КАРАНТИН РАСТЕНИЙ АВГУСТ НАУКА И ПРАКТИКА 3| 13| 2015 РУССКО-АНГЛИЙСКИЙ ЖУРНАЛ

АНГЛО-РУССКИЙ СЛОВАРЬ ПО ЗАЩИТЕ И КАРАНТИНУ РАСТЕНИЙ стр. 4 КОЛЬЦЕВАЯ ГНИЛЬ КАРТОФЕЛЯ — СКРЫТАЯ УГРОЗА УРОЖАЮ стр. 6 ЧЕРЕДА ДВАЖДЫПЕРИСТАЯ BIDENS BIPINNATA L. — ВИД КАРАНТИННОГО СОРНОГО РАСТЕНИЯ ИЗ НОВОГО ПЕРЕЧНЯ КАРАНТИННЫХ ОБЪЕКТОВ, ОТСУТСТВУЮЩИЙ НА ТЕРРИТОРИИ РФ стр. 46

ENGLISH-RUSSIAN DICTIONARY AND HANDBOOK ON PLANT PROTECTION page 5 RING ROT OF POTATO IS A HIDDEN THREAT TO HARVEST page 9 SPANISH NEEDLES BIDENS BIPINNATA L. — A QUARANTINE WEED SPECIES ON THE NEW LIST OF QUARANTINE PESTS ABSENT FROM THE RUSSIAN FEDERATION page 49

RUSSIAN-ENGLISH JOURNAL PLANT HEALTH AUGUST ISSN 2306-9767 ISSN RESEARCH AND PRACTICE 3| 13| 2015 СОДЕРЖАНИЕ CONTENT

«КАРАНТИН РАСТЕНИЙ. НАУКА И ПРАКТИКА» ДВУЯЗЫЧНЫЙ НАУЧНЫЙ ЖУРНАЛ №3 (13) 2015 Г. I НОВОСТИ I NEWS Англо-русский словарь по защите и карантину растений English-Russian Dictionary and Handbook on Plant Protection 4 5 Главный редактор: Мартин Уорд — РЕДАКЦИЯ: А.Я. Сапожников, Генеральный директор ЕОКЗР II НАУЧНЫЕ ИССЛЕДОВАНИЯ II RESEARCH STUDIES IN Волкова Е.М. — заведующая директор ФГБУ «ВНИИКР» В ОБЛАСТИ КАРАНТИНА РАСТЕНИЙ PLANT QUARANTINE лабораторией сорных растений Рингольдс Арнитис — Кольцевая гниль картофеля — скрытая угроза урожаю Ring Rot of Potato is a Hidden Threat to Harvest Шеф-редактор: Президент ЕОКЗР Д.Ф. Зинников, директор Карельского филиала ФГБУ «ВНИИКР» Denis F. Zinnikov, Director of FGBU VNIIKR’s Karelian Branch Волков О.Г. — начальник Светлана Зиновьева, О.В. Синкевич, Петрозаводский государственный университет Olga V. Sinkevich, Petrozavodsk State University отдела биометода помощник директора Ханну Кукконен — директор ФГБУ «ВНИИКР» по связям подразделения фитосанитарного Кулинич О.А. — доктор 6 9 с общественностью и СМИ надзора, EVIRA (Финляндия) биологических наук, Молекулярно-генетические методы идентификации, Coccids (Coccoidea) Significance, Distribution начальник отдела лесного вредоносность и распространение кокцид (Coccoidea) and DNA-Based Identification Methods Выпускающие редакторы: Сагитов А.О. — Генеральный карантина И.О. Камаев, начальник Ilya O. Kamaev, Head of FGBU VNIIKR’s Ольга Лесных, директор ТОО «Казахский НИИ научно-экспериментального отдела ФГБУ «ВНИИКР» Research and Testing Department Юлия Мелано, защиты и карантина растений» Н.А. Гура, старший научный сотрудник Natalia A. Gura, Senior Researcher at FGBU VNIIKR’s Приходько Ю.Н. — начальник Юлиана Бададгулова научно-методического отдела энтомологии ФГБУ «ВНИИКР» Entomological Research and Methodology Department научно-методического отдела e-mail: [email protected] Сорока С.В. — директор РУП А.В. Шипулин, младший научный сотрудник Andrey V. Shipulin, Junior Researcher at FGBU VNIIKR’s фитопатологии научно-экспериментального отдела ФГБУ «ВНИИКР» Research and Testing Department «Институт защиты растений» Редакционная коллегия НАН Республики Беларусь Скрипка О.В. — заведующая журнала «Карантин растений. 12 23 лабораторией микологии Наука и практика»: Джалилов Ф.С. — доктор Динамика относительной восприимчивости Relative Susceptibility of Vitis vinifera Cultivars биологических наук, сортов Vitis vinifera к Xylella fastidiosa to Xylella fastidiosa through Time Дренова О.Н. — начальник Швабаускене Ю.А. — заместитель профессор, заведующий Араш Рашед, Отдел экологии, стратегии и управления, Arash Rashed, Department of Environmental Science, Policy, отдела по международным Руководителя Россельхознадзора лабораторией защиты растений Университет Калифорнии Беркли, Калифорния, and Management, University of California, Berkeley, связям и вопросам ВТО Соединенные Штаты Америки МСХА им. К.А. Тимирязева California, United States of America (переводчик) Джойс Кван, Отдел экологии, стратегии и управления, Joyce Kwan, Department of Environmental Science, Policy, Долженко В.И. — академик Университет Калифорнии Беркли, Калифорния, and Management, University of California, Berkeley, California, РАН, заместитель директора Абасов М.М. — доктор Маткава Л.Р. — специалист Соединенные Штаты Америки United States of America Всероссийского НИИ биологических наук, Бреанна Барафф, Отдел экологии, стратегии и управления, отдела по международным Breanna Baraff, Department of Environmental Science, Policy, защиты растений заместитель директора Университет Калифорнии Беркли, Калифорния, and Management, University of California, Berkeley, California, связям и вопросам ВТО ФГБУ «ВНИИКР» Соединенные Штаты Америки United States of America (переводчик) Надыкта В.Д. — академик РАН, Диана Линг, Отдел экологии, стратегии и управления, Diane Ling, Department of Environmental Science, Policy, Университет Калифорнии Беркли, Калифорния, директор Всероссийского НИИ Яковлева В.А. — кандидат and Management, University of California, Berkeley, Шахманова З.Э. — специалист Соединенные Штаты Америки California, United States of America биологической защиты растений биологических наук, заместитель отдела по международным Мэтью П. Доэрти, Отдел энтомологии Университета Калифорнии, Matthew P. Daugherty, Department of Entomology, University of California директора ФГБУ «ВНИИКР» связям и вопросам ВТО Риверсайд, Калифорния, Соединенные Штаты Америки Riverside, Riverside, California, United States of America Павлюшин В.А. — академик РАН, Набил Киллини, Научно-образовательный центр цитрусовых культур, (переводчик) Nabil Killiny, Citrus Research and Education Center, директор Всероссийского НИИ Шероколава Н.А. — заместитель Отдел энтомологии и нематологии, Университет Флориды, Department of Entomology and Nematology, University of Florida, IFAS, защиты растений директора ФГБУ «ВНИИКР», Флорида, Соединенные Штаты Америки Lake Alfred, Florida, United States of America Дизайн и верстка: вице-президент ЕОКЗР Родриго П.П. Алмейда, Отдел экологии, стратегии и управления, Rodrigo P.P. Almeida, Department of Environmental Science, Policy, Мария Поваляева Университет Калифорнии Беркли, Санин С.С. — академик РАН, and Management, University of California, Berkeley, California, Калифорния, Соединенные Штаты Америки United States of America доктор биологических наук, Корректор: профессор, заведующий Татьяна Артемьева отделом Всероссийского НИИ 34 40 Менеджер по подписке фитопатологии Череда дваждыперистая Bidens bipinnata L. — Spanish Needles Bidens bipinnata L. — и дистрибуции: вид карантинного сорного растения из нового Перечня a Quarantine Weed Species on the New List Игорь Алпатов карантинных объектов, отсутствующий на территории РФ of Quarantine Pests Absent from the Russian Federation +7 (925) 357 20 61 Е.М. Волкова, заведующая лабораторией сорных растений ФГБУ «ВНИИКР» Elena M. Volkova, Chief of FGBU VNIIKR’s Weed Laboratory Ю.Р. Кочнев, м.н.с. лаборатории сорных растений ФГБУ «ВНИИКР» Yury R. Kochnev, Junior Researcher at FGBU VNIIKR’s Weed Laboratory

Журнал «Карантин растений. Наука и практика» зарегистрирован в Федеральной службе по надзору в сфере связи, информационных технологий и массовых коммуникаций (Роскомнадзор), 46 49 свидетельство о регистрации ПИ № ФС77-52594 от 25 января 2013 г. Диагностика вироида веретеновидности клубней картофеля Detection and Identification of Potato Spindle Tuber Viroid Учредитель: ООО «Успех», выпускается по заказу Федерального государственного С.Б. Абросимова, м.н.с. научно-методического отдела Svetlana B. Abrosimova, Junior Researcher at FGBU VNIIKR’s бюджетного учреждения «Всероссийский центр карантина растений» (ФГБУ «ВНИИКР») фитопатологии ФГБУ «ВНИИКР» Plant Pathology Research and Methodology Department Ю.Н. Приходько, начальник научно-методического отдела Yury N. Prikhodko, Chief of FGBU VNIIKR’s Издатель: ООО «Успех» (105122, г. Москва, Щелковское шоссе, д. 13, оф. 402) фитопатологии ФГБУ «ВНИИКР» Plant Pathology Research and Methodology Department Адрес редакции: 105122, г. Москва, Щелковское шоссе, д. 13, оф. 402 Типография: ООО «Юнион Принт», 603022, Нижегородская область, г. Нижний Новгород, Окский Съезд, д. 2, тел.: 8 (831) 439-44-99 52 56 Тираж 2000 экземпляров. Бесплатно. КАРАНТИН РАСТЕНИЙ 3| 13| 2015 3 АНГЛО-РУССКИЙ ENGLISH-RUSSIAN DICTIONARY СЛОВАРЬ-СПРАВОЧНИК AND HANDBOOK ON PLANT ПО ЗАЩИТЕ И КАРАНТИНУ PROTECTION РАСТЕНИЙ

В издательстве Российского госу- звания пестицидов. Для всех оби- ветеринарному и фитосанитарному The Publishing House of the Russian economically significant plant pests, technical translators; specialists of plant дарственного аграрного универси- ходных названий вредителей, болез- надзору, Российского сельскохозяй- Timiryazev State Agrarian University diseases, weeds, agricultural crops, or- protection companies; personnel of the тета — МСХА имени К.А. Тимиря- ней растений, сорных и культурных ственного центра, а также регио- also known as Moscow Timiryazev Ag- namental and forest plants, as well as Federal Service for Veterinary and Phy- зева вышел в свет «Англо-русский растений приводятся латинские на- нальных и национальных организа- ricultural Academy (RTSAU — MTAA) common names of pesticides. Corre- tosanitary Surveillance, the Russian словарь-справочник по защите звания соответствующих таксонов, а ций по карантину и защите растений has published an English-Russian Dic- sponding Latin names of taxa are pro- Agricultural Centre as well as regional и карантину растений» (Москва, большинство специальных терминов других стран. Словарь-справочник tionary and Handbook on Plant Pro- vided for all common names of plant and national plant protection organi- 2015, 450 с.; ISBN 978-5-9675-1124-0), снабжено дефинициями или поясне- имеет гриф Учебно-методического tection (Moscow, 2015, Pp. 450; ISBN pests, diseases, weeds and cultivated zations. The Dictionary is approved by подготовленный И.М. Митюшевым, ниями на русском языке. В качестве объединения вузов Российской Фе- 978-5-9675-1124-0) compiled by Ilya. plants. Explanations in Russian are giv- the Educational and Methodological кандидатом биологических наук, до- приложений в словарь включены дерации по агрономическому обра- M. Mityushev, Candidate of Biologi- en for the majority of the field-specific Association of Institutions of Higher центом кафедры защиты растений список аббревиатур названий орга- зованию. cal Sciences, Associate Professor at the terms. The Appendices provide a list Agricultural Education of the Russian РГАУ-МСХА имени К.А. Тимиря- низаций и терминов по защите и ка- Особо следует отметить, что из- RTSAU — MTAA’s Academic Depart- of abbreviated names of plant protec- Federation. зева. Данный словарь-справочник рантину растений, а также таблицы дание данного словаря-справочника ment of Plant Protection. In the Rus- tion organizations and abbreviations of Of special note is that the publi- является первым в России опытом для взаимного перевода наиболее автор посвятил двум знаменатель- sian Federation, this Dictionary is the plant protection terms, conversion ta- cation of the Dictionary is dedicated издания наиболее полного собрания распространенных английских и ме- ным событиям: 150-летию основа- first attempt to produce a comprehen- bles of the most commonly used metric to the 150th anniversary of Moscow англоязычных терминов по защите трических мер и весов (британская ния Российского государственного sive edition of English plant protection weights and measures of the imperial Timiryazev Agricultural Academy и карантину растений и соответ- имперская и американская системы). аграрного университета — МСХА and quarantine terms and their Russian and American systems. (RTSAU — MTAA) and the 95th anni- ствующей терминологии на русском Словарь-справочник предназна- имени К.А. Тимирязева и 95-летнему equivalents. The Dictionary is meant for a wide versary of its Academic Department языке. чен для широкого круга пользовате- юбилею кафедры защиты растений The Dictionary comprises over audience: undergraduate and postgrad- of Plant Protection which is the oldest Словарь-справочник состоит лей: студентов и аспирантов, обуча- РГАУ-МСХА, которая является ста- 10 000 entries of words and word com- uate students of agriculture and biology; plant protection academic department из более чем 10 тысяч словарных ющихся по сельскохозяйственным рейшей кафедрой данного профиля binations used in major fields of plant college professors of English, agriculture in the Russian Federation. These two статей, которые включают в себя и биологическим направлениям в России; оба события будут широко protection and quarantine, common and biology; specialists of laboratories events will see-grand scale celebrations английские термины и терминоло- подготовки, преподавателей англий- отмечаться в декабре 2015 г. names of the most wide-spread and and research institutions; linguists and in December 2015. гические сочетания по важнейшим ского языка и специальных сель- разделам защиты и карантина расте- скохозяйственных и биологических ний, обиходные названия наиболее дисциплин в вузах, сотрудников ла- распространенных и важных в эко- бораторий и научно-исследователь- номическом отношении вредителей, ских институтов, ученых-лингвистов болезней растений, сорняков, сель- и научно-технических переводчиков, скохозяйственных культур, декора- специалистов компаний-производи- тивных и лесных растений, а также телей средств защиты растений, со- общепринятые международные на- трудников Федеральной службы по

4 3| 13| 2015 КАРАНТИН РАСТЕНИЙ КАРАНТИН РАСТЕНИЙ 3| 13| 2015 5 В 2012–2013 гг. в обследование была Для подтверждения результатов большее число зараженных образцов включена территория Архангель- также применялся иммунофлуорес- обнаружено в партиях из Сортаваль- КОЛЬЦЕВАЯ ГНИЛЬ ской области. Сроки отбора образ- центный анализ. ского и Олонецкого районов, распо- цов и проведения анализа — с тре- Проведенные исследования не ложенных в южной части Карелии. тьей декады июля до конца августа. выявили возбудителя бурой бак- Патоген не был выявлен в образцах КАРТОФЕЛЯ — СКРЫТАЯ Для анализа использовались клубни териальной гнили на территории из Сегежского и Пудожского райо- и основание стеблей растения. Карелии и Архангельской области, нов (относящихся к северной части Выявление и идентификация однако было обнаружено присут- региона). УГРОЗА УРОЖАЮ Ralstonia solanacearum и Clavibacter ствие возбудителя кольцевой гнили Обследование территории Архан- michiganensis subsp. sepedonicus в об- картофеля. Этот патоген является гельской области показало наличие Д.Ф. Зинников, директор Карельского филиала ФГБУ «ВНИИКР» разцах клубней картофеля проводи- карантинным для территории Респу- возбудителя Clavibacter michiganensis О.В. Синкевич, Петрозаводский государственный университет лись согласно стандарту организа- блики Беларусь и включен в список subsp. sepedonicus во всех обследу- ции «СТО ВНИИКР 4.009−2013 Воз- А2 ЕОКЗР (СТО ВНИИКР, 2013). емых районах. Из 81 проанализи- будитель бурой бактериальной гни- В 2011 г. обследование проводили рованного образца в 2012 г. воз- ли картофеля Ralstonia solanacearum в четырех районах республики. Воз- будитель был обнаружен в 48, что (Smith) Yabuuchi et al. Методы выяв- будитель кольцевой гнили картофе- составило 59,2%, в 2013 г. — из 105 ления и идентификации» (2013). ля был обнаружен в 20,6% образцов, образцов в 46, что составило 43,8%. Для выявления возбудителей отобранных в Олонецком районе. Распределение образцов в пределах бактериальных гнилей картофеля Включение в обследование владель- Архангельской области было неод- в лаборатории Карельского филиала цев частных картофельных участков нородным, наиболее часто (более 35% случаев) патоген встречался Ценность и популярность кар- Массовое распространение и раз- лено погодными условиями, а также Способность длительно бессимптомно находиться в образцах из Шенкурского, Котлас- тофеля давно неоспоримы, однако витие болезней картофеля в посадках частичной устойчивостью сортов в клубнях и стеблях картофеля делает кольцевую гниль ского, Верхнетоемского, Вельского, в Карелии сельскохозяйственные сельхозпроизводителей вызвано на- и низкой вирулентностью некоторых опасным заболеванием, способным привести к потерям Плесецкого, Приморского и Карго- предприятия практически отказа- рушением агротехники (картофель линий патогена. Перевозка и высад- урожая до 45% (Евстратова, 2006; Лазарев, Борисова, 2010) польского районов. лись от возделывания этой культу- возделывается в монокультуре, для ка клубней со скрытым заражением Следует учесть, что при визуаль- ры, 96% произведенного картофеля посадки используется собственный являются одной из причин распро- как при производстве, так и во время хранения. ном осмотре клубней картофеля, ис- в республике приходится на долю посадочный материал, в том чис- странения заболевания. пользуемых для проведения анализа, личных подсобных и крестьянских ле продовольственный картофель). В 2011–2013 гг. проведено обсле- ФГБУ «ВНИИКР» использовался мо- 2012–2013 гг. показало значительное не было выявлено симптоматики за- (фермерских) хозяйств (Карелия, Часто зараженность клубней карто- дование посадок картофеля на тер- лекулярно-генетический метод ана- распространение заболевания на болевания, что означает присутствие 2012). феля бывает скрытой, что обуслов- ритории Республики Карелия на на- лиза — FLASH-ПЦР (см. рисунок). территории республики. При этом патогена в скрытой (латентной) фор- личие возбудителей бурой (Ralstonia ме. solanacearum (Smith) Yabuuchi et al.) Способность длительно бессим- Протокол результатов анализа и кольцевой (Clavibacter michiganensis птомно находиться в клубнях и сте- 10 проб картофеля методом FLASH-ПЦР Таблица 1 subsp. sepedonicus (Spieckermann and блях картофеля делает кольцевую Примечание: «К+» и «К-» — контрольные образцы. Результаты анализа образцов картофеля Kotthoff) Smith)) гнилей картофеля. гниль опасным заболеванием, спо- Результат «+» — наличие в образце на наличие возбудителя Clavibacter michiganensis subsp. sepedonicus Clavibacter michiganensis subsp. sepedonicus. в Республике Карелия, 2011–2013 гг. Результат «-» — отсутствие патогена в образце. Доля образцов, зараженных Обследованная площадь, Количество образцов, Районы возбудителем га шт. Республики C. michiganensis subsp. sepedonicus, % Карелия 2011 г. 2012 г. 2013 г. 2011 г. 2012 г. 2013 г. 2011 г. 2012 г. 2013 г. Олонецкий 247,8 131 41 131 62 83 20,6 72,5 25,3 Прионежский 27,1 48 13,4 13 17 33 0 64,7 30,3 Медвежьегорский 40,2 10,2 54 53 17 20 0 23,5 90,0 Кондопожский 0,16 - 0,13 3 - 5 0 - 20,0 Пудожский - 0,08 - - 3 - - 0 - Суоярвский - 1 0,16 - 1 5 - 0 20,0 г. Костомукша - 1,1 - - 19 - - 10,5 - Сортавальский - - 86,9 - - 30 - - 26,6 Сегежский - - 0,34 - - 12 - - 0 Пряжинский - - 0,32 - - 17 - - 41,1 Итого: 315,3 191,5 196 200 119 205 13,5 52,1 32,1

6 3| 13| 2015 КАРАНТИН РАСТЕНИЙ КАРАНТИН РАСТЕНИЙ 3| 13| 2015 7 собным привести к потерям урожая массового развития бактериальной 3. Лазарев А.М., Борисова Т.П. до 45% (Евстратова, 2006; Лазарев, кольцевой гнили. Бактериальные болезни картофеля: Борисова, 2010) как при производ- профилактики и меры борьбы / А.М. RING ROT OF POTATO стве, так и во время хранения. Литература Лазарев // Сельскохозяйственные ве- Учитывая изменения в перечне 1. Евстратова Л.П. Атлас болезней сти. С.-Петербург, 2010. № 4. С. 48–50. карантинных объектов и внесение и вредителей картофеля: учеб. посо- 4. Методические указания по IS A HIDDEN THREAT возбудителя кольцевой гнили кар- бие / Л.П. Евстратова, Е.В. Николае- локализации и ликвидации бакте- тофеля в III список регулируемых ва, В.Н. Пермякова — Петрозаводск: риальной кольцевой гнили карто- некарантинных вредных организмов Изд-во ПетрГУ, 2006. 214 с. феля Clavibacter michiganensis subsp. TO HARVEST на территории РФ (Приказ, 2014), 2. Карелия официальная. Офи- sepedonicus / В.И. Калач и др. РУП необходимо информировать насе- циальный портал органов государ- Научно-практический центр НАН Denis F. Zinnikov, Director of FGBU VNIIKR’s Karelian Branch ление о наличии данного патогена ственной власти Республики Карелия Белоруссии по картофелеводству Olga V. Sinkevich, Petrozavodsk State University на территории Республики Карелия [Электронный ресурс] / Министер- и плодоовощеводству. — Самохва- и Архангельской области, знакомить ство сельского, рыбного и охотни- ловичи, 2010. 12 с. производителей картофеля с сим- чьего хозяйства Республики Карелия. 5. Приказ Министерства сельско- птоматикой данного заболевания, а Отчет Министерства сельского, рыб- го хозяйства РФ от 15 декабря 2014 также вести пропаганду недопусти- ного и охотничьего хозяйства Респу- г. № 501 «Об утверждении перечня мости распространения картофеля блики Карелия за 2012 год. http://www. карантинных объектов». в другие регионы, более благопри- gov.karelia.ru/gov/Power/Ministry/ 6. СТО ВНИИКР 4.009−2013 ятные по погодным условиям для Agriculture/Docs/otchet_2012.pdf. Возбудитель бурой бактериаль- ной гнили картофеля Ralstonia solanacearum (Smith) Yabuuchi et Таблица 2 al. Методы выявления и иденти- Результаты анализа образцов картофеля на наличие возбудителя фикации. М., ФГБУ «ВНИИКР», Clavibacter michiganensis subsp. sepedonicus 2013. в Архангельской области, 2012–2013 гг.

Доля образцов, зараженных Районы Обследованная площадь, га Количество образцов, шт. возбудителем C. michiganensis Архангельской subsp. sepedonicus, % области 2012 г. 2013 г. 2012 г. 2013 г. 2012 г. 2013 г. Шенкурский 40 15 19 3 63,1 100 Котласский 33 44,8 17 17 94,1 35,2 Устьянский 5,2 1,3 3 20 33,3 15,0 Холмогорский 53 37,1 16 7 31,2 42,8 Верхнетоемский 13,69 12,65 8 8 62,5 50,0 Плесецкий 14,2 - 12 - 50,0 - Вельский 20,3 88,56 6 17 50,0 82,3 Приморский - 8 - 3 - 66,6 Test report for 10 potato samples analyzed using FLASH-PCR Каргопольский - 26,77 - 17 - 41,1 Note: «К+» and «К-» – control samples. Result «+» – presence of Clavibacter michiganensis subsp. Няндомский - 1,1 - 13 - 30,7 The value and popularity of the sepedonicus in the sample. Result «-» – absence of the pathogen in the sample. Итого: 179,39 235 81 105 59,2 43,8 potato has long been unquestionable. However, Karelian large agricultur- al producers have virtually refused to conditions and partial resistance of cul- thoff) Smith)) rots of potato. In 2012- grow this crop; 96% of potatoes are tivars and low virulence of some path- 2013, Arkhangelsk region was also harvested at smallholdings and private- ogen lines. The disease spreads due to surveyed. Samples were taken and tests ly owned farms (Karelia, 2012). transportation and planting of latently performed from late July till the end of Mass distribution and development infected tubers, among other things. August. Tubers and plant basal stems of potato diseases is caused by poor ag- In 2011–2013, potato crops plant- were taken for analyses. ricultural practices (potatoes are culti- ed in the Republic of Karelia were Detection and identification of Ral- vated in monoculture, farm-saved seeds surveyed for brown (Ralstonia solan- stonia solanacearum and Clavibacter including ware potatoes are used for acearum (Smith) Yabuuchi et al.) and michiganensis subsp. sepedonicus in planting). Tubers are frequently latent- ring (Clavibacter michiganensis subsp. potato tubers was conducted in accord- ly infected which is caused by weather sepedonicus (Spieckermann and Kot- ance with VNIIKR Technical Standard

8 3| 13| 2015 КАРАНТИН РАСТЕНИЙ КАРАНТИН РАСТЕНИЙ 3| 13| 2015 9 Table 1 Table 2 Results of testing potato samples for Results of testing potato samples for Clavibacter michiganensis subsp. sepedonicus Clavibacter michiganensis subsp. sepedonicus in the Republic of Karelia in 2011–2013 in Arkhangelsk region in 2012–2013

Proportion of samples infected with Proportion of samples infected Regions in the Surveyed area, ha Number of samples C. michiganensis subsp. sepedonicus, % Districts in Surveyed area, ha Number of samples with C. michiganensis subsp. Republic of sepedonicus, % Karelia Arkhangelsk region 2011 2012 2013 2011 2012 2013 2011 2012 2013 2012 2013 2012 2013 2012 2013 Olonets 247.8 131 41 131 62 83 20.6 72.5 25.3 Shenkursk 40 15 19 3 63.1 100 Prionezhsky 27.1 48 13.4 13 17 33 0 64.7 30.3 Kotlas 33 44.8 17 17 94.1 35.2 Medvezhgorye 40.2 10.2 54 53 17 20 0 23.5 90.0 Ustyansky 5.2 1.3 3 20 33.3 15.0 Kondopoga 0.16 - 0.13 3 - 5 0 - 20.0 Kholmogory 53 37.1 16 7 31.2 42.8 Pudozh - 0.08 - - 3 - - 0 - Verkhnya Toima 13.69 12.65 8 8 62.5 50.0 Suoyarvi - 1 0.16 - 1 5 - 0 20.0 Plesetsk 14.2 - 12 - 50.0 - Town of - 1.1 - - 19 - - 10.5 - Velsk 20.3 88.56 6 17 50.0 82.3 Kostomuksha Primorsky - 8 - 3 - 66.6 Sortavala - - 86.9 - - 30 - - 26.6 Kargopol - 26.77 - 17 - 41.1 Segezha - - 0.34 - - 12 - - 0 Nuandoma - 1.1 - 13 - 30.7 Pryazha - - 0.32 - - 17 - - 41.1 Total: 179.39 235 81 105 59.2 43.8 Total: 315.3 191.5 196 200 119 205 13.5 52.1 32.1

4.009−2013 “Brown Rot of Potato Ral- plots were included into the survey Plesetsk, Primorsky and Kargopol dis- References 4. Guidelines for Containment stonia solanacearum (Smith) Yabuuchi which enabled to record the consid- tricts. 1. Evstratova L.P. Atlas of Potato and Eradication of Bacterial Ring Rot et al. Detection and Identification erable spread of the disease in Karelia. It should be taken into account that Diseases and Pests: Study Guide / L.P. Clavibacter michiganensis subsp. sepe- Methods” (2013). The largest amount of infected samples when potato tubers were visually ex- Evstratova, E.V. Nikolaeva, V.N. Per- donicus / V.I. Kalach et al. Research and For detecting pathogens of bacte- was detected in potato lots from Sor- amined, no disease symptoms were ob- myakova —Petrozavodsk: PetrGU Pub- Practical Center for Potato, Fruit and rial rots at the Laboratory of FGBU tavala snd Olonets regions situated served, i.e. the pathogen was present in lishing House, 2006. 214 pp. Vegetable Farming of the Academy of VNIIKR’s Karelian Branch, FLASH- in the southern part of Karelia. The a latent stage. 2. The 2012 Report of the Kareli- Sciences of the Republic of Belarus. – The ability to be present in symp- an Ministry of Agriculture, Fisheries Samokhvalovichi, 2010. 12 pp. The ability to be present in symptomless potato tubers and tomless potato tubers and stems makes and Wildlife. The official web-site of 5. Order № 501 of the Ministry of stems makes ring rot a hazardous disease that can lead to yield ring rot a hazardous disease that can the Ministry: http://www.gov.karelia. Agriculture of the Russian Federation drops by 45% (Evstratova, 2006; Lazarev, Borisova, 2010) lead to yield drops by 45% (Evstrato- ru/gov/Power/Ministry/Agriculture/ dated 15 December 2014 “On Approval va, 2006; Lazarev, Borisova, 2010) both Docs/otchet_2012.pdf. of the List of Pests”. both during production and storage. during production and storage. 3. Lazarev A.M., Borisova T.P. Bac- 6. VNIIKR Technical Standard Taking into consideration chang- terial disease of potato: preventive and 4.009−2013 “Brown Rot of Potato Ral- PCR was used (see the Figure). For pathogen was not detected in samples es introduced into the List of quaran- control measures / A.M. Lazarev // stonia solanacearum (Smith) Yabuuchi confirming the results, immunofluo- from Segezha and Pudozh regions (the tine pests and addition of Clavibacter Agricultural News. Saint-Petersburg, et al. Detection and Identification rescence staining was performed. northern part of Karelia). michiganensis subsp. sepedonicus into 2010. № 4. P. 48–50. Methods. M., FGBU VNIIKR, 2013. During the surveys, brown rot of The survey of Arkhangelsk region the Russian list of regulated non-quar- potato was not found in Karelia and showed the presence of Clavibacter antine pests (Order, 2014), the public Arkhangelsk region. However, the ring michiganensis subsp. sepedonicus in all should be informed on the occurrence rot pathogen was reported. This bac- surveyed districts. Out of 81 samples of this pathogen in the Republic of Ka- terium is quarantine for the Republic tested in 2012, the pathogen was found relia and Arkhangelsk region, and po- of Belarus and on the EPPO A2 List in 48 samples which amounted to tato producers should become familiar of pests (VNIIKR Technical Standard, 59.2%. In 2013, out of 105 samples 46 with the symptoms of this disease. The 2013). were tested positive which amounted to information campaign should be start- In 2011, the survey was performed 43.8%. The pathogen was unevenly de- ed explaining the unacceptability of in four regions of the Republic. Ring tected throughout Arkhangelsk region. moving potatoes to other regions with rot of potato was detected in 20.6% Most frequently (over 35% of cases) weather conditions more favorable for of samples from Olonets region. In it was found in samples from Shen- the massive development of bacterial 2012-2013, privately owned potato kursk, Kotlas, Verkhnya Toima, Velsk, ring rot.

10 3| 13| 2015 КАРАНТИН РАСТЕНИЙ КАРАНТИН РАСТЕНИЙ 3| 13| 2015 11 Таблица 1 МОЛЕКУЛЯРНО- Краткая характеристика исследуемого материала Информация о материале № Вид ГЕНЕТИЧЕСКИЕ МЕТОДЫ (место и время сбора, объект, сборщик) образца Семейство Diaspididae ИДЕНТИФИКАЦИИ, Подсемейство Aspidiotinae персик, Грузия, июнь 2014 г., вредоносность и распространение кокцид SK02 Матяшова Г.Н. (Coccoidea) Калифорнийская щитовка Quadraspidiotus perniciosus яблоко, 2013 г., Гура Н.А. SK09 Comstock, 1881 яблоко, Белгородская обл., сентябрь 2014 г., И.О. Камаев, начальник научно-экспериментального отдела ФГБУ «ВНИИКР» SK12, 13, 19 Коваленко Я.Н. Н.А. Гура, старший научный сотрудник Красная померанцевая щитовка мандарин, Пакистан, февраль 2014 г., научно-методического отдела энтомологии ФГБУ «ВНИИКР» SP02 Aonidiella aurantii (Maskell, 1879) Камаев И.О. А.В. Шипулин, младший научный сотрудник Желтая померанцевая щитовка авокадо, продуктовый рынок, Москва, ноябрь 2014 г., научно-экспериментального отдела ФГБУ «ВНИИКР» SPC01, 02 Aonidiella citrina (Craw, 1980) Камаев И.О.

Олеандровая щитовка культура ФГБУ «ВНИИКР», июль 2014 г., Гура Н.А. SM00, 01 Aspidiotus nerii Bouche, 1833

Цитрусовая фиолетовая щитовка апельсин, экспертиза, май 2014 г., Буш М.Г. SO02 Parlatoria pergandii Comstock, 1881 Кокциды, или червецы и щитовки насекомые могут быть выявлены. Подсемейство Diaspidinae (Coccoidea), насчитывающие около Все это ограничивает применение 7 800 видов из 49 семейств (ScaleNet), диагностики червецов и щитовок на Тутовая щитовка киви, экспертиза, май 2014 г., относятся к группе сосущих насеко- стадии личинок разного возраста. Pseudaulacaspis pentagona ST07, 148, 151 Буш М.Г. мых, питающихся соками растений. Необходимость разработки точ- (Targioni Tozzetti, 1886) Среди представителей Coccoidea ных методов идентификации кокцид Ивовая щитовка черника, территория ФГБУ «ВНИИКР», окр. Быково, встречаются вредители важнейших становится еще более актуальной SS00,04 сельскохозяйственных культур, не- в связи с расширением списка каран- Chionaspis salicis (Linnaeus, 1758) Московская область, июль 2014 г., Гура Н.А. которые из которых, как например тинных вредных организмов для тер- Яблоневая запятовидная щитовка тутовая (Pseudaulacaspis pentagona) ритории России и стран Таможенно- яблоня, август 2014 г., Гура Н.А. SZ04 и калифорнийская (Quadraspidiotus го союза. Решение данной проблемы Lepidosaphes ulmi (Linnaeus, 1758) perniciosus) щитовки, имеют каран- возможно с помощью применения декоративное растение, экспертиза, тинное значение для многих стран молекулярно-генетических методов. SN01 Бересклетовая щитовка июнь 2014 г., Ершова Н.И. (рис. 1 и 2). В настоящее время активно разви- Unaspis euonymi (Comstock, 1881) Перед специалистами в области ваются филогенетические исследова- коллекция, сборы 2013 г., Гура Н.А. LB01, 02 карантина и защиты растений стоит ния щитовок и червецов на базе мо- Семейство Coccidae важная задача по своевременному лекулярно-генетических признаков, Fig. 1. San Jose Scale Quadraspidiotus perniciosus выявлению вредоносных видов кок- в их основу положены последова- Ложнощитовка мягкая (photo by N.A. Gura) культура ФГБУ «ВНИИКР», июль 2014 г., Гура Н.А. SLM03 цид, что, в свою очередь, требует их тельности фрагментов митохондри- Соссus hesperidum Linnaeus, 1758 точной идентификации. Последняя ального и ядерного генома (Morse & Рис. 1. Калифорнийская щитовка основана на морфологических при- Normark, 2006; Andersen et al., 2010; Восковая ложнощитовка лавр, окр. пос. Никита, Крым, август 2014 г., Quadraspidiotus perniciosus SLV01 знаках червецов и щитовок, которые, Sethusa et al., 2014 и др.). Кроме того, (фото Н.А. Гура) Ceroplastes sp. Камаев И.О. однако, могут быть определены лишь проведены исследования в области на стадии имаго самок. Самцы ко- цитогенетики и кариосистемати- идентификацию любых жизненных Семейство Pseudococcidae роткоживущие, в значительной мере ки кокцид Палеарктики (Гаврилов, стадий организма. Ранее уже при- Червец цитрусовый культура ФГБУ «ВНИИКР», июль 2014 г., хуже изучены и легко повреждаются 2005). Преимущество молекуляр- SCC01 водился пример возможной молеку- Planococcus citri Risso, 1813 Гура Н.А. на липком клеевом слое феромонных но-генетического подхода заключает- лярно-генетической идентификации ловушек, с помощью которых эти ся в том, что он позволяет проводить трех видов червецов по двум участ- Щетинистый червец кам генома (Копина и др., 2013). Pseudococcus longispinus культура ФГБУ «ВНИИКР», июль 2014 г., Гура Н.А. SCS01 Необходимость разработки точных методов Данная работа посвящена молеку- (Targioni Tozzetti, 1867) идентификации кокцид становится еще более лярно-генетическому исследованию Семейство Margarodidae актуальной в связи с расширением списка и обзору данных по вредоносности, распространению 14 таксонов ви- Prunus sp., Карши, Узбекистан, 2014 г., карантинных вредных организмов для территории Гигантские червецы Margarodidae SCN01 дового уровня червецов и щитовок, Коваленко Я.Н. России и стран Таможенного союза относящихся к 4 семействам.

12 3| 13| 2015 КАРАНТИН РАСТЕНИЙ КАРАНТИН РАСТЕНИЙ 3| 13| 2015 13 Исследуемый материал Таблица 2 Материалом для настоящей ра- Исследуемые фрагменты генома и праймерные системы боты послужили образцы, отобран- Участок Размер продукта, ные для экспертизы, сборы авто- Праймеры Последовательность праймера (5’-3’) Источник ров и коллег — специалистов ФГБУ гена п.о. «ВНИИКР», а также коллекционные EF1a GATGCTCCGGGACAYAGA Morse & Normark, образцы и особи из культуры чер- EF1α ~1150 2006 вецов ФГБУ «ВНИИКР» (табл. 1). EF2 ATGTGAGCGGTGTGGCAATCCAA Идентификацию подавляющего s3660 GAGAGTTMAASAGTACGTGAAAC Morse & Normark, большинства видов червецов и щи- 28s ~800 Fig. 2. A kiwi fruit damaged 28b TCGGAAGGAACCAGCTACTA 2006 товок выполнила старший научный by the white peach scale сотрудник научно-методического от- Pseudaulacaspis pentagona 2660 CTGGTTGATCCTGCCAGTAG 18s ~700 Sethusa et al., 2014 дела энтомологии Н.А. Гура. (photo by N.A. Gura) 18s-B CCGCGGCTGCTGGCACCAGA

Вредоносность Рис. 2. Плод киви, пораженный и распространение исследуемых тутовой щитовкой видов Coccoidea Pseudaulacaspis pentagona которым и наносит основной вред. собствует уменьшению их роста, кой вредоносностью, повреждая рас- территории Евразии, включая Рос- Данный раздел базируется на све- (фото Н.А. Гура) На территории России красная по- вызывает опадение листьев, дефор- тения из примерно 270 родов, отно- сию (Данциг, 1993; Miller, Davidson, дениях, представленных в работах меранцевая щитовка отсутствует, т.к. мацию плодов и снижение содер- сящихся к 90 семействам (ScaleNet). 2005). Н.С. Борхсениуса (1966), Е.М. Данциг ну и защите растений, Европейской не акклиматизируется в Закавказье жания масел у оливковых деревьев. Предпочитаемыми кормовыми куль- Яблоневая запятовидная щитовка (1993), D. Miller & J. Davidson (2005), и Средиземноморской организации (Данциг, 1993). При поражении плодов лимона об- турами являются шелковица, смо- (Lepidosaphes ulmi, рис. 9) наносит базах данных ScaleNet (http://www. по карантину и защите растений, Желтая померанцевая щитовка разуются зеленые пятна. В оранже- родина, ежевика, малина, виноград, серьезный вред яблоне в зонах пло- sel.barc.usda.gov/scalenet/scalenet. Тихоокеанской организации по за- (Aonidiella citrina, рис. 4) поражает рейных условиях развивается в трех персики, абрикосы, слива, сирень, доводства России. Этот вид также htm), ЕОКЗР — PQR (https://www. щите растений, в Африке, Израиле, растения 28 родов из 27 семейств поколениях. Космополит, отмечена олеандр, ясень, актинидия и др. Кос- повреждает грушу, сливу, персик, eppo.int/DATABASES/pqr/pqr.htm) Иордании, Казахстане, Узбекистане (ScaleNet). Наносит серьезный вред на Черноморском побережье России мополит. Имеет статус карантинного абрикос, смородину, шелковицу, из и CABI (http://www.cabi.org). и др. (по данным PQR). На террито- цитрусовым, вызывая засыхание (Данциг, 1993). объекта для Российской Федерации, декоративных и лесных — ясень, рии России щитовка отмечена на юге и опадение листьев и плодов. Кос- Цитрусовая фиолетовая щитовка Республики Беларусь, Казахстана, клен, березу, дуб, боярышник, си- Семейство Diaspididae Дальнего Востока, включая о-в Саха- мополит. Вид отмечен в регионе (Parlatoria pergandii, рис. 6) повреж- Турции, Чили (по данным PQR). рень, розу. Яблоневая запятовидная Подсемейство Aspidiotinae лин, Курильские о-ва, в Иркутской Черноморского побережья Грузии, дает около 60 родов растений из 36 Щитовка завезена на Черноморское щитовка отмечена на более чем 200 Калифорнийская щитовка обл. и Бурятии, на юге европейской оранжереях Армении и Украины семейств (ScaleNet), основной вред побережье Грузии, достоверных ука- родах растений-хозяев из 73 се- (Quadraspidiotus perniciosus)1 пора- части и Северном Кавказе (Данциг, (Данциг, 1993). наносит цитрусовым и субтропиче- заний о находках вида на территории мейств (ScaleNet). Снижает вегета- жает более 270 видов растений из 75 1993; ScaleNet). Олеандровая, или плющевая щи- ским культурам: лавру благородно- России нет (Данциг, 1993). цию, приводит к опадению листьев, родов, относящихся к 45 семействам Красная померанцевая щитовка товка (Aspidiotus nerii, рис. 5) — по- му, чайному кусту, камелии и др. Вид Ивовая щитовка (Chionaspis salicis, усыханию ветвей и целых деревьев. (ScaleNet). Предпочитает представи- (Aonidiella aurantii, рис. 3) — поли- лифаг, отмеченный на растениях преимущественно распространен рис. 8) — полифаг, отмеченный на Вид имеет космополитическое рас- телей семейства розоцветные. У пло- фаг, отмеченный на представителях более чем 500 родов из 124 семейств в странах со средиземноморским ти- растениях 72 родов из 26 семейств, пространение (Данциг, 1993). довых деревьев данный вид вызывает 260 родов из 88 семейств растений (ScaleNet), среди которых олеандр, пом климата Евразии, в России от- в основном деревьях и кустарниках Бересклетовая щитовка (Unaspis растрескивание и отмирание коры, (ScaleNet). Ареал красной померан- пальмы, орхидеи, виноград, ци- мечен на Черноморском побережье (ScaleNet). Основным кормовым euonymi, рис. 10) — полифаг, отме- преждевременное опадание листьев, цевой щитовки охватывает почти трусовые, персик, груша, сандало- Краснодарского края (Данциг, 1993). растением является ива. Из ягодных ченный на растениях из 25 родов уменьшение прироста, искривление всю зону выращивания цитрусовых, вое и оливковое деревья (Miller, Подсемейство Diaspidinae культур серьезно вредит смородине, из 20 семейств (ScaleNet). Наиболее и засыхание побегов, измельчание Davidson, 2005). Высасывая из кор- Тутовая щитовка (Pseudaulacaspis чернике, голубике, из декоратив- серьезные повреждения наносит и деформацию плодов. На плодах Рис. 3. Красная померанцевая мовых культур клеточный сок, спо- pentagona, рис. 2, 7) отличается высо- ных — клену, сирени, розе, рябине, бересклету, широко используемому и молодых побегах в местах прикре- щитовка Aonidiella aurantii жасмину и др. Побеги покрываются в декоративном садоводстве. Вредо- пления калифорнийской щитовки (фото Н.А. Гура) сплошным слоем щитков вредителя, носность щитовки проявляется в об- появляются характерные красные Таблица 3 что приводит к усыханию растений разовании сначала светло-желтых (антоциановые) пятна (рис. 1). Вид Fig. 3. Red scale Aonidiella aurantii Температурно-временные условия и резкому снижению урожая. Отме- пятен на листьях, затем происходит является космополитическим, име- (photo by N.A. Gura) для проведения ПЦР чена в Северной Америке, Северной полное обесцвечивание листовых ет статус карантинного организма с исследуемыми праймерными Африке, широко распространена на пластин, наблюдается усыхание по- в России и странах Азиатской и Ти- системами хоокеанского комиссии по каранти- EF1a/EF2 s3660/28b 2660/18s-B 1 Количество Следует отметить, что по общеприня- Этап Температура, Температура, Температура, тому мнению виды рода Quadraspidiotus Время Время Время циклов MacGillivray, 1921 рассматриваются в составе °С °С °С рода Diaspidiotus Berlese, 1896 из-за отсут- Преденатурация 95 10 мин 95 10 мин 95 5 мин 1 ствия четкого понимания границ данных таксонов и их объема (Данциг, 1993; Miller, Денатурация 95 30 с 95 30 с 95 30 с Davidson, 2005); в последнее время калифор- нийская щитовка также рассматривается Отжиг праймеров* 61 30 с 54 30 с 61 1 мин 35 как вид самостоятельного рода Comstockaspis Элонгация 72 2 мин 72 2 мин 72 2 мин MacGillivray, 1921 (ScaleNet). В настоящей работе используется устоявшееся в оте- Финальная 72 2 мин 72 2 мин - - 1 чественной практике карантина растений элонгация латинское название калифорнийской щитов- ки — Quadraspidiotus perniciosus. Примечание: * — температуру отжига праймеров определяли эмпирически.

14 3| 13| 2015 КАРАНТИН РАСТЕНИЙ КАРАНТИН РАСТЕНИЙ 3| 13| 2015 15 бегов и ветвей, сильное угнетение Таблица 4 и гибель растений. На листьях до Сравнение последовательностей EF1α исследуемых видов Coccoidea с базой данных NCBI 90% преобладают самцы, на ветках № Идентификация по и стволах, наоборот, основную часть Исследуемый вид Идентичность, % Покрытие, % колонии составляют самки. Космо- образца BLAST NCBI полит, происхождение — Юго-Вос- Семейство Diaspididae точная Азия (Miller, Davidson, 2005). Вид завезен в Крым и на Черномор- Подсемейство Aspidiotinae ское побережье Краснодарского края SK02 90 100 (Данциг, 1993). SK09 91 97 Семейство Coccidae Quadraspidiotus perniciosus SK12 Diaspidiotus sp. 90 100 Ложнощитовка мягкая (Coccus SK13 91 100 hesperidum, рис. 11). Широкий поли- фаг, питающийся на представителях SK19 90 98 свыше 500 родов растений из более Aonidiella aurantii SP02 Aonidiella aurantii 98 98 чем 130 семейств (ScaleNet), предпо- SPC01 читающий тропические и субтропи- Aonidiella citrina Aonidiella citrina 98 100 ческие культуры закрытого грунта, SPC02 комнатные растения. Предпочитает SM00 100 100 заселять верхнюю сторону листьев, Fig. 4. Yellow scale Aonidiella citrina Aspidiotus nerii Aspidiotus nerii располагаясь вдоль жилок. Мягкая (photo by J.-F. Germain, https://gd.eppo.int/taxon/AONDCI/photos) SM01 99 97 ложнощитовка обильно выделяет Parlatoria pergandii SO02 Parlatoria pergandii 100 87 медвяную росу, способствуя разви- Рис. 4. Желтая померанцевая щитовка тию сажистого грибка, что снижает Aonidiella citrina (фото J.-F. Germain, Подсемейство Diaspidinae декоративную ценность растений. https://gd.eppo.int/taxon/AONDCI/photos) говники. В результате повреждений, ST07 99 94 В открытом грунте вид распростра- наносимых червецом, листья стано- Pseudaulacaspis Pseudaulacaspis pentagona ST148 100 100 нен в регионах со средиземномор- вид, выявленный на территории Ев- вятся бурыми, засыхают и опадают. pentagona ским типом климата. Космополит. ропы, Турции, Кавказа, Китая, Кореи Космополит (http://www.cabi.org), ST151 100 100 Японская восковая ложнощи- и Японии (ScaleNet). в открытом грунте в основном рас- Chionaspis salicis SS04 Chionaspis salicis 99 99 товка (Ceroplastes japonicus, рис. 12) пространен в тропических и субтро- является полифагом, трофический Семейство Pseudococcidae пических районах. Lepidosaphes ulmi SZ04 Lepidosaphes ulmi 100 89 спектр которого представлен более Цитрусовый, или виноградный Unaspis euonymi SN01 Unaspis euonymi 99 86 100 видами растений, относящих- мучнистый червец (Planococcus citri, Молекулярно-генетические ся к 26 семействам (Борхсениус, рис. 13) — полифаг, отмеченный на методы исследования Семейство Pseudococcidae 1966; ScaleNet). Из субтропических 242 родах растений из 89 семейств Материал отбирали с помощью Planococcus citri SCC01 Planococcus citri 100 100 обработанных 96% этанолом энто- Pseudococcus longispinus SCS01 Pseudococcus longispinus 99 84 Необходимо отметить, что на результаты мологических игл в лабораторных молекулярно-генетических исследований также влияет условиях, при этом для каждой качество самого материала (лучше всего использовать особи использовали одну пару игл. Преимущество молекулярно-генетического подхода У щитовок тело отделяли от щитка ных деревьев и дается в процентах свежий или замороженный, вполне пригоден и в дальнейшем выделение ДНК про- заключается в том, что он позволяет проводить от исходного значения. Доступные высушенный) и его количество. водили только из него в отличие от идентификацию любых жизненных стадий организма. в Генбанке гомологичные исследуе- представителей остальных семейств, мым генам последовательности ДНК культур ложнощитовка повреждает (ScaleNet). Повреждает все надзем- которых сразу же помещали в сте- кацию проводили в термоциклере мощью интернет-ресурса NCBI проанализированы вместе со вновь многие цитрусовые, хурму, инжир, ные части оранжерейных и ком- рильные пробирки. Veriti TM (Applied Biosystems, США). BLAST (http://www.ncbi.nlm.nih.gov/ секвенированными последователь- гранат, яблоню, сливу, грушу, пер- натных культур, в южных широ- Выделение ДНК из исследуемо- Состав реакционной смеси: 5 мкл го- BLAST). Проверка, выравнивание ностями. сик, абрикос, вишню, черешню, айву, тах — также растений открытого го материала проводили методом товой смеси для ПЦР 5X ScreenMix- и редактирование последовательно- шелковицу, боярышник, барбарис, грунта. Наиболее часто встречается обработки образца протеиназой К, HS (ЗАО «Евроген», Россия), 1 мкл стей выполнены в редакторе «BioEdit Результаты исследования самшит, бересклет, плющ, олеандр, на винограде, цитрусовых, плодовых с последующим удалением белков каждого праймера (по 10 пМ), 2 мкл v.7.0.5.3». Исследованиям возможности ис- платан, иву, вяз и др. Вызывает сни- и субтропических культурах. Приво- без экстракции органическими рас- ДНК (с концентрацией 2-100 нг/ Попарные генетические рассто- пользования молекулярно-генети- жение роста и урожайности, опаде- дит к усыханию листьев и увяданию творителями. Использовали набор мкл). яния между последовательностями ческих методов для идентификации ние листьев и гибель молодых рас- плодов. Космополит (http://www.cabi. серии «ДНК-Экстран-2», кат. № НГ- Условия ПЦР для каждой исследу- определены по двухпараметриче- предшествовало несколько этапов: тений. На листьях часто образуется org). 511-100 (ЗАО «Синтол», Москва). емой праймерной системы представ- ской модели Кимуры. Построение – морфологическая идентифика- черный налет из-за развития грибов Щетинистый мучнистый червец Целевые участки ДНК и прай- лены в табл. 3. дендрограмм проводили с использо- ция червецов и щитовок (использо- рода Capnodium на богатых сахара- (Pseudococcus longispinus, рис. 14) — мерные системы. По литературным Секвенирование осуществлялось ванием метода максимального прав- вали только достоверно определен- ми выделениях ложнощитовок, что полифаг, обитающий на растениях данным, были выбраны праймерные по общепринятой методике на секве- доподобия, реализованного в пакете ный материал); приводит к снижению фотосинтети- 253 родов из 96 семейств. Суще- системы, представленные в табл. 2, наторе Genetic Analyzer AB-3500 программ MEGA 6.0. Статистиче- – после выделения ДНК и по- ческой активности листьев и эсте- ственный вред наносит оранжерей- для фрагментов трех ядерных генов: (Applied Biosystems, США). ское подтверждение корректности становки ПЦР с исследуемыми тической привлекательности деко- ным и комнатным культурам, таким фактор элонгации один альфа (EF1α) Первичное сравнение получен- дендрограмм рассчитывали с помо- праймерами полученный продукт ративных растений (Яснош, 1952; как аспарагус, бегония, гибискус, и два рибосомальных гена (28s и 18s). ных последовательностей с базой щью бутстреп-анализа («bootstrap») секвенировали, последовательность Ширяева, 2000). Палеарктический цикламен, орхидеи, пальмы и са- Постановка ПЦР. ПЦР-амплифи- данных ГенБанка проводилось с по- путем построения 500 альтернатив- искомого фрагмента гена сравнива-

16 3| 13| 2015 КАРАНТИН РАСТЕНИЙ КАРАНТИН РАСТЕНИЙ 3| 13| 2015 17 Таблица 5 Сравнение последовательностей 28s RNA исследуемых видов надсемейства Coccoidea с базой данных NCBI

Идентификация Исследуемый вид № образца Идентичность, % Покрытие, % по BLAST NCBI Семейство Diaspididae Подсемейство Aspidiotinae SK12 Quadraspidiotus perniciosus SK13 Diaspidiotus sp. 98 100 SK19 Fig. 6. Chaff scale Aonidiella aurantii SP02 Aonidiella aurantii 93 99 Fig. 5. Oleander scale Aspidiotus nerii Parlatoria pergandii Aonidiella citrina SPC01 Aonidiella sp. 98 100 (photo by N.A. Gura) (photo: http://www.forestryimages.org) SM00 100 100 Рис. 5. Олеандровая, или плющевая Рис. 6. Цитрусовая фиолетовая Aspidiotus nerii Aspidiotus nerii кое разделение, в общих чертах соот- SM01 100 100 щитовка Aspidiotus nerii щитовка Parlatoria pergandii (фото Н.А. Гура) ветствующее таксономическому раз- (фото: http://www.forestryimages.org) Parlatoria pergandii SO02 Parlatoria pergandii 100 94 граничению видов щитовок на уровне червецов и щитовок, представлен- надсемейств, определяется большим Карантинный для России вид ту- Подсемейство Diaspidinae ных в табл. 4. Сравнение получен- числом вариабельных участков по- товая щитовка достаточно хорошо ST07 Pseudaulacaspis 98 100 ных последовательностей с базой следовательности фрагмента гена идентифицируется по последова- Pseudaulacaspis pentagona ST151 pentagona 99 96 данных NCBI позволила заключить, EF1α, обуславливающим заметные тельности фрагмента гена EF1α по что исследуемые виды Coccoidea, за различия не только на уровне се- имеющемуся в базе ГенБанка мате- SS00 99 100 Chionaspis salicis Chionaspis salicis исключением калифорнийской щи- мейств, но и видов. Следует отметить, риалу. Напротив, идентификация SS04 97 99 товки, хорошо идентифицируются что положение в дендрограмме вида калифорнийской щитовки молеку- отсутствует в базе по данному фрагменту гена (табл. 4). Parlatoria pergandii, который относят лярными методами затрудняется Lepidosaphes ulmi SZ04 - - данных Следует отметить, что в базе данных к подсемейству Aspidiotinae (Данциг, недостатком данных в базе ГенБан- LB01 100 94 ГенБанка имеется значительное чис- 1993), определяется, возможно, срав- ка и высоким сходством последо- Unaspis euonymi Unaspis euonymi ло последовательностей по различ- нительно небольшой выборкой ис- вательностей группы видов трибы LB02 100 94 ным видам червецов и щитовок. следованных видов и не совсем ясным Aspidiotini. Семейство Coccidae В ходе анализа последователь- филогенетическим родством. В част- ностей фрагмента гена EF1α путем ности, Борхсениус (1966) выделял Фрагмент SLJ01 97 100 Ceroplastes sp. Ceroplastes sp. построения дендрограммы (рис. 15) род Parlatoria наряду с другими в от- рибосомального гена 28s SLV01 97 100 было установлено, что исследуемые дельное подсемейство Leucaspidinae. Данный ген кодирует рРНК боль- виды дифференцируются на две В то же время согласно современным шой субъединицы рибосом, участву- Соссus hesperidum SLM03 Соссus hesperidum 100 100 крупные группы: первую, состоя- молекулярным данным род Parlatoria ющих в биосинтезе белка. Этот ген, Семейство Pseudococcidae щую из двух ветвей, образуют пред- филогенетически близок к представи- наряду с межгенными спейсерами Planococcus citri SCC01 Planococcus citri 100 95 ставители семейства Pseudococcidae телям подсемейства Aspidiotinae, но (ITS), используется для молекуляр- и подсемейства Aspidiotinae, тогда как при этом внутри данного подсемей- но-генетических исследований дву- Pseudococcus longispinus SCS01 Pseudococcus longispinus 100 94 вторую формируют представители ства рассматриваемый род достаточ- крылых, перепончатокрылых, кло- Семейство Margarodidae Diaspidinae и Parlatoria pergandii. Та- но обособлен. пов и др. (NAPS). Были получены последовательно- Margarodidae SCN01 Monophlebinae 84 73 сти фрагмента гена 28s для 14 так- Рис. 7. Тутовая щитовка Pseudaulacaspis pentagona сонов видового уровня, которые, за (фото Н.А. Гура) исключением Lepidosaphes ulmi, были ли с базой данных ГенБанка (NCBI). и его количество. В последнем слу- Фрагмент гена, кодирующего идентифицированы по базе данных На этом этапе из анализа исключал- чае возможно получить последова- фактор элонгации один альфа Fig. 7. White peach scale Pseudaulacaspis pentagona ГенБанка (табл. 5). Виды щитовок ся материал, пораженный грибными тельность искомого фрагмента гена (EF1α) (photo by N.A. Gura) и червецов, кроме Quadraspidiotus организмами или паразитоидами. из одной особи (в случае щитовок Кодирует белок фактора элонга- perniciosus и видов рода Aonidiella В нашем исследовании продукты используют только тело насекомого, ции один альфа, отвечающего за обе- и Ceroplastes, достаточно точно иден- ПЦР для грибов, поражающих тела без щитка) с концентрацией ДНК спечение доставки аминоацил-тРНК тифицируются до видового уровня Coccoidea, как правило, имели мень- в растворе после выделения, равной в рибосому при биосинтезе белков. по фрагменту гена 28s благодаря ший размер по сравнению с таковым 1 нг/мл. Этот высококонсервативный ген ис- большому числу последовательной для щитовок. Изучаемые ядерные гены широко пользуется для филогенетических исследуемого участка ядерного ге- Необходимо отметить, что на ре- используются для молекулярно-ге- исследований таксонов низшего ран- нома в базе данных ГенБанка. зультаты молекулярно-генетических нетических исследований насеко- га для чешуекрылых и других насеко- Анализ последовательностей исследований также влияет качество мых. Фрагмент каждого гена ана- мых (NAPS). фрагмента гена 28s исследуемых самого материала (лучше всего ис- лизировали на предмет возможного В результате проведенной работы червецов и щитовок путем построе- пользовать свежий или заморожен- использования в диагностике видов были получены последовательности ния дендрограммы (рис. 16) выявил ный, вполне пригоден высушенный) червецов и щитовок. фрагмента гена EF1α для 11 видов закономерность в формировании

18 3| 13| 2015 КАРАНТИН РАСТЕНИЙ КАРАНТИН РАСТЕНИЙ 3| 13| 2015 19 семействам по системе Е.М. Данциг Банка и высоким сходством после- Последовательности гена 18s были связано с высоким сходством после- (1993). В подсемействе Aspidiotinae довательностей группы видов трибы получены для 13 таксонов видово- довательностей данных видов (зача- виды рода Quadraspidiotus, Aonidiella Aspidiotini. го уровня кокцид, из них в ГенБанке стую различия проявлялись в еди- и Aspidiotus, относящиеся к трибе отсутствовали последовательности ничных нуклеотидных заменах, рис. Aspidiotina, объединены в одну груп- Фрагмент для 5 видов (табл. 6). Анализ данных 18). При этом необходимо отметить, пу и дифференцируются от Parlatoria рибосомального гена 18s последовательностей путем построе- что данный фрагмент хорошо диффе- pergandii, принадлежащего к трибе Данный ген кодирует рРНК малой ния дендрограммы с помощью метода ренцирует виды на уровне семейств. Parlatoriini. Аналогичным образом субъединицы рибосом. Этот ген так- максимального правдоподобия клас- классифицируются виды подсемей- же используется для молекулярно-ге- сифицировал исследуемые таксоны Заключение ства Diaspidinae: группа видов рода нетических исследований насекомых. видового уровня на группы, согласно Результаты исследования последо- Pseudaulacaspis, Chionaspis, Unaspis, их принадлежности к тому или иному вательностей фрагментов трех генов относящихся к Diaspidini, обосо- Таблица 7 семейству (рис. 17). Виды семейства представителей Coccoidea обобще- Fig. 8. Willow scale Chionaspis salicis бляется от Lepidosaphes ulmi, от- Сводная таблица результатов щитовок слабо дифференцировались ны в табл. 7. В целом получены по- (photo by N.A. Gura) носящегося к трибе Lepidosaphini. идентификации между собой на два подсемейства, что следовательности фрагментов трех Полученные результаты в целом исследуемых видов Coccoidea Рис. 8. Ивовая щитовка Chionaspis salicis (фото Н.А. Гура) совпадают с молекулярно-генети- ческими построениями филогении Идентификация по BLAST NCBI групп видов, совпадающих с систе- согласно их принадлежности к тому щитовок (Andersen et al., 2010). EF1α 28s 18s мой Сoccoidea. Все исследованные или иному семейству. В свою оче- Идентификация карантинного Исследуемый вид Семейство Diaspididae таксоны видового уровня подразде- редь, представители семейства вида тутовой щитовки может быть лились на четыре клады с высокой щитовок подразделяются на две проведена по фрагменту данного Подсемейство Aspidiotinae бутстреп-поддержкой (99–100%), группы, соответствующие двум под- гена, в то время как идентифика- Калифорнийская щитовка Diaspidiotus sp. Diaspidiotus sp. Quadraspidiotus perniciosus ция калифорнийской щитовки, как Quadraspidiotus perniciosus Таблица 6 и в предыдущем случае, затрудня- Сравнение последовательностей 18s RNA исследуемых видов ется недостатком данных в базе Ген- Красная померанцевая надсемейства Coccoidea с базой данных NCBI щитовка Aonidiella aurantii Aonidiella aurantii Aonidiella aurantii Aonidiella aurantii Идентификация Исследуемый вид № образца Идентичность, % Покрытие, % Желтая померанцевая по BLAST NCBI щитовка Aonidiella citrina Aonidiella sp. - Aonidiella citrina Семейство Diaspididae Олеандровая щитовка Подсемейство Aspidiotinae Aspidiotus nerii Aspidiotus nerii Aspidiotus nerii Aspidiotus nerii SK06 Quadraspidiotus 100 86 Quadraspidiotus perniciosus Цитрусовая фиолетовая SK05 perniciosus 98 99 щитовка Parlatoria pergandii Parlatoria pergandii отсутствует в базе данных Parlatoria pergandii Aonidiella aurantii SP02 Aonidiella aurantii 98 100 Подсемейство Diaspidinae Aspidiotus nerii SM01 Aspidiotus nerii 100 97 Тутовая щитовка Pseudaulacaspis Pseudaulacaspis отсутствует в базе Pseudaulacaspis pentagona Parlatoria pergandii SO02 - - Pseudaulacaspis pentagona pentagona pentagona данных Ивовая щитовка Подсемейство Diaspidinae Chionaspis salicis Chionaspis salicis отсутствует в базе данных Chionaspis salicis Pseudaulacaspis Pseudaulacaspis pentagona ST07 99 86 Запятовидная щитовка отсутствует в базе pentagona Lepidosaphes ulmi отсутствует в базе данных Lepidosaphes ulmi данных отсутствует в базе Chionaspis salicis SS04 - - Бересклетовая щитовка данных Unaspis euonymi Unaspis euonymi отсутствует в базе данных Unaspis euonymi отсутствует в базе Lepidosaphes ulmi SZ04 - - данных Семейство Coccidae отсутствует в базе Ложнощитовка мягкая Unaspis euonymi SN01 - - - Соссus hesperidum Соссus hesperidum данных Соссus hesperidum Семейство Coccidae Восковая ложнощитовка - Ceroplastes sp. Ceroplastes sp. Ceroplastes sp. Ceroplastes sp. SLV01 Ceroplastes sp. 100 99 Семейство Pseudococcidae Соссus hesperidum SLM03 Соссus hesperidum 99 96 Червец цитрусовый Семейство Pseudococcidae Planococcus citri Planococcus citri Planococcus citri Planococcus citri Planococcus citri SCC01 Planococcus citri 100 87 Щетинистый червец Pseudococcus Pseudococcus longispinus Pseudococcus longispinus Pseudococcus longispinus SCS01 Pseudococcus longispinus 99 93 Pseudococcus longispinus longispinus Семейство Margarodidae Семейство Margarodidae Margarodidae SCN01 Monophlebinae 98 96 Margarodidae - Monophlebinae Monophlebinae Примечание: «-» — последовательность фрагмента гена не была получена.

20 3| 13| 2015 КАРАНТИН РАСТЕНИЙ КАРАНТИН РАСТЕНИЙ 3| 13| 2015 21 ядерных генов для 15 таксонов ви- Для видовой идентификации червецов и щитовок дового уровня Coccoidea, из них по возможно использовать фрагменты генов EF1α и 28s, COCCIDS (COCCOIDEA) гену EF1α — для 11, по гену 28s — для в которых имеется наибольшее число диагностически 14 и по гену 18s — для 13. В частно- значимых вариабельных участков, тогда как ген 18s Significance, Distribution and DNA-Based сти, для пяти видов были получены последовательности по гену 18s, от- значительно консервативнее, поэтому не может быть Identification Methods сутствующие в базе данных NCBI. рекомендован для данных целей. Дендрограммы сходства последова- тельностей по всем трем генам по- и Diaspididae // Фауна России и сопре- 9. Miller D., Davidson J. (2005) Ilya O. Kamaev, Head of FGBU VNIIKR’s Research and Testing Department зволяют строго дифференцировать дельных стран. № 144. Насекомые хо- Armored Scale Insect Pests of Trees исследуемые виды по их принадлеж- ботные. Т. 10. СПб: Наука, 1993. 453 с. and Shrubs (Hemiptera: Diaspididae). Natalia A. Gura, Senior Researcher at FGBU VNIIKR’s ности к тому или иному семейству. 4. Копина М.Б., Гура Н.А., Мугол Ithaca, United States. P. 456. Entomological Research and Methodology Department Это свидетельствует о возможности Хан Г.Н. Распространение, вредонос- 10. Morse G.E., Normark B.B. использования данных генов в ка- ность и методы идентификации ци- (2006) A molecular phylogenetic study Andrey V. Shipulin, Junior Researcher at FGBU VNIIKR’s Research and Testing Department честве молекулярно-генетических трусового червеца Planococcus citri of armoured scale insects (Hemiptera: маркеров для идентификации видов (Risso) // Карантин растений. Наука Diaspididae) // Systematic Entomology. Coccoidea. Для видовой идентифика- и практика. 2013. № 3. С. 53–59. Vol. 31. № 2. P. 338-349. ции червецов и щитовок возможно 5. Ширяева Н.В. Вредные чле- 11. NAPS Unit list of standard использовать фрагменты генов EF1α нистоногие уличных насаждений primers. http://www.msl.ubc.ca/ и 28s, в которых имеется наибольшее Северного Кавказа // Организмы, services/naps. Онлайн-доступ на 15 число диагностически значимых ва- популяции, экосистемы. Материалы мая 2015 г. риабельных участков, тогда как ген 4-й научно-практической конферен- 12. NCBI. http://www.ncbi.nlm.nih. 18s значительно консервативнее, по- ции Майкопского государственного gov. Онлайн-доступ на 15 мая 2015 г. Coccids, or mealybugs and scale latter relies on the morphological char- genetic characteristics of mitochondrial этому не может быть рекомендован технологического института. Май- 13. PQR — EPPO Plant Quarantine insects (Coccoidea), numbering about acteristics of mealybugs and scale in- and nuclear genome fragment sequences для данных целей. коп, 2000. С. 124–125. Data Retrieval system, version 5.3.5. 7,800 species in 49 families (ScaleNet), sects, however, identifiable only at the are booming (Morse & Normark, 2006; Молекулярно-генетические мар- 6. Яснош В.А. Японская восковая https://www.eppo.int/DATABASES/ belong to the group of sucking insects life stage of a female imago. Males have Andersen et al., 2010; Sethusa et al., 2014, керы EF1α и 28s позволяют иденти- ложнощитовка // Тр. ВИЗР. М.-Л., pqr/pqr.htm. feeding on plant sap. Pests of the most short life expectancy, are considerably etc). Besides, studies on cytogenetics and фицировать карантинный вид — ту- 1952. С. 83–93. 14. ScaleNet. 2013. URL http://www. important agricultural crops are found less studied and easily damaged on a karyotaxonomy of Palearctic coccids товую щитовку. Калифорнийская 7. Andersen J.C., Wu J., Gruwell M.E., sel.barc.usda.gov/scalenet/scalenet. among coccids. Some of them, for in- sticky layer of pheromone traps utilized have been undertaken (Gavrilov, 2005). щитовка может быть идентифициро- Gwiazdowski R., Santana S.E., Feliciano htm. Онлайн-доступ на 15 мая 2015 г. stance, the white peach scale (Pseu- to detect these insects. All this sets a The advantage of the DNA approach lies вана по тем же генам, однако в даль- N.M., Morse G.E., Normark B.B. (2010) 15. Sethusa M.T., Millar I.M., Yes- daulacaspis pentagona) and San Jose limit to identifying mealybugs and scale in the fact that is enables to identify all нейшем требуется исследование ма- A phylogenetic analysis of armored soufou K., Jacobs A., van der Bank M., scale (Quadraspidiotus perniciosus) are insects at the life stage of various instars. life stages. An example of DNA identifi- териала по видам рода Diaspidiotis scale insects (Hemiptera: Diaspididae), van der Bank H. (2014) DNA Barcode of quarantine concern for many coun- The need to develop accurate iden- cation of three mealybug species by two и другим видам трибы Aspidiotini based upon nuclear, mitochondrial, and Efficacy for the Identification of Eco- tries (Fig. 1 and 2). tification methods for coccids is gain- genome regions was previously present- из-за недостатка данных ГенБанка. endosymbiont gene sequences // Mol. nomically Important Scale Insects Plant protection experts are facing ing relevance in view of the Russian ed (Kopina et al., 2013). Phylogenet. Evol. № 57 (3). P. 992–1003. (Hemiptera: Coccoidea) in South Afri- a challenge with regard to timely de- and Customs Union Lists of quarantine This work focuses on DNA studies Благодарности 8. CABI. http://www.cabi.org/ Он- ca // African Entomology. Vol. 22. № 2. tection of harmful Coccoidea species pests being extended. This task can be and review of data on the significance Авторы выражают признатель- лайн-доступ на 15 мая 2015 г. P. 257–266. requiring accurate identification. The solved by using DNA methods. and distribution of 14 taxa of mealybug ность коллегам из ФГБУ «ВНИИКР» Phylogenetic studies of scale insects and scale insect species belonging to 4 за помощь в сборе материала и про- Рис. 9. Яблоневая запятовидная щитовка Lepidosaphes ulmi Fig. 10. Euonymus scale Unaspis euonymi and mealybugs based on molecular and families. ведении некоторых этапов работы (фото Н.А. Гура) (photo by N.A. Gura) младшему научному сотруднику научно-экспериментального отдела Fig. 9. Apple mussel scale Lepidosaphes ulmi Рис. 10. Бересклетовая щитовка Unaspis euonymi Г.Н. Матяшовой, младшему научному (photo by N.A. Gura) (фото Н.А. Гура) сотруднику лаборатории энтомоло- гии ИЭЦ М.Г. Буш, научному сотруд- нику научно-методического отдела энтомологии к.б.н. Я.Н. Коваленко, старшему научному сотруднику лабо- ратории энтомологии Н.И. Ершовой.

Литература 1. Борхсениус Н.С. Каталог щито- вок (Diaspidoidea) мировой фауны. М.-Л.: Наука, 1966. 450 с. 2. Гаврилов И.А. Систематика и цитогенетика кокцид (Homoptera: Coccinea) Европейской части России. Дисс. на соискание уч. ст. канд. биол. наук. СПб, 2005. 269 с. 3. Данциг Е.М. Подотряд кокциды (Coccinea). Семейства Phoenicoccidae

22 3| 13| 2015 КАРАНТИН РАСТЕНИЙ КАРАНТИН РАСТЕНИЙ 3| 13| 2015 23 Table 1 Table 2 Brief description of the material under study Genome fragments under study and primer systems

Details Sample Species Gene region Primers Primer sequence (5’-3’) Product size, bp Reference (collection place and time, object, collector) number EF1a GATGCTCCGGGACAYAGA Morse & Normark, Family Diaspididae EF1α ~1,150 EF2 ATGTGAGCGGTGTGGCAATCCAA 2006 Subfamily Aspidiotinae s3660 GAGAGTTMAASAGTACGTGAAAC Morse & Normark, peach, Georgia, June 2014, 28s ~800 SK02 28b TCGGAAGGAACCAGCTACTA 2006 Matyashova G.N. San Jose scale 2660 CTGGTTGATCCTGCCAGTAG Quadraspidiotus perniciosus apple, 2013, Gura N.A. SK09 18s ~700 Sethusa et al., 2014 Comstock, 1881 18s-B CCGCGGCTGCTGGCACCAGA apple, Belgorod region, September 2014, Kovalenko Ya.N. SK12, 13, 19 Material under study deformation and drying of shoots, size Buryatia, in the south of the European Red scale tangerine, Pakistan, February 2014, For this work, samples collected for reduction and malformation of fruit. part of Russia and the Northern Cau- SP02 Aonidiella aurantii (Maskell, 1879) Kamaev I.O. plant health testing, collection materials Typical red (reddish purple) spots ap- cuses (Dantsig, 1993; ScaleNet). provided by the authors of this article pear on fruit and young shoots where The red scale (Aonidiella aurantii, Yellow scale avocado, a food market, Moscow, November 2014, SPC01, 02 and other FGBU VNIIKR’s specialists, a scale settles (Fig. 1). The species is cos- Fig. 3) is a polyphagous pest feeding Aonidiella citrina (Craw, 1980) Kamaev I.O. as well as FGBU VNIIKR’s reference mopolitan and of quarantine concern on plants of 260 genera in 88 families collections of mealybugs were used (Ta- for Russia and the member countries of (ScaleNet). The red scale is distributed Oleander scale FGBU VNIIKR’s collection, July 2014, Gura N.A. SM00, 01 ble 1). Identification of the overwhelm- Aspidiotus nerii Bouche, 1833 ing majority of mealybug and scale in- The need to develop accurate identification methods for coccids sect species was conducted by Natalia is gaining relevance in view of the Russian and Customs Union Chaff scale orange, plant health testing sample, May 2014, Bush M.G. SO02 A. Gura, senior researcher at the Ento- Lists of quarantine pests being extended. Parlatoria pergandii Comstock, 1881 mological Research and Methodology Subfamily Diaspidinae Department. the Asia-Pacific Plant Protection Com- virtually throughout the entire citrus mission (APPPC), European and Med- growing area where it causes its major White peach scale kiwi fruit, plant health testing sample, May 2014, Significance and distribution of iterranean Plant Protection Organiza- damage. In Russia, the red scale doesn’t Pseudaulacaspis pentagona ST07, 148, 151 Bush M.G. the Coccoidea species under study tion (EPPO), and Pacific Plant Protec- occur as it doesn’t get established in the (Targioni Tozzetti, 1886) This section is based on data found tion Organization (PPPO). According Caucasus region (Dantsig, 1993). Willow scale blueberry, FGBU VNIIKR precinct, Bykovo, Moscow oblast, in the works by N.S. Borkhenius (1966), to PQR, it is on the List of quarantine The yellow scale (Aonidiella citrina, SS00,04 Chionaspis salicis (Linnaeus, 1758) July 2014, Gura N.A. E.M. Dantsig (1993), D. Miller & J. Da- pests in Africa, Israel, Jordan, Kazakh- Fig. 4) attacks plants of 28 genera in 27 vidson (2005), and databases: ScaleNet stan, Uzbekistan, etc. In Russia, the families (ScaleNet). It severely damages Apple mussel scale (http://www.sel.barc.usda.gov/scalenet/ San Jose scale is reported in the south citrus plants causing leaf and fruit dry- apple tree, August 2014, Gura N.A. SZ04 Lepidosaphes ulmi (Linnaeus, 1758) scalenet.htm), EPPO – PQR (https:// of the Far East including Sakhalin and ing and drop. It is a cosmopolitan spe- www.eppo.int/DATABASES/pqr/pqr. the Kuril Islands, in Irkutsk region and cies reported on the Black Sea coast of ornamental plant, plant health testing sample, htm), and CABI (http://www.cabi.org). Georgia, and in greenhouses in Arme- Euonymus scale SN01 June 2014, Ershova N.I. Fig. 11. Brown soft scale Coccus hesperidum nia and Ukraine (Dantsig, 1993). Unaspis euonymi (Comstock, 1881) Family Diaspididae (photo by N.A. Gura) reference specimens, collections of 2013, Gura N.A. LB01, 02 Subfamily Aspidiotinae Subfamily Coccidae The San Jose scale (Quadraspidiotus Рис. 11. Ложнощитовка мягкая Coccus hesperidum perniciosus)1 attacks over 270 plant spe- (фото Н.А. Гура) Brown soft scale FGBU VNIIKR’s reference collection, July 2014, Gura N.A. SLM03 cies in 75 genera belonging to 45 fam- Соссus hesperidum Linnaeus, 1758 ilies (ScaleNet). It prefers plants of the rose family. In fruit trees, this species Japanese wax scale laurel, the village of Nikita, Crimea, August 2014, SLV01 causes cracking and dieback of bark, Ceroplastes sp. Kamaev I.O. premature leaf fall, impeded growth, Family Pseudococcidae 1 It should be noted that species of the genus Citrus mealybug FGBU VNIIKR’s reference collection, July 2014, Gura N.A. SCC01 Quadraspidiotus MacGillivray, 1921 are Planococcus citri Risso, 1813 reputedly considered as belonging to the genus Diaspidiotus Berlese, 1896 due to the lack of Long-tailed mealybug clear understanding what species these taxa Pseudococcus longispinus FGBU VNIIKR’s reference collection, July 2014, Gura N.A. SCS01 comprise and what their volume is (Dantsig, (Targioni Tozzetti, 1867) 1993; Miller, Davidson, 2005); the San Jose scale has currently been regarded as a species of the Family Margarodidae independent genus Comstockaspis MacGillivray, 1921 (ScaleNet). Here, we use the Latin name Prunus sp., Karshi, Uzbekistan, 2014, of the San Jose scale common for the Russian Ground pearls, Margarodidae SCN01 Kovalenko Ya.N. plant quarantine tradition – Quadraspidiotus perniciosus.

24 3| 13| 2015 КАРАНТИН РАСТЕНИЙ КАРАНТИН РАСТЕНИЙ 3| 13| 2015 25 Table 3 Table 4 Temperature and time conditions for PCR with the primer systems under study Comparison of EF1α sequences of Coccoidea species under study with the NCBI database

EF1a/EF2 s3660/28b 2660/18s-B Sample Identification according Number Species under study Identity, % Coverage, % Stage Temperature, Temperature, Temperature, number to BLAST NCBI Time Time Time of cycles °С °С °С Family Diaspididae Initialization 95 10 min 95 10 min 95 5 min 1 Subfamily Aspidiotinae Denaturation 95 30 sec 95 30 sec 95 30 sec SK02 90 100 Annealing of primers* 61 30 sec 54 30 sec 61 1 min 35 SK09 91 97 Elongation 72 2 min 72 2 min 72 2 min Quadraspidiotus perniciosus SK12 Diaspidiotus sp. 90 100 Final elongation 72 2 min 72 2 min - - 1 SK13 91 100 Note: * — The temperature for annealing of primers was determined empirically. SK19 90 98 Aonidiella aurantii SP02 Aonidiella aurantii 98 98 The oleander scale (Aspidiotus nerii, on the Black Sea coast of Krasnodar krai bilberry, in ornamental crops – maple, Fig. 5) is a polyphagous species found (Dantsig, 1993). lilac, rose, rowan, jasmine, etc. Shoots SPC01 Aonidiella citrina Aonidiella citrina 98 100 on plants belonging to over 500 genera Subfamily Diaspidinae become covered with a layer of scales SPC02 in 124 families (ScaleNet) including ole- The white peach scale (Pseudaulac- which leads to the die-back of plants SM00 100 100 ander, palm trees, orchids, vine, citrus, aspis pentagona, Fig. 2, 7) is noted for and rapid yield reduction. The willow Aspidiotus nerii Aspidiotus nerii peach, pear, sandal and olive trees (Mill- causing severe damage to plants of scale is reported in North America, SM01 99 97 er, Davidson, 2005). Sucking cell sap about 270 genera belonging to 90 fami- North Africa and widely spread in Eur- Parlatoria pergandii SO02 Parlatoria pergandii 100 87 from host plants, the pest impedes their lies (ScaleNet). It prefers mulberry, cur- asia including Russia (Dantsig, 1993; growth, causes leaf drop, fruit defor- rant, blackberry, raspberry, vine, peach, Miller, Davidson, 2005). Subfamily Diaspidinae mation and reduction of oil content in apricot, plum, lilac, oleander, ash tree, The apple mussel scale (Lepidosaphes ST07 99 94 olives. When lemon fruit are damaged, actinidia, etc. This cosmopolitan species ulmi, Fig. 9) causes severe damage to green spots appear. In greenhouses, the is of quarantine concern for the Russian apple trees in Russian apple production Pseudaulacaspis pentagona ST148 Pseudaulacaspis pentagona 100 100 pest develops three generations. This Federation, Republic of Belarus, Ka- areas. This species also damages pear, ST151 100 100 cosmopolitan species is reported on zakhstan, Turkey, and Chili (PQR). The plum, peach, apricot, currant, and mul- the Black Sea coast of Russia (Dantsig, white peach scale was introduced onto berry. In ornamental and forest crops, Chionaspis salicis SS04 Chionaspis salicis 99 99 1993). the Black Sea coast of Georgia. Reliable it is harmful for ash, maple, birch, oak, Lepidosaphes ulmi SZ04 Lepidosaphes ulmi 100 89 The chaff scale (Parlatoria pergandii, data on the occurrence of this species in hawthorn, lilac, and rose. The apple Unaspis euonymi SN01 Unaspis euonymi 99 86 Fig. 6) damages about 60 plant genera Russia are not available (Dantsig, 1993). mussel scale is reported on host plants of in 36 families (ScaleNet). Major dam- The willow scale (Chionaspis salicis, over 200 genera in 73 families (ScaleN- Family Pseudococcidae age is done to citrus and subtropical Fig. 8) is a polyphagous pest mainly et). This cosmopolitan species reduces Planococcus citri SCC01 Planococcus citri 100 100 crops — bay laurel, tea plant, camellia, feeding on trees and shrubs of 72 gen- vegetation, causes leaf drop, dieback of etc. The species is predominantly spread era in 26 families (ScaleNet). Its major branches and trees (Dantsig, 1993). Pseudococcus longispinus SCS01 Pseudococcus longispinus 99 84 in Eurasian countries with the Mediter- host plant is willow. In berry crops, it se- The euonymus scale (Unaspis euony- ranean climate. In Russia, it is reported verely damages currant, blueberry, great mi, Fig. 10) is a polyphagous pest feed- ing on plants of 25 genera in 20 families Fig. 12. Japanese wax scale Ceroplastes japonicus Fig. 13. Citrus mealybug (Planococcus citri) Fig. 14. Long-tailed mealybug Pseudococcus longispinus (ScaleNet). The most severe damage is (photo by N.A. Gura) (photo by N.A. Gura) (photo by N.A. Gura) caused to spindle commonly used in or- namental horticulture. Firstly, light yel- Рис. 12. Японская восковая ложнощитовка Ceroplastes Рис. 13. Цитрусовый или виноградный мучнистый Рис. 14. Щетинистый мучнистый червец low spots on leaves are produced. Then, japonicus червец (Planococcus citri) Pseudococcus longispinus complete discoloration of lamina takes (фото Н.А. Гура) (фото Н.А. Гура) (фото Н.А. Гура) place, dieback of shoots and branches is observed followed by strong suppres- sion and death of plants. On leaves, 90% of the population is represented by males, while on branches and stems females dominate. This cosmopolitan species originates from Southeast Asia (Miller, Davidson, 2005). The species was introduced into Crimea and onto the Black Sea coast of Krasnodar krai (Dantsig, 1993).

Family Coccidae The brown soft scale (Coccus hes- peridum, Fig. 11) is a highly polypha- gous pest feeding on plants of over 500

26 3| 13| 2015 КАРАНТИН РАСТЕНИЙ КАРАНТИН РАСТЕНИЙ 3| 13| 2015 27 Table 5 Comparison of 28s RNA sequences of the superfamily Coccoidea species under study with the NCBI database

Sample BLAST NCBI Species under study Identity, % Coverage, % number identification Family Diaspididae Subfamily Aspidiotinae SK12 Quadraspidiotus perniciosus SK13 Diaspidiotus sp. 98 100 SK19 Aonidiella aurantii SP02 Aonidiella aurantii 93 99 Aonidiella citrina SPC01 Aonidiella sp. 98 100 SM00 100 100 Aspidiotus nerii Aspidiotus nerii SM01 100 100 Parlatoria pergandii SO02 Parlatoria pergandii 100 94 Subfamily Diaspidinae ST07 Pseudaulacaspis 98 100 Pseudaulacaspis pentagona ST151 pentagona 99 96 Fig. 15. Dendrogram showing similarity between EF1α gene fragment sequences of the Coccoidea species under study (species names and sample numbers are given) SS00 99 100 Most commonly, it is found on vine, is built using the maximum likelihood method. Stability measured in the bootstrap Chionaspis salicis Chionaspis salicis SS04 97 99 citrus, fruit and subtropical crops. This analysis (500 alternative dendrograms) is expressed in percent above the branches unavailable in the cosmopolitan species causes leaf wilt Рис. 15. Дендрограмма сходства последовательностей фрагмента гена Lepidosaphes ulmi SZ04 - - database and fruit decline (http://www.cabi.org). EF1α исследуемых представителей Coccoidea (названия видов и номер The long-tailed mealybug (Pseu- образца приведены), построенная с помощью метода максимального LB01 100 94 Unaspis euonymi Unaspis euonymi dococcus longispinus, Fig. 14) is a pol- правдоподобия. Устойчивость, определенная бутстреп-анализом LB02 100 94 yphagous pest settling 253 plant genera (500 альтернативных дендрограмм), дана в процентах над ветвями Family Coccidae in 96 families. It essentially damages such greenhouse and indoor plants as (indicated in Table 2) for the fragments in MEGA 6.0 software. The statistical SLJ01 97 100 Ceroplastes sp. Ceroplastes sp. asparagus, begonia, hibiscus, cyclamen, of three nuclear genes – elongation fac- confirmation of the dendrogram accu- SLV01 97 100 orchid, palm tree, and cycas. Leaves tor 1-alpha (EF1α) and two ribosomal racy was evaluated using the bootstrap damaged by the long-tailed mealybug genes (28s and 18s). analysis through building 500 alterna- Соссus hesperidum SLM03 Соссus hesperidum 100 100 become brown, dry and fall. In open- PCR amplification was performed tive trees. This statistical confirmation Family Pseudococcidae ground planting, this cosmopolitan using the VeritiTM thermal cycler (Ap- is given as percentage of the base value. Planococcus citri SCC01 Planococcus citri 100 95 species (http://www.cabi.org) is pre- plied Biosystems, USA). The reaction GenBank sequences homologous with dominantly spread in tropical and sub- mix contained 5 µl of the readymade the genes under study were analyzed Pseudococcus longispinus SCS01 Pseudococcus longispinus 100 94 tropical regions. PCR mix 5X ScreenMix-HS (Evrogen, together with the new sequences. Family Margarodidae Russia), 1 µl of every primer (10 pmol DNA studies each), and 2 µl of DNA (with the con- Results Margarodidae SCN01 Monophlebinae 84 73 The material was selected under lab- centration of 2-100 ng/µl). The following stages preceded the oratory conditions using entomological The PCR conditions for each primer studies on the possibility of using DNA needles treated with 96% ethanol, with system under study are given in Table 3. methods for identification of scale in- genera in over 130 families (ScaleNet). scale damages many citrus crops, date nese wax scales. This leads to decline in one pair of needles used per specimen. Sequencing was performed in ac- sects and mealybugs: It prefers tropical and subtropical green- plum, fig, pomegranate, apple, plum, the photosynthetic activity of leaves and In scale insects, bodies were separated cordance with the common technique – morphological identification of house crops and house plants. It mainly pear, peach, apricot, cherry, sweet cher- aesthetic attractiveness of ornamental from scales for further DNA extraction, using the Genetic Analyzer AB-3500 mealybugs and scale insects (only relia- settles on the upper side of leaves along ry, quince, mulberry, hawthorn, barber- plants (Yasnosh, 1952; Shiryaeva 2000). while specimens of the other families (Applied Biosystems, USA). bly identified material was used); veins. The brown soft scale abundantly This palearctic species occurs in Europe, were directly placed into sterile tubes. Primary comparison of the produced – after DNA had been isolated and produces honeydew facilitating the de- The advantage of the DNA Turkey, Caucuses, Korea, and Japan The extraction of DNA from the ma- sequences with the GenBank data was PCR with the primers under study had velopment of sooty blotch, thus, reduc- approach lies in the fact that is (ScaleNet). terial under study was performed by conducted using the NCBI BLAST in- been performed, the derived product ing the ornamental value of plants. In enables to identify all life stages. treating the specimens with Proteinase ternet resource (http://www.ncbi.nlm. was sequenced and the sequence of the open-ground planting, this cosmopoli- Family Pseudococcidae K followed by removal of proteins with nih.gov/BLAST). The sequences were target gene fragment was compared tan species is spread in regions with the ry, boxwood, spindle tree, ivy, oleander, The citrus mealybug (Planococcus no extraction with organic solvents. verified, aligned and edited using the with the sequences available in the Gen- Mediterranean climate. plane tree, willow, elm, etc. The pest citri, Fig. 13) is a polyphagous pest re- A kit of the DNA-Ekstran-2 series, cat- software BioEdit v.7.0.5.3. Bank (NCBI). At this stage, all material The Japanese wax scale (Ceroplastes impedes growth and causes yield reduc- portedly feeding on 242 plant genera in alogue number NG-511-100, was used Pairwise genetic distances between infested with fungi or parasitoids was japonicus, Fig. 12) is a polyphagous pest tion, leaf drop and death of young trees. 89 families (ScaleNet). It damages all (Synthol, Moscow). the sequences were determined using excluded. In our studies, PCR products feeding on over 100 plant species in 26 A black coating is formed on leaves due above-ground parts of greenhouse and Regarding DNA target regions and Kimura’s two parameter model. Den- for fungi infesting Coccoidea, as a rule, families (Borkhsenius, 1966; ScaleNet). to the development of the Capnodium indoor plants. In southern latitudes, it primers, in accordance with literary drograms were built using the maxi- were smaller in size than those for scale In subtropical crops, the brown soft fungi on sugar-rich excretions of Japa- damages open-ground plants, as well. sources, we used the following primers mum likelihood method implemented insects.

28 3| 13| 2015 КАРАНТИН РАСТЕНИЙ КАРАНТИН РАСТЕНИЙ 3| 13| 2015 29 It should be noted that DNA test re- As a result of the work performed, subfamily Diaspidinae and Parlatoria sults are also influenced by the quality of the sequences of EF1α gene were ob- pergandii. Such division, in general the material itself (it is better to utilize tained for 11 species of mealybugs and terms matching the taxonomic distinc- fresh or frozen material, the dry one is scale insects given in Table 4. Compar- tion between the scale insect species of use, as well) and its quantity. In the ison of the obtained sequences with the on the family level, is determined by latter case, it is possible to obtain the NCBI database enabled to conclude the large number of variable regions sequence of the target gene from one that the Coccoidea species under study, of the EF1α gene fragment condition- specimen (in case with scale insects, apart from the San Jose scale, are relia- ing perceptible differences on both the only bodies without scales are used), bly identified by this gene fragment (Ta- family and species level. It should be with the concentration of DNA in the ble 4). It should be noted that GenBank noted that the position of Parlatoria solution after its isolation amounting to 1 ng/ml. It should be noted that DNA test results are also influenced The nuclear genes under study are by the quality of the material itself (it is better to utilize fresh widely used for DNA studies of insects. or frozen material, the dry one is of use, as well) and its quantity. The fragment of every gene was evalu- ated with regard to its potential use in has a considerable number of sequenc- pergandii, classified as belonging to the diagnosing mealybugs and scale insects. es for various species of mealybugs and subfamily Aspidiotinae (Dantsig, 1993), scale insects. in the dendrogram is likely to be deter- The fragment of elongation factor In the course of analyzing the EF1α mined by a relatively small selection of 1-alpha gene (EF1α) gene fragment sequences through the tested species and a rather unclear It encodes the elongation factor 1-al- building a dendrogram (Fig. 15), it was phylogenic relationship. In particular, pha protein catalyzing the binding of found that the species under study could Borkhsenius (1966) identified the genus aminoacyl-transfer RNAs to the ribo- be divided into two large groups. The Parlatoria along with other genera as the some in protein synthesis. This highly first group consisting of two branches independent subfamily Leucaspidinae. conserved gene is used for phylogenetic is formed by the representatives of the Meanwhile, according to up-to-date Fig. 16. Dendrogram showing similarity between 28s gene fragment sequences of studies of taxa of lower rank in Lepidop- family Pseudococcidae and subfamily molecular data, the genus Parlatoria is the Coccoidea species under study (species names and sample numbers are given) tera and other insects (NAPS). Aspidiotinae, while the second group phylogenetically close to the represent- but at the same time the genus under is built using the maximum likelihood method. Stability measured in the bootstrap is formed by the representatives of the atives of the subfamily Aspidiotinae, consideration is quite alone-standing analysis (500 alternative dendrograms) is expressed in percent above the branches Table 6 within this subfamily. Рис. 16. Дендрограмма сходства последовательностей фрагмента гена Comparison of 18s RNA sequences of the superfamily Coccoidea species under study with the NCBI database The white peach scale quarantine for 28s исследуемых представителей надсемейства Coccoidea (приведены Russia is easily identified by the EF1α названия видов и номер образца), построенная с помощью метода Sample gene fragment sequences available in максимального правдоподобия. Устойчивость, определенная бутстреп- Species under study BLAST NCBI identification Identity, % Coverage, % number the GenBank. And, on the contrary, анализом (500 альтернативных дендрограмм), дана в процентах над ветвями Family Diaspididae DNA identification of the San Jose scale is made difficult by the lack of data in Subfamily Aspidiotinae the GenBank and high similarity be- Fig. 17. Dendrogram showing similarity between 18s gene fragment sequences of SK06 100 86 tween the sequences of the group of the Coccoidea species under study (species names and sample numbers are given) Quadraspidiotus perniciosus Quadraspidiotus perniciosus species belonging to Aspidiotini. is built using the maximum likelihood method. Stability measured in the bootstrap SK05 98 99 analysis (500 alternative dendrograms) is expressed in percent above the branches Aonidiella aurantii SP02 Aonidiella aurantii 98 100 28s ribosomal gene fragment Рис. 17. Дендрограмма сходства последовательностей фрагмента гена 18s This gene encodes rRNA of the large Aspidiotus nerii SM01 Aspidiotus nerii 100 97 исследуемых представителей Coccoidea (приведены названия видов и номер subunit of ribosomes participating in образца), построенная с помощью метода максимального правдоподобия. Parlatoria pergandii SO02 unavailable in the database - - protein synthesis. Along with internal Устойчивость, определенная бутстреп-анализом (500 альтернативных Subfamily Diaspidinae transcribed spacers (ITS), this gene is дендрограмм), дана в процентах над ветвями used for DNA studies of dipteran, hy- Pseudaulacaspis pentagona ST07 Pseudaulacaspis pentagona 99 86 menopterous insects, mites, etc. (NAPS). Chionaspis salicis SS04 unavailable in the database - - Sequences of 28s gene fragments were obtained for 14 taxa of the species Lepidosaphes ulmi SZ04 unavailable in the database - - level. They all, apart from Lepidosaphes Unaspis euonymi SN01 unavailable in the database - - Family Coccidae Ceroplastes sp. SLV01 Ceroplastes sp. 100 99 Соссus hesperidum SLM03 Соссus hesperidum 99 96 Family Pseudococcidae Planococcus citri SCC01 Planococcus citri 100 87 Pseudococcus longispinus SCS01 Pseudococcus longispinus 99 93 Family Margarodidae Margarodidae SCN01 Monophlebinae 98 96

30 3| 13| 2015 КАРАНТИН РАСТЕНИЙ КАРАНТИН РАСТЕНИЙ 3| 13| 2015 31 Table 7 Summary table of identification results for the Coccoidea species under study

BLAST NCBI identification EF1α 28s 18s Species under study Family Diaspididae Subfamily Aspidiotinae San Jose scale Diaspidiotus sp. Diaspidiotus sp. Quadraspidiotus perniciosus Quadraspidiotus perniciosus Red scale Aonidiella aurantii Aonidiella aurantii Aonidiella aurantii Aonidiella aurantii Fig. 18. 18s gene fragment sequences of the Coccoidea species under study (species names it should be noted that this fragment Yellow scale and sample numbers are given). Corresponding nucleotides are marked with letters, Aonidiella citrina Aonidiella sp. - reliably distinguishes the species on the Aonidiella citrina nucleotide identity in sequences shown by dots and deletions indicated by dashes level of families. Oleander scale Рис. 18. Последовательности фрагмента гена 18s исследуемых представителей Aspidiotus nerii Aspidiotus nerii Aspidiotus nerii Coccoidea (приведены названия видов и номер образца). Буквами обозначены Acknowledgements Aspidiotus nerii соответствующие нуклеотиды, точками показана идентичность нуклеотидов The authors express their gratitude to Chaff scale Parlatoria pergandii Parlatoria pergandii unavailable in the database в последовательностях, прочерками — делеции their FGBU VNIIKR’s colleagues – G.N. Parlatoria pergandii Matyashova, junior researcher at Re- Subfamily Diaspidinae ulmi, were identified using the GenBank differentiated from Lepidosaphes ulmi search and Testing Department, M.G. White peach scale Pseudaulacaspis Pseudaulacaspis (Table 5). Species of scale insects and belonging to the tribe Lepidosaphini. Bush, junior researcher at the Entomo- Pseudaulacaspis pentagona mealybugs, except for Quadraspidiotus On the whole, the obtained results are logical Laboratory of the Expert and Pseudaulacaspis pentagona pentagona pentagona perniciosus and species of the genera consistent with the DNA phylogeny of Testing Center, Ya.N. Kovalenko, candi- Willow scale Chionaspis salicis Chionaspis salicis unavailable in the database Aonidiella and Ceroplastes, are quite scale insects (Andersen et al., 2010). date of biological sciences, researcher at Chionaspis salicis accurately identified to the species level The quarantine white peach scale the Entomological Research and Meth- Apple mussel scale unavailable in the Lepidosaphes ulmi unavailable in the database by the 28s gene fragment owing to the can be identified by the fragment of this odology Department, and N.I. Ershova, Lepidosaphes ulmi database large number of sequences of the nu- gene, while identification of the San Jose senior researcher at the Entomological Euonymus scale clear genome region under study in the scale, as in the abovementioned case, is Laboratory of the Expert and Testing Unaspis euonymi Unaspis euonymi unavailable in the database GenBank. difficult due to the lack of data in the Center, for their assistance rendered Unaspis euonymi Analyzing the 28s gene fragment GenBank and high similarity between in collecting material and performing Family Coccidae sequences of the mealybugs and scale the sequences of the group of species some stages of work. Brown soft scale - Соссus hesperidum Соссus hesperidum insects under study through building belonging to the tribe Aspidiotini. Соссus hesperidum a dendrogram (Fig. 16), we discovered References Japanese wax scale a consistent pattern in the formation 18s ribosomal gene fragment 1. Borkhsenius N.S. Catalogue of - Ceroplastes sp. Ceroplastes sp. of species groups matching the group This gene encodes rRNA of the small Scale Insects (Diaspidoidea) of the Ceroplastes sp. system. All studied taxa of the species ribosomal subunit. This gene is also World Fauna. M.-L.: Nauka, 1966. 450 Family Pseudococcidae level were divided into four clades with used for DNA studies of insects. pp., available in Russian only. Citrus mealybug high bootstrap support (99-100%) 18s gene sequences were obtained for 2. Gavrilov I.A. Taxonomy and Planococcus citri Planococcus citri Planococcus citri Planococcus citri based on their membership in this or 13 taxa of the coccid species level. The Cytogenetics of Coccids (Homoptera: Long-tailed mealybug Pseudococcus that family. In their turn, scale insects GenBank had no sequences available Coccinea) of the European part of Rus- Pseudococcus longispinus Pseudococcus longispinus are divided into two groups matching for 5 species (Table 6). Analyzing these sia. Ph.D Thesis in Biological Sciences. Pseudococcus longispinus longispinus the two subfamilies in E.M. Dantsig’s sequences through building a dendro- Saint-Petersburg, 2005. 269 pp., availa- Family Margarodidae system (1993). The species of the gen- gram using the maximum likelihood ble in Russian only. Margarodidae - Monophlebinae Monophlebinae era Quadraspidiotus, Aonidiella and As- method enabled to classify the taxa of 3. Dantsig E.M. Suborder Coccinea. pidiotus in the subfamily Aspidiotinae the species level under study based on Families Phoenicoccidae and Diaspidi- Note: “-“ — a gene fragment sequence was not obtained. belonging to the tribe Aspidiotina are the membership in this or that fami- dae // The Fauna of Russia and Neigh- 12. NCBI. http://www.ncbi.nlm.nih. united in one group and distinguished ly (Fig. 17). Species of the scale insect boring Countries. № 144. Proboscidea Technological Institute. Maikop, 2000. 8. CABI. http://www.cabi.org/, ac- gov, accessed on 15 May 2015. from Parlatoria pergandii belonging to family were not readily differentiated Insects. Vol. 10. Saint-Petersburg: Nauka, P. 124–125, available in Russian only. cessed on 15 May 2015. 13. PQR — EPPO Plant Quarantine the tribe Parlatoriini. The same is ob- from one another into two subfamilies 1993. 453 pp., available in Russian only. 6. Yasnosh V.A. Japanese Wax Scale // 9. Miller D., Davidson J. (2005) Ar- Data Retrieval system, version 5.3.5. https:// served in classifying the genera Pseu- which was due to high similarity of se- 4. Kopina M.B., Gura N.A., Mugol Published Works of VIZR. M.-L., 1952. P. mored Scale Insect Pests of Trees and www.eppo.int/DATABASES/pqr/pqr.htm. daulacaspis, Chionaspis, Unaspis species quences in the species (differences often Khan G.N. Citrus Mealybug Planococ- 83-93, available in Russian only. Shrubs (Hemiptera: Diaspididae). Ith- 14. ScaleNet. 2013. URL http:// in the subfamily Diaspidinae – a group manifested themselves in single nucle- cus citri (Risso) Distribution, Damage 7. Andersen J.C., Wu J., Gruwell aca, United States. P. 456. www.sel.barc.usda.gov/scalenet/scalen- of species belonging to Diaspidini is otide substitutions, Fig. 18). Herewith, and Identification Methods // Plant M.E., Gwiazdowski R., Santana S.E., 10. Morse G.E., Normark B.B. et.htm, accessed on 15 May 2015. Health: Research and Practice. 2013. Feliciano N.M., Morse G.E., Normark (2006) A molecular phylogenetic study 15. Sethusa M.T., Millar I.M., Yessou- For species identification of mealybugs and scale insects, № 3. P. 53–59. B.B. (2010) A phylogenetic analysis of armoured scale insects (Hemiptera: fou K., Jacobs A., van der Bank M., van EF1α and 28s gene fragments with the largest number of 5. Shiryaeva N.V. Pests of urban of armored scale insects (Hemiptera: Diaspididae) // Systematic Entomology. der Bank H. (2014) DNA Barcode Effica- diagnostically significant variable regions can be used, plantations in the North Caucasus // Diaspididae), based upon nuclear, mi- Vol. 31. № 2. P. 338–349. cy for the Identification of Economical- Organisms, populations, ecosystems. tochondrial, and endosymbiont gene 11. NAPS Unit list of standard prim- ly Important Scale Insects (Hemiptera: while 18s gene is considerably more conserved and can’t be Proceedings of the 4-th Research and sequences // Mol. Phylogenet. Evol. № ers. http://www.msl.ubc.ca/services/ Coccoidea) in South Africa // African recommended for this purpose. Practice Conference at Maikop State 57 (3). P. 992–1003. naps, accessed on 15 May 2015. Entomology. Vol. 22. № 2. P. 257–266.

32 3| 13| 2015 КАРАНТИН РАСТЕНИЙ КАРАНТИН РАСТЕНИЙ 3| 13| 2015 33 ДИНАМИКА ОТНОСИТЕЛЬНОЙ ВОСПРИИМЧИВОСТИ сортов Vitis vinifera к Xylella fastidiosa

Араш Рашед1, Джойс Кван1, Бреанна Барафф1, Диана Линг1, Мэтью П. Доэрти2, Набил Киллини3, Родриго П.П. Алмейда1

1. Отдел экологии, стратегии и управления, Университет Калифорнии, Беркли, Калифорния, Соединенные Штаты Америки 2. Отдел энтомологии Университета Калифорнии, Риверсайд, Калифорния, Соединенные Штаты Америки 3. Научно-образовательный центр цитрусовых культур, Отдел энтомологии и нематологии, Университет Флориды, Флорида, Соединенные Штаты Америки

Введение воздействуют на патоген, ограни- (Hopkins, Purcell, 2002; Purcell, 1997). Восприимчивость растения-хо- чивая его размножение и сокращая Бактерия распространяется пере- зяина к заражениям патогенами популяцию (т.е. устойчивость), или носчиком и поражает ксилему. X. зависит от его генетической струк- ограничивая воздействие патогена fastidiosa вызывает болезнь Пирса на туры (May, Anderson, 1983), однако на фенотип растения-хозяина (т.е. винограде. Численность бактерии на проявление болезни постоянно толерантность). Следует отметить, в Калифорнии увеличилась после воздействуют факторы окружающей что уровни устойчивости к зараже- акклиматизации инвазивной цикад- среды, такие, как температура, воз- нию и толерантности к заражению ки Homalodisca vitripennis (Hemiptera: раст (Goss, Bergelson, 2006) и пище- у различных типов хозяев не всегда Cicadellidae) (Sorensen, Gill, 1996; Blua вое поведение хозяина (Laine, 2007), совпадает (Restif, Koella, 2004; Kover, et al., 1999; Purcell, Feil, 2001; Stenger а также генетические факторы (Laine Schaal, 2002; Raberg et al., 2007). et al., 2010). et al., 2011). В природных условиях, если особи одной популяции имеют Данное исследование было проведено с целью сравнения различную степень восприимчиво- уровня зараженности и выраженности симптомов сти, патоген действует как селектив- на десяти виноградных сортах, традиционно ный агент и будет воздействовать выращиваемых в Калифорнии и других районах в зависимости от приспособленно- возделывания винограда по всему миру. сти каждой отдельной особи (Restif, Koella, 2004). В сельскохозяйствен- Связь между количеством пато- X. fastidiosa проникает в здоро- ном производстве, тем не менее, раз- гена (уровнем заражения) и прояв- вый виноград, питаясь ксилемным личия в восприимчивости особей лением симптомов еще более важна соком, а затем размножается и рас- одной популяции могут быть сокра- при заражении болезнями, распро- пространяется по всему организму щены путем выращивания одного страняемыми переносчиками. При хозяина, колонизируя сосуды ксиле- сорта с определенным генотипом, заражении подобными болезнями мы (Chatterjee et al., 2008), что в ко- имеющим хозяйственное значение. результат взаимодействия патогена нечном итоге приводит к закупорке Однако выращиваемый сорт может и хозяина также может влиять на пи- сосудов, ограничивающей циркуля- оказаться восприимчив к патогенам, щевое поведение переносчика и его цию воды в растении (Tyson et al., что может привести к значительным выбор хозяина, и как следствие — на 1985; Fry, Milholland, 1990; Newman потерям урожая (Anderson, 1986; эпидемиологию болезни (McElhany et al., 2003; Alves et al., 2004). Хотя Рис. 1. Категоризация сортов Vitis vinifera по уровню их зараженности Kolmer, 1996; Leung, 2003). Однако et al., 1995). Xylella fastidiosa — это механизм патогенности еще не пол- X. fastidiosa и выраженности симптомов на A) 8-й B) 12-й и C) 16-й неделях благодаря защитным механизмам бактерия, заражающая большое ко- ностью изучен, дефицит воды, вви- после инокуляции. Планки погрешностей составляют 95% уровней доверия устойчивость хозяина может раз- личество растений-хозяев, включая ду закупорки ксилемы, — основная Fig. 1. Categorization of Vitis vinifera cultivars in relation to their X. fastidiosa виться уже после заражения. За- несколько экономически значимых причина проявления симптомов бо- infection level and symptom severity means at A) 8, B) 12, and C) 16 weeks post щитные механизмы отрицательно сельскохозяйственных культур лезни Пирса (Baccari, Lindow, 2011). inoculation. Error bars represent 95% confidence intervals

34 3| 13| 2015 КАРАНТИН РАСТЕНИЙ КАРАНТИН РАСТЕНИЙ 3| 13| 2015 35 Типичные симптомы болезни Пир- количество бактерий, и степень за- источниками заражения в вино- Материалы и методы В ходе опыта была установле- и набор Qiagen (Dneasy plant mini са — ожог листьев, неравномерное купорки ксилемы вдоль стебля так- градниках, где выращиваются более Черенки с двумя почками десяти на температура 22-26 оC. Освеще- Qiashredder, 2007). Для получения созревание побегов, черешки без же различна (Fry, Milholland, 1990; восприимчивые сорта (М.П. Доэрти, сортов винограда были укоренены ние (14:10, L:D) было дополнено максимального результата в лизиру- листовой пластины (так называемые Baccari, Lindow, 2011; Krivanek et al., неопубликованные результаты). в смесь перлита и вермикулита (в со- 1000-ватными лампами для теплич- ющий буфер добавили 0,5% лаурил «спичечные соломки»), усыхание 2005). Важность объективной ко- В данном исследовании термин отношении 1:1) в теплице исследова- ного освещения PL 2000 (P.L. Light саркозина и 10% ПВП-40 (поливи- верхушки и, в конечном итоге, ги- личественной оценки взаимосвязи «устойчивость» отражает отно- тельского цента «Oxford Tract» при Systems Inc., Линкольн, Онтарио, нилпирролидон). бель растения (Purcell, 1997; Krivanek между уровнем заражения и выра- сительную способность растения Калифорнийском Университете, Канада). Образцы растений отби- Подсчет количества патогена et al., 2005). женностью симптомов на различ- ограничить (или сократить) уровень Беркли, при этом применялась си- рали через каждые 4 недели спустя в растительной ткани проводили Различные виды растений-хозяев ных сортах V. vinifera стала еще бо- заражения, а термин «толерант- стема увлажнения туманом. Эта кол- 8 недель после инокулирования в режиме реального времени с ис- Х. fastidiosa различаются по своей лее очевидной в свете исследований, ность» — степень сохранения расте- лекция состояла их восьми техниче- в течение 3 месяцев подряд. Далее пользованием мастермикса SYBR восприимчивости к заражению дан- показавших, что: а) существует вза- нием здорового фенотипа, несмотря ских сортов винограда (cv. Barbera, период между инокуляцией и отбо- Green Mix (Applied Biosystems) ной бактерией; слива и кофе, судя по имосвязь между уровнем заражения на свою зараженность. Более того, Cabernet Franc, Cabernet Sauvignon, ром образцов будет называться «пе- на амплификаторе модели 7500 всему, относительно более воспри- и эффективностью распространения каждое из вышеописанных качеств Chardonnay, Chenin Blanc, Merlot, риодом инкубации». В каждом из (Applied Biosystems) в соответствии имчивы к заражению, чем цитру- с переносчиком (Hill, Purcell, 1997) рассматривается как метрическое Rubired, Zinfandel) и двух столовых трех периодов инкубации черешок с Daugherty et al. (2009). Все образцы совые культуры, т.е. большая часть и б) выбор хозяина переносчиком не постоянное, а не категорическая ха- сортов (cv. Flame Seedless, Thompson удаляли на расстоянии + 10 см над тестировали в трех повторностях, сосудов ксилемы колонизируется случаен и основан на выраженности рактеристика (Daugherty et al., 2009). Seedless). местом инокуляции. В последний а результаты были усреднены. Мы патогеном (Alves et al., 2004). Так- симптомов на хозяине (Daugherty et Относительный характер этих Выбраны были одни из наиболее период инкубации (16-я неделя), об- использовали праймеры HL5 и HL6, же, согласно имеющимся данным, al., 2011). двух терминов также усложняет зада- часто выращиваемых сортов в Кали- разцы были отобраны, как с +10 см, разработанные Francis et al. (2006). различные Vitis spp. имеют разную Наличие большого количества чу сравнения результатов различных форнии и в других районах. Серти- так и + 90 см над местом инокуляции. Для получения стандартной кривой степень восприимчивости к пато- бактерии может увеличить вероят- исследований, так как, помимо того, фицированные, свободные от пато- Отбор образцов с места инокуляции, ДНК X. fastidiosa выделяли из су- гену (Krivanek et al., 2005; Krivanek, ность того, что она успешно попа- что различия существуют между на- гена черенки в состоянии покоя от а также на расстоянии примерно 90 спензий культивированных клеток, Walker, 2005), при этом генотипы дет на переносчика, а значит — бу- борами исследуемых сортов, различ- каждого сорта были предоставлены см над ним позволил обнаруживать и часть этих суспензий использова- Vitis vinifera более восприимчивы дет успешно переноситься им (Hill, ные условия проведения испытаний «Foundation Plant Services» (Универ- потенциальное движение патогена ли для посева методом серийного к заражению Х. fastidiosa, чем другие Purcell, 1997; Daugherty et al., 2010). также могут значительно повлиять ситет Калифорнии, Дэвис). На не- и колонизацию новой ткани вино- разбавления для установления взаи- виды (Fritschi et al., 2008). Более того, предпочтение переносчи- на рост популяции бактерии и вы- зараженных сертифицированных града. Было сделано предположение, мосвязи между числом клеток и со- Сорта V. vinifera также различа- ком бессимптомных хозяев (Stenger раженность симптомов (Feil, Purcell, черенках разных сортов симптомы что различия в степени восприимчи- держанием ДНК. Число бактериаль- ются по степени восприимчивости et al., 2010; Daugherty et al., 2011) оз- 2001; Hill, Purcell, 1995). Данное ис- болезни не проявились, а тесты на вости объясняются структурными ных клеток оценивали на основе ко- к болезни Пирса (Krivanek et al., начает, что толерантные генотипы, следование было проведено с целью присутствие X. fastidiosa показали от- различиями между сортами, которые личества ДНК X. fastidiosa в 1 мг всей 2005; Hewitt et al., 1942; Purcell, 1974; которые могут содержать большое сравнения уровня зараженности рицательный результат. После разви- в различной степени ограничивают ДНК, выделенной из ткани черешка. Raju, Goheen, 1981). Эти различия количество бактерии, но практи- и выраженности симптомов на де- тия корневой системы черенки пере- рост патогенных микроорганизмов обусловлены тем, что на различных чески не проявляют симптомы бо- сяти виноградных сортах, традици- саживали в горшки диаметром 5 см, и их движение (Baccari, Lindow, 2011). Статистический анализ генотипах присутствует различное лезни, могут быть потенциальными онно выращиваемых в Калифорнии наполненные почвой для горшечных Растения оценивались по вы- Для проверки различий в выра- и других районах возделывания ви- культур «Supersoil potting soil» (Rod раженности симптомов по шкале женности симптомов использовали Рис 2. Различия коэффициентов ранговой корреляции между выраженностью нограда по всему миру. Устойчивость McLellan Company, Сан-Матео, Ка- от 0 до 5, предложенной Guilhabert двухмерную обобщенную линейную симптомов и между уровнем заражения на 10 сортах винограда в динамике и толерантность сорта оценивалась лифорния, США). Затем эти укоре- и Kirkpatrick (2005) (0 = бессимптом- модель со смешанными эффектами последовательно для анализа взаи- ненные черенки были перемещены ное, 1 = один или 2 листа с обожжен- (GLM-модели) с распределением Пу- Fig. 2. Variations in Spearman rho correlations between symptom severity мосвязи между этими двумя каче- в горшки объемом один галлон (3,78 ными краями, 2 = дополнительно 2–3 ассона. Сорт растений и период ин- and infection level of the 10 evaluated grape cultivars over time ствами и установления взаимосвязи л) со смесью Supersoil (50%), песка листа с ожогом, 3 = ожог всех листьев кубации были установлены как фик- между изменением уровня устойчи- (25%) и вермикулита (25%). Горшки и несколько черешков без листовой сированные эффекты. Идентичность вости и толерантности в зависимо- хранились в одном и том же месте пластины, 4 = все листья с сильным растений в повторностях рассма- сти от развития заражения. в защищенной от насекомых теплице. ожогом и большое количество че- тривали как случайный эффект. Эта структура модели была необходима Уровень зараженности и выраженность симптомов для учета повторных измерений, значительно различались среди десяти тестируемых сделанных на отдельных растениях, сортов и трех периодов инкубации. и ненормальных погрешностей. Двухмерная модель повторных из- Инокулят патогена был полу- решков без листовой пластины, 5 = мерений со смешанными эффектами чен путем выращивания клеток всего лишь несколько листьев на с диагональным повторным ковари- Х. fastidiosa (штамм STL) на среде конце лозы). Симптомы оценива- антом использовали для сравнения PWG и их суспендирования в буфере лись одновременно с отбором об- уровня заражения в сортах виногра- SCP (Hill, Purcell, 1995). Двадцать ми- разцов черешков в каждый период да. Сорт и период инкубации (по- кролитров этой суспензии использо- инкубации (8-я, 12-я и 16-я недели). вторное измерение) рассматривали вали для механической инокуляции Отобранные образцы черешков хра- как категориальные переменные 6-месячных растений винограда нили при -80 оC для последующего с фиксированным эффектом. Кри- в основание ствола при помощи подсчета количества бактерий. терий Тьюки (критерий достоверно иглы в конце декабря 2009 года. Ино- значимой разницы (HSD)) исполь- куляция проводились в два этапа. На Подсчет количества бактерий зовали для проведения сравнитель- каждом этапе инокулировали десять Образцы черешков заморажи- ного анализа пар по полученным ре- растений каждого из десяти сортов. вали в жидком азоте и измельчали зультатам. Время инокуляции никак Растения регулярно обрезались для при помощи ступки и пестика. Для не влияло на результаты анализов удаления боковых побегов и сохра- выделения ДНК использовали авто- (P.0.68 в обоих случаях), и поэто- нения высоты примерно 120–150 см. матизированную станцию QIAcube му оно было исключено из оконча-

36 3| 13| 2015 КАРАНТИН РАСТЕНИЙ КАРАНТИН РАСТЕНИЙ 3| 13| 2015 37 8. Leung H., Zhu Y., Revilla-Molina 21. Newman K.L., Almeida R.P.P., vector transmission efficiency: Inocu- I., Fan J.X., Chen H., et al. (2003) Using Purcell A.H., Lindow S.E. (2003) Use lum supply and plant infection dynam- genetic diversity to achieve sustainable of green fluorescent strain for analysis ics. Ann. Appl. Biol. 155: 361-369. rice disease management. Plant Dis 87: of Xylella fastidiosa colonization of Vitis 34. Feil H., Purcell A.H. (2001) Tem- 1156-169. vinifera. Appl. Environ. Microbiol. 101: perature-dependent growth and sur- от конкретного сорта, но уровень 9. Kover P.X., Schaal B.A. (2002) Ge- 1737-1742. vival of Xylella fastidiosa in vitro and in зараженности в двух точках отбора netic variation for disease resistance and 22. Alves E., Marucci C.R., Lopes potted grapevines. Plant Dis. 85: 1230- образцов также значительно зависел tolerance among Arabidopsis thaliana J.R.S., Leite B. (2004) Leaf symptoms 1234. от сорта. accessions. Proc. Nat. Acad. Sci. USA 9: on plum, coffee and citrus and the rela- 35. Hill B.L., Purcell A.H. (1995) 11270-11274. tionship with the extent of xylem vessels Multiplication and movement of Xylel- Обсуждение 10. Raberg L., Sim D., Read A.F. colonized by Xylella fastidiosa. Phytopa- la fastidiosa within grapevine and four Десять сортов винограда показа- (2007) Disentangling genetic variation thology 152: 291-297. other plants. Phytopathology 85: 1368- ли различную степень восприимчи- for resistance and tolerance to infec- 23. Baccari C., Lindow S.E. (2011) 1372. вости к заражению и выраженности tious diseases in animals. Science 318: Assessment of the process of movement 36. Guilhabert M.R., Kirkpatrick B.C. симптомов болезни Пирса. Посто- 812-184. of Xylella fastidiosa within susceptible (2005) Identification of Xylella fastidio- янная взаимосвязь между уровнем 11. McElhany P., Real L.A., Power and resistant grape cultivars. Phytopa- sa antivirulence genes: Hemagglutinin зараженности и выраженностью A.G. (1995) Vector preference and dis- thology 101: 77-84. adhesins contribute to X. fastidiosa bi- симптомов не была выявлена. Уро- ease dynamics: a study of barley yellow 24. Krivanek A.F., Stevenson J.F., ofilm maturation and colonization and вень зараженности был различен dwarf virus. Ecology 76: 444-457. Walker M.A. (2005) Development and attenuate virulence. Mol. Plant Microbe Рис. 3. Уровни зараженности в черешках каждого сорта, отобранных на в различные промежутки времени. 12. Hopkins D.L., Purcell A.H. (2002) comparison of symptom indices for quan- Interact. 18: 848-856. расстоянии +10 см и +90 см выше места инокуляции. Белыми столбиками Взаимосвязь между выраженностью Xylella fastidiosa: cause of Pierce’s dis- tifying grapevine resistance to Pierce’s dis- 37. Francis M., Lin H., Cabrera-La показаны уровни зараженности на расстоянии +10 см, черными – +90 см. симптомов и уровнем зараженно- ease of grapevine and other emergent ease. Phytopathology 95: 36-43. Rosa J., Doddapaneni H., Civerolo E.L. Планки погрешностей — ±1 стандартная ошибка сти четко наблюдалась только на diseases. Plant Dis. 86: 1056-1066. 25. Krivanek A.F., Walker M.A. (2006) Genome-based PCR primers Fig. 3. Infection levels of the petioles collected from +10 and +90 cm above the point of 12-й неделе после инокуляции. Ре- 13. Purcell A.H. (1997) Xylella fas- (2005) Vitis resistance to Pierce’s dis- for specific and sensitive detection and inoculation (POI) for each cultivar. Open bars refer to the infection levels at 10-cm above зультаты исследования показывают, tidiosa, a regional problem or global ease is characterized by differential Xy- quantification of Xylella fastidiosa. Eur. the point of inoculation. Filled bars represent the infection level of the petiole samples что устойчивость и толерантность threat? J. Plant Pathol. 79: 99-105. lella fastidiosa populations in stems and J. Plant Pathol. 115: 203-213. taken 90-cm above the point of inoculation. Error bars represent ±1 SE сортов Vitis vinifera к заражению со 14. Sorensen J.T., Gill R.J. (1996) A leaves. Phytopathology 95: 44-52. 38. Crawley M.J. (2009) The R Book. временем меняется. range extension of Homalodisca coagu- 26. Fritschi F.B., Lin H., Walker M.A. John Wiley & Sons, Chichester, UK. тельных моделей. Логарифмическое симптомов на каждом сорте (n = 10 late (Say) (Hemiptera: Clypeorrhyncha: (2008) Scanning electron microscopy 39. Fritschi F.B., Lin H., Walker M.A. преобразование данных об уровне сортов). Анализ взаимосвязи прово- Литература Cicadellidae) to southern California. reveals different response pattern of (2007) Xylella fastidiosa population dy- зараженности дало наиболее точный дили для каждого из трех временных 1. May R.M., Anderson R.M. (1983) Pan Pacific Entomol. 72: 160-161. four Vitis genotypes to Xylella fastidiosa namics in grapevine genotypes differing подбор для кривой нормальности. отрезков. Epidemiology and genetics in the coev- 15. Blua M.J., Phillips P.A., Redak infection. Plant Dis. 92: 276-286. in susceptibility to Pierce’s disease. Am. На 16-й неделе было проведено olution of parasites and hosts. Proc. R. R.A. (1999) A new sharpshooter threat- 27. Hewitt W.B., Frazier N.W., Hou- J. Enol. Viti. 58: 326-332. сравнение уровней зараженности Результаты Soc. B 219: 281-313. ens both crops and ornamentals. Calif. ston B.R. (1942) Pierce’s disease of 40. Hopkins D.L. (1989) Xylella fas- в образцах черешков, отобранных Уровень зараженности и выра- 2. Laine A.-L., Burdon J.J., Dodds Agric. 53: 22-25. grapevine. Calif. Agric. Exp. Stn. Circ. tidiosa - xylem-limited bacterial patho- на расстоянии +10 см и +90 см от ме- женность симптомов значительно P.N., Thrall P.H. (2011) Spatial variation 16. Purcell A.H., Feil H. (2001) 353: 1-32. gen of plants. Ann. Rev. Phytopath. 27: ста инокуляции. Ввиду зависимости различались среди десяти тестиру- in disease resistance: from molecules to Glassy-winged sharpshooter. Pesticide 28. Purcell A.H. (1974) Spatial pat- 271-90. между образцами с двумя череш- емых сортов и трех периодов инку- metapopulations. J. Ecol. 99: 96-112. Outlook 12: 199-203. terns of Pierce’s disease in the Napa Val- 41. Rashed A., Daugherty M.P, Almei- ками в каждом растении также ис- бации. Несмотря на то, что продол- 3. Laine A.-L. (2007) Pathogen fit- 17. Stenger D.C., Sisterson M.S., ley. Am. J. Enol. Viti. 25: 162-167. da R.P.P. (2011) Grapevine genotype sus- пользовали двухмерную модель по- жительность инкубации оказалась ness components and genotypes differ French R. (2010) Population genetics of 29. Raju B.C., Goheen A.C. (1981) ceptibility to Xylella fastidiosa does not вторных измерений со смешанными незначима, в целом наблюдалось in their sensitivity to nutrient and tem- Homalodisca vitripennis reovirus vali- Relative sensitivity of selected grape- predict vector transmission success. En- эффектами с диагональным повтор- снижение уровней зараженности perature variation in a wild plant-path- dates timing and limited introduction vine cultivars to Pierce’s disease bacte- viron. Entomol. 40: 1192-1199. ным ковариантом для сравнения в промежутке между 8-й и 16-й не- ogen association. J. Evol. Biol. 20: 2371- to California of its invasive insect host, rial inoculations. Am. J. Enol. Viti. 32: 42. Hopkins D.L. (1981) Seasonal уровней зараженности в этот день. делями, а выраженность симптомов 2378. the glassy-winged sharpshooter. Virol- 155-158. concentration of the Pierce’s disease bac- Первоначальная модель учитывала при этом увеличивалась (рис. 1). 4. Goss E.M., Bergelson J. (2006) ogy 407: 53-59. 30. Hill B.L., Purcell A.H. (1997) terium in grapevine stems, petioles, and промежуток времени, сорт и место В некоторых сортах постоянно на- Variation in resistance and virulence 18. Chatterjee S., Almeida R.P.P., Populations of Xylella fastidiosa in leaf veins. Phytopathology 71: 415-418. отбора образца (повторное изме- блюдался высокий уровень заражен- in the interaction between Arabidopsis Lindow S (2008) Living in two worlds: plants required for transmission by an 43. Sisterson M.S. (2008) Effects of рение), а также взаимосвязь между ности (например, Barbera), в других thaliana and a bacterial pathogen. Evo- The plant and insect lifestyles of Xylel- efficient vector. Phytopathology 87: insect-vector preference for healthy or сортом и местом отбора образца. же уровень зараженности со време- lution 60: 1562-1573. la fastidiosa. Ann. Rev. Phytopath. 46: 1197-1201. infected plants on pathogen spread: in- Промежуток времени был удален из нем снижался (например, Zinfandel, 5. Restif O., Koella J.C. (2004) Con- 243-271. 31. Daugherty M.P., Rashed A., sights from a model. J. Econom. Ento- нашей окончательной модели, а пер- Cabernet sauvignon и Flame seedless). current evolution of resistance and 19. Tyson G.E., Stojanovic B.J., Kuk- Almeida R.P.P., Perring T.M. (2011) mol. 101: 1-8. воначальный анализ не выявил су- Результаты повторных измерений tolerance to pathogens. Am. Nat. 164: linski R.F., DiVittorio T.J., Sullivan M.L. Vector preference for host infection sta- 44. Blua M.J., Perring T.M. (1992) Ef- щественного воздействия этой пере- по GLM-моделям показали значи- E90-E102. (1985) Scanning electron microscopy tus: Sharpshooter movement and Xylella fects of zucchini yellow mosaic virus on менной (F1, 252,2 = 0,019; P = 0,890). тельные различия в выраженности 6. Anderson T.R. (1986) Plant losses of Pierce’s disease bacterium in petiolar fastidiosa trans-mission. Ecol. Entomol. feeding behavior of Aphis gossypii (Ho- Корреляцию Пирсона (P. Corr.) ис- симптомов у различных сортов. and yield responses to monoculture of xylem of grape leaves. Phytopathology 36: 654-662. moptera: Aphididae) alatae. Environ. пользовали для оценки взаимосвязи Мы не выявили никаких значи- soybean cultivars susceptible, tolerant, 75: 264-269. 32. Daugherty M.P., Lopes J., Almei- Entomol. 21: 578-585. между уровнем зараженности и вы- тельных различий между уровнями and resistant to Phytophthora megasper- 20. Fry S.M., Milholland R.D. (1990) da R.P.P. (2010) Vector within-host 45. Mauck K.E., De Moraes C.M., раженностью симптомов на сортах. зараженности на растении 10 см ma f. sp. Glycinea. Plant Dis. 70: 468-471. Multiplication and translocation of Xy- preference mediates transmission of a Mescher M.C. (2010) Deceptive chem- Для этого была оценена взаимосвязь и 90 см над местом инокуляции на 7. Kolmer J.A. (1996) Genetics of re- lella fastidiosa in petioles and stems of heterogeneously distributed pathogen. ical signals induced by a plant virus между средним уровнем заражен- 16-й неделе. Однако не только об- sistance to wheat rust. Ann. Rev. Phyto- grapevine resistant, tolerant, and sus- Ecol Entomol. 35: 360-366. attract insect vectors to inferior hosts. ности и средней выраженностью щий уровень зараженности зависел path. 34: 435-455. ceptible to Pierce’s disease. Phytopathol- 33. Daugherty M.P., Bosco D., Almei- Proc. Nat. Acad. Sci. USA 107: 3600- ogy 80: 61-65. da R.P.P. (2009) Temperature mediates 3605.

38 3| 13| 2015 КАРАНТИН РАСТЕНИЙ КАРАНТИН РАСТЕНИЙ 3| 13| 2015 39 species (Krivanek et al., 2005; Krivanek, can greatly influence bacterial popula- inoculated in each block. Experimental Walker, 2005) with Vitis vinifera geno- tion growth and symptom severity (Feil, plants were regularly trimmed from the RELATIVE SUSCEPTIBILITY types being more susceptible to X. fas- Purcell, 2001; Hill, Purcell, 1995). This side-shoots and pruned to stay approx- tidiosa infection than other Vitis spp. study was conducted to compare infec- imately 120-150 cm in height. During of Vitis vinifera Cultivars to Xylella fastidiosa (Fritschi et al., 2008). tion level and symptom severity in 10 the experiment, temperature was set Within V. vinifera, different cultivars grapevine cultivars that are commonly to 22-26 oC. Lighting (14:10, L:D) was through Time also exhibit variation in susceptibility grown in California and in other viti- supplemented by 1000 Watt, PL 2000 to Pierce’s disease Krivanek et al., 2005; cultural regions across the globe. Re- greenhouse lights (P.L. Light Systems Arash Rashed1, Joyce Kwan1, Breanna Baraff1, Diane Ling1, Matthew P. Daugherty2, Hewitt et al., 1942; Purcell, 1974; Raju, sistance and tolerance were evaluated in Inc., Lincoln, ON, Canada). Plants 3 1 Goheen, 1981); this variation has been each cultivar at successive time points to were sampled every 4 weeks, starting 8 Nabil Killiny , Rodrigo P.P. Almeida attributed to among-genotype differ- see whether these traits are correlated weeks post-inoculation, for 3 consecu- ences in bacterial quantities and the rate and whether their relative levels change tive months. Hereafter, the period be- 1. Department of Environmental Science, Policy, and Management, University of California, of xylem occlusion along the stem tissue as infection progresses. tween inoculation and sampling date is (Fry, Milholland, 1990; Baccari, Lindow, referred to as ‘incubation time’. At each Berkeley, California, United States of America 2011; Krivanek et al., 2005). The im- Materials and Methods of the three incubation times a petiole 2. Department of Entomology, University of California Riverside, Riverside, California, United portance of an objective quantification Two-bud cuttings of 10 grape culti- was removed from +10-cm above the States of America for the relation-ship between infection vars were rooted in a mix of perlite and point of inoculation. In the last incu- level and symptom severity of different vermiculite (1:1) on a misting bench in bation period (week 16), samples were 3. Citrus Research and Education Center, Department of Entomology and Nematology, V. vinifera cultivars became more evi- the Oxford Tract greenhouse facility at removed from both +10 and +90-cm University of Florida, IFAS, Lake Alfred, Florida, United States of America dent in light of studies showing, i) the the University of California, Berkeley. above the point of inoculation. Sam- correlation between host infection level This collection included 8 wine grape plings plants at the point of inoculation and vector trans-mission efficiency Hill, cultivars (cv. Barbera, Cabernet Franc, and also approximately 90-cm above PLoS ONE 8(2) e55326 doi: 10.1371/journal.pone.0055326 Purcell, 1997), and ii) vector non-ran- Cabernet Sauvignon, Chardonnay, the point of inoculation would allow dom preference based on host symp- Chenin Blanc, Merlot, Rubired, Zin- detecting potential movement and new toms status (Daugherty et al., 2011). fandel) and 2 table grape cultivars (cv. colonization of succulent vine tissue; it Vector exposure to higher bacterial Flame Seedless, Thompson Seedless). has been suggested that variations in quantities can increase the probability These varieties were selected because susceptibility can be due to structur- of successful pathogen acquisition, and they are among the most commonly al differences among plant cultivars, subsequently, increase its overall trans- grown cultivars in California vineyards which restricts pathogen growth and mission efficiency (Hill, Purcell, 1997; and elsewhere. Certified pathogen free movement to various degrees (Bacca- Daugherty et al., 2010). In addition, vec- dormant cuttings of each cultivar were ri, Lindow, 2011). Plants were scored Introduction pathogen by limiting its multiplication Xylella fastidiosa is inoculated into for symptoms, following a 0 to 5 scale Variation in susceptibility to path- and reducing its population (i.e. resist- a healthy grapevine during insect xy- This study was conducted to compare infection level proposed by Guilhabert and Kirkpat- ogenic infections is a function of the ance), or by limiting its impact on host lem-sap feeding, then multiplies and and symptom severity in 10 grapevine cultivars that are rick (2005) (0 = asymptomatic, 1 = host genetic structure (May, Ander- phenotype (i.e. tolerance). Notably, lev- spreads throughout the host by colo- commonly grown in California and in other viticultural One or 2 leaves with scorched margins, son, 1983), however, constant geno- els of resistance to infection and toler- nizing xylem vessels (Chatterjee et al., regions across the globe. 2 = Two to 3 more developed scorched type-by-environment interactions can ance of infection among different host 2008). Bacterial colonization of the leaves, 3 = All leaves scorched and a influence the degree of disease expres- types are not necessarily correlated with xylem network eventually leads to oc- tor preference for asymptomatic hosts provided by Foundation Plant Services, few match-stick petioles, 4 = All leaves sion in host plants (Goss, Bergelson, each other (Restif, Koella, 2004; Kover, clusion of vessels, limiting water flow (Stenger et al., 2010; Daugherty et al., University of California, Davis. Unin- heavily scorched and many match-stick 2006). Examples of these environmen- Schaal, 2002; Raberg et al., 2007). through the plant (Tyson et al., 1985; 2011) means that tolerant genotypes – fected certified cuttings of different cul- petioles, 5 = A few leaves only present tal variables include, but are not limit- The relationship between pathogen Fry, Milholland, 1990; Newman et al., which can host high bacterial quan- tivars never developed disease symptom at the end of the cane). Symptom scores ed to, ambient incubation temperature, quantity (hereafter infection level) and 2003; Alves et al., 2004). Although tities and yet exhibit limited disease nor tested positive for X. fastidiosa. Fol- were recorded at the same time as pet- host nutrient status (Laine, 2007), and symptom severity becomes even more mechanism of pathogenicity has not symptoms – may potentially function lowing root development, cuttings were iole samplings in each incubation time host age (Laine et al., 2011). In natural crucial in vector-borne disease com- been fully elucidated, water stress due as a pathogen source for vineyards con- transplanted into 5-cm pots filled with (weeks 8, 12, and 16). Collected petioles circumstances, when variation in sus- plexes, where the outcome of patho- to xylem blockage is an important trig- taining more susceptible cultivars (MP Supersoil potting soil (Rod McLellan were stored at -80 oC for later bacterial ceptibility exists among individuals in a gen-host interactions is expected to also ger for Pierce’s disease symptoms (Bac- Daugherty, unpublished results). Company, San Mateo, CA, USA). Later, quantification. given population, pathogens would ef- influence vector host choice and feed- cari, Lindow, 2011). Typically, Pierce’s In the present study the term ‘resist- these rooted grapevine cuttings were fectively act as selective agents because ing behavior, and subsequently disease disease symptoms include progressive ance’ is used as a reflection of a plant’s transferred into 1-gallon pots filled with Bacterial Quantification they are expected to impact fitness of epidemiology (McElhany et al., 1995). leaf scorch, irregular cane maturation, relative ability to limit (or reduce) in- a mix of Supersoil (50%), sand (25%), Petiole samples were frozen in liquid individuals differentially (Restif, Koella, Xylella fastidiosa is a vector-borne xy- ‘match-stick’ petioles (petiole with no fection level, whereas ‘tolerance’ reflects and vermiculite (25%), and maintained nitrogen and ground using mortar and 2004). In agricultural systems, howev- lem-limited bacterium that infects a leaf blade), dieback of the apex, and the extent to which a plant can maintain in an insect free glasshouse in the same pestle. A robotic workstation QIAcube er, among-individual variability may be wide range of host plants, including sev- ultimately plant death (Purcell, 1997; a healthy phenotype despite infection. facility. Pathogen inoculum was pre- and a Qiagen extraction kit (Dneasy minimized by the use of a particular cul- eral economically important agricultur- Krivanek et al., 2005). Moreover, each of the above-mentioned pared by growing X. fastidiosa subspe- plant mini with Qiashredder, 2007), tivar, where a certain genotype is desir- al crops (Hopkins, Purcell, 2002; Pur- Different species of X. fastidiosa host traits is assumed to exist as a continuous cies fastidiosa (STL strain) cells on PWG was then used to perform all DNA ex- able because of its associated economic cell, 1997). In grapevines, X. fastidiosa plants vary in their susceptibility to in- metric rather than a categorical state medium and suspending them in SCP tractions. To maximize yield, the lysis value. In practice this can result in sig- causes Pierce’s disease, which increased fection; plum and coffee plants appear (Daugherty et al., 2009). buffer (Hill, Purcell, 1995). Twenty mi- buffer was supplemented with 0.5% nificant yield loss if the plant genotype in prevalence in California following to be relatively more susceptible to in- The relative nature of the two defi- croliter of this suspension was used to lauryl sarcosine and 10% PVP-40 (pol- is susceptible to pathogens (Anderson, the establishment of an invasive leaf- fection than citrus, in that a higher pro- nitions tolerance and resistance would mechanically needle-inoculate 6-month yvinylpyrrolidine). Pathogen absolute 1986; Kolmer, 1996; Leung, 2003). How- hopper vector Homalodisca vitripennis portion of their xylem vessels become also make between-study comparisons a old grapevines at the stem base, in late quantification within plant tissue was ever, post-infection plant resistance can (Hemiptera: Cicadellidae) (Sorensen, colonized by the pathogen (Alves et al., difficult task, as in addition to differenc- December 2009. Inoculations were performed with SYBR Green Mix (Ap- be achieved through defensive mecha- Gill, 1996; Blua et al., 1999; Purcell, Feil, 2004). Similarly, variation in suscepti- es between pools of evaluated cultivars, performed in 2 temporal blocks. Ten plied Biosystems) on a 7500 real-time nisms that either negatively impact the 2001; Stenger et al., 2010). bility has been reported among grape differences in experimental conditions plants of each of the 10 cultivars were thermocycler (Applied Biosystems)

40 3| 13| 2015 КАРАНТИН РАСТЕНИЙ КАРАНТИН РАСТЕНИЙ 3| 13| 2015 41 according to Daugherty et al. (2009); ed measure) were treated as fixed effect relation (P. Corr.) was used to evaluate all samples were run in triplicate and categorical variables. Tukey (Honestly the relationship between infection level results were averaged. We used primers Significant Difference (HSD)) was used and symptom severity among cultivars. HL5 and HL6 designed by Francis et al. for any post hoc pairwise comparisons. To do this, mean infection level was cor- (2006). To obtain the standard curve, X. Inoculation block did not have a sig- related with mean symptom severity for fastidiosa DNA was extracted from sus- nificant effect in either analysis (P.0.68 each cultivar (n=10 cultivars). Separate pensions of cultured cells while portions in both), and was therefore dropped correlations were conducted at each of of these suspensions were used to plate from final models. Log-transformed the three time points. serial dilutions to correlate the number infection levels provided the closest fit of cells with the content of DNA. Bacte- Results rial cell numbers were estimated based Infection level varied Infection level varied significantly on X. fastidiosa DNA quantity within significantly among the 10 among the 10 evaluated cultivars and 1mg of total extracted DNA from pet- evaluated cultivars and across across three incubation times. Although iole tissue. three incubation times. incubation time-by-cultivar interaction was non-significant, collectively, aver- Statistical Analysis to the normality curve. On week 16, age cultivar infection levels decreased To test for differences in symptom infection levels of the petioles sampled between weeks 8 and 16, while symp- scores a two-way generalized linear at +10-cm and +90-cm from the point tom severity increased (Fig. 1). Some mixed effects model (GLMM) with of inoculation were compared. Due to cultivars had consistently high infection Poisson error distribution was used. the lack of independence between the levels (e.g., Barbera), and others showed Plant cultivar and disease incubation two-petiole samples within each plant, a decrease in infection level over time time were defined as fixed effects. Plant a two-way repeated-measures mixed-ef- (e.g., Zinfandel, Cabernet sauvignon, replicate identity was treated as a ran- fects model with diagonal repeated co- and Flame seedless). Results of the re- dom effect. This model structure was variance was also used to compare in- peated measures GLMM showed sig- needed to account for the repeated fection levels at this date. Initial model nificant differences in symptom score measures made on individual plants and included block, grape cultivar, and among cultivars and incubation times. non-normal error. sampling position (repeated measure) Yet, there were differences in symptom A two-way repeated-measures and cultivar-by-sampling position in- severity changes over time among the mixed-effects model, with diagonal re- teraction. Block was removed from our evaluated cultivars. peated covariance, was used to compare final model, as initial analysis detected infection level among grape cultivars. no significant effect of this variable (F1, Discussion Cultivar and incubation time (repeat- 252.2 = 0.019; P = 0.890). Pearson’s cor- The 10 grapevine cultivars tested in this study showed variability in their Fig. 2. Variations in Spearman rho correlations between symptom severity susceptibility to infection as well as and infection level of the 10 evaluated grape cultivars over time Pierce’s disease symptom expression. Cultivars did not show a consistent pat- Рис 2. Различия коэффициентов ранговой корреляции между выраженностью tern of susceptibility as the correlation симптомов и между уровнем заражения на 10 сортах винограда в динамике between symptom expression and infec- tion level varied across sampling dates; a positive correlation between symp-

Fig. 1. Categorization of Vitis vinifera cultivars in relation to their X. fastidiosa infection level and symptom severity means at A) 8, B) 12, and C) 16 weeks post inoculation. Error bars represent 95% confidence intervals Рис. 1. Категоризация сортов Vitis vinifera по уровню их зараженности X. fastidiosa и выраженности симптомов на A) 8-й B) 12-й и C) 16-й неделях после инокуляции. Планки погрешностей составляют 95% уровней доверия

42 3| 13| 2015 КАРАНТИН РАСТЕНИЙ КАРАНТИН РАСТЕНИЙ 3| 13| 2015 43 tom score and infection level among 5. Restif O., Koella J.C. (2004) Con- 11. McElhany P., Real L.A., Power of Pierce’s disease bacterium in petiolar 28. Purcell A.H. (1974) Spatial pat- 37. Francis M., Lin H., Cabrera-La the evaluated cultivars was observed current evolution of resistance and A.G. (1995) Vector preference and dis- xylem of grape leaves. Phytopathology terns of Pierce’s disease in the Napa Val- Rosa J., Doddapaneni H., Civerolo E.L. only on week 12 post-inoculation. This tolerance to pathogens. Am. Nat. 164: ease dynamics: a study of barley yellow 75: 264-269. ley. Am. J. Enol. Viti. 25: 162-167. (2006) Genome-based PCR primers finding suggests that within V. vinifera, E90-E102. dwarf virus. Ecology 76: 444-457. 20. Fry S.M., Milholland R.D. (1990) 29. Raju B.C., Goheen A.C. (1981) for specific and sensitive detection and the degree of cultivar resistance and tol- 6. Anderson T.R. (1986) Plant losses 12. Hopkins D.L., Purcell A.H. (2002) Multiplication and translocation of Xy- Relative sensitivity of selected grape- quantification of Xylella fastidiosa. Eur. erance varies over time. and yield responses to monoculture of Xylella fastidiosa: cause of Pierce’s dis- lella fastidiosa in petioles and stems of vine cultivars to Pierce’s disease bacte- J. Plant Pathol. 115: 203-213. soybean cultivars susceptible, tolerant, ease of grapevine and other emergent grapevine resistant, tolerant, and sus- rial inoculations. Am. J. Enol. Viti. 32: 38. Crawley M.J. (2009) The R Book. References and resistant to Phytophthora megasper- diseases. Plant Dis. 86: 1056-1066. ceptible to Pierce’s disease. Phytopathol- 155-158. John Wiley & Sons, Chichester, UK. 1. May R.M., Anderson R.M. (1983) ma f. sp. Glycinea. Plant Dis. 70: 468-471. 13. Purcell A.H. (1997) Xylella fas- ogy 80: 61-65. 30. Hill B.L., Purcell A.H. (1997) 39. Fritschi F.B., Lin H., Walker M.A. Epidemiology and genetics in the coev- 7. Kolmer J.A. (1996) Genetics of re- tidiosa, a regional problem or global 21. Newman K.L., Almeida R.P.P., Populations of Xylella fastidiosa in (2007) Xylella fastidiosa population dy- olution of parasites and hosts. Proc. R. sistance to wheat rust. Ann. Rev. Phyto- threat? J. Plant Pathol. 79: 99-105. Purcell A.H., Lindow S.E. (2003) Use plants required for transmission by an namics in grapevine genotypes differing Soc. B 219: 281-313. path. 34: 435-455. 14. Sorensen J.T., Gill R.J. (1996) A of green fluorescent strain for analysis efficient vector. Phytopathology 87: in susceptibility to Pierce’s disease. Am. 2. Laine A.-L., Burdon J.J., Dodds 8. Leung H., Zhu Y., Revilla-Molina range extension of Homalodisca coagu- of Xylella fastidiosa colonization of Vitis 1197-1201. J. Enol. Viti. 58: 326-332. P.N., Thrall P.H. (2011) Spatial variation I., Fan J.X., Chen H., et al. (2003) Using late (Say) (Hemiptera: Clypeorrhyncha: vinifera. Appl. Environ. Microbiol. 101: 31. Daugherty M.P., Rashed A., 40. Hopkins D.L. (1989) Xylella fas- in disease resistance: from molecules to genetic diversity to achieve sustainable Cicadellidae) to southern California. 1737-1742. Almeida R.P.P., Perring T.M. (2011) tidiosa – xylem-limited bacterial path- metapopulations. J. Ecol. 99: 96-112. rice disease management. Plant Dis 87: Pan Pacific Entomol. 72: 160-161. 22. Alves E., Marucci C.R., Lopes Vector preference for host infection sta- ogen of plants. Ann. Rev. Phytopath. 27: 3. Laine A.-L. (2007) Pathogen fit- 1156-169. 15. Blua M.J., Phillips P.A., Redak J.R.S., Leite B. (2004) Leaf symptoms tus: Sharpshooter movement and Xylella 271-90. ness components and genotypes differ 9. Kover P.X., Schaal B.A. (2002) Ge- R.A. (1999) A new sharpshooter threat- on plum, coffee and citrus and the rela- fastidiosa trans-mission. Ecol. Entomol. 41. Rashed A., Daugherty M.P, in their sensitivity to nutrient and tem- netic variation for disease resistance and ens both crops and ornamentals. Calif. tionship with the extent of xylem vessels 36: 654-662. Almeida R.P.P. (2011) Grapevine gen- perature variation in a wild plant-path- tolerance among Arabidopsis thaliana Agric. 53: 22-25. colonized by Xylella fastidiosa. Phytopa- 32. Daugherty M.P., Lopes J., Almei- otype susceptibility to Xylella fastidiosa ogen association. J. Evol. Biol. 20: 2371- accessions. Proc. Nat. Acad. Sci. USA 9: 16. Purcell A.H., Feil H. (2001) thology 152: 291-297. da R.P.P. (2010) Vector within-host does not predict vector transmission 2378. 11270-11274. Glassy-winged sharpshooter. Pesticide 23. Baccari C., Lindow S.E. (2011) preference mediates transmission of a success. Environ. Entomol. 40: 1192- 4. Goss E.M., Bergelson J. (2006) 10. Raberg L., Sim D., Read A.F. Outlook 12: 199-203. Assessment of the process of movement heterogeneously distributed pathogen. 1199. Variation in resistance and virulence (2007) Disentangling genetic variation 17. Stenger D.C., Sisterson M.S., of Xylella fastidiosa within susceptible Ecol Entomol. 35: 360-366. 42. Hopkins D.L. (1981) Seasonal in the interaction between Arabidopsis for resistance and tolerance to infec- French R. (2010) Population genetics and resistant grape cultivars. Phytopa- 33. Daugherty M.P., Bosco D., Almei- concentration of the Pierce’s disease thaliana and a bacterial pathogen. Evo- tious diseases in animals. Science 318: of Homalodisca vitripennis reovirus val- thology 101: 77-84. da R.P.P. (2009) Temperature mediates bacterium in grapevine stems, petioles, lution 60: 1562-1573. 812-184. idates timing and limited introduction 24. Krivanek A.F., Stevenson J.F., vector transmission efficiency: Inocu- and leaf veins. Phytopathology 71: 415- to California of its invasive insect host, Walker M.A. (2005) Development lum supply and plant infection dynam- 418. the glassy-winged sharpshooter. Virol- and comparison of symptom indices ics. Ann. Appl. Biol. 155: 361-369. 43. Sisterson M.S. (2008) Effects of Fig. 3. Infection levels of the petioles collected from +10 and +90 cm above the point of inoculation (POI) for each cultivar. Open bars refer to the infection levels at 10-cm above ogy 407: 53-59. for quantifying grapevine resistance 34. Feil H., Purcell A.H. (2001) Tem- insect-vector preference for healthy or the point of inoculation. Filled bars represent the infection level of the petiole samples 18. Chatterjee S., Almeida R.P.P., Lin- to Pierce’s disease. Phytopathology 95: perature-dependent growth and sur- infected plants on pathogen spread: in- taken 90-cm above the point of inoculation. Error bars represent ±1 SE dow S (2008) Living in two worlds: The 36-43. vival of Xylella fastidiosa in vitro and in sights from a model. J. Econom. Ento- plant and insect lifestyles of Xylella fastid- 25. Krivanek A.F., Walker M.A. potted grapevines. Plant Dis. 85: 1230- mol. 101: 1-8. Рис. 3. Уровни зараженности в черешках каждого сорта, отобранных на iosa. Ann. Rev. Phytopath. 46: 243-271. (2005) Vitis resistance to Pierce’s dis- 1234. 44. Blua M.J., Perring T.M. (1992) Ef- расстоянии +10 см и +90 см выше места инокуляции. Белыми столбиками 19. Tyson G.E., Stojanovic B.J., Kuk- ease is characterized by differential Xy- 35. Hill B.L., Purcell A.H. (1995) fects of zucchini yellow mosaic virus on показаны уровни зараженности на расстоянии +10 см, черными – +90 см. Планки погрешностей — ±1 стандартная ошибка linski R.F., DiVittorio T.J., Sullivan M.L. lella fastidiosa populations in stems and Multiplication and movement of Xylel- feeding behavior of Aphis gossypii (Ho- (1985) Scanning electron microscopy leaves. Phytopathology 95: 44-52. la fastidiosa within grapevine and four moptera: Aphididae) alatae. Environ. 26. Fritschi F.B., Lin H., Walker M.A. other plants. Phytopathology 85: 1368- Entomol. 21: 578-585. (2008) Scanning electron microscopy 1372. 45. Mauck K.E., De Moraes C.M., reveals different response pattern of 36. Guilhabert M.R., Kirkpatrick B.C. Mescher M.C. (2010) Deceptive chem- four Vitis genotypes to Xylella fastidiosa (2005) Identification of Xylella fastidio- ical signals induced by a plant virus infection. Plant Dis. 92: 276-286. sa antivirulence genes: Hemagglutinin attract insect vectors to inferior hosts. 27. Hewitt W.B., Frazier N.W., Hou- adhesins contribute to X. fastidiosa bi- Proc. Nat. Acad. Sci. USA 107: 3600- ston B.R. (1942) Pierce’s disease of ofilm maturation and colonization and 3605. grapevine. Calif. Agric. Exp. Stn. Circ. attenuate virulence. Mol. Plant Microbe 353: 1-32. Interact. 18: 848-856.

44 3| 13| 2015 КАРАНТИН РАСТЕНИЙ КАРАНТИН РАСТЕНИЙ 3| 13| 2015 45 ЧЕРЕДА ДВАЖДЫПЕРИСТАЯ BIDENS BIPINNATA L. — вид карантинного сорного растения из нового Перечня карантинных объектов, отсутствующий на территории РФ

Fig. 3. Stem Fig. 4. Leaves Е.М. Волкова, заведующая лабораторией сорных растений ФГБУ «ВНИИКР» Рис. 3. Стебель Рис. 4. Листья Ю.Р. Кочнев, м.н.с. лаборатории сорных растений ФГБУ «ВНИИКР» Пластинка листа дважды пери- железнодорожных путей, по берегам Корневая система череды дваж- сто-рассеченная, некоторые листья рек и так далее. дыперистой состоит из разветвлен- на крупных растениях имеют на от- Для исследования морфологии ного стержневого корня. дельных сегментах третий порядок растения череды дваждыперистой Стебель прямой, голый, ветвя- рассечения (рис. 6). выращивали в лаборатории сорных щийся, зеленый (некоторые участки Отдельные сегменты (доли листа) б.м. овально-яйцевидные, ланцетные Череда дваждыперистая Bidens Череда дваждыперистая — одно- Кабо-Верде, Камерун, Коморские Череда дваждыперистая — однолетнее сорное с пильчатым краем, сужающиеся bipinnata L. согласно приказу Мин- летнее сорное травянистое растение острова, Конго, Кот-д’Ивуар, Мада- травянистое растение семейства Asteraceae. к основанию и верхушке. Верхушка сельхоза России от 15.12.2014 № 501 семейства Asteraceae. Происходит из гаскар, Мали, Намибия, Сенегал, Су- Происходит из Северной Америки. обычно тупозаостренная (рис. 7). «Об утверждении Перечня каран- Северной Америки. дан, Экваториальная Гвинея. Стебли заканчиваются отдельны- тинных объектов» является каран- Встречается на всех континен- Европа: Австрия, Великобрита- ми соцветиями-корзинками на длин- тинным сорным растением, отсут- тах (http://www.discoverlife.org/ ния, Германия, Испания, Италия, растений ФГБУ «ВНИИКР» начиная стебля могут быть окрашены в крас- ных цветоносах (рис. 1). ствующим на территории РФ. Ранее mp/20m?kind=Bidens+bipinnata): Франция, Швейцария, Швеция. с февраля 2015 года. Череда дважды- новато-фиолетовый цвет), у основа- Соцветие-корзинка. Обертка череда дваждыперистая некоторое Азия: Индия, Йемен, Китай, Не- Океания: Австралия, Новая Кале- перистая — растение короткого дня. ния б.м. округлый в диаметре до 1 см, корзинки состоит из одного ряда время находилась в «Перечне вре- пал, Южная Корея, Япония. дония, Папуа — Новая Гвинея. В природе, в частности в штате Ил- выше по стеблю четырехгранный, отогнутых наружу листочков. Цвет- дителей, болезней растений и сорня- Америка: Ангилья, Бразилия, Вид имеет высокий инвазивный линойс США, период цветения длит- сужающийся (рис. 3). Высота расте- ки в корзинке расположены в пазу- ков, имеющих карантинное значение Венесуэла, Канада, Колумбия, Ко- потенциал, особенно широко рас- ся с конца лета до начала осени. ния в среднем достигает 60–150 см. хах прицветных листочков (чешу- для СССР», утвержденном 6 августа ста-Рика, Никарагуа, США, Эквадор. пространен в нарушенных местоо- В тепличных условиях часть по- Листья супротивные, черешко- ек), длина которых больше длины 1986 г., в III группе (потенциально Африка: Бенин, Ботсвана, Бур- битаниях, таких как обрабатываемые сеянных плодов развилась в низко- вые, напоминают листья петрушки. листочков корзинки (рис. 8). опасные виды). кина-Фасо, Гана, Гвинея, Египет, поля, пустыри, обочины дорог, вдоль рослые растения, которые зацвели Длина листьев может достигать 30 Соцветие может состоять только и дали плоды уже ранней весной см, черешок составляет 1/4–1/3 часть из трубчатых цветков. Но обычно Рис. 1. Цветущее растение Для исследования морфологии растения череды (рис. 1). Другая часть плодов, вы- длины листа (рис. 4). Пластинки в корзинке по краю развиваются от сеянных в то же время, дала начало крупных листьев часто имеют почти 1 до 5 желтых язычковых цветков, Fig. 1.Flowering plant дваждыперистой выращивали в лаборатории сорных растений ФГБУ «ВНИИКР» начиная растениям (рис. 2), которые разви- одинаковую длину и ширину. в центре расположены многочис- лись в крупные нецветущие экзем- Черешок, жилки и край листа ленные трубчатые желтые цветки с февраля 2015 года. пляры высотой до 160 см. очень коротко опушены простыми (рис. 9, 10). волосками (рис. 5). Плоды. После цветения каждое со- Рис. 2. Вегетирующее растение Рис. 5. Опушение по краю листа цветие превращается в соплодие ша- ровидной формы. Длинные узкие пло- Fig. 2. Vegetative plant Fig. 5. Hairy leaf margins ды (семянки) торчат наружу от центра во всех направлениях (рис. 11).

Рис. 6. Третий порядок рассечения пластинки листа

Fig. 6. Three-fold pinnatisected leaf blade

46 3| 13| 2015 КАРАНТИН РАСТЕНИЙ КАРАНТИН РАСТЕНИЙ 3| 13| 2015 47 После созревания плоды легко осыпаются (рис. 12) или, зацепив- шись прицепками за прохожих, жи- вотных и т.п., переносятся на даль- ние расстояния. Как и у многих черед с игольчаты- ми (длинными и узкими) плодами, у череды дваждыперистой наблюда- ется гетерокарпия: наличие длинных и коротких плодов. Длинные плоды. Плоды прямые, не уплощенные (ширина обычно равна толщине), иногда слегка изо- гнутые (рис. 13). Поверхность продольно-ребри- стая (8 ребер). Часто 4 наиболее вы- Fig. 7. Shapes of the blade lobes Рис. 10. Строение язычкового (1) и трубчатого (2) цветков Рис. 11. Плоды на растении пуклых ребра чередуются с 4 менее выпуклыми и более узкими. Цвет Рис. 7. Форма сегментов пластинки В небольшом количестве на не- Fig. 10. Structure of ray (1) and tubular (2) flowers Fig. 11. Fruit семянок темно-серый, у вершины которых растениях образуются «ко- и основания плода соломенно-жел- толщины примерно 1,5–2 раза. Из- роткие» плоды-семянки, они форми- тый или белый. На вершине плода мерение ширины и толщины следует руются из краевых цветков и имеют формируются 2–4, обычно 3 светлых проводить в центральной части пло- несколько другую морфологию. ости, каждый остевидный отросток да, т.к. к вершине и основанию плоды Короткие плоды. В отличие от имеет направленные к основанию несколько сужаются. «длинных» семянок, они имеют ко- ости зубцы (рис. 14). Ости расходятся Плодовый рубчик округлый или ричневый цвет (рис. 17). Размеры под острым углом, длина остей око- овальный, светлый, расположен в ос- семянок: длина с остями 8-12 мм (ср. SPANISH NEEDLES ло 3 мм. У верхушки плод сужается, новании плода (рис. 15). 10,3 мм), ширина и толщина так же, ребра здесь имеют светлую окраску. По всей длине плода на поверхно- как у «длинных» семянок, около 1 Размеры семянок: длина вместе сти расположены беловато-желтые мм. Количество остей — 3, их длина BIDENS BIPINNATA L. — с остями 14–20 мм (ср. 17 мм), шири- плоские почти невозвышающиеся 2–3 мм. По всей поверхности плоды на 0,8–1,2 (ср. 1 мм), толщина 0,8–1,2 над поверхностью бородавочки, ко- имеют светлые «пятнышки» — пло- a Quarantine Weed Species on the New List (ср. 1 мм). Размеры плодов (в частно- торые выглядят скорее как пятныш- ские бородавочки и короткие редко сти почти одинаковые ширина и тол- ки (рис. 16). расположенные волоски (рис. 18). of Quarantine Pests Absent from щина) являются одним из важных Волоски малочисленные, корот- диагностических признаков, отли- кие (длиной около 0,1 мм). Распо- В работе использованы фотогра- the Russian Federation чающих плоды этого вида от плодов ложены, как правило, у основания фии Е.М. Волковой. других видов черед с «игольчатыми» и верхушки плода. Авторы благодарят В.Г. Кулакова плодами, в том числе от плодов чере- и Ю.Ю. Кулакову за предоставлен- Elena M. Volkova, Chief of FGBU VNIIKR’s Weed Laboratory ды волосистой, которые по строению Рис. 8. Листочек корзинки (1), ный посевной материал, полученный Yury R. Kochnev, Junior Researcher at FGBU VNIIKR’s Weed Laboratory уплощенные, т.е. ширина больше прицветные листочки из Грузии. (чешуйки) (2, 3, 4) Рис. 9. Соцветие – корзинка Fig. 8. Flower disk leaves (1), bracts (2, 3, 4) Fig. 9. Disk flower As per Order № 501 of the Russian America: Anguilla, Brazil, Canada, Ministry of Agriculture Adoption of Lists Colombia, Costa Rica, Nicaragua, Unit- of Quarantine Pests dated 12 December ed States, Ecuador. 2014, Bidens bipinnata L., Spanish Nee- Africa: Benin, Botswana, Burki- dles, is a quarantine weed absent from na Faso, Ghana, Guinea, Egypt, Cape the Russian Federation. Previously, this Verde, Cameroon, Comoros, Congo, plant was on the List of Pests, Plant Dis- Côte d’Ivoire, Madagascar, Mali, Na- eases and Weeds of Quarantine Concern mibia, Senegal, Sudan, Equatorial Guin- for the USSR adopted on 6 August 1986, ea. as a pest of group III, i.e. a potentially Europe: Austria, Great Britain, Ger- Рис. 12. Плоды, осыпавшиеся с растения dangerous species. many, Spain, Italy, France, Switzerland, The Spanish Needles is an annual Sweden. Fig. 12. Fruit shed from plants herbaceous weed of the family Asterace- Oceania: Australia, New Caledonia, ae. The plant is native to North America. Papua New Guinea. Since February 2015, FGBU The Spanish Needles is distributed B. bipinnata is potentially very inva- VNIIKR’s Weed Laboratory has been worldwide (http://www.discoverlife. sive. It is particularly prevalent in dis- rearing B. bipinnata with the aim of org/mp/20m?kind=Bidens+bipinnata): turbed habitats such as cultivated fields, investigating its morphology. B. bipin- Asia: India, Yemen, China, Nepal, wastelands, roadside verges, along the nata is a short-day plant. Under natural South Korea, Japan. railways, riversides, etc. conditions, the blooming period occurs

48 3| 13| 2015 КАРАНТИН РАСТЕНИЙ КАРАНТИН РАСТЕНИЙ 3| 13| 2015 49 The flower head may consist only of tubular flowers. But usually 1 to 5 yel- low ray flowers develop, as well. Numer- ous tubular yellow flowers are located around the periphery (Fig. 9, 10). Fruit. After flowering, compound fruit are formed from each flower head. Long narrow fruit (achenes) stick out- wardly from the center in all directions (Fig. 11). Upon maturing, fruit easily shed (Fig. 4), or spread over long distances Рис. 13. Плоды-семянки («длинные») by hitching on to people passing by, an- imals etc. Fig. 13. Fruit achenes (long) As many other related species with needlelike fruit, the Spanish Needles has both longer and shorter fruit. This phe- nomenon is called heterocarpy. Long fruit. Fruit are erect, not flat- tened with width usually equal to the thickness, sometimes slightly curved (Fig. 13). The surface is longitudinally ribbed (8 ribs). Usually, four most raised ribs Рис. 16. Поверхность «длинного» плода alternate with four narrower and less raised ribs. Achenes are dark gray, yel- Fig. 16. Surface of the long fruit low or white at the tip and base of the In the present paper, images by The authors express their gratitude to fruit. At the tip of the fruit 2–4 usually ness and width should be measured at E.M. Volkova are used. V.G. Kulakov and Yu.Yu. Kulakova for Рис. 14. Верхняя часть плода 3 bright spines are formed each with the central part of fruit since they some- seed material collected in Georgia. teeth directed to the base of the spine what taper to the tip and base. Fig. 17. Fruit achenes (short) Fig. 14. Tip of the fruit (Fig. 14). Spines are about 3 mm long Raphe is round or oval, light-color- Leaf blades are twice pinnatisected; diverging at an acute angle. The fruit ta- ed, located in the center of the fruit Рис. 17. Плоды-семянки («короткие») since late summer till early fall, for in- leaves of larger plants may be locally pers towards the tip. The ribs at the tip (Fig. 15). stance in Illinois, USA. three-fold pinnatisected (Fig. 6). are of lighter color. Whitish-yellow flat almost nonraised Indoors, a portion of sawn seeds ger- Certain leaf lobes may be oviform, Size of achene: 14–20 mm long with warts looking more like spots are pres- minated into short plants that flowered lanceolate with serrate margins taper- spines (on average, 17 mm), 0.8–1.2 ent over the entire length of the fruit and yielded fruit in early spring (Fig. 1). ing towards the base and tip. The tip is mm wide (on average, 1 mm), 0.8–1.2 surface (Fig. 16). The remaining seeds sawn at the same usually bluntly pointed (Fig. 7). mm thick (on average, 1 mm). Size of Hairs are abundant, short (about 0.1 time germinated into large nonbloom- At the end the stems, flower heads — the fruit (particularly, as wide as thick) mm long), usually found at the base or ing plants (Fig. 2) up to 160 cm high. disk flowers — are present (Fig. 1). is an important diagnostic feature that tip of the fruit. Disk flowers. The outer layer of the distinguishes this type of fruit from fruit The Spanish Needles is an flower head consists of a single row of other species with needlelike fruit Since February 2015, FGBU annual herbaceous weed of the of outwardly bent leaves. Flowers are including those of Bidens pilosa which VNIIKR’s Weed Laboratory surrounded by outer bracts which are are flattened, i.e., width is greater than family Asteraceae. The plant is longer than the leaves in the flower head thickness by about 1.5–2 times. Thick- has been rearing B. bipinnata native to North America. (Fig. 8). with the aim of investigating Fig. 15. Base of the fruit its morphology. B. bipinnata Fig. 18. Surface of the short fruit The root systemconsists of a branch- is a short-day plant. ing taproot. Рис. 15. Основание плода Рис. 18. Поверхность «короткого» плода The stem is erect, glabrous green A few short fruit-achenes are formed with certain areas sometimes purple in certain plants from ray flowers. These reddish and branching. At the base, it is have slightly different morphology. up to 1 cm in diameter, 4-angled, taper- Short fruit. Unlike “long” achenes, ing (Fig. 3). On the average, plants are short fruit are brown-colored (Fig. 60–150 cm high. 17). Size of achenes: 8–12 mm long Leaves are opposite, petiolar, resem- with spines (on average, 10.3 mm), bling those of parsley. The leaves reach with width and thickness of about 1 up to 30 cm in length; petiole takes up mm similar to “long” achenes. There 1/4–1/3 of the leaf length (Fig. 4). Blades are three 2–3 mm spines. Bright of larger leaves are often as long as wide. “spots” — flat warts — and short sparse Petiols, veins and leaf margins are hairs cover the entire fruit surface slightly hairy (Fig. 5). (Fig. 18).

50 3| 13| 2015 КАРАНТИН РАСТЕНИЙ КАРАНТИН РАСТЕНИЙ 3| 13| 2015 51 melongena, перец — Capsicum annuum S. okadae Hawk., S. oplocense Hawk., были обнаружены на диких видах (Lebas et al., 2005), физалис — Physalis S. sparsipilum Bitt., S. acaule Bitt., S. Solanum (Behjatnia et al., 1996) и на ДИАГНОСТИКА ВИРОИДА peruviana (Verhoeven et al., 2009), аво- acroscopicum Ochoa., S. medians Bitt., томате (Puchta et al., 1990). Части- кадо — Persea americana (Querci et al., S. demissum Lindl., S. jamessii Torr., S. цы размером 356 и 357 были заре- 1995), пепино — Solanum muricatum pinnatisectum Dun. (Краснова, 2000). гистрированы на растениях пепино ВЕРЕТЕНОВИДНОСТИ (Puchta et al., 1990; Verhoeven, Ранее возбудителя веретеновид- (Solanum muricatum) (Puchta et al., Roenhorst, 1995). ности клубней картофеля относили 1990; Shamloul et al., 1997) и Solanum PSTVd выявляли также на рас- к вирусам. В 1967 г. было установ- jasminoides (Verhoeven et al., 2010a). КЛУБНЕЙ КАРТОФЕЛЯ тениях Brugmansia suaveolens, лено, что возбудитель не является Проведенное сравнение первич- Brugmansia candida, Brugmansia flava, вирусом, т.к. представляет собой ной структуры генома изолятов С.Б. Абросимова, м.н.с. научно-методического отдела Brugmansia sanguinea, Brugmansia spp. низкомолекулярную некапсиди- PSTVd из коллекции ВНИИ фитопа- фитопатологии ФГБУ «ВНИИКР» (Verhoeven et al., 2008a, 2010a; Mertelik рованную РНК, присутствующую тологии и сиквенсов изолятов этого et al., 2009), Cestrum aurantiacum, в ядерной фракции клеток (Diner, вироида, депонированных в Генбанк Ю.Н. Приходько, начальник научно-методического отдела C. elegans, C. nocturnum (Luigi et al., Raimer, 1967). NCBI, показало, что все известные фитопатологии ФГБУ «ВНИИКР» 2011), Licianthes rantonnetii, Solanum В настоящее время известно, что изоляты PSTVd образуют четыре фи- rantonetti (Di Serio, 2007), Petunia вироид веретеновидности клубней логенетические группы (Кастальева hybridum, Solanum muricatum картофеля (PSTVd) является инфек- и др., 2011). (Mertelik et al., 2009), Solanum ционной бескапсидной кольцевой По реакции растений картофе- jasminoides (Di Serio, 2007; Verhoeven одноцепочечной РНК, имеющей ля дифференцируют три штамма et al., 2008a; Mertelik et al., 2009), вторичную структуру, способной PSTVd: суровый (severe) — вызыва- Streptosolen jamesonii (Verhoeven et к автономной репликации после за- ющий потери урожая до 65%, про- al., 2008b), Datura sp. (Verhoeven et ражения растения-хозяина. межуточный (intermediate) и мягкий в Австрии, Азербайджане, Бело- проверке на наличие этого патогена. al., 2010a), Solanum laxum, Ipomoea PSTVd является представите- (mild) — c потерей урожая в пределах руссии, Бельгии, Великобритании, В частности, зараженные растения batatas, Dahlia spp. (EPPO PQR, 2013). лем рода Pospiviroid семейства 15–25% (Puchta et al., 1990). В Россий- Венгрии, Германии, Греции, Грузии, были выявлены в коллекциях мери- При исследовании коллекции Pospiviroidae. ской Федерации преимущественно Испании, Италии, Мальте, Нидерлан- стемных культур картофеля ВНИИ пасленовых культур во Всероссий- В инфицированных растениях распространены суровый и мягкий дах, Польше, Российской Федерации картофельного хозяйства и Биоло- ском институте растениеводства (г. картофеля РНК вироида обычно штаммы PSTVd (Можаева и др., 1989; (Центрально-Европейский и Южный го-почвенного института ДВНЦ (Ка- Санкт-Петербург) PSTVd был выяв- состоит из 359 нуклеотидов (Gross Краснова, 2000). регионы, Дальний Восток), Словении, стальева и др., 1992; Можаева и др., лен на следующих дикорастущих ви- et al., 1978), реже 358 или 360 нукле- PSTVd имеет разнообразные пути Украине, Турции, Хорватии, Чехии. 1995; Романова, Леднева, 1995; Дры- дах рода Solanum: S. bertaultii Hawk., отидов (Herold et al., 1992). Частицы распространения. На большие рас- PSTVd выявлен также в Афгани- гин и др., 1996). S. leptopyes Bitt., S. neozossii Hawk., PSTVd размером 356 нуклеотидов стояния вироид распространяется стане, Бангладеш, Израиле, Индии, PSTVd неоднократно выявляли с зараженными настоящими семена- Иране, Китае, Японии, Египте, Ни- также в посадках картофеля в Бело- ми и клубнями картофеля, а также герии, США, Перу, Коста-Рике, Мек- руссии. По результатам обследова- Рис. 2. Симптомы заражения PSTVd клубней картофеля: с рассадой, плодами и семенами дру- сике, Венесуэле, Австралии и Новой ний 1995-1997 гг., было установлено, здоровый клубень (слева) и клубни, пораженные PSTVd (3 справа) гих растений-хозяев (EPPO/CABI, (фото: William M. Brown Jr., США) Зеландии (EPPO PQR, 2015). что PSTVd повсеместно распростра- 1997). В 30-е годы XX века на Украине нен в Белоруссии, заражая на отдель- Fig. 2. PSTVd symptoms on potato tubers: Перенос вироида с настоящими было описано заболевание, назван- ных полях до 30% растений карто- A healthy tuber (on the left) and PSTVd-infected tubers (3 on the right) семенами картофеля зависит от со- (photo by William M. Brown Jr., USA) Впервые веретеновидность клубней картофеля Fig. 1. Potato plants infected with PSTVd была описана в штате Нью-Джерси (США) (photo by Beltsville Agricultural Research Centre, USDA, USA) в 1922 г. под названием Potato spindle tuber (веретеновидный клубень картофеля). Рис. 1. Растение картофеля, зараженное PSTVd ное «готика картофеля», сопрово- феля. В наиболее высокой степени (фото: Beltsville Agricultural Research ждающееся образованием клубней оказались зараженными сорта Ласу- Centre, USDA, США) веретеновидной и грушевидной нок, Сантэ, Темпо и Орбит (Blotskaya, формы (Терещенко, 1937). В после- Berlinchik, 1998). Вироид веретеновидности клуб- дующие годы это заболевание было PSTVd имеет широкий круг рас- ней картофеля (PSTVd) представля- отмечено и в ряде других регио- тений-хозяев. Экспериментальный ет серьезную угрозу для сельского нов СССР (Поволжье, Закавказье, круг растений-хозяев включает хозяйства Европы, поэтому внесен Средняя Азия). Было установлено, 156 видов растений (из которых в Список А2 карантинных объектов что «готика картофеля» вызывается 139 видов относятся к семейству ЕОКЗР и Российской Федерации. PSTVd (Леонтьева, 1971). Solanaceae), представляющих 12 Впервые веретеновидность клуб- В конце 80-х — начале 90-х годов семейств (Singh, 1973). Основ- ней картофеля была описана в штате прошлого века в Российской Феде- ным растением-хозяином PSTVd Нью-Джерси (США) в 1922 г. под на- рации было отмечено распростра- является картофель — Solanum званием Potato spindle tuber (верете- нение PSTVd с семенными клонами tuberosum. Кроме этого, данный ви- новидный клубень картофеля). картофеля высших репродукций, роид поражает томат — Lycopersicon В Европе, по данным сайта EPPO размноженных методом культуры esculentum (Puchta et al., 1990; Можа- PQR (2015), PSTVd распространен in vitro и не подвергавшихся целевой ева и др., 1996), баклажан — Solanum

52 3| 13| 2015 КАРАНТИН РАСТЕНИЙ КАРАНТИН РАСТЕНИЙ 3| 13| 2015 53 ловиях, чем в сухих. Установлено, тительных остатках (Diener, Raimer, картофеля сортов Невский, Лугов- что концентрация вироида была 1971; Гирсова, 2003). ской, Прибрежный и Утенок сни- существенно более высокой у расте- Экономические потери из-за зара- зилась соответственно на 46,9; 36,4; ний, содержащихся при температу- жения PSTVd связаны со снижением 35,6 и 18,1%. При этом у сорта Лу- ре 30 °С, чем при температуре 25 °С продуктивности растений и ухуд- говской все образовавшиеся клубни (Morris, Smith, 1977). шением товарного качества клуб- были нетоварными (Гирсова, 2003). Молекула вироида имеет до 70% ней и плодов поражаемых культур. В Республике Беларусь было уста- спаренных оснований, что придает У картофеля уменьшение продук- новлено, что на второй год после за- ей устойчивость к внешним услови- тивности растений под влиянием ражения PSTVd вызывает снижение ям и воздействию различных хими- PSTVd происходит за счет уменьше- массы клубней растений картофеля ческих веществ. Было установлено, ния массы клубней и уменьшения их сортов Сантэ, Темпо, Ласунок и Ор- что вироид сохраняет инфекцион- количества. бит соответственно на 75,7; 66,6; 40 ность при хранении в течение 22 лет Потери урожая зависят от штам- и 36,8% (Blotskaya, Berlinchik, 1998). при –20 °С в составе препарата ча- ма вироида и концентрации патогена При условии удаления заражен- стично очищенной РНК (Гирсова, в растениях. Так, на томатах потери ных семенных клонов, соблюдения 2003) и до шести лет — в лиофили- составляют в среднем 10–20%, одна- комплекса карантинных мероприя- зированных листьях (Singh, Finnie, ко возможно снижение урожая до тий и внедрения эффективных мето- 1977). Было показано также, что ин- 40–50%, со значительным снижением дов диагностики существует реаль- фекционность вироида сохраняется товарного вида плодов. При сильной ная возможность искоренения этого в высушенных листьях, хранящихся инфекции потери урожая картофе- патогена или сведения его ущерба при комнатной температуре на про- ля могут достигать 65% вследствие до минимального уровня. О фактах тяжении двух лет, а в лиофильно вы- уменьшения размера и количества полного искоренения PSTVd в кол- сушенных листьях при температуре клубней. Качество клубней при этом лекционных насаждениях картофе- –20 °С — до 13 лет (Гирсова, 2003). также серьезно страдает (EPPO/ ля или же даже в рамках всей нацио- Fig. 3. Potato tubers of the Panda variety infected PSTVd сохранял инфекционность CABI, 1997). нальной системы семеноводства этой with a PSTVd isolate. Chernigov-06 ARRIF (2014, photo by the authors) в настоящих семенах картофеля, хра- У зараженных вироидом растений культуры сообщалось в частности из нящихся при комнатной температу- картофеля сорта Резерв вес клубней Австралии (Catley, 1989; Mackie et al., Рис. 3. Клубни картофеля сорта ре в течение 12 лет (Grasmick et al., снижался в 4,3 раза, а количество 2002) и Канады (Singh, Crowley, 1985). Панда, зараженные изолятом PSTVd гидропонных установках (Можаева дит только в случае капсулирования 2011) и 21 года (Singh et al., 1991), а клубней — в 4,2 раза. У зараженных Для выявления и идентификации Чернигов-06 ВНИИФ (2014 г., фото и др., 1996). Заражение вироидом РНК вироида белком вируса скручи- в семенах томата, хранящихся при растений сорта Невский количе- PSTVd ЕОКЗР рекомендует исполь- авторов) здоровых растений томата происхо- вания листьев картофеля — PLRV. том же режиме, — в течение 23 лет ство клубней снижалось вдвое, а вес зовать комплекс отборочных и под- дило через 5 дней после помещения Эффективность передачи PSTVd (Гирсова, 2003). В то же время виро- клубней — на 26% (Кастальева и др., тверждающих тестов. рта и варьирует от 0 до 100% (Singh, зараженных растений в питательный тлями зависит от сорта картофеля, ид не сохраняется в почве и в зиму- 1992). В Северо-Западном регионе Первичное выявление вироида 1970). Для семян томата уровень раствор, а инфекционность питатель- используемого в качестве источни- ющих в естественных условиях рас- РФ в результате заражения PSTVd осуществляют по наличию симпто- инфекции был оценен в 7,9–11,1% ного раствора сохранялась на протя- ка инфекции и в качестве заража- масса клубней картофеля снижалась мов на растениях-хозяевах. (Fernow et al., 1970). На картофеле жении трех дней (Гирсова, 2003). емого тест-растения, распростра- Рис. 4. Этапы проявления от 10,8 до 63,3% (Краснова, 2000). установлена также возможность В качестве переносчиков PSTVd ненности PLRV и варьирует от 0 до симптомов PSTVd на томате На пятый год после заражения Читайте продолжение материала распространения вироида c пыльцой указывались большая картофельная 55% (Salazar et al., 1995; Querci et al., (фото: Department of Primary вироидом продуктивность растений в следущем номере журнала (Fernow et al., 1970; Singh et al., 1992), тля (Macrosiphum euphorbiae), перси- 1997). Industries, США) «Карантин растений. Наука и практика» № 4(14) но практическое значение данной способности пока не оценивалось. Основными источниками проникновения вироида Fig. 4. Stages of PSTVd manifestation on tomato Обычным является распростра- на территорию Российской Федерации и распространения (photo by Department of Primary Industries, USA) нение PSTVd механическим путем его внутри страны являются инфицированные клубни, при контакте растений посредством сельскохозяйственной техники и ин- семена, плоды и рассада растений-хозяев. вентаря (EPPO/CABI, 1997). Интен- сивность механического переноса ковая тля (Myzus persicae), а также дру- Основными источниками про- зависит от целого ряда факторов: гие сосущие и листогрызущие виды никновения вироида на территорию вида растения-хозяина и сорта, ко- насекомых (Dysonicha triangularis, Российской Федерации и распро- личества зараженных растений, Empoasca flavescens, Epitrix cucumeris, странения его внутри страны явля- агротехнической практики, концен- Eupteryx atropunctata, Lygus pratensis, ются инфицированные клубни, семе- трации вироида в растениях и темпе- Leptinotarsa desemlineata, Melanoplus на, плоды и рассада растений-хозяев. ратуры. Вироид способен сохранять spp., Systena elongate) (Fernow et al., Дополнительным путем распростра- жизнеспособность в высохшем соке 1970; Werner-Solska, 1983). В то же нения вироида могут являться бес- растений, заражая тем самым сель- время было установлено, что трип- симптомные меристемные культуры скохозяйственную технику, инвен- сы (Frankliniella occidentalis, Thrips и тепличные растения картофеля. тарь и хранилища (явление конта- tabaci), а также пчелы (Apis mellifera) Высокие температуры стимули- минации) (OEPP/EPPO, 2011). и шмели (Bombus terrestris) не могут руют размножение PSTVd и прояв- Установлено распространение ви- передавать вироид (Lykke Nielsen et ление симптомов, низкие — сохра- роида с питательным раствором при al., 2012). няют инфицированность клубней Читайте продолжение материала совместном выращивании заражен- При этом перенос PSTVd перси- на одном уровне. Болезнь быстрее в следущем номере журнала ных и здоровых растений томата на ковой тлей (Myzus persicae) происхо- распространяется во влажных ус- «Карантин растений. Наука и практика» № 4(14)

54 3| 13| 2015 КАРАНТИН РАСТЕНИЙ КАРАНТИН РАСТЕНИЙ 3| 13| 2015 55 lecular weight located in the nuclear from the collection of the All-Russian be 7.9-11.1% (Fernow et al., 1970). In fraction. Hence, it is not a virus (Diner, Research Institute of Phytopatholo- potato, the viroid is also known to be DETECTION AND Raimer, 1967). gy with the PSTVd isolate sequences transmitted by pollen (Fernow et al., Currently, potato spindle tuber vi- deposited in the NCBI GenBank has 1970; Singh et al., 1992), but the practi- roid (PSTVd) is known to be an in- shown that the known isolates of PST- cal significance of pollen transmission IDENTIFICATION OF POTATO fectious non-encapsidated, circular, Vd fall within four phylogenetic groups is yet to be estimated. single-stranded RNA containing a (Kastaleva et al., 2011). The viroid can also be transmitted secondary structure and capable of in- Three PSTVd strains are differen- mechanically by plant-machinery con- SPINDLE TUBER VIROID dependently replicating in the infested tiated by their affect on potato plants: tact (EPPO/CABI, 1997). The extent host plant. severe, causing yield losses of up to of mechanical transmission depends Svetlana B. Abrosimova, Junior Researcher at FGBU VNIIKR’s PSTVd belongs to the genus Pospivi- 65%, intermediate and mild causing on a number of factors including the Plant Pathology Research and Methodology Department roid in the family Pospiviroidae. yield losses by 15-25% (Puchta et al., host plant species or cultivar, number In infested potato plants, the viroid 1990). In the Russian Federation, se- of infected plants, cultural practices, Yury N. Prikhodko, Chief of FGBU VNIIKR’s RNA, as a rule, is 359 nucleotides in vere and mild strains are most common viroid concentration, and temperature. Plant Pathology Research and Methodology Department length (Gross et al., 1978), less often (Mozhaeva et al., 1989; Krasnov, 2000). –358 or 360 nucleotides (Herold et al., PSTVd has a number of pathways. The main pathways for the 1992). Nucleotide lengths of 356 have Over longer distances, PSTVd is trans- entry and spread of the viroid been found in wild Solanum spp. (Be- mitted in true potato seeds and tubers, in the Russian Federation hjatnia et al., 1996) and tomato (Puch- as well as infected seedlings, fruits ta et al., 1990). Lengths of 356 and 357 and seeds of other host plants (EPPO/ are infected tubers, seeds, fruits nucleotides have been reported in pepi- CABI, 1997). and seedlings of host plants. no (Solanum muricatum) (Puchta et al., Transmission in true potato seeds Potato spindle tuber viroid (PSTVd) subjected to the specific analysis for the PSTVd has also been detected in 1990; Shamloul et al., 1997). is cultivar dependent and varies from It survives in dried plant sap and can poses a serious threat to agriculture in presence of this pathogen. For instance, plants of Brugmansia suaveolens, Brug- Comparison of the primary struc- 0 to 100% (Singh, 1970). The infection contaminate machinery and storage fa- Europe; therefore it is listed in EPPO infested plants were found in the mer- mansia candida, Brugmansia flava, ture of the genome of PSTVd isolates level in tomato seeds was estimated to cilities (OEPP/EPPO, 2011). A2 List of pests recommended for istem culture collections of the State Brugmansia sanguinea, Brugmansia PSTVd is known to be transmitted regulation as quarantine pests and the Research Institution All-Russian Re- spp. (Verhoeven et al., 2008a, 2010a; in nutrient solution when healthy and Fig. 5. Tomato leaf of the Mona Lisa variety inoculated with PSTVd MT-08(2) isolate Russian List of quarantine pests. search Institute of Potato Farming and Mertelik et al., 2009), Cestrum auran- (FGBU VNIIKR Quarantine greenhouse, 2015, photo by the authors) infected tomato plants are simulta- The spindle tuber viroid was first re- the FEB RAS Biology Institute of Biol- tiacum, C. elegans, C. nocturnum (Lui- neously cultivated in plant culturing ported in the state of New Jersey (USA) ogy and Soil Science (Kastaleva et al., gi et al., 2011), Licianthes rantonnetii, Рис. 5. Листья растения томата сорта Мона Лиза, unit (Mozhaeva et al., 1996). Infection in 1922 as potato spindle tuber (spin- 1992; Mozhaeva et al., 1995; Romano- Solanum rantonetti (Di Serio, 2007), инокулированного изолятом PSTVd MT-08(2) dle-shaped potato tuber) viroid. va, Ledneva, 1995; Drygin et al., 1996). Petunia hybridum, Solanum murica- (карантинная теплица ФГБУ «ВНИИКР», 2015 г., фото авторов) In Europe, according to PQR (2015) PSTVd was repeatedly detected in tum (Mertelik et al., 2009), Solanum – the EPPO database on quarantine potato plantings in Belarus. In 1995- jasminoides (Di Serio, 2007; Verhoev- pests, PSTVd is distributed in Austria, 1997, surveys revealed that PSTVd was en et al., 2008a; Mertelik et al., 2009), Azerbaijan, Belarus, Belgium, Great widely distributed in Belarus and in- Streptosolen jamesonii (Verhoeven et Britain, Hungary, Germany, Georgia, fested up to 30% of the potato plants on al., 2008b), Datura sp. (Verhoeven et Greece, Spain, Italy, Malta, Nether- individual fields. Lasunok, Sante, Tem- al., 2010a), Solanum laxum, Ipomoea lands, Poland, the Russian Federation po and Orbit were the most severely in- batatas, and Dahlia spp. (EPPO PQR, (Central European and Southern re- fested varieties (Blotskaya, Berlinchik, 2013). gions, the Far East), Slovenia, Ukraine, 1998). The study of the solanaceous crops Turkey, Croatia, and the Czech Repub- PSTVd has a wide host range. There collection performed at the All-Russian lic. are 156 host plant species (139 species of Research Institute of Plant Production PSTVd has also been detected in which belong to the family Solanaceae) (St. Petersburg) revealed the PSTVd in- Afghanistan, Bangladesh, Israel, India, in 12 families (Singh, 1973). The major festation in the following wild-growing Iran, China, Japan, Egypt, Nigeria, the United States, Peru, Costa Rica, Mexi- The spindle tuber viroid was first reported in the state co, Venezuela, Australia, and New Zea- of New Jersey (USA) in 1922 as potato spindle tuber land (EPPO PQR, 2015). In 1930s, the disease was described (spindle-shaped potato tuber) viroid. in Ukraine as “Gothic potato” causing spindle and pear-shaped tubers (Tere- host is potato — Solanum tuberosum. Solanum species: S. bertaultii Hawk., schenko, 1937). In subsequent years, PSTVd also infests tomato — Lycoper- S. leptopyes Bitt., S. neozossii Hawk., this disease was also observed in sever- sicon esculentum (Puchta et al., 1990; S. okadae Hawk., S. oplocense Hawk., al other regions of the USSR (the Volga Mozhaeva et al., 1996), aubergine — So- S. sparsipilum Bitt., S. acaule Bitt., S. region, Trans-Caucasian region, Cen- lanum melongena, pepper — Capsicum acroscopicum Ochoa., S. medians Bitt., tral Asia). “Gothic potato” was found to annuum (Lebas et al., 2005), Physa- S. demissum Lindl., S. jamessii Torr., and be caused by PSTVd (Leontiev, 1971). lis — Physalis peruviana (Verhoeven et S. pinnatisectum Dun. (Krasnova, 2000). In the late 1980s – early 1990s, PST- al., 2009), avocado — Persea americana Earlier, potato spindle tuber was be- Vd was found to be spread in the Rus- (Querci et al., 1995), and pepino — So- lieved to be caused by a virus. In 1967, sian Federation via clones of high grade lanum muricatum (Puch­ta et al., 1990; the causative agent was identified to be seed potato multiplied in vitro and not Verhoeven, Roenhorst, 1995). a non-encapsidated RNA of low mo-

56 3| 13| 2015 КАРАНТИН РАСТЕНИЙ КАРАНТИН РАСТЕНИЙ 3| 13| 2015 57 of healthy tomato plants by viroid oc- much higher concentration in plants In infected potato plants of the Re- curred in 5 days after placing the in- grown at 300C than at 250C (Morris & serve variety, weight decreased by 4.3 fected plants in a nutrient solution and Smith, 1977). times and the number of tubers – by nutrient solution retained its infectivity Viroid molecule has up to 70% of 4.2 times. In infected potato plants of for three days (Girsova, 2003). base pairs which makes it resistant to the Nevsky variety, the number of tu- The following insects were report- environmental conditions and the ef- bers reduced by half and their weight ed as PSTVd vectors: the potato aphid fects of various chemicals. The viroid by 26% (Kastaleva et al., 1992). In the (Macrosiphum euphorbiae), green was found to retain its infectivity for 22 Northwest region of the Russian Fed- peach aphid (Myzus persicae) and other years when stored at -20 °C as part of a eration, PSTVd infection caused tuber sucking and leaf mining insect species purified RNA polymerase preparation weight decrease by 10.8 – 63.3% (Kras- (Dysonicha triangularis, Empoasca fla- (Girsova, 2003) and for up to six years nov, 2000). vescens, Epitrix cucumeris, Eupteryx in lyophilized leaves (Singh & Finnie, By the fifth year of the viroid infec- atropunctata, Lygus pratensis, Leptino- 1977). The infectivity of the viroid was tion, the productivity of potato plants tarsa desemlineata, Melanoplus spp., also shown to retain for two years in of the Nevsky Lugovskoy, Pribrezhny Systena elongate) (Fernow et al., 1970; dried leaves stored at room tempera- and Utionok varieties decreased by Werner-Solska, 1983). Whereas, thrips ture and thirteen years in freeze-dried 46.9; 36.4; 35.6 and 18.1%. All Lugov- (Frankliniella occidentalis, Thrips taba- leaves at -20 °C (Girsova, 2003). skoy tubers were unmarketable (Girso- ci), honey bees (Apis mellifera) and PSTVd retained its infectivity in true va, 2003). humblebees (Bombus terrestris) are not potato seeds stored at room tempera- In Belarus, PSTVd was found to capable of transmitting the viroid (Lyk- ture for 12 years (Grasmick et al., 2011) cause decreased tuber weight in the ke Nielsen et al., 2012). and 21 years (Singh et al., 1991) and Sante, Tempo, Lasunok, Orbit varieties Transmission of PSTVd by the green for 23 years in tomato seeds stored at by 75.7, 66.6, 40 and 36.8%, respective- peach aphid (Myzus persicae) only oc- the same temperature (Girsova, 2003). ly, by the second year of infection (Blot- curs if PSTVd RNA is encapsidated in At the same time, the viroid lost its in- skaya, Berlinchik, 1998). virions of Potato leafroll virus (PLRV) fectivity in soil and plant debris over- The eradication of the viroid or min- with the efficiency of transmission de- wintering under natural conditions imization of its impact is achievable by pending on the potato cultivar used as (Diener, Raimer, 1971; Girsova, 2003). removing infected seed clones, apply- the inoculum source and as a test plant Economic losses due to the PSTVd ing a range of quarantine measures and to be infected as well as depending on infection are associated with decreased effective diagnostic methods. Complete the presence of PLRV. It varies from 0 plant productivity and deterioration eradication of PSTVd in collection to 55% (Salazar et al., 1995; Querci et of commercial quality of tubers and plantations or even across the national al., 1997). fruit of affected crops. Decreased plant system of seed production of this crop The main pathways for the entry and productivity in PSTVd infected potato was reported from Australia (Catley, spread of the viroid in the Russian Fed- is the result reduction in weight and 1989; Mackie et al., 2002) and Canada eration are infected tubers, seeds, fruits number of tubers. (Singh, Crowley, 1985). and seedlings of host plants. Secondary Yield losses depend on the strain To detect and identify PSTVd EPPO pathways could be asymptomatic mer- and viroid concentration in plants. recommends a set of preliminary and istem cultures and greenhouse potato For instance, tomato losses on average confirmatory tests. plants. amount to 10-20%, but may be up to Primary viroid detection is carried High temperatures promote PSTVd 40-50% with a significant reduction in out based on the presence of symptoms reproduction and symptom manifesta- the marketable condition of fruit. In se- on host plants. tion while low temperatures keep the vere infections, yield losses may reach tuber infection at the same level. The up to 65% due to reduced size and disease spreads more rapidly under number of tubers. The quality of tubers The continuation of the article humid conditions than under dry con- is also seriously affected (EPPO/CABI, in the next issue of magazine ditions. The viroid may be present at a 1997). «Plant Health. Research and Practice» №4 (14)

58 3| 13| 2015 КАРАНТИН РАСТЕНИЙ 60 3| 13| 2015 КАРАНТИН РАСТЕНИЙ