_H24.ab1 (TC)8 160 2 8 TC C methyltransferases superfamily protein WSULs20 *CAGCAGATAAACGCCACCAC AT1G80410-acetyltransferase- QGF27H03.yg.ab1 (CT)23 CTCCTTGGGAGGTAGCGAAGC 198 12 4 TC related WSULs21 *TCAATCGAAATCCCTTTCACC TGATTATCAGTCCACCACTCCA XLR1_Contig2838 (ATC)9 240 6 Unknown 0 TG A WSULs21 *ATGTTGGTGAAGGGATGGAG AAGCCAACCCACCAACAATCT AT4G14960-tubulin alpha-6 XLR1_Contig565 (ATG)11 246 12 2 GA C chain (TUA6) AT5G14050-transducin family WSULs22 *CGTGATCCTCTGTGGCAACA TCCAGTGGAATTTGGGAAGAA protein / WD-40 repeat family XLR1_Contig2504 (TTC)8 158 7 4 AT CA protein, contains 4 WD-40 repeats

WSULs25 *CACAGAAGGCTTTGTTGCTG QGE2g01.yg.ab1 (TAT)7 ACAATTGCAGCGTCTCATGCTC 190 7 Unknown 1.1 GT WSULs25 7 1.2 WSULs25 *AAATGAAACCTGCTGCCCAG TGCTCATTGGAGTTGGTTTATG QGF14P09.yg.ab1 (AAT)6 189 9 AT1G32260-expressed protein 8 AT G

AT1G70590-F-box family WSULs25 *CGGCAGCTCATGTGAAGAAT TCCCCAAGCACACATACAAGG XLR1_Contig237 (ACC)6 161 9 protein, contains Pfam PF00646: 9 GT A F-box domain

WSULs26 *GGTGGTGTAAGGAGACGGTT GGCCCCCTGTTCATCTGAATAA QGF14I03.yg.ab1 (ACC)6 166 3 Unknown 0 GG T WSULs26 *TTCATAAGCCCTGATCATGA XLR1_Contig2045 (AGT)6 GGGATTTTTCTGTGAGGCGATT 187 3 Unknown 4 AGC

AT2G38770.1-P-loop containing WSULs27 *GGATCGATGAAATGGCTGGA QGF8E15.yg.ab1 (ATG)7 TGTTCCCCATTTCCCACATTCT 181 3 nucleoside triphosphate 2 AT hydrolases superfamily protein

WSULs29 *TGGGGTCTCCTCCATGTTTGT AT1G55350-calpain-type XLR1_Contig3638 (TCT)6 CACCCATACGCCCCTATTCAAA 154 19 9 T cysteine protease family DEK1 WSULs30 *CGGCTCTCTGTGAGTCCAAC XLR2_Contig3213 (AAG)9 AGAAAGGCGTCACCTTCCCTTT 196 6 Unknown 4 AT

AT2G19170-subtilase family WSULs30 *CCACCTTGGTTCGCTACCTTG ATGGGGAAATTTGGCAATGAG XLR2_Contig797 (ACC)8 167 6 protein, contains similarity to 6 T A meiotic serine proteinase TMP

86 WSULs31 *CTTCGCCTCCTTTTCTCCACT AT3G16260-metallo-beta- XLR2_Contig906 (CTT)8 TATCTGTGCGGTTTCCTTGACG 191 13 G

0 lactamase family protein WSULs31 *GCTGCGTTGGAGAAGGATTA AATCCAACACCCTAACACAAC AT1G50010-tubulin alpha- XLR2_Contig1230 (TAC)8 194 12 3 TG AA 2/alpha-4 chain (TUA2)

AT4G00290-mechanosensitive WSULs31 *TTCTCCTGTTGCAACCAATCA AGGCTTTAGGCAAAGCGAAAC XLR2_Contig283 (TCA)8 161 7 ion channel domain-containing 4 CA C protein

WSULs31 *TTCTGTGGCATTCAACGAGCT XLR2_Contig1251 (AAG)7 GCCAATTTCTCCTCCATCAACC 238 18 AT5G60030-expressed protein 7 T AT5G05470-eukaryotic WSULs32 *CAGCAGCAAGTTTGGACGAA CLRZ482.b1_D01.ab1 (ATC)7 TCAGCTTCAGCCTACCTGACCA 193 3 translation initiation factor 2 7 AA subunit 1

AT5G20030-agenet domain- WSULs32 *TGAAAGGCGTGATAGTGATG GGTGTACAAGCAAGCAAGCCA CLRX7966.b1_K24.ab1 (ATG)7 207 25 containing protein, contains Pfam 9 CAG CT PF05641

WSULs33 *CAAGCTTCCCCTGATGACTG TCATCAGCATCCCAAAGAAAC CLRY5475.b1_F01.ab1 (ATG)7 174 3 AT1G80130-expressed protein 1 GT C WSULs33 *GCTGCTGTTGTTCCGGTACCT TGGATGCTTTGGATGAGGTGA AT3G56590-hydroxyproline-rich XLR2_Contig887 (CAC)7 174 3 5 T A glycoprotein family protein WSULs35 *TGGTATTCCAGCAACCCTGTG CLRX5442.b1_C17.ab1 (TTC)7 CCCTTTGATAGGCGTTGGATTG 198 4 AT5G12900-expressed protein 7 A WSULs35 *CATGAAACTTGCCACTCGAA XLR2_Contig2336 (GAT)8 CCTTTGCACCTCCGGTTATGTC 193 aD AT2G22080-expressed protein 9 GC

AT2G37410-mitochondrial WSULs37 TGGAGCATCAAAGCTCTCCAA XLR1_Contig541 (TTC)12(GTC)4 *AGGAGGCTCCGGCAAGTATG 227 16 import inner membrane 2 A translocase (TIM17)

WSULs37 XLR1_Contig2391 (TC)20-TT-(TC)8 *ATTAATCCCCCTCGCGCTTT TACGTTCCCCGCATGTTCTTTT 245 2 Unknown 4.1 WSULs37 4 4.2 AT1G02000-NAD-dependent epimerase/dehydratase family WSULs38 ATCCGGCTCACCAGAGACAAA CLRY4588.b1_H20.ab1 (AG)20(ACG)8 *GATTTCTTTGTGGCGGCGTAA 199 34 protein, similar to nucleotide 1 C sugar epimerase from Vibrio vulnificus

AT1G53300-thioredoxin family WSULs38 *AGCTGGTGTCTGCCGGAGTT ACCACCGAGGATGGGATAGTG CLRX6482.b1_D14.ab1 (TC)18(AC)9 202 5 protein, contains Pfam profiles 2 AT A PF00085

WSULs38 *GAAAATGGAAGCCAACGACA TGAAGGTGGTGTCAAAACCCA CLRX9570.b1_D18.ab1 (TC)17-C-(CT)17 208 18 Unknown 3 CC AT WSULs39 *CCATTTCCAGCAAGGTGATG AT5G44120-12S seed storage XLR2_Contig2357 (ACA)5(AGG)4 CTTTCTGACTCCTCCCCCATGA 224 4 4 TG protein (CRA1)

*M13 tail sequence added to forward primer, '5-CACGACGTTGTAAAACGAC-3'

a Dominant marker. 87

Table 2. Polymorphic EST-SSR markers used for map development and QTL analysis of an F2 population derived from a cross of the

eastern Washington prickly lettuce biotypes 6-9/13 x 4-10/6.

Growth Habit 120 Stem Count 100

100 80

60 6-9/13 4-10/6 60 Frequency Frequency 40 4-10/6 40

6-9/13 20 20

0 0 0 1 2 3 4 5 1-3 4-7 8-11 12-15 16-19 20-23

40 80 Leaf Perimeter (cm) Polyisoprene Molecular Weight g mol -1

30 60

6-9/13 4-10/6 4-10/6 20 40 Frequency Frequency

10 20

6-9/13

0 0 4 9 4 9 4 9 4 9 4 9 4 9 4 9 4 9 4 9 4 9 4 9 4 9 5 5 6 6 7 7 8 8 9 9 0 0 1 1 2 2 3 3 4 4 5 5 6 6 0 0 0 0 ------1 1 1 1 1 1 1 1 1 1 1 1 1 1 00 00 00 5 0 5 0 5 0 5 0 5 00 0 00 00 0 00 0 1 ------0000 0 0 0 0 0 5 6 6 7 7 8 8 9 9 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 0 0 0 0 0 0 0 1 1 2 2 3 3 4 4 5 5 6 6 -6 5 8 7 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 0-3 0 -1 -1 -2 -3 0 0-2100 0-2400000 0 0 0 00 0000-900 0 0 00 0 0000 0 0000 0 3 6 0 0 0 900000-1200000200000 5 4 7 1 1 180 21000 2 2

Figure 2. Distribution of selected traits showing QTL on Grp 4 and Grp 8 from an F2 population derived from a cross of eastern Washington prickly lettuce biotypes 6-9/13 x 4-10/6.

50 100 Leaf Area Polyisoprene Dispersity 6-9/13 40 80 4-10/6 6-9/13

30 60

Frequency 20 Frequency 40

10 4-10/6 20

0 0

4 9 4 9 4 9 4 9 4 9 4 9 4 9 2 2 3 3 4 4 5 5 6 6 7 7 8 8 1 2 3 4 5 6 7 8 9 1011121314 ------1 5 0 5 0 5 0 5 0 5 0 5 0 5 2 3 3 4 4 5 5 6 6 7 7 8 8 Dispersity (M W/M N) Leaf Area (cm 2)

80 60 Latex Rubber Latex Resin

50 4-10/6

40 6-9/13

40 30 6-9/13

Frequency 4-10/6 Frequency 20

0 0 1 2 3 4 5 6 7 8 9 101112 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 % Rubber (wt/wt) % Resin (wt/wt)

60 Latex Insolubles Latex Water 60 50 6-9/13

6-9/13 40 30 4-10/6 Frequency Frequency 4-10/6 20 20

0 0

6 8 0 2 4 6 8 0 2 4 6 8 0 2 4 6 8 8 0 2 4 6 8 0 2 4 6 8 0 2 4 6 1 1 2 2 2 2 2 3 3 3 3 3 4 4 4 4 4 4 5 5 5 5 5 6 6 6 6 6 7 7 7 7 ------5 7 9 1 3 5 7 9 1 3 5 7 9 1 3 5 7 0 9 1 3 5 7 9 1 3 5 7 9 1 3 5 1 1 1 2 2 2 2 2 3 3 3 3 3 4 4 4 4 4 5 5 5 5 5 6 6 6 6 6 7 7 7 % Insolubles (wt/wt) % Water (wt/wt) Figure 3. Distribution of phenotypic traits from an F2 population derived from a cross of eastern

Washington prickly lettuce biotypes 6-9/13 x 4-10/6.

Trait QTL location Phenotypic variation % Peak value Threshhold 0.05 Additive Dominance Parental Allele

8, WSULs-21 6.9 2.87 2.2 215898 118670 6-9/13 Rubber MW 8, WSULs-374.2 7.7 3.24 2.2 223844 145724 6-9/13

Dispersity a WSULs-374.1 11.2 4.79 NA 0.94 -0.27 6-9/13

8, WSULs-102 40.3 20.87 2.2 19.15 4.97 6-9/13 Leaf perimeter 8, WSULs-212 49.2 27.32 2.2 21.09 9.12 6-9/13

8, WSULs-102 52.0 29.68 2.2 0.37 0.32 6-9/13 Lobing 8, WSULs-212 67.5 45.39 2.2 0.42 0.41 6-9/13

Herbivory 8, WSULs-374.2 7.7 3.25 2.2 -0.07 -0.17 6-9/13

4, WSULs-304 25.6 11.94 2.5 -0.92 0.04 6-9/13

90 Growth habit 4, WSULs-383 7.1 2.98 2.5 -0.36 0.41 6-9/13

4, WSULs-304 29 13.84 2.6 3.55 1.07 6-9/13 Stem count 4, WSULs-383 8.1 3.43 2.6 1.62 0.92 6-9/13

a Unmapped marker, non-QTL, single marker association as determine by IM.

Table 3. QTL and associated markers

Grp 1\Chrom 7 Grp 2 Grp 3 Grp 4 Grp 5\Chrom 9

0.0 WSULs-22

10 15 26.0 WSULs-14 0 0 5 32.6 SML-29 LK1133 0.0 SML-10 0.0 WSULs-331 0.0 WSULs-299 0.0 WSULs-272 4.1 WSULs-357 5.6 WSULs-112 35.8 WSULs-50 37.5 SML-2 20.3 WSULs-30.2 47.5 WSULs-89 48.3 SML-7 45.7 SML-18 44.2 WSULs-314 56.6 SML-60 49.5 WSULs-394 58.8 WSULs-372 50.3 WSULs-224 52.2 WSULs-74 Growth Growth Habit

81.0 MM3.0b Stem Count 52.8 SML-34 LE3129 99.7 WSULs-30.1 119.4 WSULs-304 145.8 WSULs-310 129.0 MM3.0b 146.9 WSULs-84 153.7 WSULs-58 149.1 WSULs-204 154.3 SML-55 152.4 WSULs-383 154.6 WSULs-27 156.0 WSULs-2 167.6 WSULs-163 183.1 WSULs-67 189.9 WSULs-4 201.6 WSULs-46 184.0 WSULs-335 199.3 WSULs-251.1 204.6 WSULs-52 200.4 WSULs-11 205.8 WSULs-260 233.1 WSULs-313 Growth Habit 259.6 WSULs-56 265.0 MM3.0b Stem Count Leaf Perimeter Lobing 326.2 SML-3 Rubber Mw 332.6 SML-41 M1981 Herbivory

Grp 6\Chrom2 Grp 7 Grp 8 Leaf PerimeterLeaf 10 15 20 25 30 35 40 45 0 0 5 0.0 WSULs-172 0.0 WSULs-306 Lobing WSULs-102 1.4 WSULs-19 4.1 WSULs-140 0.0 WSULs-212 5.1 WSULs-120 6.3 WSULs-16 4.2 20.5 WSULs-36 14.4 WSULs-329 48.6 WSULs-176 22.5 WSULs-264 51.5 SML-56 36.2 WSULs-18 56.2 WSULs-317 66.7 WSULs-148 62.0 WSULs-381 57.5 WSULs-198 68.2 WSULs-136

91.7 WSULs-251.2 91.7 WSULs-178 Herbivory Rubber Mw 115.4 WSULs-12 131.4 WSULs-21 132.5 WSULs-374.2 148.7 SML-26 LE3093 142.2 WSULs-210 158.5 WSULs-171

Grp 9 Grp 10 Grp 11 Grp 12

0.0 WSULs-327 WSULs-132 0.0 WSULs-382 0.0 WSULs-75 0.0 0.3 WSULs-258 6.2 WSULs-37 1.1 WSULs-259

24.4 WSULs-106 28.8 WSULs-103

Figure 4. Linkage groups and QTL from eastern Washington prickly lettuce biotype cross (6-

9/13 x 4-10/6). Group designations derived from JoinMap 4.0 software. Bold, red makers with designation MM3.0b are further separation of linkage groups determined by MapMaker 3.0b.

Chromosome designations assigned based on mapped EST markers found in CGPDB and are underlined. The bold markers SML-60 and WSULs-372 were derived from the same EST contig but found in independent SSR mining experiments. Significant QTLs are shown next to linkage groups as black bars with a 1 and 2 LOD QTL interval and corresponding QTL LOD graph.

Chapter 4

Post-Harvest Content, Quality and Physical Properties of Rubber Derived from

Prickly Lettuce

Abstract

The latex bearing plant prickly lettuce ( Lactuca serriola L.) was studied to determine extractability of rubber and evaluate rubber molecular and physical characteristics after extraction. Post-harvest chemical extraction methods of rubber from freeze dried, milled, whole plants and latex extracted rubber from living plants was evaluated. All post-harvest chemical extraction methods on whole plant material yielded small quantities of rubber that was of low quality while direct rubber extraction from latex yielded high quality rubber. Nuclear magnetic resonance spectroscopy (NMR) indicated the presence cis -1,4-polyisoprene, with little to no trans -polyisoprene present. Latex-extracted rubber had physical properties similar to those of

Brazilian rubber tree [ Hevea brasiliensis (Willd. ex A. Juss.) Müll. Arg.] making it an excellent source of rubber for manufacturing.

Introduction

Natural rubber ( cis -1,4-polyisoprene) is a vitally important plant-derived bioproduct essential in the manufacture of over 40,000 products including medical devices (Mooibroek and

Cornish 2000). Rubber tree, a tropically endemic species is the source of industrialized natural rubber production. Harvest of natural rubber has steadily increases since it was first discovered and commercially produced. Worldwide manufacture of natural rubber in 2011 reached

10,978,000 million t with consumption at 10,919,000 t in 2011. Yearly production is at demand levels with minimal surpluses reported. In 2010, there was a 377,000 t deficit in consumption versus production (International Rubber Study Group 2012). Natural rubber has strategic

importance given that the current source of natural rubber is endemic to tropical regions.

Security of supply chains for countries were the rubber tree cannot be cultivated is a high priority. Plant species that are able to efficiently generate the quantity and quality of natural rubber as their tropical counterparts has yet to be found.

The ideal rubber-producing crop for temperate regions will be a fast growing annual that produces large amounts of biomass. Annual crops are more easily incorporated into crop rotation systems and can be planted or removed in response to market fluctuations and independent grower requirements (Van Beilen and Poirier 2007). Perennial plant species such as trees or shrubs often have higher starting costs, have a lag from input to harvest and remain in place for several growing seasons, making them less suited to changing market demands. Preferably, the rubber producing species will also be tolerant and well adapted to cultivation on marginal land, alleviating competition with food crops, as seen in corn-ethanol production (Babcock and

Fabiosa 2011). The required tolerance and adaptability traits are often present in weedy species.

(Lactuca serriola L.) is one such weed, and has been identified as a plant species able to produce high molecular weight rubber (Bushman et al. 2006).

Interestingly, the genus Lactuca , of which prickly lettuce is a prominent member, has long been recognized as a potential source of rubber (Bushman et al. 2006). In 1913, a report

detailed the analysis of latex from two lettuce species, Lactuca canadensis L. and L. scariola L.

Clemson Agriculture Center (Mitchell, Rice, and Roderick 1942) and the US Department of

Agriculture (Polhamus 1958). The reports described differences in latex rubber content of several lettuce species with negligible differences in percent rubber extracted from whole plants.

None of these reports discussed the purity or composition of the latex, the molecular weights of the rubber in the latex, or the condition of the tissues previous to extraction – that work was completed by Bushman et al. in 2006.

Bushman et al. (2006) examined prickly lettuce and a cultivated lettuce cultivar ( Lactuca sativa L. cv. Salinas) to determine characteristics of natural rubber in those two lettuce species.

They demonstrated that both species produce latex containing desirable high molecular weight

(>1 million g mol -1) cis -1,4-polyisoprene with very narrow polydispersity that should lead to excellent product characteristics after vulcanization. Bushman et al. (2006) also concluded that genetic, developmental, or environmental influences could impact latex molecular weight and suggested optimizing the genetic, physiological, and environmental conditions for the synthesis of higher molecular weight rubber for prickly lettuce. In order to elucidate the potential prickly lettuce has as an alternative source for latex and rubber bioproducts, further research and development must be conducted.

Evaluation of rubber from twenty eastern Washington prickly lettuce biotypes collected in 2006 found that all biotypes had rubber considered high quality as determined by molecular weight and dispersity (ð). Variation was observed in rubber content and quality with some

biotypes producing exceptionally high molecular weight rubber. The collection serves as a source for understanding several prickly lettuce biological characteristics including weed resistance (Burke et al. 2009), genetic diversity (Riar et al. 2011) and in this work, rubber production potential. In preliminary screening of rubber content and quality, rubber was extracted directly from tapped latex. As an annual plant with relatively small stems, extracting rubber from tapped latex would not be feasible in large scale production. Rubber extraction from whole plants would be a more realistic approach to harvesting prickly lettuce rubber.

Rubber is an elastomer that possesses unique chemical and physical properties.

Vulcanization introduces cross-linkages of the isoprene polymers mainly through sulfur bridges.

Sulfur cross-linking is achieved when rubber dienes react with sulfur in the presence a catalyst, under heat and pressure. Vulcanization increases the retractile force of distorted polymer chains when under mechanical stress and reduces the amount of permanent deformity remaining when deforming force is removed (Mark and Erman 1994).

Although vulcanized rubber is the final end product, physical properties of pre- vulcanized rubber (green rubber) are important indicators of rubber end-use performance.

Thermal properties or physical state changes are one gauge of the polymer qualities. Detection of energy changes and heat capacity as the material transforms from solid to amorphous to liquid

states provides the thermal properties of glass transition temperatures (Tg) and melting temperature (Tm). The Tg of a material is one indicator of the end use potential, specifying the temperature at which hardening occurs. Materials cannot be processed or worked or becomes brittle once below the Tg (Sichina 2000). The Tg also relates to the end use properties. For example, thermosetting two-part epoxy resin has a Tg below 25 °C until mixed. Once combined, cross linking of the resin while curing raises the Tg well above room temperature creating a hard bonding material (Sichina 2000). Tensile strength, another physical property, is defined as the resistance of an applied load in the opposite direction. As a pulling force is applied, tension forces cause the polymers to align, reducing the number of chain entanglements (Blyler 1969;

Hamed 1981). More chain entanglements impart a stronger resistive tensile strength. The tensile strength of a polymer increases with higher molecular weight (more entanglements) and low ð

(fewer short chains). In addition to chain entanglements, green strength of non-vulcanized elastomers is influenced by branching (Blyler 1969; Grechanovskii, Ivanova, and Poddubnyi

1973), polar group interactions (Grechanovskii, Ivanova, and Poddubnyi 1973), gel content

(Grechanovskii, Ivanova, and Poddubnyi 1973; Grechanovskii, Poddubnyi, and Ivanova 1974), crystallization on stretching (Grechanovskii, Poddubnyi, and Ivanova 1974), and test sample preparation (Amnuaypornsri, Sakdapipanich, and Tanaka 2009). Green strength of non- vulcanized rubber is important as it determines end-use processability, especially in mass production systems. Molded non-vulcanized tires would lose their shape while waiting to be vulcanized without proper green strength (Hamed 1981).

of the year. Collection is made by cutting a thin layer of bark just above the cambial layer and collecting drips of latex into a cup. Anti-coagulating agents, usually ammonia, are added during collection to preserve the latex in liquid form or formic acid is added to the latex to coagulate the suspended rubber particles and collected as cup lump rubber (Sakdapipanich and Rojruthai

2012). Other rubber producing species under commercial investigation are not amenable to tapping procedures: therefore more destructive methods must be used to release and then isolate rubber particles or polymers from plant tissue. Plant processing in this manner presents challenges in maintaining rubber integrity throughout the extraction process. For example, processing of bulk rubber from guayule (Parthenium argentatum Gray.) has been difficult due to low bulk viscosity and entrained co-extracted resin causing oxidative and thermal polymer degradation (Schloman 2005). The chemical and physical properties of rubber isolated from plant tissue is an artifact of the polymer structure within the latex-bearing cells and the method of polymer extraction as noted in guayule extractions (Schloman 2005).

In general there are two main methods of rubber extraction, solvent extraction and flotation. Chemical extraction of rubber entails isolation of rubber polymers from plant material and other metabolites using selective solvents after grinding of plant material. Solvents can be added sequentially or simultaneously. In sequential solvent extraction, a polar organic solvent such as acetone is first used to extract pigments, polar lipids, resins, and other polar metabolites while leaving non-polar hydrocarbons. A second, non-polar dissolving solvent such as hexane, cyclohexane, toluene or benzene is used to then solubilize rubber. All other non-polar compounds such as waxes and lipids could be present as impurities in the rubber fraction.

Simultaneous solvent extraction includes addition of a single solvent such as xylene (Wagner and Parma 1988) or an azeotropic mixed solvent system (Beinor and Cole 1986). Simultaneous

extraction produces a mixture of dissolved resin and rubber. Precipitation of the rubber by addition of acetone or alcohol is a means of further purifying the rubber polymers. For most small scale analytical purposes, chemical extraction has been the method of choice. Researchers have used a mixture of chemical extraction methods to analyze rubber from various plant derived sources (De Rodriguez and Kuruvadi 1991; Hammond and Polhamus 1965; Mekkriengkrai et al.

2004; Nurthen et al. 1986; Pearson et al. 2010; Pearson, Cornish, and Rath 2013; Spanò et al.

(Hamerstrand and Montgomery 1984; Schloman 2005).

Flotation extraction methods have also been used in lab scale experiments and bulk rubber production. This method usually involves milling and centrifugation steps in an aqueous buffer, the addition of acid to coagulate rubber or creaming agents to float the rubber particles is a common practice (Buranov and Elmuradov 2010; Cornish and Backhaus 1990). Direct water, milling and floatation methods have been developed for application on fleshy plants (Eskew and

Edwards 1946; Stamberger, Koenig, and Hanslick 1946)

The efficient extraction of rubber from a highly complex plant matrix continues to be a problem in all facets of natural rubber production. Brazilian rubber tree tapping of latex bypasses impurities introduced from whole plant extraction. However, tree tapping and latex collection is performed by hand, decreasing efficiency, and latex stability must be maintained by addition of anti-coagulants and anti-oxidants. Plants that must be destroyed to harvest rubber need refinements to extraction procedures that increase rubber yield and decrease rubber deterioration.

Efficient, non-degradative extraction of rubber from prickly lettuce will be a major hurdle to overcome to produce high quality bulk rubber.

The end-use potential of plant isolated rubber is dependent on the quality of rubber obtained post-extraction. Methods of harvesting, storage and extraction affect the quantity and quality of rubber available to make rubber products. To date, there are no studies evaluating extraction methods or physical properties of prickly lettuce derived rubber. The objectives of these studies were (1) to evaluate latex extracted rubber compared to extraction methods on dried prickly lettuce whole plant material (2) assess the rubber quantity, quality and molecular characteristics post extraction and (3) determine if prickly lettuce rubber has physical properties suitable for the rubber industry.

Materials and Methods

Plant Material Origin

In the fall of 2006 seed from twenty eastern Washington prickly lettuce biotypes was collected. A single seed from each field collection was propagated in greenhouse conditions to obtain working stock seed collections from each biotype.

Plant Material for Latex Extraction

Stock seed from six biotypes, including the two used in whole plant extractions (Table 1), were used to extract rubber from latex. Plants were grown at Washington State University in a

greenhouse located on campus and simultaneously at Cook Agronomy Farm near Pullman, WA

(GPS coordinates 46° 47' 3.555" N, -117° 5' 26.379" W). Plants for both locations were started under greenhouse conditions by seeding working stock seed in 10 cm square plastic pots with potting media (LC1 Mix. Sun Gro Horticulture Distribution Inc., Bellevue, WA). The greenhouse was kept at 26 °C daytime and 22 °C night time ( ± 3 °C) temperatures. Natural light was supplemented with sodium vapor lighting to give a 14 h photoperiod that coincided with the daytime portion of the temperature profile. Potted plants were placed in trays and sub-irrigated as needed. After four weeks, plants for field study were transplanted to the Pullman site. The field trial area was prepared by fall chisel plowing followed by late-April cultivation and harrowing prior to transplanting. Latex samples were collected from non-treated plots in an unrelated field experiment studying herbicide tolerance which was arranged in a randomized complete block design. Plants were spaced 1 m from each other and from plants in the adjacent plot. Soil type was classified as Palouse silt loam (fine, silty, mixed, mesic, Pachic Ultic Haploxerolls). Soil pH was 5.2, and organic matter was 3.5 %. Latex collections began once stems had developed through seed set. Greenhouse plants were transplanted to taller 16 cm round plastic pots. No other inputs were used in the cultivation of either greenhouse or field plants.

Plant Material for Whole Plant Extraction

Two biotypes were evaluated for whole plant rubber extraction, biotypes 6-9/13 and 4-

10/6 (Table 1). The selected biotypes were chosen based on preliminary screening of the original twenty collected biotypes which revealed they had the most distinct rubber producing properties.

Stock seed was sown in 10 cm square pots with potting media (LC1 Mix Sun Gro Horticulture

Distribution Inc., Bellevue, WA) under greenhouse conditions. Plants were kept at 26 °C daytime and 22 °C night time ( ± 3 °C) temperatures. Natural light was supplemented with

100

sodium vapor lighting to give a 14 h photoperiod that coincided with the daytime portion of the temperature profile. Plants were sub-irrigated as needed. After approximately four weeks in the greenhouse, plants were transplanted to a field location near Pullman Washington at Washington

State University’s Cook Agronomy Farm near Pullman. The 2010 site (GPS coordinates 46° 47’

3.555” N, -117 ° 5; 26.379” W) was planted May 22 while the 2011 site (GPS coordinates 46°

46' 55.6284" N, -117° 5' 9.96" W) had a much later planting date of June 7 due to cold and wet weather conditions. Plantings were at 2 m row spacing with 1 m between each plant. Four individual plants representing four replicates were used in the study.

Both biotypes were harvested at or near anthesis. For biotype 6-9/13 this was 75 and 79 d after planting in 2010 and 2011 respectively. Biotype 4-10/6 was harvested at 140 d in 2010 and in 2011 at 119 d after planting. The 2011 harvest of biotype 4-10/6 was prior to reaching anthesis due to threat of frost. Plants were harvested by cutting the stem at ground level and placing in a paper bag. Wet weights were immediately taken and plants were frozen and stored at -80 °C.

Whole frozen plants were crushed by hand and lyophilized using an FTS Systems Multi-Dry

(Model FD-5-84A-D). Dry weights were taken to determine percentage of water loss. Freeze dried plant material was crushed and homogenized with a Wiley mill and stored in a sealed plastic bag at 4 °C until extraction.

Latex Extraction

Latex was collected twice from greenhouse grown plants and four times in the field.

Latex collections began once stems had developed through seed set. To collect latex, multiple

45° angular cuts to plant stems were made with a razor blade and the resulting latex was collected into a tared micro-centrifuge tube. Tubes were capped and chilled. The latex collections were dried for 48 h under vacuum at 35 °C to remove all water. Dried samples were

101

extracted three times with acetone by addition of one mL acetone, vortexing, centrifugation for five min at 6822 g, and collection of supernatant into a clean, tared vial with teflon lined cap.

Acetone extraction was followed by hexane extraction to dissolve rubber. One mL hexane was added to each tube followed by vortexing and hand stirring with a spatula to dislodge rubber pellet. Samples were centrifuged and supernatant collected into a tared vial. Rubber was extracted three times with hexane, the third hexane addition being allowed to sit 8-10 h before supernatant collection. Hexane was dried under air and vials were re-weighed for total contained rubber.

Whole Plant Rubber Extraction and Yield

Three rubber extraction methods for dried, powdered prickly lettuce were compared. The first utilized a 1 L capacity soxhlet apparatus and a two solvent system. A known amount (~50 g) of crushed and homogenized plant material was placed into a single thickness cellulose thimble,

60 mm x 180 mm (Whatman). A folded piece of cellulose filter paper was placed on top of the sample to prevent splashing of dripped solvent. Acetone was used as an initial solvent to remove pigments and resin. Acetone (500 mL) was poured into the lower collection flask and 5 to 10 teflon boiling stones were added. The soxhlet apparatus was assembled and the lower flask heated to an even boil. Condenser liquid was maintained at 10 °C. Acetone extraction was continuously run for 48 h. after which time extraction solvent was transferred and dried under a stream of air into a tared vial. Extracts were further oven-dried at 55 °C for 24 h. Dried acetone extract was re-weighed to yield total percent resin. Samples were subjected to a second, non- polar solvent to extract rubber. In a separate clean flask 500 mL hexane and boiling stones were added. Soxhlets were heated and allowed to reflux for 48 h. Hexane extract was transferred to a

102

tared vial similar to the acetone extract however no oven drying occurred. The dried hexane extract was re-weighed to yield total contained percent rubber by weight.

The second extraction method employed the same two solvent system, however plant material went through a solvent slurry and filtration procedure. A known amount (~50 g) of dried, milled plant material was placed into a 500 mL Erlenmeyer flask. The first solvent, acetone, was added to completely cover the powder (200 mL). The antioxidant butylated hydroxytoluene (BHT) was added at 0.1 % wt/wt (1.0 mM). The acetone slurry was further homogenized and pulverized with a Polytron homogenizer for 60 s. A stir bar was added to the flask and allowed to mix for 24 h. The resultant slurry was vacuum filtered with a buchner filter funnel through three coffee filters into a 1 L filter flask. Filter cake was washed with acetone.

Filtrate was successively transferred to a tared vial and dried under a stream of air. Further drying was done in an oven at 55 °C for 24 h. Acetone extract was re-weighed to determine total percent resin. The filter cake was left in the filter and oven dried for 16 h. at 55 °C then removed and cooled to room temperature. Rubber was extracted in the second solvent phase. Dried, acetone extracted powder was weighed into a 500 mL Erlenmeyer flask. Hexane was added to cover the powder. The sample flask was capped and stirred slowly for 48 h. The slurry was vacuum filtered in the same manner as the acetone slurry and washed with copious amounts of hexane. Hexane filtrate was transferred to a tared vial and dried under a stream of air. As a final rinse, each flask was washed with 30 mL tetrahydrofuran. Dried hexane extract was re-weighed to yield total contained hexane soluble material.

In the third method of extraction, plant material was extracted via direct hexane solvent slurry followed by alcohol precipitation to recover rubber. A known amount of plant material

(~50 g) was added to a 500 mL Erlenmeyer flask and 200 mL hexane was added to cover the

103

powder. Antioxidant (BHT) was added at 0.1 % wt/wt. Each sample was capped and allowed to sit without stirring at room temperature for 5 d to dissolve rubber. The hexane slurry was vacuum filtered and washed with hexane. An equal volume of ethanol and methanol were added to the filtrate to precipitate the rubber fraction. The solution was allowed to sit for 6 d to precipitate all rubber. Precipitate was collected by vacuum filtering the solution through a 0.2

µm nylon filter. Filters with precipitate were placed into a vial with 20 mL hexane to re-dissolve rubber material. Each filter was washed three times with 20 mL hexane. Washes were allowed to sit 24 hours, centrifuged at 2800 g and clear solvent removed into a tared vial. Hexane was evaporated under a stream of air and vials re-weighed to determine contained hexane soluble precipitate.

Rubber Molecular Weight, Physical Properties and NMR

To analyze rubber polymers characteristics, hexane soluble fractions from whole plant extractions and latex extractions were analyzed by high performance liquid chromatography gel permeation/size exclusion chromatography (HPLC-GPC/SEC). Polymers were detected with refractive index (RI) detection to evaluate rubber (polyisoprene) polymer chain length. Dried hexane soluble fractions were re-eluted in tetrahydrofuran (THF) to a concentration of approximately 5 mg mL -1. Samples were allowed to dissolve at room temperature overnight. A

100 µL portion of the dissolved rubber solution was removed from the top, without disturbing any non-dissolved material at the bottom of the vial, and transferred to an HPLC vial fitted with a 250 µL glass insert. An autosampler injected 70 µL of the solution. Samples were analyzed with an Agilent 1100 series HPLC equipped with an Agilent G1362A RI detector. Polyisoprene polymers were separated with a Phenogel Linear/Mixed Guard Column (10 µM 7.5x50 mm), and a PLgel Mixed-B size exclusion column (10 µM 7.5x300 mm) using THF (BHT stabilized) as

104

mobile phase. Flow was set to 1 mL min -1 with a run time of 17 min. The column and detector were heated to 40 °C. Sample molecular weights were extrapolated using Varian (EasiVial) polystyrene standards to create a semi-logarithmic standard curve. A single standard of 1,4-

-1 polyisoprene (M W 999,000 g mol ) (Polymer Standards Service) was added to the standard curve as a check against the polystyrene polymers. Agilent GPC software was used together with standards to generate a standard curve and estimate average molecular weight (Mn), weighted average molecular weight (M W), and ð. Rubber material isolated from direct latex extraction was analyzed for physical properties. All other extraction procedures on dried homogenized plant material yielded low molecular weight rubber by HPLC/GPC and were therefore unsuitable for analysis (Table 2).

Samples for NMR and physical properties analysis were combined by biotype and further purified. THF stored samples from the six collection times were pooled together. Combined samples were centrifuged at 2800 g for 15 min and the top clear solution was removed to a tared vial, repeated three times with 10 mL fresh THF. Samples were concentrated under air to approximately 10 mL. Acetone was used to precipitate and purify rubber polymers. Acetone was added (30 mL) to vial capacity and the solution was air dried again to 10 mL and 30 mL of fresh acetone was added to the vial. Rubber precipitate was centrifuged at 2800 g, solvent decanted and washed twice with fresh acetone.

For dynamic mechanical analysis (DMA) combined, precipitated rubber samples were dissolved in hexane and cast by floatation. A rectangular mold dimensions 3.2 x 2.1 x 0.5 mm was filled with 3 mL water and dissolved rubber sample was pipetted to the top of the water surface and allowed to air dry at room temperature. Films were carefully removed and held between glass slides with a few drops of water to prevent sticking. Films were cut to an average

105

width of 3.5 mm and had an average thickness of 113.5 µm. Cut films were clamped into a TA

Instruments Q800 DMA to test viscoelastic properties such as tensile strength. The instrument was set to perform a controlled force experiment at 28 °C with a ramp force of 0.1 N min -1.

Stress-strain curves were generated to determine Young modulus (slope of linear range before yield), and maximal yield force.

Differential scanning calorimetry (DSC) was performed using a TA Instruments Q200 instrument with 5-10 mg of the combined precipitated rubber. Samples were subjected to two heating and cooling cycles beginning at -90 °C and heated to 200 °C at a rate of 10 °C min -1. For analysis purposes, the first heating curve was omitted and the second curve studied for thermal properties.

Identity of the extracted hexane soluble fractions was determined by 1H and 13 C nuclear magnetic resonance (NMR) spectroscopy using a Varian 400 Mhz. Combined precipitated rubber samples from prickly lettuce biotype 6-10/6 and the synthetically prepared polyisoprene standard were used for NMR structure determination. The samples were dissolved at 1% (w/v) in CDCL 3 and heated to 50 °C during analysis.

Results and Discussion

Latex Rubber Extraction and Yield

Rubber extracted directly from latex yielded more rubber of higher quality than any of the other tested methods on dried powdered prickly lettuce material. On average the amount of contained rubber in latex ranged from 2.2 to 4.9 % wt/wt (Table 1). Molecular weight the rubber extracted from latex was indicative of high polymer quality. Average M W ranged from 1119222 to 2175798 g mol -1 with ð values between 2.26 and 2.68 (Table 1).

Whole Plant Rubber Extraction and Yield

106

Extraction from homogenized whole plant material was undertaken in an attempt to simulate scale-up potential for prickly lettuce rubber production. Post harvest freezing followed by freeze drying and grinding was thought to be least destructive to rubber polymers while allowing for solvent extraction. However, the extraction methods used on this material yielded very little rubber all of which was low molecular weight (Table 2). Soxhlet extraction yielded approximately 0.04 % w/w rubber from biotype 6-9/13 in both the 2010 and 2011 studies with

-1 average M W of 29931 and 38491 g mol respectively. Biotype 4-10/6 yielded slightly more rubber, 0.093 % (2010) 0.064 % (2011), however the quality was inferior with M W at 918 and

4140 g mol -1 in 2010 and 2011. The hexane slurry followed by alcohol precipitation yielded

0.046 and 0.022 % w/w in 2010 and 2011 from biotype 6-9/13 with M W of 17236 and 187330 g mol -1, respectively. Biotype 4-10/6 precipitation amounts were nearly indistinguishable and insufficient for GPC analysis. The two solvent slurry extract demonstrated higher relative yield, yet the hexane extract had wax-like properties, presumably due to contamination. Polymer characterization via chromatography was not undertaken.

Rubber from prepared samples had degraded during post-harvest processing or in the extraction steps. The double bond diene groups of rubber polymers are susceptible to oxidative attack by free radicals. It is likely the presence of oxidative compounds released in the solution during chemical extraction degraded the rubber polymers as this degradation was not observed in rubber extracted from directly-tapped latex. Partitioning of the plants further by stem or root may help alleviate the degradation effects. Unfortunately, latex from root tissue was not examined in this study although cut taproots reveal the presence of latex in root organs. Rubber extracted from root tissue using the chemical extraction methods presented may be of higher quality as there are fewer oxidative compounds present during the extraction process.

107

NMR Analysis

Analysis of proton and carbon NMR spectra confirmed the presence of cis -1,4- polyisoprene in the selected test samples. Distinctive proton chemical shifts indicating presence of the olefinic proton ( H-C=C) at 5.13 ppm, the methylene proton (-CH2-C=C) at 2.06 ppm and the cis -methyl proton (C H3-C=C) 1.68 at ppm (Figure 1). Characteristic carbon shifts were observed consisting of the two ethylenic carbons (-CH 2-C=C-CH 2-) at 135.1 and 125.0 ppm, the methylenic carbons (-CH2-C=C-CH2-) at 26.3 and 32.1 ppm and the methyl carbon (CH3-C=C) at 23.3 ppm (Figure 2). Little to no trans -polyisoprene was detected as carbon signals corresponding to trans -methyl (16.0 ppm) and trans -methylene (40.0 ppm).

Physical Properties

DMA measures viscoelastic properties as material is deformed under controlled stress and temperature. One important viscoelastic property is tensile strength or green strength when referring to non-vulcanized compounds. The green strength of the prickly lettuce samples tested had Young’s modulus ranging from 0.0037 to 0.0166 MPa and maximal yield points between

0.1678 and 0.2849 MPa (Table 1, Figure 3). By comparison, maximal yield point of rubber tree rubber is reported to be 0.25 MPa (ASTM 2009).

DSC studies phase transition of a non-crystalline or semi-crystalline material when heated or cooled. The prickly lettuce rubber samples tested had Tg’s ranging from -64.15 to -

64.95 °C (Table 1, Figure 4). As a comparison the Tg of natural rubber isolated from Brazilian rubber tree is -75 °C (National Institute for Materials Science). Molecular weight and ð, reflected in the number-average molecular weight (Mn), are factors contributing to the Tg of polymeric material (Claudy et al. 1983). As Mn increases, Tg also increases to a maximal Mn to

Tg value. The relationship is expressed by the Fox and Flory equation, Tg = Tg( ∞) – Kg/Mn

108

where Tg( ∞) is the limiting Tg at very high Mn and Kg is the free volume constant (T. G. Fox and Flory 1950).The polyisoprene standard had the highest Tg of -62.08 °C corresponding to the highest Mn, 951428 g mol -1. Five of the rubber samples tested had average Mn values near

800,000 g mol -1 (+ 87,000) all of which had a Tg ranging from -64.15 to -64.95 °C (Table 1).

Biotype 4-10/6 had a lower Mn of 470261 g mol -1 which corresponded to a Tg of -65.05 °C

(Table 1).

Melting point is another physical transition state in polymers, where a material changes from a crystalline phase to a solid amorphous phase. The melting point determines the maximum workable temperature of a material. The prickly lettuce rubber samples had a melting point temperature (Tm) ranging from 47.66 °C to 59.07 °C. For comparison, the Tm of rubber tree rubber is estimated to be near 41 °C (National Institute for Materials Science).

The thermal properties of prickly lettuce rubber were similar to or better than that of rubber tree rubber, the industry standard. The high molecular weight and low ð of the prickly lettuce rubber attributed to high Tg, Tm, and green strength.

Conclusions

Natural rubber isolated from the common weed prickly lettuce is a potential rubber source. Isolation of rubber directly from latex yielded polymer of high quality as revealed by high M W and low ð. The rubber exhibited exceptional physical properties similar to rubber tree rubber. The extraction of rubber from whole plant material as described in this study proved to be suboptimal giving very low yields and degraded rubber polymers. Optimization of post- harvest treatment and extraction methods will need to be determined in order for prickly lettuce to become a suitable domestic source of natural rubber.

Acknowledgements

109

The authors would like to acknowledge funding for this project through the Aegilops cylindrica – Biomass for Biofuels and Bioproducts from Weedy Plants (NIFA/USDA special grant). Special thanks go to Randall Stevens, Misha Manuchehri, and Dennis Pittman, from the

Department of Crop and Soil Sciences, Washington State University for, their technical assistance in lab and field studies. Assistance with NMR analysis was given by Bill Hiscox at the

Washington State University NMR Center. NMR equipment was supported by NIH grants

RR0631401 and RR12948, NSF grants CHE-9115282 and DBI-9604689 and the Murdock

Charitable Trust. Rubber physical property analysis was performed with the guidance and support of Dr. Armando McDonald and Liqing Wei at the University of Idaho, Renewable

Materials Program College of Natural Resources.

110

Literature Cited

American Society for Testing and Materials, 2009. Standard test method for determination of

green strength of raw rubber or unvulcanized compounds (D 6746 – 08)

http://astm.stii.dost.gov.ph/Section9/09.01/PDF/D6746.pdf (Accessed January 24, 2013)

Amnuaypornsri, S, J. Sakdapipanich, and Y. Tanaka. 2009. Green strength of natural rubber: The

origin of the stress–strain behavior of natural rubber. Journal of Applied Polymer Science

111: 2127–2133.

Babcock, B. A., and J. F. Fabiosa. 2011. The impact of ethanol and ethanol subsidies on corn

prices: Revisiting history. CARD Policy Brief 11.

Beinor, R. T., and W. M. Cole. 1986. Solvent fractionation of guayule rubber. U.S. Pat.

4,623,713.

Blyler, L. L. 1969. Some aspects of the relationship between molecular structure and flow

behavior of polymer melts. Rubber Chemistry and Technology 42: 823–834.

Buranov, A. U., and B. J. Elmuradov. 2010. Extraction and characterization of latex and natural

rubber from rubber-bearing Plants. Journal of Agricultural and Food Chemistry 58:734–

743.

Burke, I. C., J. P. Yenish, D. Pittmann, and R. S. Gallagher. 2009. Resistance of a prickly lettuce

(Lactuca serriola ) biotype to 2,4-D. Weed Technology 23:586–591.

Bushman, B. S., A. A. Scholte, K. Cornish, D. J. Scott, J. L. Brichta, J. C. Vederas, O. Ochoa, R.

W. Michelmore, D. K. Shintani, and S. J. Knapp. 2006. Identification and comparison of

natural rubber from two Lactuca species. Phytochemistry 67:2590–2596.

Claudy, P., J. M. Létoffé, Y. Camberlain, and J. P. Pascault. 1983. Glass transition of

polystyrene versus molecular weight. Polymer Bulletin 9 (4-5): 208–215.

111

Cornish, K., and R. A. Backhaus. 1990. Rubber transferase activity in rubber particles of

guayule. Phytochemistry 29:3809–3813.

De Rodriguez, D. J., and S. Kuruvadi. 1991. Comparison of soxhlet and homogenizer extraction

methods to determine rubber and resin content of Mexican guayule plants. Bioresource

Technology 35:179–183.

Eskew, R. K., and P. W. Edwards. 1946. Process for recovering rubber from fleshy plants. U.S.

Pat. 2,393,035.

Fox, C. P., 1913. Wild Lettuce Rubber. J. Ind. Eng. Chem. 5:477–478.

Fox, T. G., and P. J. Flory. 1950. Second order transition temperatures and related properties of

polystyrene. I. Influence of molecular weight. Journal of Applied Physics 21: 581–591.

Grechanovskii, V. A., I. Ya Poddubnyi, and L. S. Ivanova. 1974. Molecular structure and

macroscopic properties of synthetic cis-poly(isoprene). Rubber Chemistry and

Technology 47: 342–356.

Grechanovskii, V. A., L. S. Ivanova, and I. Ya Poddubnyi. 1973. Nature of the cohesional

strength of synthetic cis-polyisoprene SKI-3 and carbon black compounds based on it.

Rubber Chemistry and Technology 46: 1234-1238

Hamed, G. R. 1981. Tack and green strength of elastomeric materials. Rubber Chemistry and

Technology 54: 576–595.

Hamerstrand, G. E., and R. R. Montgomery. 1984. Pilot-scale guayule processing using

countercurrent solvent extraction equipment. Rubber Chemistry and Technology 57: 344–

350.

Hammond, B. L., and L. G. Polhamus. 1965. Research on Guayule (Parthenium Argentatum),

1942-1959 . U.S. Dept. of Agriculture.

112

International Rubber Study Group. International Rubber Study Group - Home Page.

http://www.rubberstudy.com/ (Accessed 24 October, 2012)

Mark, J. E., and B. Erman. 1994. Science and Technology of Rubber . Academic Press.

Mekkriengkrai, D., K. Ute, E. Swiezewska, T. Chojnacki, Y. Tanaka, and J. T. Sakdapipanich.

2004. Structural characterization of rubber from jackfruit and Euphorbia as a model of

natural rubber. Biomacromolecules 5: 2013–2019.

Mitchell, J. H., M. A. Rice, and D. B. Roderick. 1942. Rubber analysis of plants in South

Carolina. Rubber Chemistry and Technology 15:978.

Mooibroek, H., and K. Cornish. 2000. Alternative sources of natural rubber. Applied

Microbiology and Biotechnology 53:355–365.

National Institute of Materials Science (NIMS), Polymer database Polymer ID (P060002)

http://polymer.nims.go.jp/PoLyInfo/cgi-bin/pi-id-search.cgi?PID=P060002&pred=on

(Accessed January 21, 2013)

Nurthen, E. J., B. V. McCleary, P. L. Milthorpe, and J. W. Whitworth. 1986. Modified soxhlet

procedure for the quantification of resin and rubber content of guayule. Anal. Chem. 58:

448–453.

Pearson, C. H., K. Cornish, and D.J. Rath. 2013. Extraction of natural rubber and resin from

guayule using an accelerated solvent extractor. Industrial Crops and Products 43:506–

510.

Pearson, C. H., K. Cornish, C. M. McMahan, D. J. Rath, and M. Whalen. 2010. Natural rubber

quantification in sunflower using an automated solvent extractor. Industrial Crops and

Products 31: 469–475.

113

Polhamus, L. 1958. Rubber content of miscellaneous plants, production research report No. 10.

Agricultural Research Service, U.S. Dept. of Agriculture.

Riar, D. S., S. Rustgi, I. C. Burke, K. S. Gill, and J. P. Yenish. 2011. EST-SSR development

from 5 Lactuca species and their use in studying genetic diversity among L. serriola

biotypes. Journal of Heredity 102:17 –28.

Sakdapipanich, J. T., and P. Rojruthai. 2012. Molecular structure of natural rubber and its

characteristics based on recent evidence. In Biotechnology - Molecular Studies and Novel

Applications for Improved Quality of Human Life , ed. Reda Sammour. InTech.

Schloman Jr., W. W. 2005. Processing guayule for latex and bulk rubber. Industrial Crops and

Products 22:41–47.

Sichina, W. J. 2000. Measurement of Tg by DSC. Perkin Elmer.

http://shop.perkinelmer.de/content/applicationnotes/app_thermaltgbydsc.pdf. (Accessed 4

January 2013)

Spanò, D., F. Pintus, C. Mascia, M. A. Scorciapino, M. Casu, G. Floris, and R. Medda. 2012.

Extraction and characterization of a natural rubber from Euphorbia characias latex.

Biopolymers 97: 589–594.4.

Stamberger, P., E. R. Koenig, and R. S. Hanslick. 1946. Treatment of rubber. U.S. Pat.

2,399,156.

Swanson, C. L., R. A. Buchanan, and F. H. Otey. 1979. Molecular weights of natural rubbers

from selected temperate zone plants. J Appl Polym Sci 23:743–748.

Tanaka, Y., S. Kawahara, E. Aik-Hwee, K. Shiba, and N. Ohya. 1995. Initiation of biosynthesis

in cis polyisoprenes. Phytochemistry 39: 779–784.

114

Van Beilen, J. B., and Y. Poirier. 2007. Establishment of new crops for the production of natural

rubber. Trends in Biotechnology 25: 522–529.

Wagner, J. P., and D. G. Parma. 1988. Continuous solvent extraction process for recovery of

natural rubber from guayule. Polymer-Plastics Technology and Engineering 27:335–350

115

% Young Yield Collection % M Mn Tg Tm Accession no. Geographical location Rubber W ðd Modulus Stress site Rubber (g mol -1)b (g mol -1)c (°C)e (°C)f SE (MPa) (MPa) Lactuca serriola N W Cultivated 6-9/13 47.20565 -117.21192 4.9 0.43 1911049 713077 2.68 -64.95 52.68 0.0083 0.2183 field Cultivated 6-9/21 46.78925 -117.62885 3.2 0.35 2175798 814905 2.67 -64.66 54.98 0.0037 0.1678 field 2-10/6 46.72285 -119.03190 Roadside 3.9 0.91 2073645 864018 2.40 -64.15 56.11 0.0166 0.2849

4-10/6 46.32177 -119.08208 Roadside 2.2 0.47 1119222 470261 2.38 -65.05 47.66 NA NA

6-10/6 46.29864 -118.40838 Roadside 4.4 0.69 1851684 819329 2.26 -64.26 59.70 NA NA Cultivated 7-10/6 46.35657 -117.95143 4.7 0.62 1986148 785052 2.53 -64.66 57.06 0.004 0.208 field Polyisoprene std a NA NA NA NA NA 999000 951428 1.05 -62.08 NA NA NA

116

a Synthetic 1,4-polyisoprene standard purchased from Polymer Standards Service. M W, Mn and ð obtained from manufacturer and Tg

determined experimentally.

b Weighted average molecular weight. Values were weighted again based on mass of each combined individual.

c Number average molecular weight.

d Dispersity value defined as M W/Mn, Where M W equals the polymer weight average molecular weight and Mn equals the polymer

number average molecular weight.

e Glass transition temperature as analyzed be DSC.

f Melting point temperature as analyzed be DSC.

Table 1. Location of collected prickly lettuce biotypes and their averaged rubber qualities, quantity, and physical properties found in

extracted latex.

117

6-9/13 4-10/6

Acetone Ext. Hexane Ext. MW Acetone Ext. Hexane Ext. MW SE SE -1 SE SE -1 (%) (%) (g mol ) (%) (%) (g mol ) 2010 10.633 0.740 0.037 0.003 29931 5.507 0.338 0.093 0.008 918 Soxhlet 2011 5.611 0.345 0.035 0.002 38491 4.918 0.200 0.064 0.020 4140

Two 2010 6.763 0.229 0.308 a 0.025 NA 6.668 0.075 0.426 a 0.045 NA Solvent Slurry 2011 6.454 0.260 0.198 a 0.019 NA 5.240 0.508 0.281 a 0.038 NA

2010 NA NA 0.046 0.006 17263 NA NA 0.003 0.001 NA Hex Slurry/ Alcohol ppt 2011 NA NA 0.022 0.006 187330 NA NA 0.005 0.003 NA

118 a Hexane extraction step in two solvent slurry extraction contained large amounts of wax material that cannot be attributed to rubber

content.

a Hexane extraction step in two solvent slurry extraction contained large amounts of wax material that cannot be attributed to rubber

content

Table 2. Amount of extractable material and rubber M W using different extraction methods from whole, freeze dried and ground

prickly lettuce plants on a percent wt/wt basis.

119

Figure 1. Proton ( 1H) NMR spectra for latex extracted acetone washed, combined and precipitated prickly lettuce rubber from biotype

6-10/6.

120

Figure 2. Carbon ( 13 C) NMR spectra for latex extracted acetone washed, combined and precipitated prickly lettuce rubber from

biotype 6-10/6.

0.5 Prickly Lettuce Rubber Stress/Strain

0.4

0.3

0.2 Stress (MPa) Stress 6-9/13 0.1 6-9/21 2-10/6 7-10/6

0.0

0 100 200 300 400 Strain (%)

Figure 3. Dynamic mechanical analysis of green strength on acetone washed, precipitated natural rubber isolated from 4 biotypes of prickly lettuce.

121

0.4 Prickly Lettuce Rubber DSC Curve

0.2 Polyisoprene Std 6-9/13 6-9/21 6-10/6 0.0 2-10/6 4-10/6 7-10/6

-0.2 HeatFlow (W/g)

-0.4

-0.6 -100 -50 0 50 100 150 200

Temperature (°C) Figure 4. Differential scanning calorimetry curves of synthetic isoprene rubber and prickly lettuce natural rubber.

122

Chapter 5

Microscopic Characterization of Rubber Particles in Prickly Lettuce

Abstract

Prickly lettuce contains high molecular weight polyisoprene and has potential as an alternative source of natural rubber. Rubber producing plants synthesize and store polyisoprene in sub-cellular rubber particles. In most rubber bearing plants rubber particles are contained in specialized vascular cells known as laticifers. To further characterize prickly lettuce rubber producing capabilities, rubber particles were isolated and measured by scanning electron microscopy. Isolated, fixed, gold coated rubber particles were viewed by Field Emission

Scanning Electron Microscopy (FESEM). Most of the observed WRPs had an average diameter of 0.288 µm (SE ±0.005) and ranged in size from 0.88 µm to 0.443 µm. Fewer, larger particles were also observed ranging from 0.575 µm to 4.9 µm in diameter, however they were isolated individuals. Prickly lettuce particles have a similar size range as Euphorbia lactiflua Phil. or the intermediate size particles of Brazilian rubber tree [ Hevea brasiliensis (Willd. ex A. Juss.) Müll.

Arg.].

Introduction

Natural rubber is one of the most important plant derived bioproducts. The tropically endemic rubber tree is the single source of industrialized rubber production, a cause for concern should any problems arise in rubber production or export. To stem rubber supply concerns, alternative sources of natural rubber are being investigated (Mooibroek and Cornish 2000; K.

Cornish 2001; Van Beilen and Poirier 2007; Van Beilen and Poirier 2007) with a short list of species able to synthesized high molecular weight rubber. Prickly lettuce ( Lactuca serriola L.)

123

was identified as a high molecular weight rubber producer (Bushman et al. 2006) yet little is known on its rubber making ability.

Prickly lettuce has the same or similar anatomical features as other rubber producing plants. Rubber is made and stored in specialized vascular cells called laticifers. Laticifer producing plants have either articulated laticifers where cells are connected via anastomoses, as with prickly lettuce, or are non-articulated (Kekwick 2001). Guayule (Parthenium argentatum

Gray.) does not possess laticifers but rather produces latex in specialized bark parenchyma cells

(Ross 1908). Within the cytoplasm of laticifers cells or guayule parenchyma cells are found spherically shaped, organelle-like, rubber particles (Backhaus and Walsh 1983; Schmidt et al.

2010; Singh et al. 2003; Wood and Cornish 2000). Rubber particles are surrounded by a fatty- acid mono layer membrane imbedded with the enzymatic machinery necessary for isoprene transfer and polymer elongation within the hydrophobic core of the particle (Cornish 2001;

Nawamawat et al. 2011). The protein and lipid components found in laticifer membranes are species specific. Within species, the lipid membranes appear to be composed of the same lipid components of the cells from which they are derived. Similar compositions suggest the absence of a highly conserved structural and chemical composition of particle membranes (Cornish

2001).

In this study, the size and structure of prickly lettuce rubber particles is described by electron microscopy. Because rubber particles are the central point of enzymatic synthesis of rubber, understanding their morphology in comparison to other known particle bearing species is essential to understanding rubber biosynthesis.

Materials and Methods

Isolation of Washed Rubber Particles

124

Freshly tapped latex was dripped into centrifuge tubes containing chilled buffer solution consisting of 100 mM Tris-HCl, 5 mM MgSO4, and 5 mM DTT in distilled water. The buffer collection solution was pH adjusted to 7.5 using 0.5 N sodium hydroxide. Adjustment of pH is critical in that complete degradation of particles was observed when buffer was not slightly basic. Latex was centrifuged at 915 g for 10 min to pellet particles, and supernatant was discarded. Particles were washed three times with isolation buffer and then stored in buffer at 4

°C.

Fixing and Viewing of Rubber Particles

Prior to fixing, WRPs were viewed with a light microscope at 40x magnification to verify the presence and integrity of isolated particles (Figure 1). For comparison purposes, particles from Indian rubber tree ( Ficus elastica Roxb. ex Hornem.) were isolated and viewed in tandem

(Figure 1). WRPs were initially fixed with 3 % glutaraldehyde in 50 mM sodium cacodylate and

1% tannic acid at room temperature for 1 h. Fixed particles were washed three times in 50 mM sodium cacodylate then post fixed in 1% osmium tetroxide (OsO 4) for 18 h. Fixed particles were washed three times with distilled water and stored in distilled water. Post fixing, particles were viewed under light microscope again to verify particle integrity during the fixing process.

Suspended particles were placed on a cover glass mounted on a stub and allowed to air dry.

Samples were gold coated using a Hummer V sputter coater before viewing by field emission scanning electron microscopy (FESEM). Samples were viewed using an FEI Quanta 200F

FESEM instrument under high vacuum.

Results and Discussion

Rubber particles isolated and fixed in this study were spherical in shape, a common shape in all studied rubber particles (Cornish et al. 1999; Singh et al. 2003; Wood and Cornish 2000).

125

The average diameter was 0.288 µm (SE ±0.0056, n=144) and particle size ranged from 0.088

µm to 0.443 µm (Figure 2, 4). Larger particles were also observed that ranged in size from 0.575

µm to 4.9 µm (Figure 3). These particles however, were isolated individuals and did not represent the major fraction of those observed by FESEM. It is worth noting that there appears to be a significant amount of particle collapse and degradation - coagulated and coalesced rubber pieces were observed forming a lattice like structure (Figure 2 B, C). This degradation likely occurred during particle isolation as some larger coagulated rubber was present when viewed under light microscopy (Figure 1 A), prior to fixing. Small intact particles accumulated at the edges of the liquid phase and around coagulated rubber pieces during the air drying of the fixed particles (Figure 1 B). It is possible that the larger rubber particles were less stable and represent the portion of coagulated rubber; however no particles of this size were observed under light microscopy. The observation of larger particles agrees with particle size distribution using laser light scattering detection where the average size was reported as 5 µm in whole latex with an enrichment of 2 µm particles in washed latex (Bushman et al. 2006). However, as noted, in this study there were few intact large particles. The values reported by Bushman (2006) may represent coagulated rubber pieces as light scattering cannot discriminate intact particles from coagulated rubber. Light scattering values would be skewed, increasing the reported average size. The observed particles had a diameter size closer to that of Euphorbia lactiflua Phil. (0.208

µm) (Wood and Cornish 2000) or the intermediate sized particles found in the rubber tree (0.25-

0.35 µm) (Singh et al. 2003).

High magnification of the particles reveals an uneven particle surface (Figure 4). Surface morphology may be due to impurities sticking to the particle surface as similar surface characteristics are observed on all surfaces including the glass cover slip.

126

Conclusions

Previous to this study there have been no other reports of microscopic analysis describing the size and structure of rubber particles isolated from prickly lettuce. Prickly lettuce rubber particles are spherical in structure, similar to other rubber particle bearing plants. The particle size distribution was smaller than previously described by other methods, however represent the size of intact particles. Optimization of the isolation method, preventing the coagulation of particles would give a more accurate estimation of the overall size distributions of rubber particles in prickly lettuce.

Acknowledgements

The authors would like to thank the staff, particularly Valerie Lynch-Holm, at the

Franceschi Microscopy and Imaging Center, Washington State University for their technical assistance.

127

Literature Cited

Backhaus, R. A., and S. Walsh. 1983. The ontogeny of rubber formation in guayule, Parthenium

argentatum Gray. Botanical Gazette 144: 391–400.

Bushman, B. S., A. A. Scholte, K. Cornish, D. J. Scott, J. L. Brichta, J. C. Vederas, O. Ochoa, R.

W. Michelmore, D. K. Shintani, and S. J. Knapp. 2006. Identification and comparison of

natural rubber from two Lactuca species. Phytochemistry 67:2590–2596.

Cornish, K., 2001. Similarities and differences in rubber biochemistry among plant species.

Phytochemistry 57:1123–1134.

Cornish, K., D. F. Wood, and J. J. Windle. 1999. Rubber particles from four different species,

examined by transmission electron microscopy and electron-paramagnetic-resonance spin

labeling, are found to consist of a homogeneous rubber core enclosed by a contiguous,

monolayer biomembrane. Planta 210: 85–96.

Kekwick, R. GO. 2001. Latex and Laticifers. In eLS .

http://onlinelibrary.wiley.com/doi/10.1038/npg.els.0000913/full. John Wiley & Sons,

Ltd.

Mooibroek, H., and K. Cornish. 2000. Alternative sources of natural rubber. Applied

Microbiology and Biotechnology 53:355–365.

Nawamawat, K., J. T. Sakdapipanich, C. C. Ho, Y. Ma, J. Song, and J. G. Vancso. 2011. Surface

nanostructure of Hevea brasiliensis natural rubber latex particles. Colloids and Surfaces

A: Physicochemical and Engineering Aspects 390: 157–166.

Ross, H. 1908. Der anatomische bau der Mexikanischen kautschukpflanze ‘guayule’,

Parthenium argentatum Gray. Berichte Der Deutsche Botanischen Gesellschaft

26A:248–263.

128

Schmidt, T., M. Lenders, A. Hillebrand, N. Van Deenen, O. Munt, R. Reichelt, W. Eisenreich, R.

Fischer, D. Prüfer, and C. Gronover. 2010. Characterization of rubber particles and

rubber chain elongation in Taraxacum koksaghyz . BMC Biochemistry 11:11.

Singh, A. P., S. G. Wi, G. C. Chung, Y. S. Kim, and H. Kang. 2003. The micromorphology and

protein characterization of rubber particles in Ficus carica , Ficus benghalensis and

Hevea brasiliensis . Journal of Experimental Botany 54:985 –992.

Van Beilen, J. B., and Y. Poirier. 2007. Establishment of new crops for the production of natural

rubber. Trends in Biotechnology 25: 522–529.

Van Beilen, J. B., and Y. Poirier. 2007. Guayule and russian dandelion as alternative sources of

natural rubber. Critical Reviews in Biotechnology 27: 217–231.

Wood, D. F. and K. Cornish. 2000. Microstructure of purified rubber particles. International

Journal of Plant Sciences 161: 435–445.

129

A BC

100µm 10µm 10µm

Figure 1. WRPs from prickly lettuce (A, B) and indian rubber tree ( Ficus elastica) (B) prior to fixation procedure. Arrow in panel A indicates presence of coagulated rubber. WRPs viewed under light microscope at 40x magnification.

130

C D

Figure 2. Progressive magnification of fixed, gold coated prickly lettuce WRPs. Viewed using

FESEM at 100x (A), 1000x (B), 10,000x (C) and 160,000x (D), magnifications.

131

Figure 3. Larger sized prickly lettuce rubber particles viewed using FESEM at various magnifications.

132

Figure 4 . Prickly lettuce rubber par ticles viewed using FESEM at 100,000x magnification.

133

Chapter 6

Future Directions

Introduction

The heretofore described work on prickly lettuce has led to some interesting discoveries with exciting possibilities for continued research in the study of rubber biosynthesis and general prickly lettuce biology. It is the hope of this scientist that the work carried out will serve as a building block and inspiration for further implementation of ideas and discovery.

Rubber Biosynthesis and Utilization

There is much to be elucidated in the processes involved in rubber synthesis, rubber extraction, and scale-up potential of prickly lettuce as an alternative rubber crop. As a first step in prickly lettuce, a detailed effort in isolating and characterizing the rubber synthesis enzymes present in rubber particles is essential. How many proteins are associated with prickly lettuce rubber particles? More proteins have the potential of leading to allergic responses in end products. Are the particle bound proteins similar to other previously described proteins such as cis -prenyltransferase (CPT), rubber elongation factor (REF) and small rubber particle protein

(SRPP)? On a more broad scope, identifying the role played by the isoprene synthesis pathways

(MVA or MEP) and the respective enzymes as pertaining to rubber production could be another area of study. The Russian dandelion species Taraxacum koksaghyz (Rodin), Taraxacum brevicorniculatum (Korol.) and guayule Parthenium argentatum (Gray), all members of the compositae family, would serve as an excellent starting point for literature review and experimental comparison. Prickly lettuce as a study tool has advantages over other rubber bearing plant species in that it is diploid, self-pollinating but easily out-crossed, can be

134

transformed, and although it has a large genome size (2.6 Gb) it’s closest relative, Lactuca sativa

L., has been sequenced.

Of secondary importance in utilization of prickly lettuce as a crop species would be to find a suitable, non-degradative, and highly efficient method of rubber extraction. As described in chapter four, chemical extraction of freeze dried, milled above-ground material yielded little rubber of low quality. It would be interesting to know what was causing the degradation. Was it oxidation from resin, pigments, or atmospheric oxygen and what could be done to counter the effects such as addition of antioxidants? Alternative extraction timings and methods could also be investigated. Does extraction of fresh material decrease degradation? Could other methods such as floatation or addition of creaming agents be utilized? Does partitioning of plants into organ types change the degradative effects? Efficient extraction methods must be worked out before any cultivar development can occur. Once rubber can be safely removed it will also be important to find ways to utilize the other plant components. Can the cellulosic material be easily converted to ethanol or be used to make other cellulose based products such as paper? Could the resin and sesquiterpene lactones from the latex have some value-added properties increasing the economic feasibility as a crop plant? These are some of the next step questions that need attention.

Identified QTL and Candidate Genes

Chapter three describes QTL and potential candidate genes related to rubber production and other interesting prickly lettuce traits. Although the markers used were derived from ESTs, meaning their origin is from a functionally expressed gene, most of them had no know sequence similarity to any annotated genes. The possibility exists to discover what those unknown genes are and how they influence the correlated traits. Of specific interest is marker WSULs-304 and

135

its relationship to growth phenotypes. Also of interest are markers WSULs-21 and WSULs-374 and their relationship to traits rubber M W and herbivory. There is a very strong correlation to leaf lobing phenotypes and two markers WSULs-102 and WSULs-212. Unlike the other markers these have sequence similarity to annotated genes from A. thaliana and are associated with morphogenesis. As proposed in chapter three, it would be interesting to over express these genes in a non-lobed lettuce background to see if lobing develops or alternatively knock down expression to see if lobing can be abolished. Lobing was clearly a single gene, maybe we landed on it.

Conclusion

From the discovery of rubber by ancient Mesoamericans, to the early industrialization and advent of vulcanization in the mid 1800’s, and finally to today’s multi-million tonne harvest, natural rubber has remained a curious substance and a staple of modern society. High demand and supply stability necessitate the discovery of alternative rubber sources. Prickly lettuce is one of the few rubber synthesizing plants able to consistently generate high molecular weight rubber.

The research described in this dissertation has outlined new discoveries and problems in prickly lettuce rubber utility. As a newly characterized rubber source, problems are to be expected.

Research directed at understanding and optimizing the rubber biosynthesis mechanism, the biochemical stability, and agronomic feasibility will determine if prickly lettuce will become a major player in the rubber industry.

136

Chapter 7

Philosophical Musings of a Would-Be Scientist

Introduction

What a rare opportunity it is to document in such a location as a doctoral dissertation the current thoughts and opinions pertaining to science, philosophy and life in general of the author.

Life is dynamic and ever changing yet holds some evident constants. The accumulation of experiences and additional knowledge leads to new opinions, new philosophies, strengthened convictions and a different view of the world. I would imagine the opinions expressed in the process of writing this chapter will be, to one degree or another, different than what would be conveyed in the years to come. So it is with science. As epiphanies may lead to new life directions, paradigm shifts change what was previously accepted as certainty. In response to the flux of life and science, I will utilize this chapter to convey some of my views on what it means to be a scientist, future positions in academia or industry, reflection on “becoming”, the term impact factor, science and religion, and finish with concluding remarks.

What it Means to be a Scientist

To my delight, I am often enthusiastically introduced by my six year old son as a plant scientist. I do not think he fully grasps the extent of what it means to be a scientist, yet he is aware of what I do and proud that I hold the title. I too am equally excited by the opportunities and challenges inherent to a career in scientific discovery. As a scientist I see myself as a truth seeker, fact finder, a problem solver, and innovator with an innate sense of curiosity.

Let me first attempt to tackle truth and fact. Is there a difference between truth and fact?

Fact seems to be more solid and indisputable whereas what is truth can be viewed quite differently between individuals. Differing opinions of truth can be derived from a single or set of

137

facts. Yet, all variable views of fact originated truths cannot be right. Facts will lead to singular truths. As additional knowledge is acquired, in all realms of understanding, the distinction between truth and fact will become less vague. Truth will become fact. There are scientific facts and scientific truths. As a scientist I seek for truth through the accumulation of facts. The scientific method helps me to experimentally decipher what is fact, indeed how things are. The process of observing and asking questions followed by hypothesis development, experimental design, collection of data, interpretation of results and drawing conclusions will assist in defining what is and what is not. Yet the scientific method is not without its flaws. What appear to be facts must be confirmed. Experiments must be repeated, data collected from multiple sources and checked for consistency. Biases derived from what is or was expected must be set aside. Only through rigorous validation can truths be concluded, applied and built upon. Even then are we seeing reality, or have observer effects influenced outcomes? I believe in the end, when all is made known, there will be no ambiguity between truth and fact.

So why is it that scientific facts and truths are in a constant flux? New discoveries continually augment but sometimes supplant previous ideas. One reason is due to the faults and imperfections of those conducting and reporting science. Human folly is inherent and ever- present no matter how detailed one might be. A decimal misplaced by German chemist Erich von

Wolf in 1870 reporting iron content in spinach as 35 mg as opposed to 3.5 mg was compelling enough for studio executive to select the leafy green as Popeye’s supper food of choice

(Arbesman 2012). In 1999 two Mars probes were lost due to a few seemingly minor mistakes.

The $125-million Mars Climate Orbiter had a misguided trajectory because programmers used

English units while NASA navigators used metric units to guide the spacecraft, plunging it into the Mars atmosphere (Stephenson et al. 1999). That same year a signaling problem in the landing

138

legs during descent of the $185-million Mars Polar Lander initiated pre-mature engine shutdown. One line of missed code could have saved the probe (Casani et al. 2000). These are but a few examples human related scientific errors. History is replete with errors, misled ideas and facts turned false. Continued questioning and verification will roots out old errors, as new ones are made. The goal is to continue moving forward in spite of mistakes.

Another reason for constant scientific amendment is due to a lack of perspective. We don’t and/or cannot see the big picture. I recently attended a department seminar were the speaker, Benildo de los Reyes from the University of Maine, gave a simple analogy on perspective. He shared that he often tells his students of the moose in the window: “If you look out a window what do you see, buildings, trees, people, lots of things. Do you see a moose? No.

Does that mean the moose is not there? No, you just cannot see one. By looking out of a confined, defined area ones view or perspective is obstructed.” The complexity of nature forces us to categorize realms of study into separate disciplines further narrowed by subjects then areas of expertise. To advance comprehension in an area of study there must be experts who have vast knowledge on a specific subject. The problem remains however, of the moose in the window. It is beyond our individual human capacity to acquire, combine, and inspect all areas of acquired knowledge and to understand all of the inherent connections. I do feel it is important to always remember the bigger picture, and attempt to make that window a little bigger, or try the view from another window, to gain a new perspective.

Scientists ask questions to solve problems. The problems may be gaps in knowledge, lack of information to make good social decisions or development of more efficient products and technologies. The scientist’s role is to find out why and figure out how. The process requires fabrication of ideas that will take the next step, even if it is in the wrong direction. My few years

139

of research experience have taught me that scientific discovery is a string of failures dappled with sweet successes. As the German-American rocket scientist Wernher von Braun described it

“Research is what I'm doing when I don't know what I'm doing”. The goal is to focus on the question and think of new ways to solve the problem. A scientific innovator must build a foundation of knowledge; learn from previous work without accepting it all as truth, then tap into the limitless potential of human imagination wherein lies the next breakthrough.

I was asked in an interview leading to my first post graduate school employment “what attribute best describes you as a scientist”. My reply was curiosity. Although somewhat cliché, I think in order to be an effective scientist there must be some open or underlying desire to know.

During the course of my graduate career curiosity has been a driving force and at times a distracting annoyance. A driving force in that any failures have not left me defeated but rather more resolute to find another way. Distracting because as I learned new techniques or gained knowledge I want to try for myself or take the next step even though my dissertation topic would not directly benefit. I have had to curb my curiosity to some extent to focus and finish projects. A good scientist maintains a healthy amount of insatiable curiosity controlled by a sense of reality and focus.

Academia or Industry

Throughout my graduate career, scientists and non-scientist alike have asked what I plan to do post graduate school, become a professor or go into industry. My reply in most cases has been “I will get a job”, which was the intent of continuing my education. I have never felt so inclined to make an absolution as to where I could land as my graduate career came to a close.

It’s always good to plan and set goals but important to be flexible. One never knows what opportunities will present themselves or lack thereof. The rise and fall of economy, budget cuts,

140

unemployment etc. dictate the available employment options at any point in time. The plan has always been to see what is available at the time of my graduation. Having an open outlook on employment prospects with an ever-present review of my personal satisfaction has and will lead me to where I need to be. As with any defunct situation, if it is not working, make a change. The same method can be made in selection of career path.

There seems to be a general sense that academia is a much more noble pursuit as opposed to selling out in the realm of private industry. At least that is the impression I get from some fellow graduate students and professors. Having now been in the academic arena as a graduate student for over four years I can see the merits and limitations of a career in an academic setting.

The ability to direct ones research, to train the next generation of scientists, to be constantly learning and openly adding to the scientific knowledge base are all compelling reasons to pursue an academic career. On the other hand securing competitive research funds, attempting to achieve tenure status, access to limited resources, teaching (if you feel undergrads are morons) detract from the appeal. Academia is a place of learning and training as it was designed to be.

My academic career has been a life changing influence not to be matched. Continuing in this path on the next level would be honorable indeed. Yet, no matter how noble an academic career may be, not all, in fact very few, trained students can choose this course

When I think of industry I often think of the bottom line, a potentially negative aspect of this realm. Projects are decided based on potential earnings and can come and go regardless of scientific value. All companies are in business to make profit, else how would they stay in business? Yet when it comes to influence and impact of scientific discovery as it pertains to applied technologies, especially in agriculture, I feel industry far outweighs any academic endeavor. The developments in industry are meant to be applied on a large scale. Companies

141

have the resources to invest in advanced technologies that get them ahead of the competition then implement and distribute the technology in turn significantly influencing how things are done. Examples include advance made during the industrial revolution in transportation, electricity, and processing. Medicine would not progress without pharmaceutical company investment. Agriculture could not maintain yields without industry release of pest management compounds, optimized fertilizers, and the next generation of genetically modified crops. Of course one cannot undermine the advances open source academic research has made. Businesses rely on the information generated in these institutions as major flows of knowledge (Adams and

Clemmons 2008) yet they are also often the funding sources for that same research. When it is all boiled down, a career in academia or industry are both simply jobs, they will have their positives and negative, their politics, budgets, meetings, layoffs, bonuses etc. Your attitude and work ethic will define success.

The Prospect of Becoming

There have been many times in my life where I have questioned my abilities or doubted my potential to be something greater than that of my current state. When I was in elementary school I could hardly imagine myself in high school. After high school I could not see myself as a missionary in a foreign country, before marriage; me, a husband, before children; a father, a graduate student so close to a PhD, unimaginable. Nevertheless here I sit, a high school graduate returned missionary, married with three children writing a dissertation. Really all of those prior- to moments consisted of a lack of vision, a fear of the unknown, a lapse of self-confidence.

Fortunately those feelings have not been paralyzing, stifling my progression. I have since learned that “becoming” is a process, that as you do, you become. I need not fear nor undermine my potential; I must merely do, and do my best. Choice is the guiding factor that allows one to

142

maneuver through the course of life and determine what one is becoming. Interesting that if becoming is used as an adjective rather than a verb it means flattering, appropriate, fitting, right.

Becoming is the process of developing into something fitting for each individual.

Impact Factor

As a graduate student and budding scientist I have be made more and more aware of the importance given to “impact factor”. Thomas Reuters Web of Knowledge has been publishing

Journal Citation Reports (JCR) since 1975 as a means of determining importance and influence of a journal (Hubbard and McVeigh 2011). The numerical value for each year is determined by taking the number of citations in the current year through the previous two years and dividing by the previous two years (Hubbard and McVeigh 2011). Higher precedence is often given to journals with a high impact factor. Another measure of impact was proposed in 2005 to determine “cumulative impact and relevance of an individual's scientific research output” called the h-index (Hirsch 2005). The h-index of an individual also relies on citations and takes into account the number of authored papers and how many times they are cited as a whole. If the author has 20 papers and 15 are cited at least 15 times then the h-index is 15. The h-index attempts to give higher relevance to researchers with more papers and more citations over time.

A few highly cited papers will not increase ones h-index. These numerical measures, impact factor, h-index and others, are often correlated to the influence and significance of the scientist’s contributions to the scientific community. The use of such evaluation systems has utility but also drawbacks. In 2009 a seemingly obscure journal Acta Crystallographica – Section A made a 20 fold jump to the second highest impact factor position due to a massively cited paper “A short history of SHELX” (Sheldrick 2007) which outlines the development of an open source software program used in crystal structure determination (Schwarzenbach et al. 2010). At face value it

143

would appear that this journal and author have made a spectacular achievement. It could also be argued that the impact factor measure is completely flawed. In reality the single paper presents nothing ground breaking but rather a point of reference for many fields using the software.

Previous to the publication the unpublished software was cited as individual programs themselves (Schwarzenbach et al. 2010). The journal will enjoy two years of high ranking based on the impact factor assessment method then return to the previous standing of 2.0-2.5, representing an anomaly not necessarily a flaw. Although there is no perfect metric to determine ones scientific influence the use of such is helpful for assessment and comparison purposes as long as they are not the sole means evaluation. Publishing in journals within a specific field is more important than just shooting for the highest impact factor. I personally never expect to publish in the highest rated journal CA-A Cancer Journal for Clinicians , the field will never apply to me. It is important to take into account other activities other than publication and citation number as well. Publication in non-journal settings such as agricultural bulletins can have a far reaching impact to the farmer. Teaching, mentoring and other outreach activities can inspire the next generation of scientists, with implications that could far outreach any h-index.

When I think of impact factor, I think of the impact my being in the world will have. A successful career is part of that impact but not the ultimate definer of my influence. Impact, when thought of in this way, is much more of a personal all encompassing assessment of one’s life impression. I already know my life has influenced others as others have touched mine. It is then a question of what kind of impact one will have. Hopefully, the impact will be a positive one.

My wife will know of my love for her, and always will be grateful for our partnership. My children will grow with confidence in themselves with a knowledge there father is on their side, and they in turn will have a positive impact. My friends and associates can find in me trust,

144

loyalty, and a willingness to serve. This impact factor will be a self assessment and a contact assessment. You can judge the greatness of an individual by the influence they have had in the lives of those around them. In these regards my impact factor far outweighs any assessment

Thomas Reuters can devise.

Science and Religion

The final merge between fact, truth, and faith, science and religion. Where shall I take my stance? That has long been the question through my adolescence and adulthood, a question that all people must face. My beliefs have been shaped by the teachings in my home which were centered in Christianity and conveyed through membership in The Church of Jesus Christ of

Latter-Day Saints (LDS). Experience, study, and search for truth have further solidified my faith and testimony that there exists a living God who has made a plan with purpose to human life.

Review of some of the most notable and read science philosophizers would mildly discount or outright contradict my stance. A 1969 interview with Karl Popper sealed until after his death revealed an agnostic view on Gods existence with religious undertone of belief: “When

I look at what I call the gift of life, I feel a gratitude which is in tune with some religious ideas of

God. However, the moment I even speak of it, I am embarrassed that I may do something wrong to God in talking about God." (Zerin 1998). Philosopher Alfred Ayer rejected atheism and agnosticism as both take the position of Gods existence as a meaningful hypothesis, which he did not believe (Ayer 1952). It is no surprise to me that most science philosophers cannot accept deity or forms of religion.

Although the trend of disbelief continues throughout the world, there are scientists and philosophers who see the value and necessity in taking a religious position as complementary to their work. Of science and religion, theoretical chemist Henry Eyring was of the opinion there is

145

no distinction "Is there any conflict between science and religion? There is no conflict in the mind of God, but often there is conflict in the minds of men.” (Eyring 1983). Eyring felt science and religion will converge as pure truth is found. Even Albert Einstein an open agnostic viewed the scientific pursuit of truth and understanding stemmed from a religious sphere were faith in a rational, explicable world must be exercised: “Science without religion is lame, religion without science is blind.” ( Science, Philosophy, and Religion: A Symposium 1941). There must be some link between the search for understanding of the physical world and the spiritual.

Are my emotions, desires, and feelings, solely an artifact of heredity; an evolutionary accumulation of biological successes leading to a cerebral self-fulfilling biochemical soup? To a certain extent, yes. I cannot help but see linkages between my biological self and that of my ancestry and posterity. Yet, am I left to the fortune or folly of genetic recombination and mutation. I may have or be predisposed to certain disease and bodily dysfunction as determined by me heredity, but my genetic make-up does not determine my thoughts and in turn my actions.

I am not so biologically preprogrammed that predilections cannot be changed or my character concluded. My being goes beyond that of a chemical concoction. There is an eternal nature imbued within my mortal frame that has given me life and will continue once the biochemistry reaches equilibrium. Of this truth I cannot scientifically prove, so far. Maybe the actuality that it cannot be shown or proven is a part of the design. It must be reasoned and felt. Many of the most important life lessons cannot be scientifically manifest and can only be learned through emotions, desires, and feelings. Perhaps the decision as to the divine must be made solely on and anchored in faith. When it comes to religion I don’t see a conflict, only a choice. All major choices I have ever made have been laid out in logic but made in emotion. Belief is always a choice whether the sought truth is scientific or religious in nature.

146

It seems somewhat absurd to reason that the presence and existence of life and truly my own cognition is a happenstance of millions, correction, billions of years of luck. Is the creation of our world and the apparent evolution of innumerable creatures a fortunate event never before or hereto after achieved? It appears so as we have yet to confirm life outside our own sphere, but

I think not. Scripture has stated “worlds without number have I created” ( Pearl of Great Price:

Selections from the Book of Moses 2013) life has been created elsewhere. There is too much of complex structure to conclude all these things have happened by accident. I propose that there are fundamental, universal laws that govern the nature of the universe on all levels. From the apparent structure of the observable universe itself (Springel, Frenk, and White 2006), to the sub- atomic (Amsler et al. 2008), evidence of composition and structure emerge. Each new validated discovery leads us ever closer to the fundamental, however complex. The existence of a divine organizer, formulator, and designer is not beyond reason.

Concluding Remarks

So what does all of this mean? As my chosen profession, I am a scientist. I am doing my best to discover fact filled truths that will have a positive impact on the world. My impact will hopefully extend farther than my professional contributions. With every life challenge and experience I chose to become something greater than my previous self. As my defense date nears and the summation of five years of work is evaluated I know that the final outcome is not just the scientific contribution embodied in the work but also a change of the individual performing the work. My hope in becoming a Ph.D. recipient is that it will have played positive role in the ultimate assessment of who I am and will be in this life and throughout eternity “…the Final

Judgment is not just an evaluation of a sum total of good and evil acts—what we have done. It is

147

an acknowledgment of the final effect of our acts and thoughts—what we have become ” (Oaks

2000).

148

Literature Cited

Adams, J. D., and J. R. Clemmons. 2008. The origins of industrial scientific discoveries.

Working Paper. National Bureau of Economic Research.

http://www.nber.org/papers/w13823. (Accessed Janurary 2, 2013)

Amsler, C., M. Doser, M. Antonelli, D.M. Asner, K.S. Babu, H. Baer, H.R. Band, et al. 2008.

Review of particle physics. Physics Letters B 667 (1–5): 1–6.

Arbesman, S. 2012. The Half-life of Facts: Why Everything We Know Has an Expiration Date .

First Edition. Penguin Group.

Ayer, A. J. 1952. Language, Truth and Logic . 2nd ed. Dover Publications.

Casani, J., A. Albee, C. Leising, S. Battel, D. MacPherson, R. Brace, W. Menard, et al. 2000.

Report on the Loss of the Mars Polar Lander and Deep Space 2 Missions: JPL Special .

http://sunnyday.mit.edu/accidents/mpl_report_1.pdf (Accessed December 10, 2012)

Eyring, H. B. 1983. Reflections of a Scientist . Deseret Book Co.

Hirsch, J. E. 2005. An index to quantify an individual’s scientific research output. Proceedings

of the National Academy of Sciences of the United States of America 102 (46):16569–

16572.

Hubbard, S. C., and M. E. McVeigh. 2011. Casting a wide net: The journal impact factor

numerator. Learned Publishing 24 (2): 133–137.

Oaks, D. H. 2000. The challenge to become. In The Church of Jesus Christ of Latter-day Saints .

https://www.lds.org/general-conference/2000/10/the-challenge-to-

become?lang=eng&l=fb. (Accessed December 10, 2012)

Pearl of Great Price: Selections from the Book of Moses .

http://www.lds.org/scriptures/pgp/moses/1.33?lang=eng#32. (Accessed January 3, 2013)

149

Schwarzenbach, D., G. Kostorz, B. McMahon, and P. Strickland. 2010. (IUCr) SHELX makes

an impact. http://www.iucr.org/home/leading-article/2010/2010-07-12. (Accessed

January 2, 2013.

Science, Philosophy, and Religion: A Symposium . 1941. The conference on science, philosophy

and religion in their relation to the democratic way of life, Inc.

Sheldrick, George M. 2007. A short history of SHELX. Acta Crystallographica Section A

Foundations of Crystallography 64 (1): 112–122.

Springel, V., C. S. Frenk, and S. D. M. White. 2006. The large-scale structure of the universe.

Nature 440 (7088):1137–1144.

Stephenson, A. G., L. S. LaPiana, D. R. Mulville, P. J. Rutledge, F. H. Bauer, D. Folta, G. A.

Dukeman, R. Sackheim, and P. Norvig. 1999. Mars Climate Orbiter Mishap

Investigation Board Phase I Report .

Zerin, Edward. 1998. Karl Popper on God. Skeptic .6 (2).

150

Appendix A

Preface

The following appendix contains material performed and published by the dissertation author. Although the study topic does not pertain to the previously described work on prickly lettuce rubber production, it contains a significant contribution by the author in fulfillment of said degree. The work was published in Pest Management Science and is formatted according to the journal requirements.

Uptake, Translocation and Metabolism of Aminocyclopyrachlor in Prickly Lettuce, Rush

Skeletonweed, and Yellow Starthistle

Wiley & Sons Ltd.

Jared L Bell 1, Ian C Burke 1, and Timothy S Prather 2

Correspondence to: Ian C Burke

Washington State University, Department of Crop and Soil Sciences,

Johnson Hall 173, Pullman, WA 99164-6420.

E-mail: [email protected]

1Crop and Soil Science Department, Washington State University, Pullman WA, USA

2Department of Plant, Soil and Entomological Sciences, Ag Science 317, University of Idaho,

Moscow ID, USA

151

Abstract

BACKGROUND: Aminocyclopyrachlor is a new herbicide proposed to control broadleaf weeds and shrubs in non-crop and rangeland systems. To better understand observed field efficacy, uptake and translocation of foliar applied aminocyclopyrachlor (DPX-MAT28) and aminocyclopyrachlor methyl ester (DPX-KJM44) were evaluated in two annuals, prickly lettuce

(Lactuca serriola L.) and yellow starthistle ( Centaurea solstitialis L.) and one perennial, rush skeletonweed ( Chondrilla juncea L.).

RESULTS: Absorption and translocation varied between species. While absorption of DPX-

KJM44 was greater than absorption of DPX-MAT28, rush skeletonweed absorbed the most followed by yellow starthistle and prickly lettuce. Overall total translocation of either herbicide was highest in yellow starthistle followed by rush skeletonweed and prickly lettuce. Proportional herbicide movement between species was similar with the majority translocating to developing shoots. However, in rush skeletonweed, early translocation was directed to root tissue. In rush skeletonweed, no DPX-MAT28 metabolism occurred while DPX-KJM44 was rapidly de- esterified and translocated as DPX-MAT28.

CONCLUSION: Aminocyclopyrachlor absorption and translocation is dependent on active ingredient structure and species sensitivity. Highly sensitive species like prickly lettuce absorb and translocate less material than relatively less sensitive species like rush skeletonweed. De- esterification of DPX-KJM44 appears to delay translocation of the resulting acid in yellow starthistle and rush skeletonweed.

Keywords: Absorption, autoradiography, auxinic herbicides, growth regulator, pyrimidine carboxylic acid, translocation.

152

1 Introduction

Aminocyclopyrachlor is a new pyrimidine-based auxin type herbicide proposed to control broadleaf weeds and shrubs in noncropland systems including roadsides, industrial areas, and rangeland. Aminocyclopyrachlor (DPX-MAT28) (Figure 1-1) and aminocyclopyrachlor methyl ester (DPX-KJM44) (Figure 1-2) were the active ingredients available for both laboratory and field studies. Control of forbs has been observed in several dicot families including Asteraceae,

Fabaceae, Chenopodiaceae, Convolvulaceae, Solanaceae and Euphorbiaceae and woody plant species such as red maple ( Acer rubrum L.), box elder ( Acer negundo L.), common hackberry

(Celtis occidentalis L.), white willow (Salix alba L.), blackgum (Nyssa sylvatica Marsh.), mesquite [Prosopis juliflora (Sw.) DC.] and American elm (Ulmus Americana L.). 1-4.While effective on broadleaf weeds and shrubs, aminocyclopyrachlor also has reduced activity on some monocot species. Tolerance by monocot species is an important quality for restoration of desirable native perennial grasses in grasslands and broadleaf weed control in established turf. 5-7

Other unique features of aminocyclopyrachlor are low proposed use rates, low mammalian toxicity, and favorable environmental profile. 4-5

Aminocyclopyrachlor is structurally similar to other pyridine-based herbicides such as picloram, clopyralid and aminopyralid. 8 Aminocyclopyrachlor has an additional nitrogen atom in the heterocyclic ring, making it the first pyrimidine-based growth regulator herbicide (Figure 1).

The specific mode of action has yet to be established but general consensus is that it behaves similarly to auxinic herbicides with symptoms including stem and leaf epinasty and wilting. 8

The two compounds are almost identical in structure; DPX-KJM44 adds a methyl group to the carboxyl end. In comparison to DPX-MAT28, DPX-KJM44 is more lipophilic. The octanol/water partition coefficient ( Kow ) is 1.87 (at 20°C) for the DPX-KJM44 and -2.48 for the

153

DPX-MAT28 (pH 7 at 20°C). 9 Methyl ester herbicide derivatives are commonly used to increase absorption as they facilitate penetration through the lipophilic leaf cuticle. 10-12 Upon application, esterase action in the cuticle 13-14 and the apoplast 15 actively remove the ester, releasing the free acid into the plant cells and into the phloem by ion trapping 16 . Rapid de-esterification produces a strong concentration gradient across the cuticle promoting continuous uptake of the herbicide, increasing total absorption. The Kleier model of xenobiotic transport predicts relatively low potential for phloem transport for compounds with a low Kow like the free acid of aminocyclopyrachlor, even though it has a near optimal p Ka (4.65). 16-17

Three weed species, all members of the Asteraceae family, were chosen as model plants to understand absorption, translocation, and metabolism of DPX-MAT28 and DPX-KJM44. The three species were selected due to observed differences in symptomology and control, but they are also widely distributed and troublesome weeds throughout the Pacific Northwest and the western United States. Prickly lettuce is an annual herbaceous weed, native to the Mediterranean region. It is found throughout North America and Hawaii. Prickly lettuce is a troublesome weed in cropping systems in the Pacific Northwest that can cause up to 80% yield loss in soybean in

Canada if not controlled 18 . Biotypes of prickly lettuce have developed resistance to several classes of herbicides including acetolactate synthase inhibitor herbicides 19 and more recently 2,4-

D20 .

Rush skeletonweed is an herbaceous perennial with an extensive taproot system that can reach over two m in length. 21 The species is an obligate apomictic species that also reproduces through adventitious buds on roots. 22 Both seed and vegetative propagules are produced. Seed are apomictic, and mature plants generating 1500 flower heads and 20,000 seeds in a single season. 21 Vegetative re-growth occurs through rootstocks initiated from the base of previous

154

years’ growth and bud expansion from lateral roots. Upon fragmentation, shoots can develop from as little as one centimeter of a root section.21 For effective chemical control of rush skeletonweed, absorbed herbicide must translocate to the root system. Effective control of rush skeletonweed can be achieved with mixtures of clopyralid, 2,4-D, MCPA, or dicamba applied over three consecutive seasons. 23

Yellow starthistle is an annual herbaceous weed from the Mediterranean region and may have been introduced to California from Spain in contaminated alfalfa seed in the early to mid-

1800’s. 24 Yellow starthistle infests approximately 6 million hectares in California alone with substantial populations in Oregon, Washington and Idaho. 25 Several strategies for control of yellow starthistle in California have been developed including grazing 26 , mowing 27 , large-area burns 28 , competitive planting of grasses and clovers 29 ; or biological control. 30 Of these, prescribed burning in combination with applications of clopyralid has been most effective for control method for yellow starthistle infestations.

Field application rates of aminocyclopyrachlor vary for control of each of these species.

Prickly lettuce is highly sensitive at low use rates and control can be achieved 70 g ai ha -1 (C.

William Kral, personal communication). In contrast, dosage and timing of application affect the long term control of rush skeletonweed. Applications of DPX-KJM44 to spring and fall rosettes at rates of 70, 140 and 210 g ai ha -1 give > 90% control. 31 Applications at the floral bud stage are less effective at lower rates yielding 62, 81 and 91% control at each rate, respectively. Further evaluation of rosette density found that although initial control was achieved in the fall rosette application at all rates, rosettes formed with the 70 g ai/ha application suggesting insufficient systemic control. 31 Effective control of yellow starthistle with aminocyclopyrachlor is possible at application rates between application rates needed for rush skeletonweed or prickly lettuce.

155

Effective control of weed species is affected by initial absorption and subsequent translocation of sufficient herbicide to the site of action to be phytotoxic. As aminocyclopyrachlor is a new class of auxinic herbicide, limited studies have been conducted to determine absorption, translocation, and metabolism of the compound in targeted plant species.

On a fundamental level, structural differences between the two active ingredient forms may affect total absorption and translocation and could be dependent on the rate of de-esterification.

The objective of these studies were to (1) compare the absorption and translocation of DPX-

MAT28 versus DPX-KJM44 in prickly lettuce, yellow starthistle, and rush skeletonweed; (2) determine the rate of conversion of the DPX-KJM44 to DPX-MAT28, and (3) determine whether metabolism of DPX-MAT28 in rush skeletonweed occurs.

2 Materials and Methods

2.1 Plant Material

Absorption and translocation studies were conducted on prickly lettuce, rush skeletonweed, and yellow starthistle. Rush skeletonweed plants were grown from root fragments with fully formed rosettes. Plant and root fragment were separated from the mother plant and placed into 10 cm square plastic pots containing a 3:1 mixture sand:potting media (LC1 Mix.

Sun Gro Horticulture Distribution Inc., Bellevue, WA). Rosettes developed from the transplanted rhizome fragments as they would in the field during the fall or spring. Plants were given 2 weeks to recover from transplant stress before treatment. Prickly lettuce and yellow starthistle were grown from seed. Prickly lettuce seeds were collected in southeastern Washington. Yellow starthistle seeds were collected from a site near Lacrosse, Washington. Seeds of both species were planted into 10 cm square plastic pots containing potting media. Following emergence, plants were thinned to one per pot and transplanted into 3:1 sand:potting media. Plants were

156

grown in a greenhouse and kept at of 26 °C daytime and 22 °C nighttime ( ± 3 °C) temperatures.

Natural light was supplemented with sodium vapor lighting to give a 14 h photoperiod that coincided with the daytime portion of the temperature profile. Plants were subirrigated as needed. Seeded plants were grown for 4 weeks to a 4 to 5 leaf rosette stage.

Metabolism of aminocyclopyrachlor was investigated in rush skeletonweed. Rush skeletonweed plants were grown from 5 cm root fragments placed into 16 cm round plastic pots containing a soil mixture of 3:1 sand:potting media. Pots were placed in a greenhouse under the same conditions as previously described; however, more time was required for plants to develop than in the absorption and translocation study. Plantlets emerged from root fragment nodes and were treated when the resulting rosette had 8 to 10 leaves, approximately 2 mo.

2.2 Absorption and Translocation of DPX-MAT28 and DPX-KJM44

Plants at the 4 to 5 leaf stage were selected for treatment. A 1 cm 2 portion of the adaxial side of the youngest fully expanded leaf was marked and covered to prevent spray solution from contacting that portion of the leaf. Plants were treated with a non-radiolabeled mixture of herbicide containing 210 g ai ha -1 of either DPX-MAT28 or DPX-KJM44 and a nonionic surfactant (NIS) (Induce ® nonionic surfactant, Helena Chemical Company, Memphis, TN) at

0.25% v/v using a carrier volume of 300 L ha -1. Immediately after herbicide application, 5, 0.5-

L droplets of technical grade DPX-MAT28 (specific activity 350.3kBq µmol -1) or DPX-KJM44

(specific activity 375.0 kBq µmol -1) [pyrimidyl 2-14 C] was applied to the marked leaf area, avoiding the leaf midrib. Aminocyclopyrachlor spotting material was dissolved in 200 µL

MeOH, diluted with deionized water, and 0.2% NIS (v/v). The amount of radioactivity applied was approximately 3.33 kBq. A 25 µL glass syringe (Hamilton Company, Reno, NV) placed in a

157

repeating dispenser (PB600 Dispenser, Hamilton Company, Reno, NV) was used for applications.

Plants were harvested at 2, 4, 8, 24, or 72 HAT and divided into seven parts, leaves above the treated leaf, leaves below the treated leaf, crown, root, the treated portion of the treated leaf, the acropetal portion of the treated leaf, and the basal portion of the treated leaf. The treated portion of the treated leaf was washed by swirling the plant part in a scintillation vial containing

1 mL of methanol:deionized water (1:1 v/v) and 1% (v/v) NIS to wash off nonabsorbed radioactive material for 20 s. To the rinsate, 20 mL of scintillation fluid (EcoLume, MP

Biomedicals, Solon, OH) was added prior to quantification via liquid scintillation spectrometry

(LSS) (Tri-Carb 2900TR, PerkinElmer, Shelton, CT). Each plant part was placed into a paper envelope and dried at 40 ºC for 48 h. Dried portions were weighed and then combusted using a biological oxidizer (Biological Oxidizer OX500, R.J. Harvey Instrument Corporation, Tappan,

14 NY). The resulting CO 2 was captured into 15 mL scintillation cocktail (R.J. Harvey

Instruments, Tappan, NY) at a combustion time of 2 min per sample. Radioactivity in oxidized samples was quantified by LSS.

The absorption and translocation studies were organized as a split-split plot with herbicide treatment as the main plot, time after treatment as the sub-plot, and plant parts as the sub-sub-plot. Treatments were replicated four times, and the experiments were conducted twice.

Absorption was determined by subtracting the amount of 14 C recovered in the leaf wash from the total amount of radioactivity recovered from all plant parts (amount applied). Translocation out of the treated leaf was calculated as percent applied by summing of radioactivity recovered in all plant parts excluding the treated leaf and dividing by the total amount of absorbed radioactivity.

2.3 Metabolism of DPX-MAT28 and DPX-KJM44

158

The metabolism study was similar to the absorption and translocation study with a few exceptions. Rush skeletonweed plants were prepared and treated as previously described for absorption and translocation. At harvest, the entire spotted leaf was kept intact. To ensure detection of radiolabeled material, the amount of activity applied to each plant was increased to

6.00 kBq. At harvest, individual plant parts were wrapped in aluminum foil, sealed in a 7.6 by

17.8 cm plastic bag, and stored at -20ºC until extraction.

For extraction, frozen plant parts were weighed then placed into a conical centrifuge tube.

Depending on the size of the part, 15 mL (VWR International Inc., West Chester, PA) or 50 mL

(Evergreen Scientific Inc., Los Angeles, CA) centrifuge tubes were used. All extraction and dilution steps were conducted in methanol. Methanol was added to each tube, 3 mL for the 15 mL tube or 10 mL for the 50 mL tube, and the plant tissue was homogenized (Polytron,

Brinkmann Instruments. Westbury, NY). The homogenizer was rinsed with 5 mL methanol into the tube. Tubes were then centrifuged (Beckman GS-6R Centrifuge, Beckman Instruments Inc.,

Palo Alto, CA) at 2000 g for 10 min and the supernatant decanted into a second centrifuge tube.

Homogenization and centrifugation were carried out three times for each plant part. Following the third centrifugation, the pellet was air dried, wrapped in aluminum foil and oxidized in biological oxidizer as previously described to determine the efficiency of the extraction. The average efficiency of extraction was 85.4% for DPX-MAT28 and 93.2% for DPX-KJM44.

Combined extracts were dried under a stream of air at room temperature and then re-eluted in

500 µL methanol. To evaluate potential post-extraction degradation, 5 µl radiolabeled herbicide solution was added to extracts from nontreated plants extracted as described above.

Separation of herbicide metabolites was done by normal-phase thin layer chromatography

(TLC). Silica gel plates (20 x 20 cm) (Whatman ®, Partisil K6 Absorption TLC plates with

159

preadsorbant zone, Florham Park, NJ) were used as stationary phase and a solvent system of methanol, isopropanol, ethyl acetate, and acetic acid (7:1:1:1, v/v) as the mobile phase. Plates were pre-scored into nineteen individual 1 cm lanes and a 250 µL aliquot was applied 3 cm above the bottom of the plate, leaving a blank lane between each replicate. The area of application was maintained to ~5 mm by successive spotting and drying. As standards, 0.5 µL stock solutions of [ 14 C] DPX-MAT28 and [ 14 C] DPX-KJM44 (1.2 kBq), dissolved in methanol, were applied on the center lanes of the plate. Plates were developed for 75 min at which point the mobile phase had moved 155 cm above the origin then allowed to air dry. The radioactive

14 positions, proportions and corresponding relative mobility (R f) of [ C] parent compounds and metabolites were determined by scanning TLC plates with a AR-2000 radiochromatogram scanner (AR-2000 radio-TLC Imaging Scanner, Bioscan Inc., Washington, DC). Radioactive trace peaks were manually integrated. Peaks below 1% of total radioactivity were rejected.

Parent herbicide was identified by comparing Rf values from the corresponding standard. Data consisted of the percentage parent herbicide, the sum percentage of all metabolites that were more polar than the parent herbicide, and the sum percentage of all metabolites that were less polar than the parent herbicide.

2.4 Autoradiography

To better visualize the final position of the radiolabeled herbicide, treated plants were exposed on x-ray film. A portion of the second fully expanded leaf of each weed species was marked and treated with 3.33 kBq of radioactive herbicide solution as described in the absorption and translocation experiment. Entire plants were harvested at 24 and 72 HAT. Soil was removed from the roots by washing with distilled water. Plants were immediately mounted between two layers of 22 × 28 cm 2 newspaper. Curled leaves were spread carefully to avoid the treated leaf

160

contacting other plant parts and pressed in wooden press boards. The stacking order in the press from bottom to top was wooden plate, cardboard, newspaper, fully spread plant, newspaper, cardboard and second wooden plate. The press was held together by large metal binder clips on all four sides and stored at -20 C. After one week, plants were taken out of the press and wrapped in one layer of plastic film, again avoiding contact of the treated leaf with other plant parts.

Pressed whole plant materials were placed in a 35 x 43 cm cassette and a sheet of x-ray film

(Kodak Scientific X-OMAT Blue Full Speed MXB/CSB1 imaging film, Perkin Elmer, Inc.,

Waltham, MA) positioned over the pressed plant. Exposure times were 4 weeks at -20ºC. After exposure, the imaging films were developed. The film was dried for half an hour and scanned with a flatbed scanner. Non-treated plants were used as a control.

2.5 Statistical Analysis

The five plant portions of quantified radioactivity were combined as the total absorbed into the plant (the sum of the radioactivity from the treated leaf, above treated leaf, below treated leaf, and root portions), the total radioactivity translocated out of the treated leaf (the sum of the radioactivity from the above treated leaf, below treated leaf, and root portions), the above treated leaf portion, and the below treated leaf portions (the sum of the radioactivity from the below treated leaf and root portions). Data were subjected to ANOVA using SAS 9.2 that employed

PROC MIXED 32 . ANOVA indicated that trial effects for absorption, total translocation out of the treated leaf, and translocation to the root were not significant for any plant species or harvest interval (P > 0.05), therefore data were pooled over trials. Non-linear regression was conducted on both absorption and translocation replicate data to describe overall treatment patterns.

Absorption data was fit to an asymptotic, exponential maximum two term model as the following equation:

161

y = a *[1-exp (-b*x )] [1] where y is the percent absorption expressed as the percent of the applied dose; a is the upper asymptote, or theoretical absorption maximum; x is time, expressed as hours after treatment; b is a slope term that has a positive relationship to the rate with which absorption reaches maximal levels. Identical regression analysis has been used to model absorption of imazamox in feral rye to understand MCPA-ester/imazamox synergism. 33

A three term Gompertz equation was used to relate translocation over time. The

Gompertz equation was:

y = a *[ exp (-exp (-(x - k)/ b)] [2] where y is the percent translocation expressed as the percent of the applied dose, a is the asymptote or the maximum translocation expressed as the percent applied , x is time, expressed as hours after treatment; k is the point of inflection (in h) and b is the slope of the curve at the point of greatest inflection.

Coefficients of determination ( R2) were calculated for all regressions. For the Gompertz and exponential maximum equations fitted to the data, an approximate R2 value was obtained by subtracting the ratio of residual sums of squares to corrected total sums of squares from 1. 34 The R2 and residual mean squares were used to determine goodness of fit to nonlinear models.

For the metabolism study, data consisted of area normalized percentage of either DPX-

MAT28 or DPX-KJM44. Statistical procedures were similar to the absorption and translocation study and percentage metabolism was modeled using the equation:

-kt C = y0 +C0e [3]

162

where y0 is the point where the decay rate equals 0; C0 is the percent in the treated leaf at time zero minus y0 ; k is the first-order rate constant (h -1); and t is time (h). Aminocyclopyrachlor half- life (T 1/2 ) was calculated from equation [4]:

T1/2 = ln2/ k [4] where k is the first order rate constant calculated in equation [3].

3 Results

3.1 Absorption and Translocation of DPX-MAT28 and DPX-KJM44

Absorption of applied DPX-MAT28 was biphasic, and the majority of DPX-MAT28 was absorbed within 24 HAT by each species (Figure 2B). In prickly lettuce, absorption of DPX-

MAT28 increased only slightly as harvest interval increased, but never exceeded 5% of applied radioactivity. Increased absorption of DPX-KJM44 was observed in prickly lettuce in the first 24

HAT (9.9% of the applied) (Figure 2A). A maximum of 10.3% of applied radioactivity was absorbed by prickly lettuce at 72 HAT. Based on observed injury, absorption rates in prickly lettuce appear low due to rapid herbicidal activity – symptoms were observed within 24 h of treatment and epinasty in prickly lettuce was much more pronounced than in the other two species.

In yellow starthistle, absorption was 10.6% of the applied DPX-MAT28 in the first 24 h, and was 14.6% of the applied DPX-MAT28 at 72 HAT. Absorption of DPX-KJM44 into yellow starthistle increased for the duration of the experiment, reaching 31.6% of the applied DPX-

KJM44. Absorption of aminocyclopyrachlor by rush skeletonweed was greater than the other two species, with 64.1% of the applied DPX-MAT28 and 53.2% of DPX-KJM44 absorbed by 24

HAT. Absorption in rush skeletonweed at 72 HAT was similar to that of the 24 HAT observations for each compound (Figure 2).

163

Translocation out of the treated leaf to the rest of the plant was greater in yellow starthistle than the other two species (Figure 3). At 72 HAT, yellow starthistle translocated

19.3% of the applied DPX-KJM44 out of the treated leaf. Rush skeletonweed and prickly lettuce translocated less, 6.5% and 3.2% of the applied radioactivity respectively. Translocation of DPX-

MAT28 out of the treated leaf was lower than DPX-KJM44 for each plant species. At 72 HAT,

1%, 3.6%, and 10.7% of the applied DPX-MAT28 had translocated out of the treated leaves of prickly lettuce, rush skeletonweed, and yellow starthistle, respectively. In rush skeletonweed, translocation out of the treated leaf was greater at the 24 HAT harvest than the other harvest intervals (8.7% of the applied).

In yellow starthistle, translocation of radioactivity was directed toward the above ground portions (all plant parts excluding roots) of the plant consisting of the crown and upper leaves

(Figure 4). Translocation to the above ground portion of yellow starthistle was similar regardless of active ingredient form, and was > 9% at 72 HAT. Translocation of radioactivity to the above ground portions in prickly lettuce and rush skeletonweed was less than yellow starthistle, and was less than 2.3% of the applied for both compounds. Although less than 2.3% of the applied radioactivity translocated to the above ground portions in rush skeletonweed, 3.6% of the applied radioactivity moved to the below ground portions of the plant at 72 HAT when the radioactivity was applied as DPX-KJM44 (Figure 5). When applied as DPX-MAT28, movement of radioactivity to the below ground portion in rush skeletonweed was also 3.6% at 24 HAT, although by 72 HAT radioactivity was lower (1.3% of the applied) and similar to that of yellow starthistle.

3.2 Metabolism

164

No metabolites of aminocyclopyrachlor were observed. All radioactivity recovered from rush skeletonweed was DPX-MAT28 ( Rf=0.85) or DPX-KJM44 ( Rf=0.93) (Figure 6). No DPX-

KJM44 was recovered from outside the treated leaf, indicating that DPX-KJM44 was de- esterified and translocated as DPX-MAT28. De-esterification was biphasic and occurred rapidly in the first 24 HAT but slowed thereafter (Figure 7). At 72 HAT, 17.9% of DPX-KJM44 remained in the treated leaves. Based on first-order kinetics, the half-life of the DPX-KJM44 in rush skeletonweed was 3.5 h.

3.3 Autoradiography

Autoradiographs of the treated plants were consistent with the empirical data collected through biological oxidation of the plant samples (Figure 8). Prickly lettuce and yellow starthistle accumulated radiolabeled material in the newer developing leaves, indicating acropetal movement of the radiolabel. Rush skeletonweed autoradiographs had a higher quantity of radioactivity, judged by the relative intensity of the radioactivity, localized in the root tissue, followed by accumulation in new leaves. Movement of radiolabel in rush skeletonweed was basipetal. Although not quantitative, autoradiographs provide validation of the absorption and translocation studies and allow visualization of localization of the herbicide in the various plant tissues. The images also suggest DPX-MAT28 is both phloem and xylem mobile.

4 Discussion

The objective of these studies were to compare the absorption and translocation of DPX-

MAT28 to DPX-KJM44 in prickly lettuce, yellow starthistle, and rush skeletonweed as the three species differ in their response to a field use rate of the two forms of the herbicide. Species sensitivity and herbicide structure affects both absorption and translocation of the active ingredient, aminocyclopyrachlor. When treated with DPX-MAT28 or DPX-KJM44, the most

165

sensitive species, prickly lettuce, absorbed the least radioactivity, regardless of herbicide form.

Yellow starthistle absorbed more DPX-MAT28 and DPX-KJM44, and the least sensitive weed, rush skeletonweed, absorbed the most DPX-MAT28 or DPX-KJM44. Yellow starthistle and prickly lettuce absorbed more DPX-KJM44 than DPX-MAT28. Ester herbicide derivatives enhance absorption by increasing the lipophilic nature of the compound, facilitating cuticle penetration. 10-12

Conversely, radioactivity translocated in greater quantities out of the treated leaf when applied as DPX-MAT28 than when applied as DPX-KJM44 at the 2 and 4 h harvest intervals in rush skeletonweed and yellow starthistle. Ester herbicide derivatives are not very mobile in the symplast due to their lipophilic nature. Although permeable to the lipophilic wax layers of the leaf cuticle, methyl ester herbicide derivatives have reduced permeability to the hydrophilic pectin and cellulose layers of the cuticle and apoplast. Esterase activity in the cuticle and apoplast create a more hydrophilic free acid that can then reach the plasma membrane and symplast. 13-15 . The de-esterification reaction required to convert the DPX-KJM44 into the more mobile and herbicidally active DPX-MAT28 likely slowed the availability of DPX-MAT28 for translocation. As a consequence of the increased translocation of DPX-MAT28 at the early harvest intervals, the deregulation of sink strength likely occurred more rapidly in DPX-MAT28- treated plants and contributed to the lower overall total absorption and translocation observed with that compound form. In later harvests, greater amounts of radioactivity translocated when applied as DPX-KJM44 than when applied as DPX-MAT28 as more DPX-KJM44 was absorbed at those later harvests. Growth inhibition is one of the several auxin-herbicide-mediated responses in plants, and usually occurs within 24 h. Growth inhibition and deregulation of sink strength occurred more rapidly in prickly lettuce or when aminocyclopyrachlor was applied as

166

DPX-MAT28. The result of the deregulation of growth in prickly lettuce and DPX-MAT28 applications was the lower observed absorption compared to yellow starthistle or rush skeletonweed in this study or absorption by Canada thistle 9 or the DPX-KJM44 derivative, respectively.

In addition to esterase activity and de-regulation of sink strength, difference in herbicide perception may account for the varying degrees of response observed in this experiment. When exposed to high auxin levels or persistent auxin xenobiotics, such as non-metabolized auxinic herbicides, plants elicit a metabolic and physiological auxin response that begins with TIR1/AFB auxin receptors. 35 The presence of auxins causes release and degradation transcriptional repressors (AUX/IAA), which in turn leads to derepression of auxin response factors (ARFs) allowing for transcription induced activation of auxin-reactive genes. 35 Initial responses, once perception occurs, include upregulation in ACC synthase leading to elevated ethylene levels, this in turn activates ion channels and +H-ATPases causing abnormal cell elongation and epinasty. 36

Within hours of perception, abscisic acid (ABA) biosynthesis genes are over expressed causing stomatal closure, meristematic growth inhibition, and senescence. The further production of reactive oxygen species, and cyanide, leads to membrane degradation, chloroplast damage, and vasculature failure. The summation of metabolic and physiologic response causes plant death. 36

Rush skeletonweed auxin perception to aminocyclopyrachlor may be less significant than that observed in the other weed species tested. Indeed, mutations in TIR1 homologue AFB5 from

Arabidopsis conferred resistance to picolinate auxins such as picloram with no cross resistance to

2,4-D or IAA 37 suggesting chemical selectivity and substrate specificity to auxin receptor proteins. Unperceived or reduced sensitivity to auxinic herbicide presence would allow for

167

continued absorption and translocation of herbicide as the biochemical lethal cascade of events would take longer to complete.

The de-esterification rate of DPX-KJM44 was slower in rush skeletonweed than Canada thistle. 9 At 72 HAT, 18% of the applied DPX-KJM44 remained as DPX-KJM44 in rush skeletonweed. More rapid de-esterification was observed in Canada thistle - 18% of DPX-

KJM44 remained at 6 HAT, and the half-life in Canada thistle appeared to be less than 1 h. 9

Indeed, the de-esterification rate in rush skeletonweed was slower than many other ester herbicide derivative auxin and growth-regulator type herbicides. 11

Metabolism profiles have been observed in other auxinic herbicides such as aminopyralid and clopyralid. 38 De-esterification rates of various herbicides have been observed to differ between species. Differences in the rates of de-esterification are most likely related to the presence of plant esterases and their affinity to herbicide substrates. Indeed, Gershater 11 reported that the auxinic herbicide 2,4-D methyl was the preferred substrate when compared to other agrochemical pro-herbicide esters, namely fenoxaprop-ethyl, fenthioprop-ethyl, clodinafop- propargyl and bromoxynil-octanoate. When compared between species the rate of 2,4-D-methyl carboxylester hydrolysis ranged from 365.2 ± 54.8 pkat/mg extracted protein in Arabidopsis thaliana (L.) Heynh. to 54.0 ± 3.7 pkat/mg in barnyardgrass (Echinochloa crus-galli L. Beauv), indicating species dependent differences in carboxylesterase catalytic activity. Comparing the carboxylester hydrolysis rates in Canada thistle and rush skeletonweed would be of interest, as the rate of de-esterification could affect control with a highly active molecule like aminocyclopyrachlor. In species where de-esterification is rapid, little difference or advantage would be observed between DPX-MAT28 and DPX-KJM44 . In species with relatively slow de- esterification rates, more active ingredient may ultimately be translocated to important organs as

168

perturbations in the source-sink relationship may be slower to manifest when the herbicide is applied as DPX-KJM44. Proportionally greater amounts of absorbed DPX-KJM44 than DPX-

MAT28 moved to the roots of rush skeletonweed at 72 HAT. Although initially root-directed, proportional accumulation of DPX-MAT28 in the roots declined over time.

5 Conclusions

Absorption and translocation of aminocyclopyrachlor is dependent upon active ingredient form and sensitivity of the target plant species. Highly susceptible species like prickly lettuce absorb and translocate less material than relatively less sensitive species like rush skeletonweed.

Absorption is enhanced using DPX-KJM44 in all species studied. The least difference in absorption was observed in rush skeletonweed. Translocation is similar to other auxin phloem mobile herbicides, accumulating in meristematic sink tissues. De-esterification of DPX-KJM44 in rush skeletonweed appears be a limiting factor in early translocation. Reduced de- esterification rates may explain the delay in translocation of the resulting acid in yellow starthistle and rush skeletonweed. Determining sensitivity and de-esterification rates for a target species will be important in assessing the utility of using the DPX-KJM44. In most instances,

DPX-MAT28 may be sufficient for effective weed control.

Acknowledgments

The authors would like to thank DuPont Crop Protection for funding of this research and providing radiolabeled herbicide standards. The authors extend their appreciation to Dennis

Pittman, Dilpreet Riar, Jamin Smitchger and Randall Stevens (from Department of Crop and Soil

Sciences, Washington State University) for their technical assistance. The authors also acknowledge Dr. Andrew Kniss (University of Wyoming) for advice on regression analysis.

169

Literature Cited

1 Armel GR, Klingeman WE, Flanagan PC, Breeden GK, and Halcomb M, Comparisons of the

experimental herbicide DPX-KJM44 with aminopyralid for control of key invasive weeds

in Tennessee. Proc Weed Sci Soc Am Abstr 49 :410 (2009).

2 Claus J, Turner RG, Armel G, and Holliday M, DuPont Aminocyclopyrachlor (proposed

common name) (DPX-MAT28/KJM44) herbicide for use in turf, IWC, bare-ground and

brush markets. Inter Weed Sci Cong 5:277 (2008).

3 Jenks BM, Yellow toadflax control in rangeland with DPX-MAT28. Proc West Soc Weed Sci

Abstr 63 :4 (2010).

4 Turner RG, Claus JS, Hidalgo E, Holliday MJ, and Armel GR, Technical introduction of the

new DuPont vegetation management herbicide aminocyclopyrachlor. Proc Weed Sci Soc

Am Abstr 49 :405 (2009).

5 Anonymous, DuPont: DPX-MAT28 Technical Bulletin, E.I. du Pont de Nemours and Company

(2009).

6 Edwards R, The effects of DPX-KJM44 on native and non-native Colorado rangeland species.

Proc West Soc Weed Sci Abstr 61 :5 (2008).

7 Vassios JD, Douglass C, Bridges M, Lindenmayer B and Nissen S. Native grass tolerance to

aminopyralid and DPX-KJM44. Proc Weed Sci Soc Am Abstr 49 :153 (2009).

8 Senseman SA, Herbicide Handbook 9th Edition . Lawrence, KS: Weed Science Society of

America (2007).

9 Bukun BR, Lindenmayer B, Nissen SJ, Westra P, and Shaner DL, Absorption and translocation

of aminocyclopyrachlor and aminocyclopyrachlor-methyl ester in Canada thistle

(Cirsium arvense ). Weed Sci 58 :96–102 (2010).

170

10 Douglas DB, Swisher BA, and Burnside OC, Behavior of 14 chaloxyfop-methyl in intact plants

and cell cultures. Weed Sci 33 :291–299 (1985).

11 Gershater M, Sharples K, and Edwards R. Carboxylesterase activities toward pesticide esters

in crops and weeds. Phytochemistry 67 :2561-2567 (2006).

12 Hassall KA, The Biochemistry and Uses of Pesticides: Structure, Metabolism, Mode of Action

and Uses in Crop Protection . 2nd ed., Macmillan, Co., Basingstoke (1990).

13 Incledon B J and Hall JC. Enzymatic de-esterification of xenobiotics in plants. In Regulation

of Enzymatic Systems Detoxifying Xenobiotics in Plants , ed. by Hatzios KK, Kluwer

Academic, Dordrecht pp. 67-82 (1997).

14 Kloppenburg DJ and Hall JC, Penetration of clopyralid and related weak acid herbicides into

and through isolated cuticular membranes of Euonymus fortune . Weed Res 30 :431-438

(1990).

15 Haslam R, Raveton M, Cole DJ, Pallet KE and Coleman JOD, The identification and

properties of apoplastic carboxylesterases from wheat that catalyse deesterification of

herbicides. Pestici Biochem and Physiol 71 :178-189 (2001).

16 Devine MD, Bestman HD, and. Vanden Born W H, Uptake and accumulation of the

herbicides chlorsulfuron and clopyralid in excised pea root tissue. Plant Physiol 85 :82-86

(1987).

17 Hsu FC and Kleier DA, Phloem mobility of xenobiotics, VIII: a short review. J. Exp. Bot.

47 :1265–1271 (1996).

18 Weaver S, Cluney K, Downs M, and Page E, Prickly lettuce ( Lactuca serriola ) interference

and seed production in soybeans and winter wheat. Weed Sci 54 :496-503 (2006).

171

19 Mallory-Smith CA, Thill DC and Dial MJ, Identification of sulfonylurea herbicide-resistant

prickly lettuce ( Lactuca serriola ). Weed Technol 4:163-168 (1990).

20 Burke IC, Yenish JP, Pittmann D, and Gallagher RS, Resistance of a prickly lettuce ( Lactuca

serriola ) biotype to 2,4-D. Weed Technol 23 :586-591 (2009).

21 Cuthbertson EG, Chondrilla juncea in Australia: root morphology and regeneration from root

fragments. Australian J Exp Agr Animal Husb 12 :528-534 (1971).

22 Chaboudez, P. and J. J. Burdon. Frequency-dependent selection in a wild plant-pathogen

system. Oecologia 102 :490-493 (1995).

23 Heap JW, Control of rush skeletonweed ( Chondrilla juncea ) with herbicides. Weed Technol

7:954-959 (1993)

24 Gerlach Jr. JD, The introduction, dynamics of geographic range expansion, and ecosystem

effects of yellow starthistle ( Centaurea solstitialis ). Proc Calif Weed Sci Soc 49 :136–141

(1997).

25 DiTomaso JM, Kyser GB, and Pitcairn MJ, Yellow starthistle management guide, in Cal-IPC

Publication 2006-03. [Online]. California Invasive Plant Council. http://www.cal-ipc.org

/ip/management/yst [June 1, 2010].

26 Thomsen CD, Williams WA, and Vayssieres M, Controlled grazing on annual grassland

decreases yellow starthistle. Calif Agric 47 :36-40 (1993).

27 Benefield CB, DiTomaso JM, Kyser GB, Orloff SB, Churches KR, Marcum DB, and Nader

GA, Success of mowing to control yellow starthistle depends on timing and plant's

branching form. Calif Agric 53 :17-21 (1999).

172

28 DiTomaso JM, Kyser GB, and Hastings MS, Prescribed burning for control of yellow

starthistle ( Centaurea solstitialis ) and enhanced native plant diversity. Calif Agric

47 :233-242 (1999).

29 Enloe SF, Ditomaso JM, Orloff SB, and Drake DJ, Perennial grass establishment integrated

with clopyralid treatment for yellow starthistle management on annual range. Weed

Technol 19 :94-101 (2005).

30 Pitcairn MJ, Piper GL, and Coombs EM, Yellow starthistle, in Biological Control of Invasive

Plants in the United States, ed. by Coombs EM, Clark JK, Piper GL, and Cofrancesco Jr.

AF. Oregon State University Press Corvallis, pp. 421-430 & 432-435 (2004).

31 Prather T, and Wallace J, Rush skeletonweed control with DPX-MAT28 on Idaho rangeland,

in 2010 Western Society of Weed Science Research Progress Reports, ed. by Rauch T and

Cambell J, Western Society of Weed Science, Las Cruces, pp. (in press) (2010).

32 [SAS] Statistical Analysis Systems. SAS/STAT User’s Guide. Release 7.00. Statistical

Analysis Systems Institute, Cary, NC 1028 p. (1998).

33 Kniss A, Lyon D, Vassios J, and Nissen S. MCPA Synergizes Imazamox Control of Feral

Rye ( Secale cereale ). Weed Technol In-Press. (2011).

34 Draper NR and Smith H, Applied Regression Analysis . J Wiley, New York pp. 33-42, 511

(1981).

35 Dharmasiri N, Dharmasiri S., and Estelle M, The F-box protein TIR1 is an auxin receptor.

Nature 435 : 441-445 (2005)

36 Grossmann K, Auxin herbicides: current status of mechanism and mode of action. Pest

Management Science, 66 :113–120 (2010).

173

37 Walsh T, Neal R, Merlo A, Honma M, Hicks G, Wolff K, Matsumura W, and Davies J,

Mutations in an auxin receptor homolog AFB5 and in SGT1b confer resistance to

synthetic picolinate auxins and not to 2,4-dichlorophenoxyacetic acid or indole-3-acetic

acid in Arabidopsis. Plant Physiology 142 :542-552 (2006).

174

1 2

Figure 1. Chemical structures of (1) aminocyclopyrachlor acid and (2 aminocyclopyrachlor methyl ester.

175

100 (A) 90 Rush skeletonweed, y = 66.08(1-exp(-0.84*x)) R2=0.97 Yellow starthistle, y = 31.13(1-exp(-0.15*x)) R2=0.93 80 Prickly lettuce, y = 9.75(1-exp(-0.10*x)) R2=0.89 70

60 50

10 0

100 (B) 2 90 Rush skeletonweed, y = 59.16(1-exp(-0.11*x)) R =0.93 2 applied) of (% Absorption Yellow starthistle, y =13.88(1-exp(-0.15*x)) R =0.90 80 Prickly lettuce, y = 4.06(1-exp(-21.53*x)) R2=0.80 70

60 50

20 10

0 8 16 24 32 40 48 56 64 72

Hours after treatment Figure 2. Absorption of foliar applied (A) 14 C-DPX-KJM44 and (B) 14 C-DPX-MAT28 into rush skeletonweed, yellow starthistle, and prickly lettuce, expressed as % of applied. Error bars represent the standard error of the mean where n=8.

176

40 (A)

Rush skeletonweed, y=7.0exp(-exp((-x-21.1)/21.7)) R2=0.99 Yellow starthistle, y=21.2exp(-exp((-x-21.1)/28.0)) R2=0.99 2 30 Prickly lettuce, y=3.5exp(-exp((-x-19.0)/15.8)) R =0.99

40 (B)

Rush skeletonweed, y=5.9exp(-exp((-x-0.55)/5.3)) R2=0.95 Yellow starthistle, y=10.9exp(-exp((-x-12.1)/12.4)) R2=0.55 Prickly lettuce, y=1.7exp(-exp((-x-20.0)/32.2)) R2=0.96 30

applied) of (% translocation Total

0 8 16 24 32 40 48 56 64 72 Hours after treatment

Figure 3. Total translocation of foliar applied (A) 14 C-DPX-KJM44 and (B) 14 C-DPX-MAT28 out of the treated leaf of rush skeletonweed, yellow starthistle, and prickly lettuce, expressed as

% of applied. Error bars represent the standard error of the mean where n=8.

177

16 (A) 14 Rush skeletonweed, y=0.04exp(-exp((-x-9.22)/19.3)) R2=0.95 Yellow starthistle, y=9.3exp(-exp((-x-18.2)/10.8)) R2=0.99 2 12 Prickly lettuce, y=2.0exp(-exp((-x-20.0)/13.5)) R =0.99

0 16 (B) Rush skeletonweed, y=2.5exp(-exp((-x-5.2)/4.7)) R2=0.70 14 Yellow starthistle, y=9.2exp(-exp((-x-12.0)/11.9)) R2=0.95 Prickly lettuce, y=0.014x+0.18 R=0.85 12

Translocation to aboveground portion (% of applied) 6

0 8 16 24 32 40 48 56 64 72

Hours after treatment

Figure 4. Translocation of foliar applied (A) 14 C-DPX-KJM44 and (B) 14 C-DPX-MAT28 to the above ground portion of each species, expressed as % of applied. Error bars represent the standard error of the mean where n=8.

178

10 (A) 9 Rush skeletonweed, y=4.4exp(-exp((-x-29.4)/25.8)) R2=0.99 Yellow starthistle, y=2.4exp(-exp((-x-12.3)/9.2)) R2=0.99 8 Prickly lettuce, y=0.2exp(-exp((-x-4.26)/5.26)) R2=0.95 7 6

3 2

10 (B) 9 Rush skeletonweed, y=2.3exp(-exp((-x-5.4)/4.43)) R2=0.64 2 8 Yellow starthistle, y=1.25exp(-exp((-x-4.9)/2.9)) R =0.91 Prickly lettuce, y= 0.003x+0.036 R=0.85 7

Translocation of roots to applied) (% 6

4 3

0 8 16 24 32 40 48 56 64 72 Hours after treatment

Figure 5. Translocation of foliar applied (A) 14 C-DPX-KJM44 and (B) 14 C-DPX-MAT28 to the below ground portion of each species, expressed as % of applied. Error bars represent the standard error of the mean where n=8.

179

Figure 6. TLC plates of extracted leaf tissue from 14 C treated leaf portions of six plants at 2 and

72 HAT harvest intervals. Color indicates intensity of radioactive signal on a log scale .

180

100

(TLC area normalization) area (TLC 20

leaf treated in ester Methyl %

0 0 8 16 24 32 40 48 56 64 72 Hours after treatment

Figure 7. De-esterification rate of DPX-KJM44 in rush skeletonweed. Percentage of radioactivity from TLC separations of 14 C-DPX-KJM44 and 14 C-DPX-MAT28 from treated leaves of rush skeletonweed (n=6) at different harvest intervals.

181

182

Figure 8. Autoradiographs of prickly lettuce (A), rush skeletonweed (B), and yellow starthistle (C), 24 HAT with foliar appli ed

aminocyclopyrachlor methyl ester.