DOCSLIB.ORG

Principal Component Analysis Approach for Determination Of

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Principal Component Analysis Approach for Determination Of Principal Component Analysis Approach for Determination of Stroke Protein Biomarkers and Modified Atmospheric Pressure Chemical Ionization Source Development for Volatile Analyses A dissertation submitted to the Graduate School Of the University of Cincinnati In partial fulfillment of the Requirements for the degree of DOCTORATE OF PHILOSOPHY In the Department of Chemistry Of the College of Arts and Sciences March 2017 By Keaton S. Nahan B.S., Forensic Science, Chestnut Hill College, Philadelphia, PA, May 2011 Committee Co-Chairs: Dr. Julio A. Landero Figueroa and Dr. Peng Zhang i Abstract Proteins play a role in neurological health and disorders. About 25% of proteins contain metals and these proteins are known as metalloproteins. Both blood plasma proteins and metalloproteins play an active role in stroke. These proteins may be quantified with approaches as simple as multiplexed assay to that of quantitative protein mass spectrometry (proteomics). Identification of present bound metals is more elusive. Inductively coupled plasma mass spectrometry (ICP-MS) is capable of both quantitation as well as speciation of metalloproteins when coupled with chromatography. Determination of metalloproteins, for use as a stroke determination tool, was performed by bottom up proteomics. Multivariate analysis was used to simplify the determination of important stroke biomarkers that were identified or quantified by quantitative multiplexed assays and tandem mass spectrometry, respectively. While ICP-MS was used as a means for determination of metal containing species, atmospheric pressure chemical ionization mass spectrometry (APCI-MS) is used for quantitation of volatile species. Typical means of APCI-MS are coupled with chromatography for separations prior to quantitation or directly performed by flow injection. Alternatively, gas chromatography mass spectrometry (GC-MS) also is capable of separating volatile molecules at low levels by using solid phase microextraction (SPME) fibers. In order to improve APCI-MS, it was proposed to modify an APCI source to incorporate a conductive SPME source that was capable of low solvent analysis for detection of volatile species. While commercial SPME fibers are produced from a variety of polymers, this modified APCI source was produced from multiwalled carbon nanotubes (MWCNT’s) to ensure flexibility, improved surface area, and conductivity. ii iii Acknowledgments I dedicate my dissertation to the late Dr. Joseph “Doc” Caruso. When I began at the University of Cincinnati, I had my own difficulties, but Doc took me into the research group anyways. He always made me feel like a part of the group and that he was the head of the research group family. If I ever had a lousy day, Doc always knew the perfect joke to tell. Some of my favorite moments with Doc were fixing things around the lab with him. He showed me how to plumb a water circulator, adhere polymer pipes, and what a passionate chemist looks like. He was as intelligent as he was warm-hearted. The parties that Doc and Judy Caruso held at their home were always a blast. Their family and our research group shared laughs as much as we enjoyed the sound of Doc playing the accordion. Doc and Judy made me and the rest of the group feel like family. I will never forget what Doc gave me and I will continue to become the greatest chemist I can become. I would like to thank Dr. Julio Landero for mentoring me in everything from fixing instruments to the theory of instrumentation. He was able to convey many topics at a level I could understand in order to succeed in my projects. Most of all, I want to thank him for taking the heavy responsibility of the research group after Doc’s passing. While many were worried about what was going to happen next, Dr. Landero made it clear that he would be there to support us until we finished. As my advisor, he spent a substantial amount of time helping me with my manuscripts as well as preparing me for the future. When I needed a reality check, he gave me his blunt opinion and it was always appreciated to keep me on track for graduation. I want to thank my committee Dr. Ridgway, Dr. Zhang, and Dr. Stan. You have aided me in my research decisions, improved my critical thinking, and turned me into a level headed chemist. During my first year in teaching, I was the teaching assistant in general chemistry lab for Dr. Anne Vonderheide. After working with Dr. Vonderheide my first year, I had received an iv opportunity to work on a mass spectrometer in the analytical laboratory with her. At that moment, I had gained a deep insight into using the mass spectrometer and understanding its intricacies. After discussing an experiment with Dr. Vonderheide, I was allowed to modify the mass spectrometer to my heart’s content, which led me to another project that was inspired by my interest in instrumentation. I can’t thank her enough for allowing me to work mass spectrometric instrumentation as well as her aid in helping me gains funds for my 6th year. Dr. V has been an excellent mentor. Dr. Vonderheide also introduced me to Dr. Vesselin Shanov and Dr. Noe Alvarez who have provided me with the nanomaterials essential for my project as well as aided me in improving the ionization source apparatus. Their help has been essential in making this project successful. I would like to thank Dr. Anna Gudmundsdottir for providing funds from the department to finish my education during my 6th year of graduate school. I want to thank Dr. Stephan Macha and Dr. Larry Sallans for allowing me to ask them numerous questions about mass spectrometry as well as letting me borrow seemingly miscellaneous tools. They were quick to give me in-depth answers and suggestions. During my time at UC, I was lucky to have been in such a great research group. I want to thank Amberlie Clutterbuck, Anna Donnell, Skyler Smith, Jiawei Gong, Phanichand Kodali, Karnakar Chitta, Cory Stiner, and Megan Stanton for being great peers to work with. I want to highlight Anna Donnell for being a great peer mentor for my growth as a mass spectrometrist, chemist, and teacher. Also, I am happy to have made friends with visiting scholars: Oliver Hochmoller, Aline Olivieri, Tina Wigger, and Dr. Maria Hespanhol. v Over the years at UC, I made many friends including Travis Pollard, Gus Powers, Brett Bolton, Vianessa Ng, Rob Ross, Xiaoyu Cao, Jennifer Vernia, Daoli Zhao, Xuefei Guo, Tingting Wang, and Li Duan. I cherish the laughs, discussions, and parties we shared. I want to especially thank Rob and Xiaoyu for reintroducing me to Wenwen. Most of all, I want to thank my beautiful wife, Wenwen Yang. Ever since we started dating in 2013, she has stood by, supported me, and motivated me to achieve greater success. I will vi always remember December 30, 2015 as the happiest day of my life. She is my other half and I can’t imagine making it out of graduate school without her. Even when I had to do my research on a broken foot, she would help me in whatever way she could. She always drove me to the easiest entrances to get in with crutches and told me when I was pushing myself too hard. Wenwen is my constant source of inspiration. We are in for a great future together, dear, and I will lead the way. vii Table of Contents Page Table of Figures..........................................................................................................................xi Table of Tables..........................................................................................................................xii 1. Chapter 1:Introduction.........................................................................................................1 1.1. Preface 1.2. Sample Preparation 1.2.1. Acid Sample Dissolution 1.3. Instrumentation 1.3.1. Molecular Mass Spectrometry 1.3.1.1. Ionization 1.3.1.1.1. Chemical Ionization 1.3.1.1.2. Electrospray Ionization 1.3.1.1.3. Atmospheric Pressure Chemical Ionization 1.3.1.1.4. Desorption Electrospray Ionization 1.3.1.1.5. Direct Probe Atmospheric Pressure Chemical Ionization 1.3.1.1.6. Atmospheric Solids Analysis Probe 1.3.1.1.7. Desorption Atmospheric Pressure Chemical Ionization 1.3.1.2. Sample Introduction 1.3.1.2.1. Infusion and Flow Injection Analysis 1.3.1.2.2. Solid Phase Microextraction 1.3.1.2.2.1. Carbon Nanotube Solid Phase Microextraction Fibers 1.3.1.2.3. Liquid Chromatography 1.3.1.2.3.1. Affinity Chromatography 1.3.1.2.3.2. Reverse Phase Chromatography viii 1.3.2. Inductively Coupled Plasma Mass Spectrometry 1.3.2.1. Ionization, Nebulization, and Transport 1.3.2.2. Interferences in Atomic Mass Spectroscopy 1.3.2.3. Detection 1.3.2.4. Speciation 1.4. Statistics 1.4.1. Univariate Statistics 1.4.2. Multivariate Statistics 1.4.2.1. Data Pretreatment 1.4.2.2. Principal Component Analysis 1.5. Applications 1.5.1. Applications of Metallomics and Disease 1.5.2. Applications of Volatile Organic Molecule Determination 1.5.2.1. Chemical Warfare Agents 1.5.2.2. Mars 2. Chapter 2. The Metalloprotein and Metal Profile of Human Blood Plasma as a Diagnostic Fingerprint for Stroke Determination.............................................................30 2.1. Abstract 2.2. Introduction 2.3. Methods 2.3.1. Blood Plasma Acquisition 2.3.2. Reagents 2.3.3. Apparatus 2.3.4. Procedure 2.3.4.1. Trace Metal Analysis 2.3.4.2. Immunodepletion and SEC-ICP-MS/MS ix 2.3.5. Metalloprotein Identification by LC-MS/MS 2.3.6. Statistical Analyses 2.3.6.1. Software 2.3.6.2. Data Pretreatment 2.4. Results and Discussion 2.4.1. ICP-MS/MS 2.4.2. SEC-ICP-MS/MS Metalloprotein Analyses 2.4.3. Multivariate Analysis 2.4.4.
Load more

Recommended publications
  • Supplemental Figure 1. Vimentin
    Double mutant specific genes Transcript gene_assignment Gene Symbol RefSeq FDR Fold- FDR Fold- FDR Fold- ID (single vs. Change (double Change (double Change wt) (single vs. wt) (double vs. single) (double vs. wt) vs. wt) vs. single) 10485013 BC085239 // 1110051M20Rik // RIKEN cDNA 1110051M20 gene // 2 E1 // 228356 /// NM 1110051M20Ri BC085239 0.164013 -1.38517 0.0345128 -2.24228 0.154535 -1.61877 k 10358717 NM_197990 // 1700025G04Rik // RIKEN cDNA 1700025G04 gene // 1 G2 // 69399 /// BC 1700025G04Rik NM_197990 0.142593 -1.37878 0.0212926 -3.13385 0.093068 -2.27291 10358713 NM_197990 // 1700025G04Rik // RIKEN cDNA 1700025G04 gene // 1 G2 // 69399 1700025G04Rik NM_197990 0.0655213 -1.71563 0.0222468 -2.32498 0.166843 -1.35517 10481312 NM_027283 // 1700026L06Rik // RIKEN cDNA 1700026L06 gene // 2 A3 // 69987 /// EN 1700026L06Rik NM_027283 0.0503754 -1.46385 0.0140999 -2.19537 0.0825609 -1.49972 10351465 BC150846 // 1700084C01Rik // RIKEN cDNA 1700084C01 gene // 1 H3 // 78465 /// NM_ 1700084C01Rik BC150846 0.107391 -1.5916 0.0385418 -2.05801 0.295457 -1.29305 10569654 AK007416 // 1810010D01Rik // RIKEN cDNA 1810010D01 gene // 7 F5 // 381935 /// XR 1810010D01Rik AK007416 0.145576 1.69432 0.0476957 2.51662 0.288571 1.48533 10508883 NM_001083916 // 1810019J16Rik // RIKEN cDNA 1810019J16 gene // 4 D2.3 // 69073 / 1810019J16Rik NM_001083916 0.0533206 1.57139 0.0145433 2.56417 0.0836674 1.63179 10585282 ENSMUST00000050829 // 2010007H06Rik // RIKEN cDNA 2010007H06 gene // --- // 6984 2010007H06Rik ENSMUST00000050829 0.129914 -1.71998 0.0434862 -2.51672
    [Show full text]
  • Ligand-Gated Chloride Channels Are Receptors for Biogenic Amines in C
    Ligand-Gated Chloride Channels Are Receptors for Biogenic Amines in C. elegans The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation Ringstad, N., N. Abe, and H. R. Horvitz. “Ligand-Gated Chloride Channels Are Receptors for Biogenic Amines in C. elegans.” Science 325, no. 5936 (July 2, 2009): 96-100. As Published http://dx.doi.org/10.1126/science.1169243 Publisher American Association for the Advancement of Science (AAAS) Version Author's final manuscript Citable link http://hdl.handle.net/1721.1/84506 Terms of Use Creative Commons Attribution-Noncommercial-Share Alike 3.0 Detailed Terms http://creativecommons.org/licenses/by-nc-sa/3.0/ NIH Public Access Author Manuscript Science. Author manuscript; available in PMC 2010 October 25. NIH-PA Author ManuscriptPublished NIH-PA Author Manuscript in final edited NIH-PA Author Manuscript form as: Science. 2009 July 3; 325(5936): 96±100. doi:10.1126/science.1169243. Ligand-gated chloride channels are receptors for biogenic amines in C. elegans Niels Ringstad1,2, Namiko Abe1,2,3, and H. Robert Horvitz1 1HHMI, Department of Biology and McGovern Institute for Brain Research, MIT, Cambridge MA 02139 Abstract Biogenic amines such as serotonin and dopamine are intercellular signaling molecules that function widely as neurotransmitters and neuromodulators. We have identified in the nematode Caenorhabditis elegans three ligand-gated chloride channels that are receptors for biogenic amines: LGC-53 is a high-affinity dopamine receptor, LGC-55 is a high-affinity tyramine receptor, and LGC-40 is a low-affinity serotonin receptor that is also gated by choline and acetylcholine.
    [Show full text]
  • Primate Specific Retrotransposons, Svas, in the Evolution of Networks That Alter Brain Function
    Title: Primate specific retrotransposons, SVAs, in the evolution of networks that alter brain function. Olga Vasieva1*, Sultan Cetiner1, Abigail Savage2, Gerald G. Schumann3, Vivien J Bubb2, John P Quinn2*, 1 Institute of Integrative Biology, University of Liverpool, Liverpool, L69 7ZB, U.K 2 Department of Molecular and Clinical Pharmacology, Institute of Translational Medicine, The University of Liverpool, Liverpool L69 3BX, UK 3 Division of Medical Biotechnology, Paul-Ehrlich-Institut, Langen, D-63225 Germany *. Corresponding author Olga Vasieva: Institute of Integrative Biology, Department of Comparative genomics, University of Liverpool, Liverpool, L69 7ZB, [email protected] ; Tel: (+44) 151 795 4456; FAX:(+44) 151 795 4406 John Quinn: Department of Molecular and Clinical Pharmacology, Institute of Translational Medicine, The University of Liverpool, Liverpool L69 3BX, UK, [email protected]; Tel: (+44) 151 794 5498. Key words: SVA, trans-mobilisation, behaviour, brain, evolution, psychiatric disorders 1 Abstract The hominid-specific non-LTR retrotransposon termed SINE–VNTR–Alu (SVA) is the youngest of the transposable elements in the human genome. The propagation of the most ancient SVA type A took place about 13.5 Myrs ago, and the youngest SVA types appeared in the human genome after the chimpanzee divergence. Functional enrichment analysis of genes associated with SVA insertions demonstrated their strong link to multiple ontological categories attributed to brain function and the disorders. SVA types that expanded their presence in the human genome at different stages of hominoid life history were also associated with progressively evolving behavioural features that indicated a potential impact of SVA propagation on a cognitive ability of a modern human.
    [Show full text]
  • Genetic and Genomic Analysis of Hyperlipidemia, Obesity and Diabetes Using (C57BL/6J × TALLYHO/Jngj) F2 Mice
    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Nutrition Publications and Other Works Nutrition 12-19-2010 Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P. Stewart Marshall University Hyoung Y. Kim University of Tennessee - Knoxville, [email protected] Arnold M. Saxton University of Tennessee - Knoxville, [email protected] Jung H. Kim Marshall University Follow this and additional works at: https://trace.tennessee.edu/utk_nutrpubs Part of the Animal Sciences Commons, and the Nutrition Commons Recommended Citation BMC Genomics 2010, 11:713 doi:10.1186/1471-2164-11-713 This Article is brought to you for free and open access by the Nutrition at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Nutrition Publications and Other Works by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. Stewart et al. BMC Genomics 2010, 11:713 http://www.biomedcentral.com/1471-2164/11/713 RESEARCH ARTICLE Open Access Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P Stewart1, Hyoung Yon Kim2, Arnold M Saxton3, Jung Han Kim1* Abstract Background: Type 2 diabetes (T2D) is the most common form of diabetes in humans and is closely associated with dyslipidemia and obesity that magnifies the mortality and morbidity related to T2D. The genetic contribution to human T2D and related metabolic disorders is evident, and mostly follows polygenic inheritance. The TALLYHO/ JngJ (TH) mice are a polygenic model for T2D characterized by obesity, hyperinsulinemia, impaired glucose uptake and tolerance, hyperlipidemia, and hyperglycemia.
    [Show full text]
  • ONLINE SUPPLEMENTARY TABLE Table 2. Differentially Expressed
    ONLINE SUPPLEMENTARY TABLE Table 2. Differentially Expressed Probe Sets in Livers of GK Rats. A. Immune/Inflammatory (67 probe sets, 63 genes) Age Strain Probe ID Gene Name Symbol Accession Gene Function 5 WKY 1398390_at small inducible cytokine B13 precursor Cxcl13 AA892854 chemokine activity; lymph node development 5 WKY 1389581_at interleukin 33 Il33 BF390510 cytokine activity 5 WKY *1373970_at interleukin 33 Il33 AI716248 cytokine activity 5 WKY 1369171_at macrophage stimulating 1 (hepatocyte growth factor-like) Mst1; E2F2 NM_024352 serine-throenine kinase; tumor suppression 5 WKY 1388071_x_at major histocompatability antigen Mhc M24024 antigen processing and presentation 5 WKY 1385465_at sialic acid binding Ig-like lectin 5 Siglec5 BG379188 sialic acid-recognizing receptor 5 WKY 1393108_at major histocompatability antigen Mhc BM387813 antigen processing and presentation 5 WKY 1388202_at major histocompatability antigen Mhc BI395698 antigen processing and presentation 5 WKY 1371171_at major histocompatability antigen Mhc M10094 antigen processing and presentation 5 WKY 1370382_at major histocompatability antigen Mhc BI279526 antigen processing and presentation 5 WKY 1371033_at major histocompatability antigen Mhc AI715202 antigen processing and presentation 5 WKY 1383991_at leucine rich repeat containing 8 family, member E Lrrc8e BE096426 proliferation and activation of lymphocytes and monocytes. 5 WKY 1383046_at complement component factor H Cfh; Fh AA957258 regulation of complement cascade 4 WKY 1369522_a_at CD244 natural killer
    [Show full text]
  • Table SI. Primer List of Genes Used for Reverse Transcription‑Quantitative PCR Validation
    Table SI. Primer list of genes used for reverse transcription‑quantitative PCR validation. Genes Forward (5'‑3') Reverse (5'‑3') Length COL1A1 AGTGGTTTGGATGGTGCCAA GCACCATCATTTCCACGAGC 170 COL6A1 CCCCTCCCCACTCATCACTA CGAATCAGGTTGGTCGGGAA 65 COL2A1 GGTCCTGCAGGTGAACCC CTCTGTCTCCTTGCTTGCCA 181 DCT CTACGAAACCAGGATGACCGT ACCATCATTGGTTTGCCTTTCA 192 PDE4D ATTGCCCACGATAGCTGCTC GCAGATGTGCCATTGTCCAC 181 RP11‑428C19.4 ACGCTAGAAACAGTGGTGCG AATCCCCGGAAAGATCCAGC 179 GPC‑AS2 TCTCAACTCCCCTCCTTCGAG TTACATTTCCCGGCCCATCTC 151 XLOC_110310 AGTGGTAGGGCAAGTCCTCT CGTGGTGGGATTCAAAGGGA 187 COL1A1, collagen type I alpha 1; COL6A1, collagen type VI, alpha 1; COL2A1, collagen type II alpha 1; DCT, dopachrome tautomerase; PDE4D, phosphodiesterase 4D cAMP‑specific. Table SII. The differentially expressed mRNAs in the ParoAF_Control group. Gene ID logFC P‑Value Symbol Description ENSG00000165480 ‑6.4838 8.32E‑12 SKA3 Spindle and kinetochore associated complex subunit 3 ENSG00000165424 ‑6.43924 0.002056 ZCCHC24 Zinc finger, CCHC domain containing 24 ENSG00000182836 ‑6.20215 0.000817 PLCXD3 Phosphatidylinositol‑specific phospholipase C, X domain containing 3 ENSG00000174358 ‑5.79775 0.029093 SLC6A19 Solute carrier family 6 (neutral amino acid transporter), member 19 ENSG00000168916 ‑5.761 0.004046 ZNF608 Zinc finger protein 608 ENSG00000134343 ‑5.56371 0.01356 ANO3 Anoctamin 3 ENSG00000110400 ‑5.48194 0.004123 PVRL1 Poliovirus receptor‑related 1 (herpesvirus entry mediator C) ENSG00000124882 ‑5.45849 0.022164 EREG Epiregulin ENSG00000113448 ‑5.41752 0.000577 PDE4D Phosphodiesterase
    [Show full text]
  • Discovery of Genes by Phylocsf Supplemental
    Supplemental Materials for Discovery of high-confidence human protein-coding genes and exons by whole-genome PhyloCSF helps elucidate 118 GWAS loci Supplemental Methods ....................................................................................................................... 2 Supplemental annotation methods ........................................................................................................... 2 Manual annotation overview ...................................................................................................................................... 2 Summary diagram for the workflow used in this study ................................................................................. 3 Transcriptomics analysis ............................................................................................................................................. 3 Comparative annotation ............................................................................................................................................... 4 Overlap of novel annotations with transposon sequences ........................................................................... 6 Assessing the novelty of annotations ...................................................................................................................... 7 Additional considerations for the annotation of PCCRs in other species ............................................... 7 PhyloCSF and browser tracks ....................................................................................................................
    [Show full text]
  • Screening of 109 Neuropeptides on Asics Reveals No Direct Agonists
    www.nature.com/scientificreports OPEN Screening of 109 neuropeptides on ASICs reveals no direct agonists and dynorphin A, YFMRFamide and Received: 7 August 2018 Accepted: 14 November 2018 endomorphin-1 as modulators Published: xx xx xxxx Anna Vyvers, Axel Schmidt, Dominik Wiemuth & Stefan Gründer Acid-sensing ion channels (ASICs) belong to the DEG/ENaC gene family. While ASIC1a, ASIC1b and ASIC3 are activated by extracellular protons, ASIC4 and the closely related bile acid-sensitive ion channel (BASIC or ASIC5) are orphan receptors. Neuropeptides are important modulators of ASICs. Moreover, related DEG/ENaCs are directly activated by neuropeptides, rendering neuropeptides interesting ligands of ASICs. Here, we performed an unbiased screen of 109 short neuropeptides (<20 amino acids) on fve homomeric ASICs: ASIC1a, ASIC1b, ASIC3, ASIC4 and BASIC. This screen revealed no direct agonist of any ASIC but three modulators. First, dynorphin A as a modulator of ASIC1a, which increased currents of partially desensitized channels; second, YFMRFamide as a modulator of ASIC1b and ASIC3, which decreased currents of ASIC1b and slowed desensitization of ASIC1b and ASIC3; and, third, endomorphin-1 as a modulator of ASIC3, which also slowed desensitization. With the exception of YFMRFamide, which, however, is not a mammalian neuropeptide, we identifed no new modulator of ASICs. In summary, our screen confrmed some known peptide modulators of ASICs but identifed no new peptide ligands of ASICs, suggesting that most short peptides acting as ligands of ASICs are already known. Acid-sensing ion channels form a small family of proton-gated ion channels that belongs to the degenerin/epi- thelial Na+ channel (DEG/ENaC) gene family1.
    [Show full text]
  • Gonadotropin-Inhibitory Hormone Action in the Brain and Pituitary
    REVIEW ARTICLE published: 28 November 2012 doi: 10.3389/fendo.2012.00148 Gonadotropin-inhibitory hormone action in the brain and pituitary Takayoshi Ubuka,You Lee Son,YasukoTobari and KazuyoshiTsutsui* Laboratory of Integrative Brain Sciences, Department of Biology, Center for Medical Life Science, Waseda University, Tokyo, Japan Edited by: Gonadotropin-inhibitory hormone (GnIH) was first identified in the Japanese quail as a Hubert Vaudry, University of Rouen, hypothalamic neuropeptide inhibitor of gonadotropin secretion. Subsequent studies have France shown that GnIH is present in the brains of birds including songbirds, and mammals includ- Reviewed by: ing humans. The identified avian and mammalian GnIH peptides universally possess an Lance Kriegsfeld, University of California, USA LPXRFamide (X = L or Q) motif at their C-termini. Mammalian GnIH peptides are also José A. Muñoz-Cueto, University of designated as RFamide-related peptides from their structures.The receptor for GnIH is the Cadiz, Spain G protein-coupled receptor 147 (GPR147), which is thought to be coupled to Gαi protein. *Correspondence: Cell bodies of GnIH neurons are located in the paraventricular nucleus (PVN) in birds and Kazuyoshi Tsutsui, Laboratory of the dorsomedial hypothalamic area (DMH) in mammals. GnIH neurons in the PVN or DMH Integrative Brain Sciences, Department of Biology, Center for project to the median eminence to control anterior pituitary function. GPR147 is expressed Medical Life Science, Waseda in the gonadotropes and GnIH suppresses synthesis and release of gonadotropins. It was University, 2-2 Wakamatsu-cho, further shown in immortalized mouse gonadotrope cell line (LβT2 cells) that GnIH inhibits Shinjuku-ku, Tokyo 162-8480, Japan. e-mail: [email protected] gonadotropin-releasing hormone (GnRH) induced gonadotropin subunit gene transcriptions by inhibiting adenylate cyclase/cAMP/PKA-dependent ERK pathway.
    [Show full text]
  • Mouse Ccdc60 Knockout Project (CRISPR/Cas9)
    https://www.alphaknockout.com Mouse Ccdc60 Knockout Project (CRISPR/Cas9) Objective: To create a Ccdc60 knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Ccdc60 gene (NCBI Reference Sequence: NM_177759 ; Ensembl: ENSMUSG00000043913 ) is located on Mouse chromosome 5. 14 exons are identified, with the ATG start codon in exon 1 and the TAG stop codon in exon 14 (Transcript: ENSMUST00000050178). Exon 6~7 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Exon 6 starts from about 34.31% of the coding region. Exon 6~7 covers 19.02% of the coding region. The size of effective KO region: ~6090 bp. The KO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 6 7 14 Legends Exon of mouse Ccdc60 Knockout region Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section upstream of Exon 6 is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix. The gRNA site is selected outside of these tandem repeats. Overview of the Dot Plot (down) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section downstream of Exon 7 is aligned with itself to determine if there are tandem repeats.
    [Show full text]
  • DNA Methylation Alterations in Blood Cells of Toddlers with Down Syndrome
    G C A T T A C G G C A T genes Article DNA Methylation Alterations in Blood Cells of Toddlers with Down Syndrome Oxana Yu. Naumova 1,2,* , Rebecca Lipschutz 2, Sergey Yu. Rychkov 1, Olga V. Zhukova 1 and Elena L. Grigorenko 2,3,4,* 1 Vavilov Institute of General Genetics RAS, 119991 Moscow, Russia; [email protected] (S.Y.R.); [email protected] (O.V.Z.) 2 Department of Psychology, University of Houston, Houston, TX 77204, USA; [email protected] 3 Department of Psychology, Saint-Petersburg State University, 199034 Saint Petersburg, Russia 4 Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, TX 77030, USA * Correspondence: [email protected] or [email protected] (O.Y.N.); [email protected] (E.L.G.) Abstract: Recent research has provided evidence on genome-wide alterations in DNA methylation patterns due to trisomy 21, which have been detected in various tissues of individuals with Down syndrome (DS) across different developmental stages. Here, we report new data on the systematic genome-wide DNA methylation perturbations in blood cells of individuals with DS from a previously understudied age group—young children. We show that the study findings are highly consistent with those from the prior literature. In addition, utilizing relevant published data from two other developmental stages, neonatal and adult, we track a quasi-longitudinal trend in the DS-associated DNA methylation patterns as a systematic epigenomic destabilization with age. Citation: Naumova, O.Y.; Lipschutz, R.; Rychkov, S.Y.; Keywords: Down syndrome; infants and toddlers; trisomy 21; DNA methylation; Illumina 450K Zhukova, O.V.; Grigorenko, E.L.
    [Show full text]
  • An Ancient Germ Cell-Specific RNA-Binding Protein Protects
    RESEARCH ARTICLE An ancient germ cell-specific RNA-binding protein protects the germline from cryptic splice site poisoning Ingrid Ehrmann1, James H Crichton2, Matthew R Gazzara3,4, Katherine James5, Yilei Liu1,6, Sushma Nagaraja Grellscheid1,7, TomazˇCurk8, Dirk de Rooij9,10, Jannetta S Steyn11, Simon Cockell11, Ian R Adams2, Yoseph Barash3,12*, David J Elliott1* 1Institute of Genetic Medicine, Newcastle University, Newcastle, United Kingdom; 2MRC Human Genetics Unit, MRC Institute of Genetics and Molecular Medicine, University of Edinburgh, Edinburgh, United Kingdom; 3Department of Genetics, Perelman School of Medicine, University of Pennsylvania, Philadelphia, United States; 4Department of Biochemistry and Biophysics, Perelman School of Medicine, University of Pennsylvania, Philadelphia, United States; 5Life Sciences, Natural History Museum, London, United Kingdom; 6Department of Plant and Microbial Biology, University of Zu¨ rich, Zu¨ rich, Switzerland; 7School of Biological and Biomedical Sciences, University of Durham, Durham, United Kingdom; 8Laboratory of Bioinformatics, Faculty of Computer and Information Sciences, University of Ljubljana, Ljubljana, Slovenia; 9Reproductive Biology Group, Division of Developmental Biology, Department of Biology, Faculty of Science, Utrecht University, Utrecht, The Netherlands; 10Center for Reproductive Medicine, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands; 11Bioinformatics Support Unit, Faculty of Medical Sciences, Newcastle University, Newcastle, United Kingdom; 12Department of Computer and Information Science, University of Pennsylvania, Philadelphia, United States *For correspondence: [email protected] (YB); [email protected] (DJE) Competing interests: The Abstract Male germ cells of all placental mammals express an ancient nuclear RNA binding authors declare that no protein of unknown function called RBMXL2. Here we find that deletion of the retrogene encoding competing interests exist.
    [Show full text]