THE ROLES OF ATF3 IN STRESS-REGULATED SIGNAL TRANSDUCTION
AND CELL DEATH IN PANCREATIC BETA-CELLS
DISSERTATION
Presented in Partial Fulfillment of the Requirements for
the Degree Doctor of Philosophy in the Graduate
School of The Ohio State University
By
Matthew G. Hartman, B.S.
* * * * *
The Ohio State University 2005
Dissertation Committee: Approved by Dr. Tsonwin Hai, Advisor
Dr. Gary Kociba Advisor
Dr. James DeWille Molecular, Cellular and Developmental Biology Program Dr. John Oberdick ABSTRACT
Currently there are 20 million people diagnosed with diabetes in the United
States and the incidence is expected to increase by 42% over the next twenty years. Type 1, or insulin-dependent diabetes, is an autoimmune disorder characterized by infiltration of activated T-lymphocytes into the pancreas. Auto- reactive immune cells initiate β-cell destruction by several mechanisms including secretion of soluble factors (cytokines), direct cell-cell contact, and activation of osmotic lysis signals. Type 2, or insulin-independent diabetes, is characterized by insulin resistance in the peripheral tissues such as the liver, fat, and skeletal muscle. Phosphorylation of key substrates involved in the insulin signal transduction pathway by stress-activated protein kinases contributes to the insulin resistance and prevents the uptake of glucose from the blood. Recent reports suggest that type 2 diabetes is a slower progressing form of type 1 and that β-cell apoptosis contributes to the pathogenesis of both forms. Activating Transcription Factor 3 (ATF3) is a member of the ATF/CREB family of transcription factors which regulate gene expression through their ability to bind a common DNA sequence motif (TGACGTCA). Levels of endogenous ATF3 are extremely low in most tissues or cell types; however,
ATF3 has been characterized as an immediate-early gene whose expression is
ii up-regulated during the stress response. Prior to this work and during its undertaking several reports were published which describe the physiological outcomes of ATF3 expression during the stress response. These reports demonstrate a variety roles for ATF3 including protection from stress-induced apoptosis in neurons, promotion of apoptosis in endothelial cells, and enhancement of metastatic potential in colon cancer cells. In addition, transgenic mice which ectopically express ATF3 in endocrine precursor cells during development showed defects in pancreatic islet formation. Based on this information, we set out to investigate a potential role for ATF3 in the pathogenesis of diabetes by examining ATF3 expression and function in pancreatic β-cells.
In chapter 2 we tested the hypothesis that ATF3 could be induced in pancreatic β-cells by stress signals relevant to type 1 or type 2 diabetes. Pro- inflammatory cytokines are secreted by infiltrating lymphocytes and act to promote β-cell apoptosis through their ability to up-regulate pro-apoptotic genes
(iNOS) and down-regulate pro-survival genes (Bcl-2). We found that treatment of β-cell lines with IL-1β alone resulted in transient ATF3 induction, whereas treatment with IL-1β+TNF-α+IFN-γ showed sustained ATF3 expression. ATF3 expression was also found to be up-regulated in β-cell lines following exposure to free fatty acids, high glucose concentrations, or oxidative stress, which are relevant to type 2 diabetes. Investigation of signal transduction pathways involved in the induction of ATF3 by IL-1β revealed that both the JNK and
NFκBpathways are required for optimal expression. Finally, we observed in
iii vivo ATF3 expression in insulin-positive cells from a type 1 diabetic mouse model (NOD), as well as type 1 and 2 human patient pancreatic sections.
In chapter 3, both gain-of-function and loss-of-function strategies were employed in order to test the functional significance of ATF3 expression in β- cells. Transgenic mice were generated using a PDX1 enhancer region that specifically targeted ATF3 expression to pancreatic β-cells. Ectopic ATF3 expression in insulin precursor cells during development resulted in decreased islet area at postnatal day 1 (P1), abnormal distribution of hormone-producing cells, and decreased body weight. ATF3 transgenic mice displayed several diabetic symptoms including low serum insulin levels, high glucagon levels, high blood glucose levels, and elevated ketone bodies. In order to test whether
ATF3 expression is required for β-cell death following stress treatment, primary islets were purified from either ATF3+/+ or ATF3-/- mice. Partial protection from two cytokine (IL-1β+IFN-γ)-induced apoptosis was observed using ATF3-/- islets, suggesting that ATF3 induction is required for optimal cell death. In addition, ATF3 induction by nitric oxide (NO) is required for optimal levels of
NO-induced β-cell death.
Data presented in chapter 4 investigates the potential interaction between
Akt activation and ATF3 induction and explores the functional relevance of this cross-talk. In this chapter, Akt activation is shown to block ATF3 induction following IL-1β treatment through its ability to inhibit JNK activation in β-cells.
Based on this cross-talk, we hypothesized that one mechanism whereby Akt prevents β-cell death is by inhibiting expression of pro-apoptotic genes, such as
iv ATF3. In support of this hypothesis, co-expression of ATF3 in β-cells significantly reversed the phenotype observed in the constitutively active Akt transgenic mice. Insights into the mechanism of ATF3-mediated killing revealed that ATF3 expression was sufficient to induce caspase-9 activation, suggesting that both ATF3 and Akt may affect cell survival at the level of the intrinsic (mitochondrial) cell death pathway.
Work presented in this thesis implicates a novel role for ATF3 in stress- induced β-cell death and diabetes. Our lab is currently interested in gaining a mechanistic understanding of ATF3-induced β-cell death, including the identification of target genes and interacting proteins that are involved in this process. In addition, we are interested in investigating the roles of the intrinsic versus the extrinsic apoptotic pathways and the cell death machinery
(caspases) in ATF3-dependent β-cell apoptosis. Based on this body of work,
ATF3 represents a potential therapeutic target for the generation of inhibitors designed to enhance β-cell survival.
v
Dedicated to my family: George, Jane, Halea, and Tim
vi ACKNOWLEDGMENTS
I would like to thank my advisor Dr. Tsonwin Hai for the tireless dedication and encouragement she provided while training me to become a better scientist. I appreciate all those long friday lab meetings in which she challenged me to understand the logic and critical thought processes involved in scientific discovery. I also thank her for giving me the freedom to test my own ideas and hypothesis. I would also like to thank my committee members
Dr. Gary Kociba, Dr. James DeWille, and Dr. John Oberdick for discussions and advice on my research. A special thanks to Dr. Kociba for providing pathology expertise in the critical analysis of pancreas tissue sections.
I would like to thank current and past members of the Hai lab: Dr. Amy
Allen-Jennings, Dr. Yoshida Okamoto, Jingchun Chen, Dan Lu, Dan Li, Xin Yin,
Erik Zmuda, and Christopher Wolford. The fun and supportive atmosphere that they provided in the lab was greatly appreciated. I thank them for making me laugh, especially during those difficult lab days. I would like to give a special thanks to Matthew Duer for providing expert assistance in the maintenance, screening, and characterization of transgenic mice.
vii I would like to give a special thanks to my parents. Without their unconditional love, support, and guidance my journey to become a scientist would not have been possible. They have provided me with an example of honesty and integrity, and their hard work and sacrifice over the years gives me the motivation to overcome any obstacle. I am extremely proud of my twin sister Halea and younger brother Tim. Their outgoing personalities and passion for living has provided me with many special memories throughout the years and I look forward to many more in the future.
Finally, I would like to thank my wife Tiffiney for her love and support. You are my best friend and I look forward to many happy years of marriage in our future.
viii VITA
September 23, 1974…………………………Born – Princeton, NJ
1997……………………………………...B.S. Biology, University of Maryland
1998-present……………………………Graduate Teaching and Research Associate, The Ohio State University
PUBLICATIONS
1. James L. Smith, Alicia E. Schaffner, Joseph K. Hofmeister, Matthew G. Hartman, Guo Wei, David A. Hume, and Michael C. Ostrowski. Ets-2 is a target for an Akt (PKB)/Jun N-terminal Kinase signaling pathway in macrophages of motheaten-viable mutant mice. Mol. Cell Biol. 2000 Nov; 20(21):8026-34.
2. Amy E. Allen-Jennings, Matthew G. Hartman, Gary J. Kociba, and Tsonwin Hai. The roles of ATF3 in glucose homeostasis: A transgenic mouse model with liver dysfunction and defects in endocrine pancreas. J Biol Chem. 2001 Aug 3; 276 (31):29507-14.
3. Matthew G. Hartman and Tsonwin Hai. The molecular biology and nomenclature of the ATF/CREB family of transcription factors: ATF proteins and homeostastis. Gene 2001 Jul 25;273(1):1-11
4. Amy E. Allen-Jennings, Matthew G. Hartman, Gary J. Kociba, and Tsonwin Hai. The roles of ATF3 in liver dysfunction and the regulation of phosphoenolpyruvate carboxykinase gene expression. J Biol Chem. 2002 May 31;277(22):20020-5.
ix 5. Matthew G. Hartman, Mi-Lyan Kim, Dan Lu, Gary J. Kociba, Tala Shukri, Jean Buteau, Xiaozhong Wang, Wendy L. Frankel, Denis Guttridge, Marc Prentki, Shane T. Grey, David Ron, and Tsonwin Hai. Role of Activating Transcription Factor 3 in Stress-Induced β-cell apoptosis. Mol Cell Biol. 2004 Jul;24(13):5721-5732.
FIELDS OF STUDY
Major Field: Molecular, Cellular and Developmental Biology
x TABLE OF CONTENTS
Page
Abstract ...... ii
Dedication ...... vi
Acknowledgments ...... vii
Vita ...... ix
List of Tables ...... xiii
List of Figures...... xiv
Abbreviations...... xvii
Chapters:
1. Introduction...... 1
A.1: The ATF/CREB family of transcription factors...... 1 A.2: Cloning and Characterization of ATF3 ...... 3 A.3: ATF3 as a stress-inducible gene...... 11 A.4: Signal transduction pathways involved in ATF3 induction ...... 13 A.5: ATF3 transcriptional activity...... 16 A.6: Consequences of expression: the dichotomy of ATF3...... 18 A.7: Potential role in proliferation and metastasis...... 20 A.8: Conclusion ...... 22
B.1: Epidemiology of diabetes...... 23 B2.1: Type 1 diabetes: genetic susceptibility...... 24 B2.2: Type 1 diabetes: β-cell autoantigens ...... 27 B2.3: Type 1 diabetes: effector cells ...... 29 B2.4: Type 1 diabetes: mechanisms of β-cell death...... 32 B3.1: Type 2 diabetes: insulin signaling ...... 42 B3.2: Type 2 diabetes: obesity and insulin resistance...... 44
xi B3.3: Type 2 diabetes: β-cell apoptosis...... 49 B3.4: Type 2 diabetes: genetic susceptibility...... 52 B3.5: Type 2 diabetes: therapeutic targets...... 54
C.1: Overview of thesis work...... 56
2. ATF3 Induction in Pancreatic β-cells by Stress Signals Relevant to Type 1 and Type 2 Diabetes...... 58
Summary...... 58 Introduction ...... 59 Materials and Methods ...... 62 Results ...... 69 Discussion...... 81
3. Functional Consequence of ATF3 Expression in Pancreatic β-cells...... 84
Summary...... 84 Introduction ...... 85 Materials and Methods ...... 89 Results ...... 97 Discussion...... 110
4. Examination of Potential Cross-talk and Functional Interaction Between ATF3 and Akt in β-cells ...... 117
Summary ...... 117 Introduction...... 118 Materials and Methods ...... 131 Results...... 136 Discussion ...... 153 Thesis Summary...... 156
5. Future Perspectives...... 160
Bibliography...... 164
xii LIST OF TABLES
Table Page
1.1 A partial list of treatments that induce ATF3 expression...... 13
1.2 Auto-antigens and T1D pathogenesis ...... 29
3.1 PDX-ATF3 mice have low body weight and defects secondary to β-cell deficiency...... 103
xiii LIST OF FIGURES
Figure Page
1.1 Dendogram representation of sequence homology within the bZip domain of transcription factors...... 3
1.2 Exon organization of ATF3 ...... 4
1.3 Schematic representation of the ATF3 gene and the mRNA species generated by alternative splicing ...... 7
1.4 Nucleotide sequence of the 5’-flanking region of ATF3 ...... 10
1.5 Type 1 diabetes associated haplotypes...... 26
1.6 Effector cells involved in β-cell destructioin ...... 32
1.7 Proposed cellular mechanisms of β-cell death ...... 35
1.8 Signaling mechanisms and cross-talk between IL-1β, IFN-γ, and TNF-α receptors ...... 39
1.9 Cytokine-induced changes in β-cell gene expression with a potential role in the process of β-cell death ...... 41
1.10 The role of serine kinase activation in oxidative stress- induced insulin resistance ...... 46
1.11 Fundamental therapies targeting key molecules involved in obesity-induced insulin resistance...... 56
2.1 ATF3 is induced by cytokines and elevated glucose or palmitate ...... 71
2.2 ATF3 is induced by oxidative stress in pancreatic β-cell lines...... 72
2.3 Role for NFκB pathway in ATF3 induction by cytokines ...... 75
xiv 2.4 Role for JNK/SAPK pathway in ATF3 induction by cytokines...... 76
2.5 ATF3 expression in the NOD type 1 diabetic pancreata...... 79
2.6 ATF3 expression in insulin-positive cells of NOD and human diabetic pancreata ...... 80
3.1 Model for pancreas development ...... 88
3.2 Generation of PDX-ATF3 transgenic mice ...... 101
3.3 PDX-ATF3 mice have small and abnormal islets...... 102
3.4 ATF3 expression promotes activation (cleavage) of caspase-3 ...... 104
3.5 ATF3 is induced in the developing embryo by hypoxia or hypoxia/reoxygenation...... 105
3.6 Islets deficient in ATF3 are partially protected from cytokine-induced apoptosis ...... 108
3.7 Islets deficient in ATF3 are partially protected from NO-induced apoptosis ...... 109
4.1 Domain structure of Akt isoforms and AGC kinases ...... 120
4.2 Schematic representation of Akt activation...... 123
4.3 Physiological functions of Akt ...... 129
4.4 Schematic representation of JNK/SAPK activation...... 131
4.5 Inhibition of IL-1β-mediated ATF3 induction by insulin signaling ...... 141
4.6 Role for PI3K in insulin-mediated inhibition of ATF3 induction...... 142
4.7 Inhibition of IL-1β-mediated ATF3 induction by activated Akt ...... 143
4.8 Inhibition of ATF3 basal promoter activity by activated Akt...... 144
4.9 ATF3 expression stimulates the intrinsic cell death pathway...... 146
4.10 Generation of RIP-ATF3 transgenic mice ...... 150
4.11 Characterization of RIP-myrAkt/ATF3 double transgenic mice...... 151
xv
4.12 Examination of islet morphology in RIP-myrAkt/ATF3 double transgenic mice ...... 152
4.13 Examination of ATF3 phosphorylation status...... 155
4.14 Final Model ...... 161
xvi ABBREVIATIONS
AA amino acids
ADR adriamycin
AID auto-inhibitory domain
AP alkaline phosphatase
APC antigen-presenting cell
ASK apoptosis signal regulating kinase
ATF Activating Transcription Factor
BGal Beta galactosidase
BOH-buty beta hydroxyl butyrate bp base pairs
BPDE benzo[a]pyrene diol epoxide bZip basic region, leucine zipper cAMP cyclic adenosine monophosphate
CCl4 carbon tetrachloride
CDK cyclin-dependent kinase cDNA complimentary deoxyribonucleic acid
CKI cyclin-dependent kinase inhibitor
CO2 carbon dioxide
xvii CREB cAMP-response element binding protein
CTD carboxy-terminal domain
CTLA cytotoxic T-lymphocyte antigen
DAB diaminobenzidine
DEPC diethylpyrocarbonate
DMEM Dulbecco’s Modified Eagle medium
DMSO dimethyl sulfoxide
DNA deoxyribonucleic acid dNTPs deoxynucleotide triphosphates
DTT dithiothreitol e embryonic
E early
EDTA ethylenediamine tetraacetic acid
EGF epidermal growth factor eIF eukaryotic initiation factor
EMSA electromobility shift assay
ERK extracellular signal regulated kinase
ES embryonic stem
FACS fluorescent associated cell sorting
FADD Fas-associated death domain protein
FBS fetal bovine serum
FFA free fatty acids
xviii FGF fibroblast growth factor
FITC fluorescein isothiocyanate
FL full length
G gap
GABA γ-aminobutyric acid
GAD glutamic acid decarboxylase
GAPDH glyceraldehyde-3-phosphate dehydrogenase
GFP green fluorescent protein
GH growth hormone
GLUT glucose transporter
GSNO S-nitrosoglutathione
GSK glycogen synthase kinase
GST glutathione-S-transferase
GTT glucose tolerance test
Gy gray
H2O2 hydrogen peroxide
HA hemagglutinin
H+E hematoxylin and eosin
HGF human growth factor
HIF hypoxia-inducible factor
HLA human leukocyte antigen
HM hydrophobic motif
HRE hypoxia responsive element
xix HSP heat shock protein
HTLV human T-cell leukemia virus
HUVEC human umbilical vein endothelial cells
IA-2 insulinoma-associated protein
IAPP islet amyloid polypeptide
IB immunoblot
IB-1 islet-brain 1
IF immunofluorescence
IFN interferon
IGF insulin growth factor
IHC immunohistochemistry
IKK Ikappa B kinase
IL interleukin
IP immunoprecipitation
IP intraperitoneal
IR ionizing radiation
IR insulin receptor
IRS insulin receptor substrate
JIP JNK-interacting protein
JNK c-jun N-terminal kinase
Kb kilobase
KD kinase domain
KO knock out
xx L-NIO iminoethyl ornithine dihydrochloride
LPC lysophosphatidylcholine
LPS lipopolysaccharide
LRF liver regenerating factor
LTR long terminal repeat
Luc luciferase
MAPK mitogen activated protein kinase
MEF mouse embryonic fibroblast
MHC major histocompatibility complex
MKK mitogen activated protein kinase kinase
MOI multiplicity of infection mRNA messenger ribonucleic acid myr myristolated
NAC N-acetyl-cysteine
Neo neomycin
NFκB nuclear factor kappa B
NGF nerve growth factor
NO nitric oxide
NOD non-obese diabetic
NonTxg nontransgenic
NOS nitric oxide synthase
NP-40 nonidet P-40 ob obese
xxi oxLDL oxidized low-density lipoprotein
P postnatal
PBS phosphate buffered saline
PCR polymerase chain reaction
PDGF platelet derived growth factor
PDX pancreas/duodenum homeobox gene
PEPCK phosphoenol pyruvate carboxy kinase
PH pleckstrin homology
PI propidium iodide
PIP phosphatidylinositol
PMA phorbol 12-myristate 13-acetate
Pol polymerase
Poly(A) poly adenosine
PPAR peroxisome proliferative activated receptor
PTZ pentylenetetrazole
PVDF polyvinylidene fluoride
RIP rat insulin promoter
RNA ribonucleic acid
ROS reactive oxygen species
RPMI Roswell Park Memorial Institute
RT reverse transcriptase
RTK receptor tyrosine kinase
RT-PCR reverse transcriptase-polymerase chain reaction
xxii rtTA reverse tetracycline trans-activator
Saos osteosarcoma
SAPK stress activated protein kinsae
SDS-PAGE sodium dodecyl sulfate-polyacrylamide gel electrophoresis
SE standard error
SH src homology
SiRNA short interfering RNA
SNP single nucleotide polymorphism
SSC saline citrate
STZ streptozotocin
T1D type 1 diabetes
T2D type 2 diabetes
TAMRA tetramethylrhodamine tetO tetracycline operator
TG triglyceride
TGF transforming growth factor
TNF tumor necrosis factor tRNA transfer RNA
TTR transthryretin
TXG transgenic
TZD thiazolidinediones
UTR untranslated region
UV ultraviolet
xxiii VNTR variable number of tandem repeats
xxiv CHAPTER 1
INTRODUCTION
Work presented in this thesis implicates a role for Activating Transcription
Factor 3 (ATF3) in the pathogenesis of diabetes through its ability to promote β- cell death. The first part of chapter 1 presents an overview of ATF3, including the cloning and characterization of its gene structure, induction during the stress response, and physiological consequences of ATF3 expression. The second part of chapter 1 reviews our current understanding of type 1 and type 2 diabetes, with emphasis on signal transduction and mechanisms of β-cell death.
Following this overview, chapter 1 dissects the rationale for examining the induction and functional significance of ATF3 expression in β-cells and summarizes results presented in subsequent data chapters.
A.1 The ATF/CREB family of transcription factors
Sequence-specific transcription factors function to regulate gene expression through their ability to bind specific DNA sequences located within promoter regions. The ATF/CREB transcription factors were originally defined by their
DNA binding activity in which they interact with a core consensus sequence of
1 5’-TGACGTCA-3’. This ATF/CRE site can be found in many viral promoters including the E1A-inducible adenovirus E2, E3, and E4 promoters, as well as the HTLVI LTR (Lee et al., 1987). Many cellular gene promoters have also been shown to contain the ATF/CRE consensus sequence, including cAMP- inducible genes (somatostatin), c-fos, HMG-CoA reductase, insulin, and cyclin
A (Lin and Green, 1988). Screening of a λgt11 expression library with a DNA probe containing three tandem ATF-binding sites revealed that multiple cellular proteins were able to recognize this core DNA sequence. In that screen, more than 10 different cDNA clones were identified and clones designated as ATF-1 through ATF-8 were chosen for further analysis (Hai et al., 1989). Sequence analysis of ATF clones 1-6 revealed the presence of a highly basic region immediately followed by a leucine-zipper (bZip) motif in all six cDNA clones (Hai et al., 1989). ATF proteins have been grouped with other members of the bZip- containing superfamily based on sequence homology within this domain
(Newman and Keating, 2003) (Fig. 1.1). Electrophoretic mobility shift assays
(EMSA) demonstrated that ATF-1, ATF-2, and ATF-3 proteins bind to DNA as homodimers and that selective hetero-dimerization can occur between ATF family members (Hai et al., 1989).
Research in our laboratory over the past several years has focused on the
ATF3 transcription factor. Work presented in this thesis examines the induction and consequences of ATF3 expression in pancreatic β-cells. This introduction will briefly review previously characterized aspects of ATF3 biology, including
2 the characterization of ATF3 gene sequence and protein structure, the regulation of ATF3 gene expression, and the functional consequences of ATF3 upregulation.
Figure 1.1: Dendogram representation of sequence homology within the bZip domain of transcription factors (Newman and Keating, 2003).
A.2 Cloning and Characterization of ATF3
Characterization of the human ATF3 gene structure revealed that the full- length ATF3 is encoded by four exons, designated as exons A, B, C, and E
(Liang et al., 1996). Exon A measures 167 bp in length and contains the 5’
3 untranslated region. Exon B contains the AUG initiation codon and this 244 bp region codes for the first 80 amino acid residues. Exon C codes for 36 amino acids that represent the basic region, whereas exon E encodes 65 amino acids that make up the leucine zipper region and 3’ untranslated region (Liang et al.,
1996) (Fig. 1.2). Homologous genes have been identified in other species that share approximately 95% amino acid identity with human ATF3 and have been referred to as LRF-1 (Hsu et al., 1991) in rat and TI-241 (Ishiguro et al., 1996) in mouse.
1 167 411 519 717 1914 mRNA ABC E
CAAAUG GAG GUA AAA GAG AGCUAA M E V K ES* Protein Basic ZIP
1 80 116 181
Figure 1.2: Exon organization of ATF3. Schematic representation of the mRNA and protein for ATF3. Exons in mRNA are indicated by boxes labeled as A, B, C, and E. Functional domains within protein are indicated by boxes, with the basic region and leucine zipper (ZIP) domains labeled. The codons and amino acids at the border of each domain are indicated. (Liang et al., 1996)
Several splice variants of ATF3 have been identified in various cell types.
The ATF3∆Zip isoform arises due to inclusion of an additional exon D, which is located between exons C and E (Chen et al., 1994). This additional exon D
4 contains an in-frame termination codon resulting in the production of a truncated protein lacking the leucine zipper domain. The ATF3∆Zip isoform does not bind to DNA; it slightly but consistently stimulates transcription from promoters with or without ATF sites, presumably by sequestering away co- inhibitory factors (Chen et al., 1994). ATF3∆Zip2a and ATF3∆Zip2b isoforms were originally detected following treatment of HUVEC cells with homocysteine and induction of these isoforms was shown to be enhanced by thapsigargin, tunicamycin, hydrogen peroxide and TNF-α (Hashimoto et al., 2002). Both splice variants encode a 135 amino acid protein sequence and utilize a novel splice acceptor site located 76 bases upstream of exon D, designated as exon
D’. Splicing between exons D and E occurs in ATF3∆Zip2b in a similar manner as ATF3∆Zip; however, this 91 base pair fragment is not removed in
ATF3∆Zip2a. Although localized to the cell nuclei, ATF3∆Zip2 protein is unable to bind DNA and counteracts the transcriptional repression by full-length ATF3
(Hashimoto et al., 2002). The splice variants designated as ATF3∆Zip2c and
ATF3∆Zip3 were originally identified in HepG2 hepatoma cells following amino acid deprivation (Pan et al., 2003). Analysis of the nucleotide sequence revealed that ∆Zip2c arises from a splicing event that removes 87 bp within exon B and therefore creates two exons designated as exons B1 and B2. The
∆Zip2c isoform contains exons D’ and D but lacks exon E and produces a protein lacking the leucine zipper dimerization domain (Pan et al., 2003). ∆Zip3 contains an intact exon B, however, no splicing event occurs between exons C and D’ which allows for the inclusion of additional sequence containing a stop
5 codon. The ATF3b isoform, a 124-amino acid protein which lacks the N- terminal 57 amino acids, was originally identified from untreated glucagon expressing pancreatic α cells (Wang et al., 2003b). mRNA encoding this isoform arises due to a splicing event that removes 106 nucleotides covering the ATG start codon found in exon B. ATF3b is derived from translation initiation at an alternative downstream start codon, producing a truncated protein with an intact bZip domain that was shown to stimulate proglucagon gene transcription (Wang et al., 2003b) (Fig. 1.3).
6 ATG TAA A. Full- length ABCE TAG ∆Zip ABCED TGA D ∆Zip2a ABCED’ E’
TGA ∆Zip2b ABCED’D TGA ∆Zip2c AB1CB2 D’D TAG D ∆Zip3 ABCC’ D’ ATG TAA ATF3b A B3 B4 CE
B. 87 base pairs Spliced ∆Zip2c fragment
ATGATGCTTCAACACCCAGGCCAGGTCTCTGCCTCGGAA GAAGAGCTGAGGTTTGCCATCCAGAACAAGCACCTCTGC M M L Q H P G Q V S A S E E E L R F A I Q N K H L C B1 B2
ATF3b 106 base pairs Spliced fragment
AGCTGAGGTTTGCCATCCAGAACAAGCACCTCTGC ATGATGCTTCAACACCCAGGCCAG CATCGGATGTCCTCTG M S S B3 B4
C. Basic Leucine-zipper Full-length 181 AA ∆Zip 118 AA
∆Zip2a,b 135 AA ∆Zip2c 106 AA ∆Zip3 120 AA
ATF3b 124 AA
Figure 1.3: Schematic representation of the ATF3 gene and the mRNA species generated by alternative splicing. (a) The genomic arrangement of all known splicing isoforms is compared with that of ATF3-FL. Exons A-E and C’-E’ are indicated by boxes, and the translation start sites (ATG) and translation stop codons (TAA, TAG, TGA) for each isoform are shown. (b) The details for variation in splicing that generates the ∆Zip2c and ATF3b isoforms are shown. (c) The predicted protein structure for each of the ATF3 mRNAs is shown, with the basic and leucine zipper regions designated.
7 Sequence analysis of the ATF3 promoter region approximately 2 kilobases upstream from the transcriptional start site revealed the presence of a TATA box located at -30 relative to the transcriptional start site, as well as an
ATF/CRE site around -90 (Liang et al., 1996). In addition to the ATF/CRE site, several other transcription factor consensus binding sites were identified including NFκB, AP1, E2F, Myc/Max, Smad, p53, and HIF sites. Several consensus sites within the ATF3 5’-flanking region can be classified into two groups: elements known to confer inducibility and elements implicated in cell cycle regulation. The ATF/CRE, AP1, p53, Smad, HIF and NFκB sites can be classified as inducible due to activation of the corresponding transcription factors by signals such as UV, cytokines, TGF-β, and hypoxia (Meyer and
Habener, 1993). Deletion analysis of the 5’ flanking region revealed that the
ATF/CRE site located at -92 to -85 is a major sequence element responsible for
ATF3 induction by homocysteine (Cai et al., 2000). EMSA, immunoprecipitation, and cotransfection assays demonstrated that ATF2 and c- jun bind to this element and promote upregulation of ATF3 promoter activity. In addition, two p53-responsive elements were identified between -379 to -370 and -351 to -342 relative to the transcriptional start site. p53 was shown to bind these sites by EMSA analysis and these elements were able to confer p53 responsiveness to a heterologous promoter using reporter assays (Zhang et al.,
2002). Analysis of ATF3 upregulation following TGF-β treatment revealed in vivo binding of Smad2/3 and Smad4 proteins to the region between -1850 to -
1408 (Kang et al., 2003). Thus, ATF3 induction during the stress response
8 appears be mediated, at least partly, at the transcriptional level. The presence of Myc/Max and E2F sites within the ATF3 promoter suggests that expression may be regulated in a cell cycle-dependent manner; however, currently there is no evidence to support this notion.
9 Myc/Max AAGCTTCACGTGTTCT
-2040 CCCTCCTCTCCTTGCTTCACTTTATAATGGTGCTATTTATTCCAGAACAATCTATAAGTAGATAAAATAG -1970 CTAAGTAGAGATAACAAATAACTTCATTCAAATGCAAACACTCCTCCACCTAATCCCGCCCGGTGTCCGC -1920 CGGGCTGCTCCGACACGCCCGGGGTTTACCTGCGCGCACTCCAGCGGGAGGGCGGGTTGTGGAGGTGTGC
-1850 TGAGCGGCGCGCGGGGGTGAGGGCGTGGAATCTGAGGGTGGGGCCCGGAGAGCCGTTACCAGGGCGAAAA Smad -1780 GTAAAGCGAAAACACCCGCCCTGCACTTCCCGCGCGACGCCGCTGGAAATCGGTTCAGGTCCAGAGCAGG -1710 ATCTCGGAGGATCCCGCGTGGAACCCCAGGGCTCCCGGGTCCGCCGGGGCGCAAAGACTTCCGAGGCCGC Myc/Max Myc/Max AP1 NFκB -1640 CCTCCGCGTGTTCCCAGGCCCGTGGAGAGGTGGGTGGTCTGAGTAAGGTCGGGCTTGGCGGCGAGGAACC NFκB Smad -1570 CCGGTGGGGGGAACTGGGGACTTCAAGTGAGACCCAGGATCCAGACACCTCTAGTTTCTACCCCAAATTA
-1500 ACCAAACTGTGACCTTGGGCCGCTCTCTCCCAGAGGCAGGTGGAAAGAAGCAGGTGTTTCTGCCCTTCAC E2F -1430 CGTGCCCCCACACCCTGCGGCCGCGCAGGTCTCCCTCCCAGGCAGGTGCGAAAGTCCCAGGCCACACTTG AP1 -1360 TCTACAAATAGTCATCCACGGGAGTAAGAAGGTTCCTTGGTTCTGCCGCTCTCTGAGCAGAAATTGTTGG
-1290 GGTCGGGGAATAAGAACCAGGAAATCGTTTTTAAGGTTCAAACCCAGTTCTGCTGAGGTCTCAGCTCGAA E2F -1220 TCTCGGACCACGGGGCCCCGCCTTTCCCGCCACCCTGGCTTGAGGGCAGAGGGGATTTCTGCTGCGGGTT Myc/Max -1150 CCGCCTGTGGTCAGTGCGTCCCCATTCCGGGCCGTCCGGTCCCAGTCCAATCGGCTCTGGAGCGAGAGAC
-1080 GTGAAAGCTGAAGATGGTTTTCCCTAAATATGCCTGAGACGGCACCCCAGGCCTGGGCAGGTTCGCGGAC -1010 CCCAAAGCACCTTCTTCTTTCCCCCTCCTCCTGGCCGCTGGCTTCCGCCCCCTCCTACCCTCCCACCGGG E2F -940 TTGCCTCTGATTCCTCCTGGACTCCGATCTTTTCACGCTCTTGTTGGTTTACTGACAGTTCTTGTCAATT
-870 TCAAACGCTTTGTGATTGTAAAAAAAAAAAAATCGAACCGATACGGTCCTACCACTCGCCCTAGTTTCGG Myc/Max -800 AGCCCGGAGCTGTCCTGCGTGTGCGTCCATGTGGAGTGTCCGGGGCTGCGGGCTCGGGCGCACGGTGCCA -730 GCCGAGGGCTGCCCTCCGCTTTGTGTTAACCGGCGGGCTTCTCGGTCCCCGCCGCAGAGGTCACACCCGG AP1 -660 CGGGTAACGGAGTGGATACACCGAAGGGTGACTTTGGACACCTTCCCCACACCACAGACTAACGCTTCTG
-590 CCCCTACTCCGCCCCTGCTAGAGAAGTAGGAGGCCAATTGGGGAGGGGGTTATTTTCCTGAAGCTCCAGA -520 AAATGACCACGTATTTTAGAGAAAGGTTCGTGCCCGCTTCCCAGCCTCACCTAGTCTGGGCTGGGGCCGG
-450 GACCCGCCTCCCCACCTTCCCCGCCCCCCCCGCTCTTCAACCTAGCGGAGGGACAGATGCCAGCGCGGTG p53 p53 -380 GAGTCATGCCGCTGGCTTGGGCACCATTGGTCATGCCTGGAACACGCAGCAGCGAGTACGCACATCTGGC
-310 GGCTATCCCGGGCGGCTCCGGTCCTGATATGGAGAGAGAGGGCGGGCTGGTGTGTGTCTCAGTGAGCGAG
-240 GGCGGGGGAACGCGCCTGGGCTGGCTCCTCCCCGAACTTGCATCACCAGTGCCCCCTCTCTCCACCCCTT
-170 CGGCCCCGCCTTGGCCCCTCCTCCACCCCCCTTCCTCCGCTCCGTTCGGCCGGTTCTCCCGGGAAGCTAT ATF/CRE TATA -100 TAATAGCATTACGTCAGCCTGGGACTGGCAACACGGAGTAAACGACCGCGCCGCCAGCCTGAGGGCTATA Box -30 AAAGGGGTGATGCAACGCTCTCCAAGCCACAGTCGCACGCAGCCAGGCGCGCACTGCACAGCTCTCTTCT +1 +41 CTCGCCGCCG
Figure 1.4: Nucleotide sequence of the 5’-flanking region of ATF3. The TATA box and several transcription factor binding sites are underlined and labeled. The arrow marks the transcription start site (+1). GenBank Accession #U37542
10 A.3 ATF3 as a stress-inducible gene
Research over the past decade has identified ATF3 as a stress-inducible gene. Endogenous basal levels of ATF3 mRNA are rapidly increased following exposure of various cell types to different stress agents including cyclohexamide, anisomycin, ionizing radiation, and UV (Hai et al., 1999). ATF3 induction has also been observed in various tissues in vivo following treatment with chemical toxins or following surgical procedures (Hai et al., 1999). For example, in vivo physiological stress models have demonstrated ATF3 induction in cells surrounding the liver central veins following CCl4 treatment and induction throughout the liver following alcohol treatment (Chen et al.,
1996). ATF3 was also shown to be induced in the ventricular wall of the rat heart following ischemia (deficiency of blood) or ischemia coupled with reperfusion (Chen et al., 1996; Yin et al., 1997). Treatment of rats with pentylenetetrazole (PTZ), a well characterized seizure-promoting drug, was able to induce ATF3 specifically in the dentate gyrus region of the brain. These studies also identified gadd153/Chop10, which has an inverse expression pattern following stress treatment, as an ATF3 interacting protein that acts to inhibit binding to an ATF/CRE consensus site (Chen et al., 1996). Thus, it has been proposed that gadd153/Chop10 acts to inhibit the function of endogenous
ATF3 protein through the formation of non-functional heterodimers. While
ATF3 induction was observed by a wide variety of stress signals, treatment with light stimulation during the dark phase of the mouse circadian cycle failed to
11 induce ATF3 expression in the suprachiasmatic nucleus, suggesting that ATF3 may not play a role in the circadian rhythm stress response (Chen et al., 1996).
ATF3 induction has been observed by several different stress stimuli through the use of microarray-based screening approaches. Independent microarray screens revealed a 10-fold increase in ATF3 transcription in human skin fibroblasts following exposure to UVA light and an approximately 12-fold increase in ATF3 transcription in macrophages exposed to LPS (Abe et al.,
2003; Drysdale et al., 1996). Proteosome inhibitors are potential cancer therapeutic agents that have been shown to arrest tumor cell growth independently of the well-characterized pro-apoptotic genes encoding p53, Bax,
Bad, and Bak (Herrmann et al., 1998). Exposure of MCF7 breast cancer cells to the proteosome inhibitors lactacystin or MG132 resulted in an approximately
10-fold induction of ATF3 mRNA (Zimmermann et al., 2000). In addition, cDNA microarray studies revealed upregulation of ATF3 expression following treatment of Min6 pancreatic β-cell line with the fatty acid palmitate (Busch et al., 2002). In conclusion, ATF3 induction during the cellular stress response has been well documented and this upregulation of expression is neither cell specific nor stress specific. Upregulation during the stress response is not a common feature of all genes encoding bZip transcription factors, and this mode of regulation may be limited to a subset of genes. Work presented in this thesis increases our understanding of ATF3 induction in pancreatic β-cells by diabetic stress signal using both in vitro and in vivo stress paradigms.
12
In vivo models In vitro models Tissue Treatment Cell Type Treatment
Liver partial hepatectomy hepatocytes cycloheximide alcohol EGF carbon tetrachloride HGF cycloheximide
hepatic ischemia macrophages cytokines acetaminophen LPS, BCG Heart ischemia PMA ischemia-reperfusion myeloid cells Fas antibody
Kidney ischemia-reperfusion neuroblastoma forskolin FGF Brain seizure fibroblasts serum Skin wounding anisomycin IR, UV Thymus anti-CD3 E1A# Peripheral axotomy nerves
Table 1.1: A partial list of treatments that induce ATF3 expression. All treatments listed in the figure were demonstrated to increase the steady-state levels of ATF3 mRNA.
A.4 Signal transduction pathways involved in ATF3 induction
ATF3 has been classified as an ‘immediate early gene’ based on its rapid timing of induction following stress treatment. Induction of immediate early genes typically does not require new protein synthesis, but rather requires only the modification of pre-existing transcription factors. Several signaling pathways have been implicated in the induction of ATF3 during the stress response including MAPK pathways (JNK, p38), the p53 tumor suppressor, and
13 TGF-β/Smad signaling. Evidence for each of these will be discussed below.
JNK/p38: Several published reports describe a link between activation of the
JNK MAPK pathway and ATF3 induction following stress treatment. The anthracycline antibiotic adriamycin (ADR) promotes tumor cell death through mechanisms involving intercalation and alkylation of DNA, leading to distortions in the double helix structure (Neidle, 1979). Treatment of a human leukemia T cell line with toxic doses of ADR resulted in increased activation of JNK1 which directly correlated with increased steady-state levels of the immediate early response genes, ATF3 and c-jun (Yu et al., 1996). ATF3 induction was also observed following treatment of human endothelial cells with homocysteine (Cai et al., 2000). Treatment with homocysteine resulted in a rapid and sustained activation of JNK and expression of dominant negative MKK4 and MKK7 inhibited JNK activation and ATF3 induction. Homocysteine treatment was shown to promote binding of an ATF2/c-jun containing complex to an ATF/CRE consensus sequence located at position -92 to -85 within the ATF3 promoter
(Cai et al., 2000). Benzo[a]pyrene diol epoxide (BPDE) is a polycyclic aromatic hydrocarbon which has been shown to function as a genotoxic chemical carcinogen. ATF3 protein levels increased beginning at 2 hours following treatment of mammary epithelial cells with BPDE and were sustained up to 10 hours (Wang et al., 2003a). Increased phosphorylation and activation of the
JNK kinase and c-jun transcription factor were detected within 30 minutes of
BPDE treatment, consistent with the involvement of the JNK pathway in ATF3 induction. In addition to these reports, it has been shown that ATF3 induction
14 by ionizing radiation in primary human fibroblasts requires JNK and p38 MAP kinase activation (Kool et al., 2003). Both the JNK and p38 MAP kinases phosphorylate ATF2 following their activation by IR, and this activated form of
ATF2 was shown to increase ATF3 promoter activity.
p53: Previous work has implicated a role for the p53 tumor suppressor protein in the induction of ATF3 during the stress response. ATF3 expression was found to be upregulated following treatment of the ML-1 human myeloid cell line with ionizing radiation (IR) (Amundson et al., 1999). The five-fold induction of
ATF3 observed in the wild type cell lines was inhibited following abrogation of p53 function. In addition, ATF3 expression was induced in the thymus following
5 Gy whole-body gamma-irradiation of wild type mice; however, no ATF3 induction was detected in p53-/- mice (Amundson et al., 1999). Consistent with a role for p53 in ATF3 induction, microarray analysis using a human lung cancer cell line harboring a temperature sensitive p53 allele revealed ATF3 upregulation following a shift to the permissive temperature (Kannan et al.,
2001). ATF3 induction was observed even in the presence of cyclohexamide, a potent protein synthesis inhibitor, suggesting that ATF3 may be a primary p53 target gene. Consistent with these results, ATF3 was induced less efficiently in
HCT116 cells containing a null mutant p53 allele following treatment with UV or the proteosome inhibitor MG132 (Zhang et al., 2002). It was demonstrated that p53 functions to stimulate ATF3 promoter activity through its ability to bind to p53-responsive elements located at -379 to -370 and -351 to -342 (Zhang et al.,
15 2002). In conclusion, studies suggest that ATF3 upregulation during the stress response requires function of the p53 transcription factor.
TGF-β: Two recent reports have implicated a role for the TGF-β signaling pathway in regulating ATF3 induction. ATF3 was shown to be a direct transcriptional target of TGF-β, and binding of Smad2/3 and Smad4 proteins to the TGF-β responsive region within the ATF3 promoter was detected in vivo
(Kang et al., 2003). Treatment with cyclohexamide did not block the induction of ATF3 by TGF-β, suggesting that TGF-β can directly induce ATF3 transcription through activation of Smad proteins. In support of these results, both TGF-β treatment and overexpression of constitutively active Smad3 were found to increase ATF3 protein levels in NMuMG cells (Bakin et al., 2005). In both cases, ATF3 was found to play a role in mediating TGF-β-induced repression of downstream target genes.
Work presented in this thesis investigates the signal transduction pathways required for ATF3 induction in pancreatic β-cells. Data presented in this thesis provides evidence that the JNK/SAPK pathway, which has previously been implicated in the promotion of β-cell death, plays an essential role in regulating
ATF3 induction. Furthermore, a novel role for the NFκB pathway in regulating
ATF3 expression is presented.
A.5 ATF3 transcriptional activity
bZip domain containing transcription factors possess DNA binding activity and a wealth of information supports the notion that the ATF3 homodimer
16 functions as a transcriptional repressor. Initially it was discovered that ATF3 could repress the activity of promoters containing ATF sites, but not promoters lacking ATF sites (Chen et al., 1994). Chen et. al. proposed the co-factor model in which ATF3 represses transcription from a promoter with ATF sites by stabilizing inhibitory co-factors at the promoter. Consistent with this model was the finding that the ATF3∆Zip isoform, which lacks a functional DNA binding domain, stimulates transcription from a promoter either with or without ATF sites (Chen et al., 1994). Examination of the effects on physiologically significant genes revealed that expression of ATF3 inhibited TNF-α-induced E- selectin promoter activity, as well as p53-dependent transactivation of the collagenase promoter (Nawa et al., 2000; Yan et al., 2002). In addition to its function as a homodimer, ATF3 has been shown to associate with Smad3, resulting in repression of the Inhibitor of differentiation (Id1) gene in epithelial cells (Kang et al., 2003). During viral infection, the repression capability of
ATF3 was found to be enhanced by co-expression of the hepatitis B virus X protein which interacted with ATF3 and strengthened its DNA-protein interaction
(Barnabas et al., 1997). ATF3 was also shown to possess transcriptional activation capabilities upon dimerizaton with AP-1 family members such as c-
Jun or JunD (Nilsson et al., 1995). In conclusion, following its induction during the stress response, ATF3 can function as a transcriptional repressor or activator based on its protein partner and the cellular promoter context.
17 A.6 Consequences of expression: the dichotomy of ATF3
Prior to this thesis undertaking, the consequences of ATF3 expression were poorly characterized. Previous results from our laboratory suggested that ATF3 expression was sufficient to promote detrimental cellular outcomes. For example, induction of ATF3 expression in a tetracycline-inducible fibroblast stable cell line resulted in cellular apoptosis, as measured by AnnexinV staining, TUNEL, and DNA laddering (Wolfgang, unpublished results). In addition to cell line studies, our laboratory had previously examined the functional consequences of ATF3 induction through the use of transgenic mouse models with ectopic expression of ATF3 in various tissues. The consequence of ATF3 expression in the heart was examined by cardiac-specific expression in transgenic mice using the α-myosin heavy chain promoter.
Transgenic mice displayed atrial enlargement, as well as atrial and ventricular hypertrophy and isolated cardiac myocytes had reduced contractility (Okamoto et al., 2001). Ectopic expression of ATF3 in hepatocytes resulted in mice displaying several phenotypic symptoms indicative of general liver dysfunction.
These mice showed defects in their ability to regulate glucose homeostasis due to the ability of ATF3 to inhibit expression of gluconeogenic enzymes (Allen-
Jennings et al., 2002). In addition, transgenic mice expressing ATF3 in both the liver and endocrine pancreas had elevated blood glucose levels due to decreased production of pancreatic insulin (Allen-Jennings et al., 2001). Thus, initial gain-of-function approaches performed in our laboratory suggested that
18 ectopic ATF3 expression in several different cell types leads to detrimental cellular outcomes.
During the course of this thesis work, conflicting reports have been published which describe either an anti-apoptotic role or a pro-apoptotic role for
ATF3 following its induction in a variety of cell types. For example, expression of ATF3 in human umbilical vein endothelial cells (HUVECs) by adenovirus- mediated gene transfer protected these cells from TNF-α induced apoptosis
(Kawauchi et al., 2002). Further examination of this protective mechanism revealed down-regulation of p53 gene expression due to ATF3 binding to an atypical AP-1 element within the p53 promoter. Consistent with the notion that
ATF3 inhibits apoptosis by repressing p53 gene transcription, ATF3 expression had no effect on TNF-α-induced apoptosis in Saos-2 cells with a p53 null allele
(Kawauchi et al., 2002). In addition, ATF3 expression was shown to protect cardiac myocytes from doxorubicin-induced apoptosis through a mechanism involving down-regulated p53 expression (Nobori et al., 2002). Expression of
ATF3 by adenovirus-mediated gene transfer protected both PC12 cells and superior nerve ganglion neurons from JNK-induced cell death (Nakagomi et al.,
2003). Under these conditions, ATF3 formed a functional heterodimer with c- jun which induced expression of the heat shock protein 27 (Hsp27) gene.
Hsp27 rescues neurons from cell death and promotes neurite outgrowth in part through its ability to stimulate Akt activation (Nakagomi et al., 2003).
In support of our laboratory’s previous results, several published reports support the notion that ATF3 expression leads to detrimental cellular outcomes.
19 Inhibition of ATF3 induction using antisense cDNA technology was shown to block homocysteine-induced endothelial cell death, thus supporting a pro- apoptotic role for ATF3 (Zhang et al., 2001). In a separate report, treatment with ATF3 antisense cDNA partly suppressed vascular endothelial cell death by
TNF-α, oxLDL, and LPC (Nawa et al., 2002). ATF3 upregulation was observed following treatment with DNA topoisomerase inhibitors and this induction was independent of caspase activation (Mashima et al., 2001). Examination of
ATF3 function revealed that either stable or transient expression accelerated drug-induced apoptosis and enhanced caspase activation; however, ATF3 expression had no effect on Bcl-2, Bcl-xL or Bax expression levels (Mashima et al., 2001).
The apparent discrepancy in the effects of ATF3 on cell survival largely remains a mystery, and may reflect differences in cell types, stress-paradigms, or post-translational regulation (modification, interacting proteins, etc.). Work presented in this thesis adds to our understanding of the functional significance of ATF3 expression in pancreatic β-cells. Through the use of both gain-of- function (transgenic mice) and loss-of-function (knock-out mice) approaches, data presented in this thesis supports a pro-apoptotic role for ATF3 during the stress response in β-cells.
A.7 Potential role in proliferation and metastasis
Several studies have implicated ATF3 in the regulation of cellular proliferation and metastasis. Experiments performed using chick embryo
20 fibroblasts demonstrated that ectopic ATF3 expression enhances cellular proliferation under normal growth conditions and promotes a fusiform morphology characteristic of cellular transformation (Perez et al., 2001). In these studies, ATF3 expression sustained cell proliferation under low serum conditions; however, ATF3 expression did not induce anchorage-independent growth as measured by soft-agar assay. Consistent with a proliferation- promoting role for ATF3, treatment of hepatocytes with mitogenic factors caused a significant increase in ATF3 mRNA levels and exogenous expression of ATF3 was sufficient to increase the rate of DNA synthesis, albeit slightly
(Allan et al., 2001). The increased rate of DNA synthesis correlated with enhanced cyclin D1 expression and it was shown that ATF3 acts to stimulate cyclin D1 promoter activity through binding to a highly conserved AP-1 site. In contrast to these reports, inducible expression of ATF3 in HeLa cells resulted in decreased colony formation and ATF3 enhanced the ability of cisplatinum and etoposide to inhibit cell proliferation (Fan et al., 2002). ATF3 expression was further shown to slow down progression of cells from the G1 to S phase. Thus, studies aimed at defining a role for ATF3 in the regulation of cell growth or proliferation have yielded conflicting results, possibly due to differences in cell systems.
Studies aimed at understanding the metastatic behavior of different melanoma cell lines have implicated ATF3 in the process of metastasis. B16-
F10 and B16-BL6 are B16 mouse melanoma sublines that preferentially metastasize to the lung following intravenous injection and subcutaneous
21 injection, respectively. A differential hybridization screen identified four genes
(polyubiquitin, pyruvate kinase, ATF3, TI-227 novel gene) that were highly expressed in the more metastatic mouse B16 melanoma subline (B16-F10) compared with the less metastatic subline (B16-BL6). Among these four genes, expression of ATF3 converted the low metastatic B16-F1 subline into high metastatic cells following intravenous inoculation (Ishiguro et al., 1996). In addition, abrogation of ATF3 expression by antisense oligonucleotides reduced attachment and invasion of HT29 colon cancer cells in vitro (Ishiguro et al.,
2000) and prevented cell migration of HT29 cells using a wound filling assay; however, ATF3 down regulation had no effect on cell cycle regulation (Ishiguro and Nagawa, 2000). In vivo experiments revealed that mice treated with ATF3 antisense oligonucleotides displayed less tumor formation and survived longer than control mice following subcutaneous inoculation of HT29 cells (Ishiguro et al., 2000). In conclusion, recent data suggest a functionally significant role for
ATF3 in determining metastatic potential of tumor cell lines.
A.8 Conclusion
Work presented in this thesis describes the stress-induction, signaling pathways, and functional consequences of ATF3 expression in pancreatic β- cells. β-cells play an extremely important role in regulating glucose homeostasis through their ability to synthesize and secrete insulin.
Autoimmune-mediated β-cell destruction and decreased insulin sensitivity in peripheral tissues promote the onset of type 1 and type 2 diabetes,
22 respectively. Work presented in this thesis implicates a role for the ATF3 transcription factor in the pathogenesis of stress-induced diabetes. The following section of this introduction provides an overview of our current knowledge of type 1 and type 2 diabetes.
B.1 Epidemiology of Diabetes
It has been predicted that the incidence of diabetes will increase up to 42% by the year 2025, affecting 300 million people worldwide (5.4% of the world population) (Winer and Sowers, 2004). There are currently 20 million people with diabetes in the United States, in addition to an estimated 5 million who remain undiagnosed. Diabetes was the fifth leading cause of death in the
United States in the year 2000 and diabetic patients suffer from complications related to stroke, heart failure, new-onset blindness, limb amputation, end-stage renal disease, and birth complications. While the incidence of type 1 (insulin- dependent) diabetes is predicted to remain steady, the number of type 2
(insulin-independent) diabetic cases is expected to dramatically increase due to factors such as the availability of “fast food”, changes from labor-intense to sedentary occupations, mechanization, and easily available transportation. As diabetes reaches epidemic proportions in industrialized countries, tests for early diagnosis, improved diet and lifestyle habits, and improved treatments should be developed to combat this disease. The first part of this section will review our current understanding of type 1 diabetes, with particular emphasis on modes of genetic susceptibility, immune effector cells, and mechanisms of β-
23 cell death. The second part of this section will review our current understanding of type 2 diabetes including genetic susceptibility, mechanisms of insulin resistance, and potential therapeutic targets.
B2.1 Type 1 Diabetes: Genetic Susceptibility
Type 1 diabetes (T1D) is a chronic autoimmune disorder that selectively destroys the pancreatic β-cells within the islets of Langerhans, leading to insulin deficiency. The onset of diabetes in humans is triggered by alterations at several well-characterized genetic loci, as well as other non-inheritable factors such as environmental cues. Genes linked to the major histocompatibility complex (MHC) are clearly associated with the development of type1 diabetes in humans and the Human Leukocyte Antigen (HLA) region is the major locus, contributing up to 50% of the inherited risk (Castano and Eisenbarth, 1990).
Examination of antigen expression revealed that 95% of type1-diabetic caucasians express either HLA DR3 and/or DR4, compared to 40% of the general population (Wolf et al., 1983). In addition, Nepom and colleagues identified specific HLA-DQ sequences expressed in more than 90% of HLA-
DR4 T1D patients which are involved in the susceptibility to disease (Nepom et al., 1986). Further examination of the HLA-DQ sequence from T1D patients revealed that lack of aspartic acid at position 57 is strongly associated with disease, possibly through interference with antigen presentation (Todd et al.,
1987).
24 In addition to the HLA locus, several other loci are postulated to affect disease onset in T1D patients (Fig. 1.5). INS-VNTR represents a non-coding region located directly upstream of the insulin gene promoter on chromosome
11 (Anjos and Polychronakos, 2004). INS-VNTR consists of tandem repeats of the sequence unit “ACAGGGGTCTGGGG” and can be denoted as class I (30-
60 repeats) or class III (120-170 repeats). Research performed by
Polychronakos and colleagues showed that the INS-VNTR region plays an important role in regulating thymic expression of insulin, and that higher expression observed with class III alleles allows for enhanced negative selection of insulin auto-reactive T-lymphocytes (Vafiadis et al., 1997; Kappler et al., 1987). Therefore, decreased thymic insulin expression in class I patients leads to increased numbers of autoreactive T-cells which promote type 1 diabetes onset. The CTLA-4 gene, which has been linked to autoimmune diabetes, codes for a transmembrane glycoprotein expressed on the surface of activated T-cells; however, alternative splicing events result in the production of a soluble form expressed mainly in inactivated T-cells (Ueda et al., 2003).
Several CTLA-4 polymorphisms located within the 5’ promoter or coding regions have been identified in humans which act to modulate gene expression levels (Ling et al., 1999). It has been proposed that downregulation of CTLA-4 expression may result in constitutive T-cell activation, resulting in increased numbers of auto-reactive T-lymphocytes that can infiltrate pancreatic islet tissue. Consistent with this notion, CTLA-4 knock-out mice experience fatal lymphoproliferative disease with multi-organ destruction, which is mediated by
25 auto-reactive T-lymphocytes (Waterhouse et al., 1995). Together, the INS-
VNTR and CTLA-4 genes do not contribute more that 15% of T1D risk and much work remains to discover the additional loci.
A.
B.
Figure 1.5: Type 1 diabetes associated haplotypes. (A) INS-VNTR is referred to as the IDDM2 susceptibility locus. INS-VNTR, which is located outside of the protein coding region, is likely involved in regulating insulin expression. Class I consists of 30-60 repeats of a 14-15 bp consensus sequence whereas Class II individuals have 120-170 repeats. (B) Depiction of the T1D associated CTLA-4 haplotype and the potential functional role of disease-associated polymorphisms. SNPs and their possible functional significance are indicated. Down-regulated expression of CTLA-4 is thought to result in constitutive T-cell activation. (Anjos and Polychronakos, 2003).
26 Insights into T1D susceptibility loci have been obtained through the characterization of the Non-Obese Diabetic (NOD) mouse. The NOD mouse is an animal model for type1 diabetes which is characterized by infiltration of activated T-lymphocytes into the pancreatic islets followed by beta cell destruction. Similar to the human condition, disease onset is regulated by multiple genes and unique major histocompatibility complex class II alleles are responsible for diabetes progression in these mice. The NOD mice have been shown to contain a unique MHC I-Aβg7 allele which encodes a serine at position
57 and this mutation decreases the binding affinity between MHC class II molecules with auto-antigen peptides (Cameron et al., 1998). Thus, the timing and duration of auto-antigen presentation in the thymus may not be sufficient to eliminate auto-reactive T-cells by apoptosis (Serreze, 1993). In addition, NOD mice have decreased I-E molecules on their antigen presenting cell (APC) surface due to a deletion in the Eα promoter (Adorini et al., 2002). It has been shown that I-E molecules prevent auto-immune responses through clonal deletion of pathogenic T-cells.
B2.2 Type 1 Diabetes: β-cell auto-antigens
Several β-cell specific antigens have been associated with T1D and antigen- presenting cells containing these self-antigens have been found in the thymus of both diabetic mice and humans (Pugliese et al., 2001) (Table 1.2). The insulin molecule, consisting of an A and B chain covalently linked by disulfide bonds, was the first β-cell protein to which an autoimmune response was
27 detected in a T1D patient (Palmer et al., 1983). Additional islet auto-antigens include the identification of glutamic acid decarboxylase (GAD), the rate-limiting enzyme in the conversion of glutamic acid to γ-aminobutyric acid (GABA)
(Baekkeskov et al., 1990). GAD65 and GAD67 are encoded by two different genes; however, only GAD65 is expressed in human islets where it associates with synaptic-like vesicles that secrete GABA. GAD65-specific antibodies can be detected in approximately 70% of T1D patients, compared to 4% of normal controls. Insulinoma-associated protein 2 (IA-2), a receptor tyrosine phosphatase enriched in secretory granules and neuroendocrine cells, was identified in a screen using sera from T1D patients (Rabin et al., 1992). IA-2 expression in pancreatic β-cells is detectable in association with insulin granule membranes, suggesting a role for IA-2 in regulating granule trafficking or maturation. In addition to these well-characterized islet auto-antigens, a currently unknown 69 kDa auto-antigen (ICA-69) was identified which contains two short regions of homology with bovine serum albumin. Expression of this antigen could be detected in islets and brain and 30% of diabetic patients had detectable ICA-69 antibodies (Pietropaolo et al., 1993). Several additional β- cell auto-antigens are listed in Table 1.2.
28
Candidate auto-antigens in T1D
Insulin/proinsulin GAD 65kD and 67kD
Insulinoma cell membrane protein (IA-2) Bovine Serum Albumin (BSA) GLUT2 Heat Shock Protein 62 and 65 Gangliosides Carboxypeptidase H
Table 1.2: Auto-antigens and T1D pathogenesis. Auto-antigens are self- antigens that initiate and drive the autoimmune response. Several self-antigens have been associated with autoimmune diabetes, but three appear to be the most relevant (proinsulin, GAD, and the tyrosine phosphatase-like islet antigen IA-2). Antigen-presenting cells expressing diabetes-associated self-antigens have been identified in the mouse and human thymus.
B2.3 Type 1 Diabetes: Effector Cells
Several different types of effector cells become activated during the immune response and have been shown to play a role in T1D onset, including macrophages, B cells, and T cells. Macrophages and B cells are essential components during the initial stages of the immune response, which ultimately promotes T cell activation and β-cell destruction. Individual effector cell functions are discussed below.
Macrophages: Electron microscopy has revealed that macrophages represent the major population of cells present at early stages of insulitis in NOD mice and this event precedes invasion of the islets by T lymphocytes (Yoon et al.,
1998). Researchers found that treatment with silica, a substance that is toxic to
29 macrophages, prevents development of insulitis and diabetes, suggesting that macrophages play an important role in T1D. Results published by Yoon et al demonstrate that islets transplanted into a macrophage-depleted NOD recipient are not destroyed by T-cells (Jun et al., 1999). Indeed, work over the past few years suggests that macrophages play an essential role in the process of T cell activation which is required for β-cell destruction and diabetes. Macrophages trigger activation of CD4+ T cells through the release of IL-12 and, upon their activation, CD4+ T cells have been shown to secrete IL-2 and IFN-γ which further activates CD8+ T cells. Macrophages themselves exert direct cytotoxic effects on β-cells through the release of soluble cytokines (IL-1β, TNF-α, and
IFN-γ) and nitric oxide (NO) (Appels et al., 1989).
B Cells: B cells have been shown to play an important role in the pathogenesis of T1D. T lymphocytes from diabetic NOD mice can transfer diabetes to recipient mice lacking B cells, suggesting that B cells are not required for disease progress once T cell activation has occurred. However, later studies identified B cells as critical antigen presenting cells (APCs) for β-cell auto- antigens which are required for T cell activation (Serreze et al., 1996).
Consistent with this notion, B cell deficient NOD mice do not develop insulitis or diabetes (Noorchashm et al., 1997). B cells also contribute directly to β-cell destruction through the production of autoantibodies against β-cell antigens.
T Cells: Studies using BB rats and NOD mice have generated substantial evidence suggesting that T cells play a critical role in auto-immune diabetes.
Neonatal thymectomy in BB rats prevented the onset of diabetes and treatment
30 with antibodies directed against T cell surface antigens blocked disease progression (Like et al., 1982; Like et al., 1986). Athymic NOD mice fail to develop insulitis or diabetes and T cell transfer studies have shown that both
CD4+ and CD8+ T cells are required for diabetes pathogenesis. Evidence suggests that CD8+ T cells function as effector cells as they have been shown to destroy β-cells in vitro and transfer diabetes in vivo with the help of CD4+ T cells. Cytokines secreted by CD4+ T cells act to maximally activate CD8+ T cells and these CD8+ T cells may act as the final β-cell death effectors through mechanisms including inflammatory cytokine release, Fas activation, and increased osmotic stress. Each of these mechanisms will be discussed below.
31
Figure 1.6: Effector cells involved in β-cell destruction. Antigen-presenting cells (dendritic cells) expressing β-cell auto-antigens on their surface activate immune cells, including macrophages and T cells. These immune cells secrete soluble factors (pro-inflammatory cytokines) which may lead to β-cell destruction either directly or indirectly via upregulation of toxic molecules such as nitric oxide. In addition, T cells may mediate β-cell death through direct cell- cell contact (Fas-FasL interaction) or by insertion of tubular perforin molecules (osmotic stress).
B2.4 Type 1 Diabetes: Mechanisms of β-Cell Death
β-cell death during diabetes progression occurs through several well- characterized mechanisms and this section will review our current understanding of the humoral and cellular mediators, signaling pathways, and transcriptional networks involved in insulin cell death.
Humoral response: A great body of evidence suggests that pro-inflammatory cytokines such as IL-1β, TNF-α and IFN-γ are secreted by macrophages and T- lymphocytes and play a key role in T1D pathogenesis. Expression of these pro-
32 inflammatory cytokines has been detected in NOD mouse islets during insulitis and treatment of mouse or human islets with cytokines leads to morphological and functional damage (Trincavelli et al., 2002). Pro-inflammatory cytokines have been shown to promote β-cell damage through several distinct mechanisms including upregulation of inducible nitric oxide synthase (iNOS) expression which leads to the synthesis of the free radical gas nitric oxide (NO)
(Thomas et al., 2002). The functional significance of NO production was underscored by studies showing that specific iNOS inhibitors significantly protected β-cells from IL-1β-induced dysfunction (Corbett et al., 1993); however, in vivo studies demonstrated that iNOS-deficient NOD mice develop diabetes as usual (Corbett et al., 1993). The highly reactive NO radical impairs
β-cell function by several mechanisms including the promotion of internucleosomal DNA strand breaks characteristic of apoptosis. In addition,
NO negatively impacts the insulin secretory response through its ability to inhibit the Krebs cycle enzyme aconitase, thereby decreasing glucose oxidation
(Welsh et al., 1991). Inhibition of aconitase enzyme activity leads to decreased
ATP production and calcium uptake, critical events required for glucose stimulated insulin secretion (Wollheim and Sharp, 1981). In addition to its effects on aconitase enzyme activity, NO impairs the insulin secretory response through S-nitrosylation of key proteins, including phospholipase c and protein kinase c (PKC) (Sjoholm, 1996). In conclusion, one important mechanism whereby proinflammatory cytokines effect β-cell viability is through increased
NO production.
33 Cellular response: In addition to humoral effects, activated T cells promote β- cell death through mechanism involving direct cell-cell contact. Pro- inflammatory cytokines have been shown to upregulate expression of Fas on the surface of β-cells (Loweth et al., 1998). Activated CD4+ and CD8+ T cells express Fas ligand on their surface and engagement of the Fas receptor with its ligand initiates β-cell apoptosis through the death receptor pathway. The perforin/granzyme pathway is believed to play a role in terminal β-cell destruction following experiments which showed that perforin-deficient NOD mice display normal insulitis but exhibit delayed onset of diabetes (Kagi et al.,
1997). Cell death initiated by the perforin/granzyme pathway involves the insertion of tubular perforin complexes into the cell membrane through which the proteases granzyme A and B can pass and activate nucleases within the cell (Mandrup-Poulsen, 2003). Thus, a diverse array of mechanisms exists for destruction of the insulin-producing β-cells during type1 autoimmune diabetes
(Fig. 1.7).
34
Figure 1.7: Proposed cellular mechanisms of β-cell death. (A) cell-cell contact: The perforin/granzyme pathway, which leads to insertion of tubular perforin complexes into the cell membrane and consequent osmotic lysis, is a major mode of cell death induced by cytotoxic T cells. Activation of the Fas receptor on the surface of β-cells leads to apoptosis through the death receptor pathway. FasL is expressed primarily on the surface of activated CD8+ T cells and direct contact with Fas receptor on the β-cell surface initiates killing. (B) soluble mediators. Upon activation, T cells and macrophages secrete soluble mediators (cytokines) which further stimulate the cytokine response in other immune cells. Pro-inflammatory cytokines bind to their respective receptors on the β-cell surface where they initiate a cascade of events that ultimately results in β-cell death. (Mathis et al, 2001)
Signaling: Recent work has identified several signal transduction pathways activated by pro-inflammatory cytokines that play a role in β-cell apoptosis (Fig.
1.8). A wealth of information suggests that IL-1β and TNF-α exert their effects through activation of the MAPK and NFκB pathways, whereas IFN-γ activates
35 the JAK/STAT pathway, which can cross-talk with the MAPK cascade. The
MAPK family is a group of serine/threonine-specific kinases that mediate a variety of signals that are crucial for the regulation of cell growth, differentialtion and cell death. The best characterized members of the MAPK family include the extracellular signal-regulated kinases (ERKs), which are mainly activated by mitogens, and the stress-activated protein kinases p38 and JNK. Recent data suggests that the ERK and p38 pathways are important regulators of cytokine- mediated β-cell NO production. IL-1β stimulated ERK and p38 activation in both purified rat islets and β-cell lines and this response was sustained for up to
12 hours (Larsen et al., 1998). The ability of IL-1β to upregulate iNOS expression in isolated rat islets was blocked following combined inhibition of the p38 and ERK pathways, suggesting that these pathways regulate cytokine- mediated NO production (Larsen et al., 1998). However, non-cytokine stimuli activated the ERK and p38 pathways without concomitant induction of iNOS expression, suggesting that these pathways are necessary, but not sufficient, for NO production. Additional studies revealed that inhibition of the p38 and
ERK MAPK pathways moderately reduced cytokine-induced apoptosis of FACS purified β-cells, suggesting that other pathways are involved in β-cell death
(Pavlovic et al., 2000). In addition to activating ERK and p38, cytokine treatment stimulates activation of the JNK MAPK pathway. Through the use of cell-permeable peptide inhibitors, the JNK pathway was recognized as a regulator of cytokine-induced β-cell death without affecting nitric oxide production (Ammendrup et al., 2000). Thus, MAPKs are central for both nitric
36 oxide-dependent and –independent signaling responses in pancreatic β-cells.
The ERK and p38 pathways are necessary, but not sufficient, for iNOS upregulation, whereas the JNK pathway plays a prominent role in mediating apoptosis.
In addition to MAPK activation, IL-1β and TNF-α signaling converge on the
NFκB pathway. In unstressed cells, the NFκB transcription factor remains sequestered in the cytoplasm through its interaction with IκB; however, following treatment with pro-inflammatory cytokines, NFκB rapidly translocates into the nucleus where it regulates gene expression events. Treatment of β- cells with IL-1β stimulates NFκB nuclear translocation and experiments demonstrated the requirement of NFκB for induced expression of iNOS and Fas mRNAs (Darville and Eizirik, 1998). In order to test the functional requirement of NFκB for cytokine-induced cell death, Heimberg and colleagues infected purified rat beta cells with an adenovirus that expresses a non-degradable form of IκB. Inhibition of NFκB activation prevented cytokine-induced iNOS and Fas expression and significantly improved β-cell survival (Heimberg et al., 2001). In support of these results, Baker et al reported partial protection from IL-1β+IFN-
γ+TNF-α induced MIN6 cell death following treatment with a dominant negative
NFκB inhibitor (Baker et al., 2001). In conclusion, although NFκB activation promotes cell survival in most cell types, it appears to play a pro-apoptotic role in pancreatic β-cells. These contradictory effects of NFκB function may be due to differences in downstream gene regulation between cell types.
37 Treatment with IL-β alone is not sufficient to induce apoptosis of purified human, rat, or mouse beta cells; however, when used in combination with IFN-γ a high level of beta cell killing was observed, suggesting that pathways activated by IFN-γ play a significant role (Pavlovic et al., 1999). The binding of
IFN-γ to its receptor leads to recruitment and activation of the JAK1 and JAK2 protein kinases. These kinases exert their effects by phosphorylating members of the STAT family of transcription factors which migrate to the nucleus and regulate expression of genes containing γ-activation sites. STAT proteins are thought to play a role in β-cell death based on studies showing that STAT1 activation is required for IFN-γ induced iNOS upregulation and STAT1 expression is increased in islets from NOD mice (Suk et al., 2001).
38
Figure 1.8: Signaling mechanisms and cross-talk between IL-1β, IFN-γ, and TNF-α receptors. IFN-γ signals mainly via the JAK/STAT pathway. TNF- α and IL-1β signaling converge on the IKK/NFκB and MAPK pathways. IL-1β also signals via phospholipase C and diacylglycerol dependent PKC activation. NFκB appears to be the main transcription factor for iNOS gene expression. MAPKs provide cross-talk links between the signaling pathways of the three cytokines, allowing explanations for the observed synergistic activities of these cytokines on pancreatic β-cell function and viability. (Eizirik and Mandrup- Poulsen, 2001).
Transcriptional networks: β-cell death following cytokine treatment is a slow process which can take up to 9 days, suggesting that apoptosis in these cells is a complex biological phenomenon that requires de novo protein synthesis
(Eizirik and Darville, 2001). In order to study the overall changes in gene
39 expression, several microarray studies have been performed following cytokine treatment of primary β-cells (Cardozo et al., 2001). These studies confirmed the upregulation of several pro-apoptotic genes (iNOS, Fas, caspase-1,
GADD153) and the downregulation of several anti-apoptotic genes (Bcl-2) following cytokine treatment (Fig. 1.9). In addition, examination of changes in transcription factor expression revealed upregulation of c-jun, c-fos, ATF2,
NFκB, c-myc, and STAT1 concomitant with downregulation of PDX-1 and Isl-1.
Cytokines have been shown to promote de-differentiation of β-cells, leading to decreased insulin expression and impairment of mitochondrial glucose metabolism (Sandler et al., 1991). The de-differentiation effect of cytokines is probably mediated through the upregulation of c-myc, which promotes de- differentiation under conditions of decreased growth factors, and through the downregulation of PDX-1 and Isl-1. In conclusion, β-cell apoptosis during T1D arises due to a complex series of events and identification of signal transduction pathways and genes involved in this process will increase our understanding of
β-cell biology. Work presented in this thesis identifies the ATF3 transcription factor as a stress-inducible, pro-apoptotic gene in pancreatic β-cells. In addition, examination of signal transduction pathways revealed that both the
JNK and NFκB pathways play a role in ATF3 induction by IL-1β. Finally, work presented in this thesis demonstrates signaling cross-talk and functional interaction between the Akt serine/threonine kinase, a well-characterized pro- survival factor in β-cells, and ATF3.
40
Figure 1.9: Cytokine-induced changes in β-cell gene expression with a potential role in the process of β-cell death. Changes in β-cell gene expression were examined using high density oligonucleotide arrays following cytokine treatment. NFκB and STAT1 transcription factors mediate the signal transduction of IL-1β and IFN-γ respectively. These two transcription factors have a high probability of regulating groups of genes involved in β-cell death. NFκB regulated target genes that contribute to apoptosis include Fas, iNOS, and Bcl-2. (Eizirik and Mandrup-Poulsen, 2001)
B.3 Type 2 Diabetes
A western lifestyle is associated with a higher prevalence of type 2 diabetes
(T2D), which now accounts for approximately 90% of all diabetes cases. A strong correlation exists between body fatness and T2D, and prevention of weight gain through moderate exercise and healthy eating habits is of paramount importance in combating this disease (Tuomilehto et al., 2001). In 41 addition, increased consumption of vegetables and whole grain products accompanied by decreased unsaturated fat intake may lower risk for T2D.
Decreasing alcohol consumption and cigarette smoke inhalation may play an important role in reducing the risk for T2D (van Dam, 2003).
B3.1 Type 2 Diabetes: Insulin Signaling
Insulin is a key hormone regulating cellular metabolism through its ability to control glucose uptake in peripheral tissues, such as liver, skeletal muscle, and fat. Insulin exerts its effects by binding to the heterotetrameric receptor found at the cell surface, thus activating the receptor’s intrinsic tyrosine kinase activity
(Lizcano and Alessi, 2002). The activated insulin receptor transphosphorylates tyrosine residues located in the catalytic loop of the kinase domain along with several tyrosines found in the C-terminal and juxtamembrane regions (Kido et al., 2001). Phosphorylated tyrosine residue 972 was demonstrated to function as a major docking site for insulin receptor substrate (IRS) proteins, which function to transmit the insulin signal to several downstream pathways (Wick et al., 2003). The insulin-induced responses are mediated by three major pathways emanating from the activated IRS proteins: (i) PI3K/Akt pathway, (ii)
Cbl pathway, and (iii) MAPK pathway (Saltiel and Kahn, 2001).
PI3Ks: PI3Ks are heterodimeric proteins composed of a 110kDa catalytic subunit and 85kDa regulatory subunit that translocate to the plasma membrane through association with phosphorylated tyrosine residues within IRS proteins.
PI3K functions to phosphorylate membrane-bound lipid molecules at the 3’
42 position of the inositol ring, thus generating the second messenger phosphatidylinositol (3,4,5) triphosphate (PIP3). PIP3 interacts with the plekstrin homology domain of the Akt/PKB serine/threonine kinase, thus recruiting
Akt/PKB to the plasma membrane where it becomes activated upon phosphorylation by PDK1 and PDK2 (Brazil and Hemmings, 2001). Akt/PKB mediates several important downstream effects of insulin signaling including membrane translocation of GLUT4 followed by glucose uptake, activation of glycogen synthesis through phosphorylation and inhibition of GSK-3, and increased lipogenesis via upregulation of fatty acid synthase (Cross et al.,
1995).
Cbl: Recent reports suggest a role for the Cbl proto-oncogene in regulating glucose transport following activation of the insulin receptor. Cbl is recruited to the insulin receptor by the CAP adaptor protein and upon phosphorylation gains the ability to interact with the caveolar protein flotillin. A protein complex forms which allows for the recruitment of the GTP binding protein Tc10 and ultimately activation of the downsteam effector TCGAP which increased GLUT4 membrane association (Chiang et al., 2003).
MAPK: The proliferation-promoting effects of insulin are mediated by the Ras
MAPK pathway which can become activated through association of SHC with the insulin receptor and Grb2 assocation with IRS proteins (Liang et al., 1999).
Recuitment of Ras to the IR results in conversion of the GDP-bound form to the
GTP-bound form and initiates a phosphorylation cascade that results in
43 sequential activation of the Raf, MEK, and ERK kinases. Activated ERK translocates into the nucleus where it transmits cellular proliferation signals.
B3.2 Type 2 Diabetes: Obesity and Insulin Resistance
Unlike T1D which arises due to a lack of insulin, T2D is classified as an
“insulin-independent” disorder and the pathogenesis of this disease is associated with impaired insulin signaling. Recent insights into the mechanism of insulin resistance suggest that several factors contribute to the decreased insulin response and these will be discussed below.
Stress-activated kinases: A variety of stimuli lead to activation of several stress-sensitive serine/threonine kinases in liver, adipose, and skeletal muscle cells (Fig. 1.10). Once activated, these kinases phosphorylate the insulin receptor and IRS proteins on specific serine or threonine residues, thus decreasing levels of tyrosine phosphorylation. This results in decreased association with downstream effector molecules including PI3K, thus reducing insulin signaling effects (Birnbaum, 2001). In support of this notion, the stress- activated JNK kinase has been demonstrated to phosphorylate IRS-1 on residue S307 and this prevents physical interaction with the activated insulin receptor (Aguirre et al., 2002). In addition to the JNK MAPK, IKK-β activation leads to insulin resistance. IKK-β, a serine kinase known to regulate NFκB nuclear translocation, phosphorylates S307 of IRS-1 and IKK-β +/- mice showed increased insulin sensitivity compared with control littermates (Yuan et al., 2001). Several studies suggest that these stress-activated kinases become
44 activated following prolonged exposure to high glucose concentrations
(hyperglycemia) and elevated free fatty acids (FFAs). Considerable evidence indicates that hyperglycemia and elevated FFAs cooperate for the formation of reactive oxygen species (ROS) and this redox imbalance leads to insulin resistance through stress-kinase activation (Adler et al., 1999). In addition to their effects on stress-kinase activation, FFAs block insulin-mediated glucose uptake through the upregulation of Munc18c expression, a well-known inhibitor of GLUT4 translocation (Schlaepfer et al., 2003). Inhibition of these stress- activated kinases represents an attractive pharmacological approach for treatment of insulin resistance in T2D patients. Recently, salicylates have been shown to lower blood glucose levels and restore insulin sensitivity in T2D patients. Treatment with salicylates inhibited IKK-β activity, which resulted in decreased serine phosphorylation and increased tyrosine phosphorylation patterns of IRS proteins (Yuan et al., 2001; Kim et al., 2001b).
45
Figure 1.10: The role of serine kinase activation in oxidative stress- induced insulin resistance. A variety of stimuli, including hyperglycemia, elevated FFA levels, and cytokines increase ROS production and oxidative stress. This results in the activation of multiple stress-sensitive ser/thr kinase signaling cascades. Once activated, these kinases are able to phosphorylate multiple targets, such as the IR and IRS proteins. Increased phosphorylation of IR or IRS proteins on discrete serine or threonine sites decreases the extent of insulin-stimulated tyrosine phosphorylation. Consequently, the association and/or activities of downstream signaling molecules are decreased, resulting in reduced insulin action. (Evans et al. 2003).
Adipocytokines: Recently is has been shown that adipocytes act to secrete several different proteins termed “adipocytokines” which regulate insulin sensitivity and glucose metabolism. This section will briefly summarize three
46 key adipocytokines and will review their biological actions and effects on insulin sensitivity.
Adiponectin is a hormone secreted by small adipocytes that positively affects insulin sensitivity, thus reducing plasma glucose concentrations. Adiponectin knock-out mice display impaired insulin sensitivity and adiponectin mRNA levels are decreased under conditions of obesity and lipoatrophy (Maeda et al., 2002).
Adiponectin exerts its effects, in part, by stimulating fatty acid oxidation in muscle cells and by blocking glucose production in the liver through inhibition of gluconeogenic enzymes (Yamauchi et al., 2001). Recent reports suggest that the insulin-sensitizing effects of adiponectin are carried out, in part, through the activation of 5’-AMP-activated protein kinase (AMPK). Studies demonstrated that expression of dominant-negative AMPK in the liver blocked the ability of adiponectin to reduce expression levels of PEPCK and G6Pase (Lochhead et al., 2000). In conclusion, adiponectin secreted by small adipocytes acts as an insulin-sensitizing hormone and exerts a protective role against insulin resistance in vivo.
Leptin, a hormone secreted by fat cells, was originally cloned as the gene mutated in the ob/ob mice which leads to massive obesity (Ahima and Flier,
2000). Leptin is abundantly expressed in adipocytes and regulates energy balance by decreasing food intake and increasing energy expenditure
(Friedman and Halaas, 1998). Leptin, whose expression and secretion are increased by obesity, functions to decrease appetite by changing gene expression profiles in the hypothalamus. Contradictory reports exist describing
47 the direct effects of leptin on insulin sensitivity in peripheral tissues; however, the majority of reports suggest that leptin positively affects insulin sensitivity.
For example, leptin treatment of ob/ob mice improved insulin sensitivity and alleviated hyperglycemia independently of its effects on food intake (Halaas et al., 1995).
Resistin is a third adipocytokine that is expressed almost exclusively in white adipose tissue and the protein is detectable in adipocytes and in the blood
(Steppan et al., 2001). The analysis of resistin expression in several different models of obesity and diabetes has yielded conflicting results. Elevated levels of resistin were reported in the ob/ob, db/db, and Fischer 344 rats (Steppan et al., 2001; Levy et al., 2002); however, decreased expression of resistin was observed in the fructose-fed rat model of insulin resistance and under conditions of high-fat diet induced obesity (Juan et al., 2001; Le Lay et al.,
2001). Excess visceral fat depots are highly correlated with obesity-induced insulin resistance. Resistin expression was found to be elevated in visceral depots in the mouse with highest levels of expression in gonadal fat, suggesting a role for resistin in obesity-induced insulin resistance. Consistent with these findings, elevated levels of resistin were observed in abdominal depots from diabetic rats and humans (Atzmon et al., 2002; McTernan et al., 2002). Two recent studies suggest that resistin promotes insulin resistance. First, intraperitoneal administration of recombinant resistin resulted in impaired glucose homeostasis and insulin action (Steppan et al., 2001). Second, recombinant resistin blocked insulin-stimulated glucose uptake in skeletal
48 muscle cells and 3T3-L1 adipocytes (Moon et al., 2003). Future studies must expand on these initial findings and should address the mechanism of resistin- mediated insulin resistance.
B3.3 Type 2 Diabetes: β-Cell Apoptosis
β-cell hypertrophy and increased insulin secretion compensate for the insulin resistance in the short term; however, mounting evidence suggests that T2D is a slower progressing form of T1D in that β-cell apoptosis contributes to the pathogenesis of both forms. In support of this notion, researchers have found reduced β-cell mass in T2D rodent models and human patients which is due to increased apoptosis rather than decreased neogenesis or replication (Stefan et al., 1982; Butler et al., 2003). Over the past few years, several factors have been implicated in the regulation of β-cell apoptosis during T2D progression and these will be discussed below.
Hyperglycemia and FFAs: Several studies report that chronic exposure of cultured human islets to high glucose concentrations and elevated FFAs results in β-cell apoptosis in a dose-dependent manner (Maedler et al., 2001b; Maedler et al., 2001a; Poitout and Robertson, 2002). Glucotoxicity and lipotoxicity- induced β-cell apoptosis has been demonstrated to proceed via several distinct molecular mechanisms. Several studies reported that human pancreatic islets exposed to elevated glucose and FFA levels showed overexpression of the proapoptotic genes Bad and Bid, suggesting that apoptosis is mediated through the intrinsic mitochondrial death pathway (Federici et al., 2001). In addition,
49 one study demonstrated that treatment of purified rat islets with FFAs was associated with increased ceramide production, and blocking ceramide synthesis prevented FFA-induced apoptosis (Shimabukuro et al., 1998). In addition, chronic hyperglycemia and lipotoxicity result in increased levels of reactive oxygen species (ROS) which have been implicated in β-cell failure and apoptosis. β-cells are extremely sensitive to oxidative stress due to low levels of anti-oxidant enzymes such as catalase, glutathione peroxidase, and superoxide dismutase (Tiedge et al., 1997). Overexpression of anti-oxidant enzymes in pancreatic β-cells of transgenic mice partially prevents cells from oxidative stress induced apoptosis (Benhamou et al., 1998). Treatment of β- cells with hydrogen peroxide was shown to increase expression of the p21 cyclin-dependent kinase inhibitor, decrease insulin mRNA and cytosolic ATP levels, and promote apoptosis (Maechler et al., 1999). In conclusion, chronic exposure of β-cells to elevated glucose and FFA concentrations promotes β-cell apoptosis through several different mechanisms.
IRS-2/PKB Signaling: Recent studies suggest that signal transduction mediated by IRS-2 is critical for β-cell growth and survival. Both IRS-1-/- and
IRS-2-/- mice exhibit insulin insensitivity due to defects in downstream insulin signaling events (Withers et al., 1998). However, the IRS-1-/- mice do not become diabetic and these mice display increased β-cell mass to compensate for the insulin resistance. In contrast, the IRS-2-/- mice become profoundly diabetic due to decreased β-cell mass which is accompanied by reduced insulin secretion (Withers et al., 1998). The decrease in β-cell mass observed in the
50 IRS-2-/- mice was due to an increased rate of β-cell apoptosis. In support of a role for IRS-2 in mediating β-cell survival, decreasing IRS-2 expression in pancreatic β-cell lines was accompanied by spontaneous β-cell apoptosis
(Lingohr et al., 2003). Recent evidence suggests that the survival promoting effects of IRS-2 are manifested through its ability to activate the downstream
Akt/PKB kinase. In summary, IRS-2 plays a key role in maintaining β-cell survival and β-cell mass, in part, through activation of the PI3K-Akt signaling pathway.
Islet amyloid polypeptide: Studies have demonstrated deposits of islet amyloid polypeptide (IAPP) in pancreatic islets from T2D patients (Westermark and Wilander, 1978; Cooper et al., 1987). This 37-amino acid IAPP molecule is coexpressed with insulin by β-cells and trafficked with insulin to secretory vesicles from which it is co-secreted (Hartter et al., 1991). Exposure of β-cells to human IAPP or overexpression of human IAPP in cells leads to IAPP aggregation and cell death by apoptosis (Lorenzo et al., 1994; Saafi et al.,
2001). A recent insight into the mechanism of cell death suggests that IAPP promotes cell toxicity by formation of nonselective ion channels in cell membranes (Mirzabekov et al., 1996).
In conclusion, β-cell apoptosis plays a significant role in the pathogenesis of both T1D and T2D; however, the stress signals, important signaling molecules, and mechanisms of cell death appear to differ between these two diseases. A greater understanding of β-cell death could potentially give rise to therapeutics used to combat both forms of diabetes.
51 B3.4 Type 2 Diabetes: Genetic Susceptibility
T2D is a complex disorder in which the effects of multiple genes combine with metabolic and environmental factors to contribute to the overall pathogenesis of the disease. Several candidate genes that confer susceptibility to T2D have been identified in humans, and three of these factors will be discussed below.
IB1/JIP-1: Islet-brain-1 (IB1), the homologue of the c-Jun amino-terminal kinase-interacting protein-1 (JIP-1), functions both as a DNA-binding transactivator in the nucleus and a molecular scaffold protein in the cytoplasm.
Insights into its biology established IB1 as a potential candidate gene for diabetes in humans. For example, knock-down of IB1 expression in a β-cell line by antisense treatment resulted in decreased expression of GLUT2 and insulin mRNAs (Waeber et al., 2000). In addition, IB1 functions to prevent activation of c-jun by anchoring activated JNK in the cytoplasm. Linkage analysis performed on 638 individuals from 149 French families with T2D revealed no significant linkage between IB1 markers and diabetes. However, sequence analysis of the
IB1 coding region from one member of each family revealed a unique missense mutation in one family that results in a serine-to-asparagine substitution at codon 59 (Waeber et al., 2000). All six affected members of the family were heterozygous for the S59N mutation and the mutation was shown to segregate with diabetes. In vitro experiments demonstrated that S59N mutant IB1 had a reduced ability to prevent c-Jun-mediated repression of insulin gene expression and no longer blocked MEKK1-mediated β-cell apoptosis. Thus, IB1 mutations
52 within the human population may contribute to decreased insulin gene expression and reduced β-cell mass, therefore predisposing individuals to diabetes.
Adiponectin: A genome-wide scan of Japanese type 2 diabetic families identified at least 9 different chromosomal regions that harbor potential diabetes susceptibility genes. One of these regions, designated as 3q26-q28, contains the gene encoding adiponectin and sequence analysis identified 10 frequent polymorphisms in this locus (Kadowaki et al., 2003). Patients with the G/G genotype at SNP276 were at increased risk for T2D compared with subjects having the T/T genotype. Moreover, subjects with the G allele had decreased plasma adiponectin levels, suggesting that this mutation may confer inherited insulin resistance due to decreased adiponectin levels.
AKT2: A third T2D susceptibility gene was identified by screening genomic
DNA from 104 subjects displaying severe insulin resistance for mutations in known insulin signaling molecules. Sequencing efforts identified a missense mutation in the AKT2 gene of a nonobese 34-year-old female and this mutation was also detected in her nonobese mother, her maternal grandmother, and a maternal uncle (George et al., 2004). This identified missense mutation consisted of a G to A substitution which results in an arginine to histidine substitution at amino acid 274. R274 is located within the catalytic core domain of Akt2 and is critical for the correct positioning of the substrate relative to the catalytic base and adenosine triphosphate (Yang et al., 2002). Examination of
53 AKT2H274 function in cultured cells revealed that this mutation disrupts well- characterized insulin effects such as GSK3 phosphorylation, FOXA2 cytoplasmic retention, and adipocyte differentiation (George et al., 2004).
In conclusion, T2D is a complex disease in which multiple genes may have a slight or moderate effect on inheritable susceptibility and these effects may become manifested under certain environmental conditions or ethnic backgrounds.
B3.5 Type 2 Diabetes: Therapeutic Targets
Clinical management of T2D has focused more on regulating serum glucose concentrations through adipocyte maintenance and insulin sensitivity than on β- cell preservation (Fig. 1.11). PPARγ (peroxisome proliferative activated receptor) is a transcription factor required for adipocyte differentiation and adipocyte size was significantly reduced in PPARγ deficient mice compared to wild type mice. Studies have shown protection against adipocyte hypertrophy and reduced insulin resistance in heterozygous PPARγ-deficient mice under high-fat diet conditions (Kubota et al., 1999). Recent work suggests that
PPARγ mediates high-fat-diet induced obesity and insulin resistance by downregulating leptin expression. Leptin, which decreases food intake and increases energy expenditure, was only slightly increased in wild-type mice under high-fat-diet conditions. In contrast, leptin levels were markedly increased in PPARγ-deficient mice despite the fact that adipocyte size was smaller (Kadowaki et al., 2002). In conclusion, heterozygous PPARγ-deficient
54 mice are protected from the development of insulin resistance due to adipocyte hypertrophy under a high-fat diet.
Recent evidence suggests that stimulation of PPARγ activity alleviates insulin resistance by promoting the differentiation of pre-adipocytes into hormone-secreting small adipocytes. Thiazolidinediones (TZDs) are a class of oral antidiabetic agents that have been approved for the treatment of T2D.
TZDs function as selective and potent agonists of PPARγ and have proven to be valuable insulin-sensitizing drugs through their ability to regulate adipocyte differentiation. In support of this, treatment of Zucker fa/fa rats with TZDs increased the number of small adipocytes and decreased the number of large adipocytes, thus reducing TNF-α and FFA levels that promote insulin resistance
(Okuno et al., 1998). In addition, TZDs have been shown to decrease accumulation of circulating FFAs through their ability to suppress triglyceride lipolysis (Oakes et al., 2001). In summary, regulation of the dose or activity of
PPARγ by genetic or chemical methods leads to protection against obesity and
T2D induced by high fat diet.
55
Figure 1.11: Fundamental therapies targeting key molecules involved in obesity-induced insulin resistance. The pre-adipocyte is unable to produce insulin-sensitizing hormone (adiponectin), a leading cause of insulin resistance in lipoatrophic diabetes. High-fat-diet induced adipocyte hypertrophy (large adipocyte), which causes a decrease in secretion of adiponectin and increases secretion of insulin resistant hormones, promotes insulin resistance and obesity. Partial reduction in the dose or activity of PPARγ, due to a genetically inherited or functional antagonist, leads to the protection against obesity and T2D induced by high fat diet. (Kadowaki et al, 2003).
C. Overview of Thesis Work
Work presented in this thesis implicates the protein product of the ATF3 gene in the pathogenesis of type 1 and type 2 diabetes. Chapter 2 describes the induction of ATF3 in pancreatic β-cell lines following treatment with T1D and
T2D relevant stress signals, upregulation of ATF3 expression using in vivo diabetic models, and examination of signal transduction pathways responsible for ATF3 induction. Work presented in chapter 3 describes the functional significance of ATF3 expression in pancreatic β-cells through the generation of transgenic mice (gain-of-function) and analysis of knock-out mice (loss-of- function) approaches. Finally, chapter 4 examines the effects of Akt activation
56 on ATF3 induction during the stress response, as well as the functional interaction between these two molecules. A better understanding of the mechanism whereby ATF3 promotes β-cell death would provide potential therapeutic strategies to combat stress-induced diabetes.
57 CHAPTER 2
ATF3 INDUCTION IN PANCREATIC β-CELLS BY STRESS SIGNALS
RELEVANT TO TYPE 1 AND TYPE 2 DIABETES
SUMMARY
Activating Transcription Factor 3 (ATF3), which is a member of the
ATF/CREB family, binds to a core DNA consensus sequence of TGACGTCA where it functions as a transcriptional repressor. As mentioned in chapter 1, most cells contain minimal endogenous levels of ATF3; however, ATF3 expression has been shown to increase in a variety of cell types following treatment with stress (Hai et al., 1999; Hai and Hartman, 2001). For example,
ATF3 mRNA levels in the pancreas were greatly increased following treatment with three different stress models: partial pancreatectomy, ischemia- reperfusion, and streptozotocin treatment (Allen-Jennings et al., 2001). ATF3 has been classified as an immediate early gene based on its rapid induction during the stress response, and it is possible that ATF3 acts to regulate the onset of stress-associated diseases. Various forms of stress have been implicated in the pathogenesis of diabetes. Type 1 diabetes is an autoimmune disorder that
58 is characterized by infiltration of activated T-lymphocytes into the pancreatic islets of Langerhans. Infiltrating lymphocytes mediate β-cell destruction through mechanisms involving direct cell-cell contact, as well as secretion of soluble factors (pro-inflammatory cytokines) (Mandrup-Poulsen, 2001). In type 2 diabetes, which is characterized by insulin resistance in the peripheral tissues, elevated levels of FFAs and hyperglycemia generate ROS which promote β-cell death (Buchanan, 2003). We tested the hypothesis that ATF3 is induced in insulin-producing β-cells by stress signals relevant to type 1 and type 2 diabetes. In this chapter we present data demonstrating that ATF3 is induced in β-cells following treatment with proinflammatory cytokines, hydrogen peroxide, FFAs and hyperglycemia. Using an inhibitory approach, we present evidence that both the JNK and NFκB pathways play a role in ATF3 induction by IL-1β. Finally, we demonstrate that ATF3 protein levels are elevated in β- cells during diabetes progression using in vivo disease models.
INTRODUCTION
It is widely accepted that autoimmunity is the main cause of type 1 but not type 2 diabetes. Despite this difference, β-cell death plays an important role in the pathophysiological progression of both diseases (Eizirik and Mandrup-
Poulsen, 2001; Mandrup-Poulsen, 2001). On one hand, proinflammatory cytokines (interleukin-1β [IL-1β], tumor necrosis factor alpha [TNF-α], and gamma interferon [IFN-γ]) destroy β-cells in the islets of Langerhans, leading to the pathogenesis of type 1 diabetes (Eizirik and Mandrup-Poulsen, 2001;
59 Mandrup-Poulsen, 1996); on the other hand, elevated glucose and free fatty acids (FFAs)-common metabolic abnormalities in type 2 diabetes-induce β-cell death, contributing to the progression of the disease (Jonas et al., 1999; Lee et al., 1994). Emerging evidence indicates that activation of the NF-κB and Jun N- terminal kinase/stress-activated protein kinase (JNK/SAPK) signaling pathways is a key event leading to cell death, when β-cells are exposed to these signals: proinflammatory cytokines, elevated glucose, and elevated FFAs (Eizirik and
Mandrup-Poulsen, 2001). Furthermore, activation of these pathways has been demonstrated to impair insulin signaling and play a role in type 2 diabetes
(Aguirre et al., 2000; Evans et al., 2003). Therefore, these stress-activated signaling pathways constitute a common molecular mechanism in the pathophysiological progression of type 1 and type 2 diabetes.
Thus far, inducible nitric oxide (NO) synthase (iNOS), whose expression leads to NO production, is one of the best known target genes for these pathways (Eizirik and Pavlovic, 1997). Several lines of evidence indicate that iNOS plays an important role in the pathogenesis of diabetes. (i) iNOS is induced in the islets by cytokines and is expressed in the islets of diabetes prone BB rats and nonobese diabetic (NOD) mice (Rabinovitch et al., 1996). (ii)
Transgenic mice expressing iNOS in β-cells develop β-cell destruction and diabetes (Takamura et al., 1998). (iii) β-cells lacking functional iNOS are partially protected from stress-induced cell death.
Similar to iNOS, Activating Transcription Factor 3 (ATF3) is an inducible gene whose expression increases upon exposure of cells to various stress
60 stimuli, including in the brain by seizure; in the liver by carbon tetrachloride; in the heart by ischemia coupled with reperfusion (ischemia-reperfusion), and in the pancreas by partial pancreatectomy (Hai and Hartman, 2001; Allen-
Jennings et al., 2001). ATF3 has been classified as an immediate early gene based on its rapid induction during the stress response and, importantly, the induction of ATF3 correlates with cellular damage: all signals that induce ATF3 also induce cellular damage, and signals that do not induce ATF3 do not induce damage (Hai and Hartman, 2001). As mentioned in chapter 1, several well- characterized stress activated signal transduction pathways (JNK, p53, TGF-β) have been implicated in ATF3 induction based, in part, on their ability to upregulate ATF3 promoter activity.
Based on these observations, we decided to examine ATF3 induction in pancreatic β-cells by stress treatments relevant to type 1 and type 2 diabetes.
In this report, we describe ATF3 induction in pancreatic β-cell lines following treatment with pro-inflammatory cytokines, FFAs, elevated glucose concentration, and oxidative stress. Induction of ATF3 is mediated in part by the NFκB and JNK signaling pathways, two stress-induced pathways implicated in both type 1 and type 2 diabetes. Finally, ATF3 is expressed in the islets of patients with type 1 or type 2 diabetes, and in the islets of nonobese diabetic mice that have developed insulitis or diabetes.
61 MATERIALS AND METHODS
Cell Culture and Treatments
INS832/13 cells were grown in RPMI medium (11mM glucose) supplemented with 10% heat-inactivated FBS, penicillin/streptomycin, 10mM HEPES, 1mM sodium pyruvate, 2mM L-glutamine, and 50µM β-mercaptoethanol. β-TC-6 cells were cultured in DMEM containing 4mM L-glutamine that was modified to contain 4.5g/L glucose, 1.5g/L sodium bicarbonate, penicillin/streptomycin, and
15% heat-inactivated FBS. Rin-m cells were grown in RPMI 1640 medium containing 2mM L-glutamine that was modified to contain 4.5g/L glucose, 1.5g/L sodium bicarbonate, penicillin/streptomycin, 10mM HEPES, 1mM sodium pyruvate and 10% FBS (not heat-inactivated). COS-1 cells were grown in
DMEM media containing 5mM glucose, penicillin/streptomycin, and 10% heat- inactivated FBS. INS832/13 cells were incubated with reduced glucose (5mM) for 24 h before treatments including (i) IL-1β (2,000 U/ml), TNF-α, or IFN-γ
(1,000 U/ml each), or in combination (R and D Systems); (ii) bovine serum albumin (BSA) alone (0.5%) or BSA coupled with palmitate (0.4 mM) as detailed elsewhere (Roduit et al., 2000); and (iii) high glucose (25 mM). Rin-m or βTC6 cells were treated with hydrogen peroxide (100µM) for 1 hour in the presence or absence of 40mM N-Acetyl Cysteine (NAC). For inhibitors, cells were incubated with 20 µM Bay11-7082 or Bay11-7085 (Biomol), NFκB SN50 or NFκB SN50M (4µg/ml; Biomol) or JNKI-1 (1µM or 5µM; Cleveland Clinic
Foundation) for 30 minutes prior to IL-1β treatment.
62 RNA isolation from monolayer cells
Cells were lysed directly in a culture dish by adding 1ml of TRIzol Reagent to a
10 cm2 dish, and passing the cell lysate several times through a pipette.
Transferred cells to an eppendorf tube and allowed samples to sit at room temperature for 5 minutes to allow for the complete dissociation of nucleoprotein complexes. Added 0.2mL of chloroform per 1mL of TRIzol
Reagent. Shook tubes vigorously by hand for 15 seconds and incubated them at room temperature for 2-3 minutes. Centrifuged the samples at 12,000 x g for
15 minutes at 2 to 8°C. Following centrifugation, removed the aqueous (top) phase containing RNA promptly and precipitated the RNA by addition of 0.5mL isopropyl alcohol per 1mL TRIzol. Incubated samples at room temperature for
10 minutes and centrifuged at 12,000 x g for 10 minutes at 2 to 8°C. The RNA precipitate forms a gel-like pellet on the side and bottom of the tube. Removed the supernatant and washed the RNA pellet once with 75% ethanol, adding at least 1mL of ethanol per 1mL of TRIzol reagent. Mixed the samples by vortexing and centrifuge at 7,500 x g for 5 minutes at 2 to 8°C. Removed supernatant and allowed RNA pellet to air dry (not completely), added DEPC-
H2O to pellet and incubated at 55°C for 10 minutes to dissolve pellet. The concentration of the RNA was measured using a Beckman DU-64
Spectrophotometer.
63 RT-PCR
5µg RNA was incubated with 0.5µg of oligo-dT, 18mer (Invitrogen) in a total volume of 11.5µl at 70°C for 5 minutes. The RNA samples were immediately put on ice for 3 minutes. Then 8.5µl of RT mix [2.35X Taq Polymerase Buffer
(Invitrogen), 24mM DTT, 1.2mM dNTP’s, 5.9mM MgCl2, 2.4U/ul RNasin
(Promega)] was added and the tubes were incubated at 42°C for 1 hour. As an
RT minus control, some samples were incubated in RT mix that had water in place of AMV-RT. Placing the tubes at 70°C for 15 minutes stopped the reactions. PCR was then performed on 1µl cDNA. The oligos used to detect mouse and rat ATF3 expression were oligo #209 (5’-GCTGCC
AAGTGTCGAAACAAG-3’) and oligo #210 (5’-CAGTTTTCCAATGGCTTCAGG-
3’). The GAPDH oligos used to detect GAPDH as an internal control are oligo
#182 (5’-CCGGATCCTGGGAAGCTTGTCATCAACGG-3’) and oligo #183 (5’-
GGCTCGAGGCAGTGATGGCATGGACTG-3’). PCR reactions were carried out in a final volume of 20µl under the following buffer conditions: 1X Taq
Polymerase Buffer (Invitrogen), 20pmol each primer, 0.2mM dNTP’s
(Invitrogen), 2.5mM MgCl2, 0.05 U/µl Taq Polymerase (Invitrogen). 30-40 PCR cycles were performed using the following thermal cycling conditions: denaturation for 1 minute at 94°C; hybridization for 1 minute at 52°C; elongation for 1 minute at 72°C. The amplified products were separated on a 1.2% agarose gel stained with ethidium bromide.
64 Real-Time PCR
Real-Time PCR was carried out on the iCycler iQ Real Time PCR detection system (Bio-Rad) using gene-specific probes and primers. The probes were labeled at 5’ by 6-carboxy fluorescein as fluorescent reporter and at the 3’ end by tetramethylrhodamine as a quencher. The sequences of the probes and primers are as follows: ATF3 upstream primer, 5’-
CGAAGACTGGAGCAAAATGATG-3’; ATF3 probe, 5’-CATCCAGGCCAGG
TCTCTGCCTCAG-3’; GAPDH upstream primer, 5’-CAACGGGAAGCCCATCA-
3’; GAPDH downstream primer, 5’-CGGCCTCACCCCATTT-3’; GAPDH probe,
5’-CTTCCAGGAGCGAGACCCCACTAAC-3’. Due to sequence conservation, these primers and probes work for mRNAs derived from both mouse (βTC6) and rat (RIN-m, INS832/13) cells. For ATF3 downstream primer, different sequences were used for mouse and rat: mouse, 5’-
CAGGTTAGCAAAATCCTCAAATAC-3’; rat, 5’-CAGGTTAGCAAAATCCTCAA
ACAC-3’. 5% of the cDNA product was used in Real-Time PCR in 25µl reactions as follows: (a) 95°C for 3 minutes, 1 cycle, (b) 95°C for 30s followed by 60°C for 30s, 40 cycles. Standard curves were generated using serial dilutions of a plasmid containing ATF3 or GAPDH cDNA.
Nuclear Extract Preparation
Cells were scraped in PBS using a rubber policeman and transferred to an eppendorf tube pre-chilled on ice. Cells were pelleted by spinning for 15 seconds at 14,000 X g in a benchtop microfuge and PBS was aspirated off cell
65 pellet. Resuspended cell pellet in 400µl ice cold Buffer A (10mM HEPES pH7.9, 10mM KCl, 0.1mM EDTA, 0.1mM EGTA, 1mMDTT, 0.5mM PMSF) by gentle pipeting with a yellow tip. Cells were allowed to swell on ice for 15 minutes. Next, added 25µl of a 10% solution of NP-40 and vigorously vortexed tubes for 10 seconds. Centrifuged the homogenate for 30 seconds at 14,000 X g and discarded the supernatant containing the cytoplasmic fraction. The nuclear pellet was resuspended in 50µl ice cold Buffer C (20mM HEPES pH7.9,
0.4M NaCl, 1mM EDTA, 1mM EGTA, 1mM DTT, 1mM PMSF) and the tubes were vigorously rocked at 4°C for 15 minutes. The nuclear extract was centrifuged at 14,000 X g for 5 minutes at 4°C and supernatant was transferred to a new tube.
Immunoblotting
Equal amounts of nuclear extract were resolved by SDS-polyacrylamide gel electrophoresis followed by transfer to PVDF membrane (Millipore). Primary antibodies used for protein detection were used as follows: anti-ATF3 1:1,000
(Santa Cruz), anti-actin 1:3,000 (Sigma), anti-extracellular signal-regulated kinase 1:1,000 (Cell Signaling Technology).
Immunohistochemistry
Pancreas sections on slides were deparaffinized in xylene (10min, 2X), then rehydrated in a decreasing ethanol series to distilled water (100%, 100%, 95%,
95%, 75%, 75%, 0%- 5min each). The sections were then incubated in 0.3%
66 hydrogen peroxide in methanol for 30 minutes at room temperature and then rinsed in PBS (5min, 2X). Then the sections were blocked with 10% normal goat serum (Vector Laboratories) in a 0.1% NP40/PBS solution for 60 minutes at room temperature. The blocking solution was removed and the primary antibody diluted in block solution at the indicated concentrations was added to the section and incubated overnight at 4°C in a humidity chamber: rabbit-anti-
ATF3 (1:1,000), guinea pig-anti-insulin (1:50), mouse-anti-glucagon (1:1,000).
After the primary antibody incubation, the sections were rinsed with PBS (5min,
3X). For ATF3 staining, the sections were incubated with a biotinylated anti- rabbit secondary (1:200 dilution in block) antibody for 30 minutes at room temperature in a humidity chamber. The sections were then rinsed with PBS
(5min, 3X) and incubated with the ABC elite reagent (Vector Laboratories) for
30 minutes at room temperature in a humidity chamber. The sections were rinsed with PBS (5min, 2X) and the color reaction was performed using the
DAB substrate kit (Vector Laboratories) according to the manufacturers recommendations for 20-30 minutes. For insulin and glucagon staining, the sections were incubated with Alkaline Phosphatase conjugated anti-guinea pig or anti-mouse secondary antibody (1:200 dilution in block) for 30 minutes at room temperature in a humidity chamber. The sections were rinsed with PBS
(5min, 3X) and the color reaction was performed using the AP substrate kit
(Vector Laboratories) according to the manufacturers recommendations for 20-
30 minutes. The sections were rinsed with double distilled water for 5 minutes and counter stained with methyl green (Vector Laboratories) for 2-3 minutes at
67 60°C. The sections were rinsed with double distilled water for 1 minute, and dehydrated through and ethanol series into xylene and mounted using
Permount mounting media (Fisher Scientific).
Analyses of JNK/SAPK and NFκB activity
JNK/SAPK was immunoprecipitated from INS832/13 cell extract at 30 minutes after IL-1β treatment, and assayed using glutathione S-transferase-Jun (1 to 79 amino acids) as substrate in the absence or presence of indicated inhibitors.
NFκB activity was determined by electrophoretic mobility shift assay (EMSA) as previously described (Guttridge et al., 1999).
Transfection and Luciferase Assay
COS-1 cells were plated at 400,000 cells per 6cm tissue culture dish 24 hours before transfection. COS-1 cells were transfected using the Lipofectamine-
PLUS method in serum-free media for 3 hours at 37°C, 5% CO2. Complete medium was replaced onto the cells and extracts were prepared 36 hours post- transfection in the following manner: Cells were washed 3X with ice-cold PBS, aspirating medium after each wash. Added 0.75ml cold PBS to plates, scraped cells, and transferred to an eppendorf tube. Spun cells in cold room at 14,000
X g and resuspended in 350µl Triton/glycylglycine lysis buffer (1% Triton-X 100,
25mM Gly-Gly pH 7.8, 15mM MgSO4, 4mM EGTA, 1mM DTT). Lysed cells were sonicated (3X, 15 seconds each, 60% output) and spun at 14,000 X g for
15 minutes in cold room and supernatant was transferred to fresh eppendorf
68 tube. For luciferase measurements, gently vortexed the cell lysate and placed
100µl in a luminometer cuvette (Sarstedt). Added 360µl of luciferase assay buffer (25mM Gly-Gly pH 7.8, 15mM KPO4, 15mM MgSO4, 4mM EGTA, 2mM
ATP, 1mM DTT) to tube and placed in luminometer chamber. Diluted stock luciferin to 200µM in 25mM glycylglycine pH 7.8 and minimized exposure of substrate to light. Injected 100µl of diluted luciferin solution into the sample in the luminometer measured light output for 10 seconds at room temperature.
RESULTS
Induction of ATF3 in β-cell lines by signals relevant to type 1 or type 2 diabetes
Although ATF3 has been shown to be a stress-inducible gene, it is not clear whether it is induced in β-cells by signals relevant to type 1 or type 2 diabetes.
To address this question, we examined ATF3 expression in INS832/13 insulin- positive β-cells. As shown in Fig. 1a, IL-1β alone transiently increased ATF3 mRNA level as indicated by real-time PCR, but TNF-α or IFN-γ alone did not
(not shown). Interestingly, TNF-α plus IFN-γ enhanced and prolonged the induction of ATF3 by IL-1β (Fig. 2.1a). Immunoblot analysis confirmed the production of ATF3 protein (Fig. 2.1b). This TNF-α-IFN-γ-mediated potentiation parallels the well-documented potentiation of IL-1β-induced apoptosis by these two cytokines (Mandrup-Poulsen, 1996), supporting the notion that ATF3 expression contributes to apoptosis. Combinations of two cytokines indicated that IL-1β-TNF-α or IL-1β-IFN-γ induced ATF3 at about 70 to 90% efficiency
69 compared to all three cytokines, and TNF-α-IFN-γ induced ATF3 at around 10% efficiency (Fig. 2.1c). Elevated glucose (25mM), a condition known to induce apoptosis in INS832/13 cells, induced ATF3 around 30-fold (Fig. 2.1d, bar 3).
The fatty acid palmitate (n-hexadecanoate, 16:0), which is known to modestly induce apoptosis, induced ATF3 by two-fold (Fig. 2.1d, bar 2). Interestingly, glucose plus palmitate (glucolipotoxicity) induced ATF3 with higher efficiency than either treatment alone (Fig. 2.1d). The induction of ATF3 by palmitate is consistent with the DNA microarray result that ATF3 is induced in Min-6 β-cells by this fatty acid (Busch et al., 2002).
Chronic hyperglycemia has been shown to increase levels of oxidative stress, and pancreatic β-cells are highly susceptible to oxidative stress due to low levels of anti-oxidant enzymes (Maechler et al., 1999). Next, we examined the induction of ATF3 in Rin-m and βTC6 islet cells following treatment with hydrogen peroxide. As shown in Fig. 2.2, ATF3 mRNA increased at 1 hour after H2O2 treatment. Real-Time PCR analysis indicated that the induction was about 13-fold in RIN-m cells and 5-fold in βTC6 cells. Significantly, N-acetyl-L- cysteine, and anti-oxidant scavenger, greatly reduced the induction, suggesting that H2O2 induces ATF3 through an oxidative stress-mediated mechanism.
70
a. b.
c. d.
Figure 2.1: ATF3 is induced by cytokines and elevated glucose or palmitate. (a to c) INS832/13 cells were treated with the indicated cytokines as detailed in the Methods section and assayed at the indicated time points by real-time PCR for ATF3 mRNA (a and c) or by immunoblot for ATF3 protein (b). For real-time PCR, GAPDH mRNA was used as an internal control, and the level from untreated cells was defined as 1. (c) The level of induction by all three cytokines was arbitrarily defined as 100%. (d) INS832/13 cells were treated with glucose or palmitate (0.4 mM coupled with 0.5% BSA) as indicated, and ATF3 mRNA was assayed by real-time PCR at 1 h after induction.
71
Figure 2.2: ATF3 is induced by oxidative stress in pancreatic β-cell lines. Rat Rin-m and mouse βTC-6 islet cells were treated with 100 µM H2O2 for 1 h either in the absence or presence of 40 mM NAC as indicated. Total RNA was isolated and analyzed by RT-PCR or RT coupled with real-time PCR. ATF3 transcripts were normalized against GAPDH transcripts, and the normalized signals in uninduced cells were defined as 1.
72 NF-κB and JNK/SAPK pathways in the induction of ATF3 by IL-1β
As described in the introduction, the NF-κB and JNK/SAPK pathways play an important role in β-cell apoptosis and diabetes. Interestingly, the human
ATF3 promoter contains NF-κB, AP-1 and ATF/CRE sites, binding sites recognized by the transcription factors activated by the NF-κB and JNK/SAPK pathways. These observations, combined with the induction of ATF3 by stress signals in β-cells (above), prompted us to examine whether the activation of these pathways is necessary for the induction of ATF3 by IL-1β using an inhibitory approach. To inhibit the NF-κB pathway, we used two types of reagents: (a) small compound inhibitors of IKK (Bay11-7082 and Bay11-7085) and (b) a cell-permeable peptide NF-κB SN50 which blocks the nuclear translocation of NF-κB p50 (Lin et al., 1995). These inhibitors reduced the induction of ATF3 by IL-1β in INS832/13 cells as indicated by real-time PCR, but a control peptide NF-κB SN50M which contains a mutation in the peptide did not affect ATF3 induction (Fig. 2.3a). Immunoblot analysis indicated that the inhibitors also reduced the ATF3 protein level (Fig. 2.3b). EMSA confirmed that Bay11-7082 and Bay11-7085 inhibited the NF-κB DNA binding activity in the nuclear extracts (Fig. 2.3c). However, these inhibitors did not block
JNK/SAPK activity which was induced by IL-1β (Fig. 2.3d). Since the ATF3 upstream promoter contains several NFκB consensus binding sites, we tested the effects of NFκB overexpression on ATF3 promoter activity as measured by luciferase reporter activity. Expression of NFκB p50 and p65 subunits stimulated ATF3 promoter activity in a similar manner to an artificial promoter
73 containing NFκB-consensus sites, suggesting that NFκB regulates ATF3 expression at the transcriptional level (Fig. 2.3e).
To inhibit the JNK/SAPK pathway, we used the JNKI-1 peptide, a cell- permeable peptide that inhibits the activation of this pathway (Bonny et al.,
2001). JNKI-1 reduced the induction of ATF3 by IL-1β at both the mRNA (Fig.
2.4a) and protein levels (Fig. 2.4b). The inhibition at the protein level appears to be more efficient than that at the mRNA level and further investigation is required to explain this apparent difference. The specificity of the peptide is indicated by its ability to inhibit JNK/SAPK activity (Fig. 2.4c), but not NFκB nuclear translocation (Fig. 2.4d). Interestingly, combination of both inhibitors
(JNKI-1 plus Bay11-7082) did not result in a complete inhibition of ATF3 induction (Fig. 2.4a), suggesting that other pathways are involved.
74
Figure 2.3: Role for NFκB pathway in ATF3 induction by cytokines. (a to c) INS832/13 cells were treated with IL-1β in the absence or presence of the indicated inhibitors or a control peptide inhibitor NFκB SN50M. ATF3 mRNA was assayed at 1 h after IL-1β treatment by real-time PCR (a); ATF3 protein was assayed at 1 h after treatment by immunoblot (b); NFκB DNA binding activity in the nuclear extract was assayed by EMSA at 15 min after treatment or at the indicated time points (c). (d) INS832/13 cells were treated with IL-1β for 30 min, and JNK/SAPK was assayed by IP-kinase assay using GST-Jun as the substrate in the absence or presence of the indicated inhibitors. (e) COS-1 cells were transfected with the indicated expression constructs using the Lipofectamine-PLUS method and extracts were prepared 36 h post-transfection for analysis of luciferase reporter levels.
75
Figure 2.4: Role for JNK/SAPK pathway in ATF3 induction by cytokines. (a and b) Same as figure 2.3 except JNKI-1 was used as the inhibitor. (c) JNK/SAPK was assayed by IP-kinase assay in the absence or presence of JNKI-1. (d) NFκB DNA binding activity in the nuclear extract was assayed by EMSA as described in figure 2.3 except JNKI-1 was used as the inhibitor.
76 Expression of ATF3 in the islets of diabetic mice and patients
To address whether ATF3 is expressed in the pathophysiological context of diabetic progression, we examined ATF3 expression in the islets of NOD mice which develop diabetes spontaneously (Hanafusa et al., 1994). As shown by immunohistochemistry, ATF3 is expressed in the islets at the diabetic stage
(Fig. 2.5f), and the prediabetic but insulitis stage (Fig. 2.5e). Hematoxylin and eosin staining of the adjacent sections revealed that, at the insulitis stage, ATF3 is expressed in cells adjacent to the infiltrating lymphocytes (compare Fig. 2.5b and 2.5e). The specificity of the signal is demonstrated by the lack of signal in cells away from the lymphocytes and the lack of signal in islets before the NOD mice develop insulitis (Fig. 2.5a and 2.5d). To determine whether ATF3 is expressed in insulin-positive cells, we carried out immunohistochemistry on adjacent sections using antibodies that recognize ATF3, insulin, or glucagon.
These studies revealed that ATF3-expressing cells directly overlapped with insulin-positive cells, but not glucagon-positive cells. Insulin-positive cells occupied less than half of the islet (the rest of the islet was filled with infiltrating lymphocytes), and ATF3-positive cells were in the area where insulin-positive cells reside (Fig. 2.6a-c). Significantly, in addition to the diabetic mouse model,
ATF3 is expressed in the diabetic islets of both type 1 and type 2 human patients. Similar to the mouse model, the ATF3-positive cells corresponded to the insulin-positive cells in the human tissues. As expected, most of the insulin- positive cells had been destroyed and only a few clusters of insulin-positive cells were found in the type 1 samples. The type 1 sample also contained
77 many atrophic islets with glucagon-positive but not insulin-positive cells and no
ATF3-positive cells were found in these islets (Fig. 2.6d-f). Many clusters of insulin-positive cells were observed in type 2 human patient pancreata and these cells directly overlapped with ATF3-positive cells, confirming that ATF3 expression is increased in human diabetic insulin-producing cells (Fig. 2.6g-i).
78
a. b. c.
d. e. f.
Figure 2.5: ATF3 expression in the NOD type 1 diabetic mouse pancreata. Pancreata from NOD mice at 1 week (a and d), 12 weeks (b and e), or 33 weeks (c and f) of age were stained by H&E (a to c) or analyzed by immunohistochemistry for ATF3 (d to f). In panel b infiltrating lymphocytes in the islets are delineated by red dots, and in panel e islets are delineated by black dots.
79
Figure 2.6: ATF3 expression in insulin-positive cells of NOD and human diabetic pancreata. Immunohistochemistry was carried out for insulin, ATF3, or glucagons using adjacent paraffin sections. (a to c) Pancreata from NOD mice that had developed insulitis (at 17 weeks of age) were analyzed for insulin (a), ATF3 (b), or glucagon (c). (d to f) Archived paraffin sections from a type 1 patient were analyzed for insulin (d), ATF3 (e), or glucagon (f) content. (g to i) Same as panels d to f except sections from type 2 patients were used.
80 DISCUSSION
In this chapter, we present data demonstrating ATF3 induction in β-cell lines following treatment with pro-inflammatory cytokines. We observed transient induction of ATF3 following treatment with IL-1β alone, whereas treatment with
3 cytokines (IL-1β, TNF-α, and IFN-γ) resulted in sustained ATF3 induction. IL-
1β is known to function by binding the low affinity IL-1 receptor type I (IL-1RI) and this produces a conformational change which allows docking of an IL-1 receptor accessory protein (IL-1AcP) (Dinarello, 1997). IL-1RI activated kinase
(IRAK) is recruited to the IL-1/IL-1RI/IL-1AcP complex by the adaptor protein
MyD88, and this results in downstream activation of the NFκB, PKC, and MAPK signaling pathways (Dupraz et al., 2000). Enhanced and prolonged ATF3 induction following 3 cytokine treatment may arise from additional pathways being activated compared with IL-1β treatment alone. IFN-γ signals via the
IFN-γ receptor 1 which dimerizes with IFN-γ receptor 2 and subsequently recruits Janus tyrosine kinases 1 and 2 (JAK 1/2) to the membrane.
Phosphorylation of the IFN-γ receptor allows docking of two signal transducers and activators of transcription 1 molecules (STAT1). After docking, STAT1 is activated through phosphorylation by JAK2. STAT1 then homodimerizes and translocates to the nucleus where it functions as a transcriptional activator (Tau and Rothman, 1999). TNF signaling through the p60 and p80 TNF receptors results in recruitment of the Fas-associated death domain protein (FADD) as well as activation of protein kinases such as JNK, p38, and PKR (Rath and
Aggarwal, 1999; Saklatvala et al., 1999). A role for these IFN-γ/TNF-α-
81 activated pathways in mediating ATF3 induction has not yet been examined.
One common link between all 3 cytokine pathways is that they converge on the iNOS target gene to stimulate nitric oxide (NO) production. NO is sufficient to induce ATF3 (chapter 3 data) and prolonged ATF3 expression may be due to elevated iNOS expression in 3 cytokine-treated cells. This supposition is supported by a recent observation that an iNOS inhibitor reduced cytokine- induced ATF3 expression in INS-1β cells at later (>8 h) time points (Kutlu et al.,
2003).
Using an inhibitory approach, we demonstrated that the JNK and NFκB pathways are required for optimal ATF3 induction by IL-1β. Interestingly, a combination of both inhibitors did not result in complete inhibition of ATF3 induction, suggesting that other pathways are involved. The p38 MAPK pathway is activated upon exposure of pancreatic β-cells to IL-1β and data from our lab suggests that p38 is required for ATF3 induction by anisomycin in various cell types (unpublished data); however, the functional requirement for p38 in ATF3 induction in the context of β-cells has not been determined.
Although ATF3 is induced by a variety of seemingly diverse stress signals such as ischemia-reperfusion, hyperglycemia, hyperlipidemia, cytokines, and
UV light, many of these signals elicit oxidative stress, that is, an imbalance between the reactive species and anti-oxidant molecules (Rosen et al., 2001).
Therefore, ATF3 can be viewed as an oxidative-stress induced gene.
Consistent with this notion, ATF3 is induced by H2O2 and this induction is repressed by the antioxidant N-acetyl-cysteine. Accumulating evidence
82 indicates that oxidative stress induces a variety of responses relevant to diabetes, including activation of the NF-κB and JNK/SAPK pathways, insulin- resistance, β-cell dysfunction, and β-cell destruction (Evans et al., 2003).
Elevated ATF3 protein levels were observed in pancreata from NOD type 1 diabetic mice, as well as type 1 and type 2 human patient sections. ATF3 expression correlates with disease onset in the NOD mice; however, the functional significance of ATF3 expression in disease progression should be tested by backcrossing the ATF3 KO mice into the NOD genetic background.
In addition, ATF3 expression appeared to be localized to the cytoplasm in both mouse and human diabetic sections. The functional relevance of this cytoplasmic localization is currently unknown and the possibility that the antibody is reacting with an alternative ATF3 splice form cannot be ruled out.
ACKNOWLEDGEMENTS
I would like to thank Mi-Lyan Kim for helping with the two-cytokine induction experiments. I would also like to thank Dr. Marc Prentki and Jean Buteau for preparation of FFA + high glucose INS cell cDNAs that were used for real-time
PCR analysis. In addition, I would like to thank Dr. Denis Guttridge and his lab for performing control NFκB EMSA experiments and Dan Lu for performing control JNK IP-kinase assays.
83 CHAPTER 3
FUNCTIONAL CONSEQUENCES OF ATF3 EXPRESSION IN β-CELLS
SUMMARY
Data presented in chapter 2 demonstrated upregulation of ATF3 gene expression in pancreatic β-cells by stress signals relevant to type 1 and type 2 diabetes. In these experiments, a correlation was observed between ATF3 expression and insulin-producing cell death: all diabetic stress treatments shown to induce ATF3 during the immediate-early response are known to promote β-cell apoptosis at prolonged time points. Recently, reports have been published describing conflicting functional roles for ATF3 during the stress response. For example, ATF3 expression in neurons appears to play a protective role through its ability to prevent NGF withdrawal-induced apoptosis.
In contrast, cardiac-specific expression of ATF3 leads to detrimental outcomes including conduction abnormalities and contractile dysfunction. In order to examine the functional consequence of ATF3 expression in β-cells, we took both gain-of-function (PDX-ATF3 transgenic mice) and loss-of-function
(examination of ATF3 KO islets) approaches. In this chapter, we present data
84 demonstrating that ATF3 expression in pancreatic β-cells leads to a diabetic phenotype by triggering apoptosis of the insulin-producing cells.
INTRODUCTION
As mentioned previously, ATF3 is a stress-inducible gene whose expression greatly increases following exposure of cells to a variety of stress stimuli. Data presented in chapter 2 provides evidence that ATF3 is induced in pancreatic β- cells following treatment with diabetic stress signals, such as pro-inflammatory cytokines, FFAs, high glucose concentrations, and oxidative stress. However, the functional significance of ATF3 expression is not clear. To date, both protective and detrimental effects of ATF3 expression have been reported.
Ectopic expression of ATF3 by adenovirus-mediated gene transfer inhibited both adriamycin-induced apoptosis in neonatal rat cardiac myocytes, as well as
TNF-α induced apoptosis in human umbilical vein endothelial cells (Nobori et al., 2002; Kawauchi et al., 2002). Interestingly, in both of these reports the protective capability of ATF3 was dependent upon its ability to repress p53 gene transcription. Consistent with a protective role for ATF3, ectopic expression protected superior cervical ganglion neurons from nerve growth factor withdrawal-induced apoptosis (Nakagomi et al., 2003). However, in HeLa cells ectopic expression of ATF3 enhanced the ability of etoposide or camptothecin to induce apoptosis (Mashima et al., 2001). Consistent with the pro-apoptotic role of ATF3, transgenic mice expressing ATF3 in the heart have conduction abnormalities and contractile dysfunction (Okamoto et al., 2001).
85 Indeed, the functional outcome of ATF3 expression may depend upon the precise cellular context in which it is expressed.
Previous studies have implicated a functional role for ATF3 in the regulation of glucose homeostasis. Glucose homeostasis is maintained in adults through metabolic processes such as glycogenolysis, which acts to degrade glycogen to glucose, and gluconeogenesis, which triggers glucose synthesis from non- carbohydrate precursors (Girard et al., 1973; McGrane et al., 1992). These metabolic processes mainly take place in the liver but are regulated by the ratio of two hormones secreted by the endocrine pancreas. When the blood glucose level is low, the insulin:glucagon ratio is low, resulting in the activation of the intracellular cAMP signaling pathway that in turn stimulates glycogenolysis and gluconeogenesis. However, when the blood glucose level is high, the insulin:glucagon ratio is high and these metabolic processes are repressed. A wealth of data has demonstrated ATF3 induction in the liver following exposure of animals to chemicals (carbon tetrachloride, cyclohexamide, alcohol) or surgically-induced stress (hepatic ischemia, partial hepatectomy) (Hai et al.,
1999); however, until recently the functional consequences of ATF3 expression in the liver were unsolved.
In an effort to gain an understanding of the functional role of ATF3 in the liver, transgenic mice were generated that express ATF3 under control of the transthyretin (TTR) promoter (Allen-Jennings et al., 2002). One group of transgenic mice, which displayed restricted ATF3 expression to hepatocytes, had symptoms indicative of general liver dysfunction including increased
86 alkaline phosphatase, bile acids, alanine transaminase, and aspartate transaminase. The low blood glucose phenotype observed in these transgenic mice was due to the ability of ATF3 to inhibit gluconeogenesis through repression of PEPCK gene expression. A second group of transgenic mice expressed ATF3 in both the liver and endocrine pancreas during developmental stages (ductal epithelium). Pancreas development begins at approximately embryonic day e9.5-e10.5 as the dorsal and ventral pancreatic buds arise from the primitive gut endoderm (Sander and German, 1997). Differentiation of exocrine versus endocrine pancreas occurs around embryonic day e14.5 and the dorsal and ventral buds fuse to form a highly branched structure. Intact islets are formed by P1 and the ability to sense glucose and regulate insulin secretion becomes established (Fig 3.1). This second group of transgenic mice actually displayed higher blood glucose levels compared with non-transgenic mice and it was observed that the transgenic mice had a reduction in all four types of pancreatic endocrine cells which was due to decreased mitotic rates
(Allen-Jennings et al., 2001). Thus, it appears that ectopic ATF3 expression in endocrine precursor cells has detrimental outcomes by interfering with normal pancreas development.
87
Figure 3.1: Model for pancreas development. At embryonic day 9.5, the dorsal pancreatic bud first appears as a bulge in the primitive gut endoderm, near the junction of the foregut and midgut in the area that will become the duodenum. Shortly thereafter the ventral pancreatic bud arises. As the stomach and duodenum rotate, the ventral bud and hepatopancreatic orifice move around until they come into contact, and around e16-17 fuse with the dorsal bud. As the buds grow, they rapidly form new fold leading to a highly branched structure. Even though endocrine cells can be detected in the forming pancreas from the earliest stages, islets with the characteristic distribution of insulin-expressing cells in the center and non-insulin-producing cells in the periphery do not form until the end of gestation, at about e18.5. Neogenesis of islets continues throughout neonatal life but ceases shortly after weaning. (Sander and German, 1997).
88 In order to further elucidate the functional outcome of ATF3 expression in pancreatic β-cells, we took both gain-of-function and loss-of-function approaches. Transgenic mice which overexpress ATF3 in insulin precursor cells displayed diabetic phenotypes including elevated blood glucose levels, decreased serum insulin levels, increased triglycerides and ketone bodies. In addition, these transgenic mice had a decrease in pancreatic islet area compared to non-transgenic mice which may be due to increased caspase-3 activation in insulin-producing cells. In support of these results, pancreatic islets purified from ATF3 knock-out mice were partially resistant to cytokine- induced cell death. The identification of ATF3 as a nitric oxide-inducible gene reveals a novel mechanism of ATF3 regulation in pancreatic β-cells.
MATERIALS AND METHODS
Generation of PDX-ATF3 Transgenic Mice
A 1.0-kb enhancer region (kb -2.7 to -1.7) of the PDX promoter (a gift from C.
Wright at Vanderbilt University) was inserted upstream of the E1B TATA box to drive the expression of human ATF3 as shown (Fig. 3.1). The PDX-HA-ATF3 fragment was digested out of the vector and isolated off of a 1% Seaplaque low melt agarose gel (The Ohio State University Neurobiotechnology Center
Transgenic Animal and ES Cell Facility). The PDX-HA-ATF3 fragment was injected into pronuclei of one-cell embryos from FVB/N females. Transgenic mice were identified by PCR using the ATF3 specific upstream primer: 5’-
GCTGCAAAGTGCCGAAACAAG-3’ (#215) and the Growth Hormone polyA
89 specific downstream primer: 5’-TTAGGACAAGGCTGGTGGG-3’ (#222).
Transgene expression was examined by ATF3 immunohistochemistry using paraffin-embedded sections of whole embryos at different developmental stages.
Hematoxylin and Eosin Staining
Sections were de-paraffinized with xylene (5min, 2X) followed by rehydration using the following wash sequence: 100% ethanol (5min, 2X), 95% ethanol
(5min, 2X), 75% ethanol (5min, 1X), 0% ethanol (5min, 1X). Sections were dipped into diluted hematoxylin stain solution (diluted 1:5 with 25% ethyleneglycol, pH 2.5) for various times followed by rinsing in tap water for 1 minute. After excess stain was washed away, sections were dipped into diluted eosin stain solution (diluted 1:5 with 70% ethanol, pH 4.5) for various times followed by rinsing in tap water. Sections were dehydrated back to 100% ethanol, dipped in histoclear solution (a few dips) and coverslips were added using permount mounting media.
Measurement of islet area
Quantitation of islet area was carried out using the BioQuant Pancreas Area
Measurement program and islet area results were standardized against total pancreas tissue area.
90 Insulin and Glucagon co-I.F.
Pancreas sections on slides were deparaffinized in xylene (10min, 2X), then rehydrated in a decreasing ethanol series to distilled water (100%, 100%, 95%,
95%, 75%, 75%, 0%- 5min each). The sections were then incubated in 0.3% hydrogen peroxide in methanol for 30 minutes at room temperature and then rinsed in PBS (5min, 2X). Then the sections were blocked with 10% normal goat serum (Vector Laboratories) in a 0.1% NP40/PBS solution for 60 minutes at room temperature. The blocking solution was removed and the primary antibody diluted in block solution at the indicated concentrations was added to the section and incubated overnight at 4°C in a humidity chamber: guinea pig- anti-insulin (1:1,000), mouse-anti-glucagon (1:1,000). After the primary antibody incubation, the sections were rinsed with PBS (5min, 3X). Secondary antibody diluted in block solution at the indicated concentrations was added to the section and incubated at room temperature for 30 minutes: anti-mouse-
Texas Red (1:100), anti-Guinea Pig-FITC (1:200). After the secondary antibody incubation, the sections were rinsed with PBS (5min, 3X), and coverslips were added using Vectashield Mounting Medium (for fluorescence). Fluorescent signal was visualized using confocal microscopy.
Body Weight, Serum, and Blood Analysis
P1 mice were weighed on a Mettler-Toledo BB2440 balance. For serum isolation, P1 pups were decapitated with scissors. The blood was collected using micro-hematocrit capillary tubes (Fisher Scientific) and put into
91 Microtainer serum separator tubes (Becton Dickinson). The tubes were centrifuged according to the manufacturer’s conditions and the top layer
(serum) was either analyzed that day or stored at -20ºC for future analysis.
Blood glucose was measured using the Glucometer Elite (Bayer) and serum parameters were measured by radioimmunoassay (Linco).
INS Cell Infection and Caspase-3 Immunoblotting
INS-r3 cells were grown in media identical to INS832/13 cells (see chapter 2 methods) except for the addition of 150ug/mL G418 to maintain the stably integrated rtTA gene. INS-r3 cells were seeded at a density of 3 x 106 cells/
6cm plate approximately 24 hours before infection. During infection, added either β-gal control virus or tetO-ATF3 virus at the indicated MOI to the cells in
2ml of complete medium. Cells were harvested 36 hours later and protein extracts were prepared by RIPA lysis. 200ug of whole cell extract was resolved by SDS-PAGE and immunoblotting for the cleaved (active) form of caspase-3 was carried out under the following antibody conditions: anti-cleaved caspase-
3 (Cell Signaling; 1:1,000).
Active-Caspase 3 Immunohistochemistry
Sections were de-paraffinized by three washes of xylene (5min. each) followed by dehydration using the following wash sequence: 100% ethanol (10min., 2X),
95% ethanol (10min., 2X), dH2O (5min., 2X), PBS (5min., 1X). For antigen unmasking, sections were heated in boiling 10mM sodium citrate buffer (pH 6.0)
92 for 1 minute at full power followed by reduced heat (just below boiling) for an additional 9 minutes. The slides were cooled in dH2O for 20 minutes after antigen unmasking. The sections were washed in dH2O (5min., 3X) followed by incubation in 1% hydrogen peroxide for 10 minutes. Next, the sections were washed in dH2O (5min., 3X) followed by PBS (5min., 1X). The sections were blocked for 1 hour at room temperature and antibody diluted in blocking solution was added to the sections overnight at 4ºC: Cleaved Caspase-3 (Asp175)
(1:500). After the primary antibody incubation, the sections were rinsed with
PBS (5min, 3X). For Cleaved Caspase-3 staining staining, the sections were incubated with a biotinylated anti-rabbit secondary (1:200 dilution in block) antibody for 30 minutes at room temperature in a humidity chamber. The sections were then rinsed with PBS (5min, 3X) and incubated with the ABC elite reagent (Vector Laboratories) for 30 minutes at room temperature in a humidity chamber. The sections were rinsed with PBS (5min, 2X) and the color reaction was performed using the DAB substrate kit (Vector Laboratories) according to the manufacturers recommendations for 20-30 minutes.
Embryo Stress Model
Embryos were removed from a pregnant female mouse at embryonic day e12.5 and placed under either normoxic conditions (95% oxygen), hypoxic conditions
(60% oxygen), or hypoxia/reoxygenation for 2 hours. Following treatment, embryos were frozen on powdered dry ice. Total RNA was extracted from
93 embryos using the Trizol method and using for RT-PCR experiments. In addition, frozen sections were prepared and used for in situ hybridization.
RT-PCR
RT-PCR was performed as described in chapter 2 using total RNA isolated from e12.5 mouse embryos. Embryos were homogenized at high power with a
Tekman Tissuemizer in 1ml Trizol at room temperature, after which the standard Trizol protocol was followed.
Preparation of probes for in situ hybridization
A plasmid containing the ATF3 mouse cDNA (TH1087) was linearized with SalI restriction enzyme for use in preparation of an antisense RNA probe. The RNA probes were synthesized in 5µl of transcription buffer (40mM Tris-HCl [pH 8.0],
25mM NaCl, 8mM MgCl2, 5mM dithiothreitol, 2mM spermidine) containing 50ng linearized template DNA, 125µCi of [α-33P]UTP (1,000 Ci/mmol; Amersham),
500µM each ATP, CTP, and GTP, 20U of RNasin (Promega), and 25U T7 polymerase (Life Technologies) at 40ºC for 2 hours. All reagents except for the enzymes and isotope were made in diethyl pyrocarbonate-treated water
(DEPC-dH2O) and the concentration of UTP in the reaction mixture was greater than 12µM in order to prevent premature termination. After the 2 hour incubation, the reaction mixture was diluted to 25µl with transcription buffer,
0.5U of RQ1 DNase (Promega) were added, and the mixture was incubated at
37ºC for 15 minutes. The probes were separated from unincorporated
94 triphosphates by G-50 exclusion chromatography and degraded to an average size of 150 nucleotides by adding an equal volume of base degradation buffer
(80mM NaHCO3, 120mM Na2CO3) for 45 minutes at 60ºC. After base degradation, 5µg of tRNA and 40µl of 1M HOAc were added to the reaction and ethanol precipitated. The RNA probes were stored until use at -20ºC in hybridization solution (10% dextran sulfate, 50% ultrapure deionized formamide, 0.3M NaCl, 10mM Tris-HCl [pH 8.0], 1mM EDTA, 0.02% polyvinylpyrrolidone, 0.02% ficoll, 10mM dithiothreitol, 0.5mg denatured tRNA per ml).
In situ hybridization
Paraffin-embedded sections were de-paraffinized by xylene washes (10min,
2X), followed by rehydration using the following wash sequence: 100% ethanol
(5min, 2X), 95% ethanol (5min, 2X), 75% ethanol (5min, 2X), dH2O (5min, 1X).
Tissues were fixed in 4% paraformaldehyde (freshly made) for 5 minutes, washed for 1 minute in PBS, washed twice in 2X standard saline citrate
(SSC;1X SSC is 0.15M NaCl plus 0.015M sodium citrate) for 5 minutes each, 1 minute in 0.1M triethanolamine [pH 8.0], and blotted dry to remove excess water. The samples were then dunked up and down 10 times in a fresh solution of acetic anhydride (0.5ml acetic anhydride in 200ml 0.1M triethanolamine), incubated in that same solution for 10 minutes, washed in 2X
SSC for 1 minute, and dehydrated with a 30, 50, 70, 85, 95, and 100% ethanol series. The samples were then hybridized with the ATF3 antisense probe (2 x
95 107 dpm/ml) at 55ºC for 16 to 20 hours in a humidified chamber. To remove any nonhybridized single-stranded RNAs, the samples were washed twice in 4X
SSC and then incubated in an RNase A solution (20µg of RNase A per ml,
10mM Tris-HCl [pH 8.0], 1mM EDTA, 0.5M NaCl) for 30 minutes at 37ºC. The samples were then washed twice in 2X SSC for 5 minutes each, once in 1X
SSC for 10 minutes, once in 0.5X SSC for 10 minutes, and once in 0.1X SSC for 30 minutes at 70ºC. The sections were dehydrated as described above with the addition of 0.3M ammonium acetate in the ethanol solutions to prevent the dissociation of the RNA-RNA hybrid and then analyzed by liquid autoradiography, using Kodak NTB-2 emulsion diluted in an equal volume of distilled water according to the manufacturer’s instructions. Each sample was dipped twice into the emulsion and was allowed to dry overnight before being placed into a light-tight container at 4ºC for exposure. After exposure, the slides were developed in the dark room for 2 minutes in Dektol Developer (Kodak), 1 minute in dH2O, 5 minutes in Fixer (Kodak), and rinsed in running distilled water. Samples were counterstained with hematoxylin and eosin as described above. The samples were coverslipped with Gurr (BDH Laboratory Supplies) and photographed using a Zeiss Axiophot microscope under dark-field exposure.
Primary islets and flow cytometric analysis of apoptosis
Mouse islets were isolated with Liberase (Roche) as previously described (Grey et al., 1999) and were treated as indicated with the following: medium (control),
96 IL-1β (20U/ml), IFN-γ (200U/ml), TNF-α (200U/ml), anti-Fas monoclonal
5 antibody Jo-2 (2µg/ml), or 0.625mM GSNO. When indicated, L-N -(1- iminoethyl) ornithine dihydrochloride (L-NIO) was included at 500µM. For
GSNO treatment, NO content in the medium was confirmed by Griess reagent.
At 24 hours after treatment, islets were dispersed, stained with propidium iodide, and analyzed by flow cytometry for apoptosis as described previously
(Grey et al., 1999). Apoptotic cells were scored as cells with a hypodiploid DNA content (<2N). Cell debris and apoptotic cell-free fragments were excluded by discounting the events with an FL-2 area profile below that of chicken erythrocyte nuclei.
RESULTS
Dysfunction in transgenic mice expressing ATF3 in islets
To address the functional significance of ATF3 expression in islets, we took a gain-of-function approach and generated transgenic mice expressing ATF3 under the control of the fragment from kb -2.7 to -1.7 of the PDX-1 promoter
(Fig. 3.2a). This fragment was demonstrated to target transgenes selectively in the developing islets and in β-cells after birth (Gerrish et al., 2000; Wu et al.,
1997). Analysis of transgene expression revealed that ATF3 was expressed beginning at embryonic day e13.5 in insulin-precursor cells associated with the ductal epithelia (Fig. 3.2b). Previously, it was reported that transgenic mice expressing ATF3 under control of the transthyretin promoter have defects in glucose homeostasis (Allen-Jennings et al., 2001). However, the transthyretin
97 promoter fragment directed the expression of ATF3 in both the liver and pancreatic ductal epithelium. Therefore, it was not possible to ascertain the impact of ATF3 expression in islets. Using the PDX-ATF3 construct, we obtained five transgenic founders which did not express the transgene
(presumably due to mosaicism or silencing), but could pass it on to the progeny.
F1 mice from all five founders expressed the transgene and died before mating.
Therefore, no transgenic lines were established and all results were derived from the analysis of F1 mice. Three founders gave rise to litters of small size and low transgenic transmission rate (much lower than the expected 50% rate).
The remaining two founders gave rise to the expected transgenic transmission rate (approximately 50%) and their progeny were further analyzed. F1 mice
(PDX-ATF3) from founder 1 died within several days after birth and displayed islets with reduced size (Fig. 3.3a). Analyses of islet population indicated a shift in size distribution toward smaller islets in the transgenic mice (Fig. 3.3b).
Additional quantitation revealed decreased number of isets per given area (Fig.
3.2c) and decreased area per given islet (Fig. 3.3d) in the transgenic mice.
Immunofluorescence analysis indicated abnormal distribution of hormone- positive cells in transgenic pancreata (Fig. 3.3e). Transgenic pancreata had fewer insulin-positive cells (green) than non-transgenic pancreata.
Furthermore, glucagon-positive cells (red) in transgenic pancreata formed clusters with insulin-positive cells but failed to form the proper mantle/core arrangement of the α/β cells as in the non-transgenic pancreata (glucagon- positive α cells at the periphery of the islets and insulin-positive β cells at the
98 core). These transgenic mice had low body weight, and defects consistent with
β-cell deficiency (transgenic versus nontransgenic, P < 0.001): high glucose, low insulin, high β-hydroxybutyrate, and high triglyceride (Table 3.1). Due to starvation conditions in these mice, triglycerides are mobilized to the liver where they are converted to glycerol and fatty acids. Fatty acid oxidation in the liver produces large amounts of acetoacetate and β-hydroxybutyrate (ketone bodies), which become the major source of fuel for the brain (Table 3.1). Due to the small size of the mice, sera from three to four mice were combined as one sample for analyses, and at least four samples were used to generate the data. Analysis of glucagon did not show statistically significant differences between transgenic and nontransgenic mice (Table 3.1), although the levels were consistently higher in the transgenic mice. F1 mice from founder 2 displayed less severe phenotypes. Although the precise reasons are not clear, variation in the severity of phenotypes among different transgenic founder lines is a common phenomenon. Islets from progeny of founder 2 were not greatly reduced in size or number, but displayed abnormal morphology with rough surface. Many of these mice died before 1 week and none survived to adulthood.
Decreased numbers of insulin-producing cells in the transgenic mouse pancreas could be the result of decreased rates of β-cell proliferation or increased levels of β-cell apoptosis. Adenoviral infection of INS 832/13 cells revealed that ATF3 expression is sufficient to induce apoptosis in this β-cell line. However, no caspase-3 cleavage was observed following infection of cells
99 with a control β-gal virus, indicating that cell death was specific to ATF3 expression (Fig. 3.4a). Immunohistochemical staining for the activated
(cleaved) form of caspase-3, utilized as a marker for apoptosis, revealed more active caspase-3 positive cells in the transgenic mouse pancreas (Fig. 3.4b).
Thus, ectopic expression of ATF3 appears to be sufficient to induce apoptosis in pancreatic β-cells and this result is consistent with the finding that ATF3 overexpression in HeLa cells accelerated drug-induced caspase protease activation (Mashima et al., 2001).
In the PDX transgenic mice, ectopic ATF3 expression was detected as early as embryonic day e13.5 in the mouse pancreas primordium. Next, we wanted to examine whether endogenous ATF3 could be induced in the embryonic stage in order to determine the physiological relevance of our mouse model.
Treatment of e12.5 mouse embryos under low oxygen conditions (60% O2,
2hrs) or low oxygen followed by re-oxygenation (60%, 2hrs; 95% O2, 1hr) resulted in increased ATF3 mRNA levels as measured by RT-PCR (Fig. 3.5a).
In addition, in situ hybridization revealed increased steady-state ATF3 mRNA levels throughout the embryo following low oxygen treatment (Fig. 3.5b). Thus, endogenous ATF3 mRNA levels were induced in mouse embryos using this low oxygen stress model.
100
Figure 3.2: Generation of PDX-ATF3 transgenic mice. (a) Schematic of the transgenic construct. (b) Analysis of transgene expression. ATF3 immunohistochemisty was performed using mouse paraffin-embedded sections collected at embryonic day 14.5 (e14.5).
101
Figure 3.3: PDX-ATF3 mice have small and abnormal islets. Pancreatic sections of non-transgenic or transgenic mice were stained with H&E (a) and analyzed for size distribution of their islets (b), islet number per given area (c), and average area per islet (d) (x axis, 1=1,000 pixel units). For H&E stain, multiple sections from more than five mice in each group were analyzed and representative figures are shown. The green line delineates one islet from each group. For size analysis, 200 islets from three non-transgenic and 50 islets from three transgenic mice were analyzed. (e) Pancreatic sections from non- transgenic (upper panel) or transgenic (lower panel) mice were analyzed by immunofluorescence using insulin (green) and glucagon (red) antibodies.
102
Table 3.1: Metabolic analysis of PDX-ATF3 transgenic mice. Non- transgenic or transgenic mice at postnatal day 1 to 3 were sacrificed. Body weight, blood glucose level, and levels of insulin, glucagon, triglyceride (TG), or β-hydroxybutyrate (β-OH-buty) were analyzed. Data represented are based on four samples, with each sample containing combined sera from three to four mice. Schematic of beta oxidation and ketone body production during starvation or diabetic conditions.
103
Figure 3.4: ATF3 expression promotes activation (cleavage) of caspase-3. (a) INS-r3 cells were infected with either a β-Gal or tetracycline-responsive ATF3 adenovirus at the indicated MOI and whole cell extracts were prepared 36 h post-transfection. Levels of ATF3 and cleaved caspase-3 were analyzed by immunoblotting. (b) Active caspase-3 immunohistochemistry was performed using mouse paraffin embedded sections collected on postnatal day P1.
104
a.
b.
Figure 3.5: ATF3 is induced in the developing embryo by hypoxia or hypoxia/reoxygenation. Embryos were removed from pregnant female at e12.5 and placed under either normoxic conditions (95% O2), hypoxic conditions (60% O2), or hypoxia/reoxygenation (60% O2, 95% O2). (a) Examination of ATF3 expression by RT-PCR analysis. (b) Examination of ATF3 expression by in situ hybridization.
105
Islets deficient in ATF3 are partially protected from cytokine- or NO- induced apoptosis
To investigate the functional significance of ATF3, mice deficient in ATF3 were generated. The mutant allele lacks exon B, which contains the AUG initiation codon, and homozygous knockout mice (ATF3-/-) did not produce any
ATF3 protein in the liver after intraperitoneal injection of LPS (data not shown).
The ATF3-/- mice have no lethality or obvious phenotypes, consistent with the notion that ATF3 is a stress-inducible gene and is not required under normal conditions. To determine whether ATF3 plays a role in stress-induced β-cell apoptosis, levels of cytokine-induced apoptosis were compared between primary islets isolated from ATF3+/+ and ATF3-/- mice. Islets were treated with cytokines and apoptosis was measured 24 hours later by propidium iodide stain followed by flow cytometry. Results from five experiments indicated that ATF3-/- islets were partially protected from two-cytokine (IL-1β+IFN-γ)-induced apoptosis (P < 0.05) but were only marginally protected (not statistically significant) from three-cytokine (IL-1β+IFN-γ+TNF-α)- or two-cytokine plus Fas- induced apoptosis (Fig. 3.6b).
As presented in chapter 2, the NF-κB and JNK/SAPK pathways play an important role in the induction of ATF3 by IL-1β. Overwhelming evidence in the literature indicates that these pathways mediate cytokine-induced expression of iNOS (Eizirik and Mandrup-Poulsen, 2001; Grey et al., 1999). Induction of iNOS leads to NO production, and NO donor GSNO is widely used to mimic the
106 action of iNOS. We found that GSNO induced ATF3 in both INS832/13 β cells
(Fig. 3.7a) and primary islets (Fig. 3.7b). Interestingly, ATF3-/- islets were partially protected (P < 0.01) from GSNO-induced apoptosis (Fig. 3.7c). That is,
NO in the absence of ATF3 (ATF3-/- background) fails to elicit efficient killing, suggesting that the induction of ATF3 by NO plays a role in NO-induced β-cell apoptosis. Previously, iNOS-/- islets (ATF3+/+) were shown to be partially protected from cytokine-induced apoptosis (Liu et al., 2000), indicating that induction of ATF3 in the absence of iNOS fails to elicit efficient killing. Taken together, these observations suggest that induction of both ATF3 and iNOS is necessary for stress signals to elicit efficient β-cell killing. Consistent with this interpretation, iNOS inhibitor L-NIO further decreased two-cytokine-induced apoptosis in ATF3-/- islets (Fig. 3.7d).
107
Figure 3.6: Islets deficient in ATF3 are partially protected from cytokine- induced apoptosis. (a) Schematic of the ATF3 knockout construct. Insertion of neomycin resistance gene by homologous recombination disrupts exon B which contains the ATG start codon. (b) (right panel) Primary islets from wild type (WT) or ATF3 knockout (KO) mice were treated with medium (as a control), IL-1β+IFN-γ (2 Cyto.), IL-1β+IFN-γ+TNF-α (3 Cyto.), or IL-1β+IFN- γ+Jo2 (2 Cyto.+Fas), and assayed for apoptosis at 24 h after treatment. Mean +/- SE of percentage increase in apoptosis from five experiments are shown (right panel).
108
Figure 3.7: Islets deficient in ATF3 are partially protected from NO- induced apoptosis. (a) INS832/13 cells were treated with increasing amounts of GSNO (0.05 mM, lane 4; 0.1 mM, lane 5; 0.5 mM, lane 6) for 2 h or were left untreated (medium control, lane 3) and then were assayed by immunoblot for ATF3 or ERK. Lanes 1 and 2 are extracts from liver treated (+) or untreated (-) with LPS for 4 h. (b) Primary islets from wild-type mice were treated with 0.625 mM GSNO for the indicated periods and assayed by immunoblot for ATF3 or actin. (c and d) Primary islets from wild-type (WT) or ATF3 knockout (KO) mice were treated with 0.625 mM GSNO, or treated with IL-1β+IFN-γ (2 Cyto.) in the absence (-) or presence (+) of the iNOS inhibitor L-NIO, and assayed for apoptosis at 24 h after treatment.
109 DISCUSSION
Analysis of PDX-ATF3 Transgenic Mice
Results presented in this data chapter demonstrate that ectopic expression of ATF3 in insulin-producing cells leads to detrimental outcomes including decreased islet area, decreased serum insulin levels, elevated blood glucose and ketone bodies. ATF3 expressing mice had reduced body weight compared to nontransgenic littermates and died shortly after birth. Analysis of timing and location of transgene expression revealed ATF3 protein accumulation beginning at embryonic day e13.5 in cells adjacent to the ductal epithelia. Thus, the 1.0- kb PDX enhancer fragment used in these mice directs transgene expression to newly differentiated endocrine (insulin) cells branching off from the ducts and we are analyzing the effects of ATF3 expression in β-cells during pancreas development (before intact islets have formed). In the human context, death is a common feature to both type 1 and type 2 diabetes and the disease- promoting stress signals trigger insulin cell death after intact, glucose-sensing islets have formed (post-development). Therefore, generation of inducible-
ATF3 transgenic mice would more closely mimic the physiological stress response associated with diabetes onset. Transgene expression could be turned on in the adult mouse (once intact islets have formed) and transgene expression levels could be regulated to recapitulate the endogenous situation.
Generation of PDX-ATF3 transgenic mice yielded several founders that displayed varying severities of phenotypes. At this point it is unclear whether differences in diabetic phenotypes between founders were due to differences in
110 transgene expression levels. Transgene expression was detected by immunohistochemical staining of mouse pancreas sections; however, this is not a quantitative assay and no obvious differences were observed between founders using this method. Western blot analysis represents a quantitative method to measure transgene levels; however, the percentage of transgene expressing cells is very low and the signal would be diluted out by the vast majority of non-expressing cells. The observation that several different founder lines displayed similar diabetic phenotypes indicates that the results were not due to non-specific effects of transgene integration site. In support of this notion, similar diabetic phenotypes have been observed following pancreatic expression of ATF3 using three different transgenic constructs (TTR-, PDX-,
RIP- [chpt. 4]). Nuclear accumulation of ATF3 was observed by immunohistochemistry using pancreas sections from all three types of transgenic mice. In contrast to this observation, ATF3 accumulation appeared to be concentrated in the cytoplasm of insulin-positive cells from NOD or human patient tissues. The possibility exists that ATF3 may play several different functional roles based on its subcellular localization.
Data presented in this chapter suggests that expression of ATF3 in β-cells is sufficient to induce apoptosis both in vitro (adenovirus infection of INS cell line) and in vivo (PDX-ATF3 transgenic mice). Previous analysis of the TTR-ATF3 mice revealed decreased phospho-histone H3-positive cells associated with the ductal epithelium, suggesting that ATF3 may play a role in regulating cell cycle progression. In support of this dual functionality of ATF3, Dr. Curt Wolfgang
111 previously created a tetracycline-inducible stable cell line using HeLa cells.
Upon induction of ATF3 in these cells, he observed apoptosis as measured by several assays including DNA laddering, TUNEL, PI + AnnexinV staining
(unpublished results). However, after several passages, induction of ATF3 expression was sufficient to cause >90% of cells to arrest in the G1 phase of the cell cycle. Combined with its published role as a metastasis-promoting factor, ATF3 mimics the function of the well-characterized TGF-β pathway which can promote apoptosis, cell cycle arrest, or metastasis when activated under various conditions or cell types.
Embryo Stress Model
In order to test whether ATF3 could be induced in the mouse embryo during development, e12.5 embryos were removed from the mother and placed under hypoxia (low oxygen) conditions or hypoxia coupled with re-oxygenation. The cellular response to hypoxia has been well-characterized and involves an increase in glucose uptake and glycolysis, increased oxygen transport by promoting red blood cell maturation/angiogenesis, and upregulation of pro- survival genes (Bruick, 2003). Many of these cellular responses to low oxygen conditions are carried out by the bHLH-containing Hypoxia-Inducible Factor
(HIF) transcription factor which binds to hypoxia responsive elements (HREs) within target gene promoters (Wenger, 2002; Wang and Semenza, 1995). The novel finding that ATF3 can be induced throughout the entire mouse embryo by hypoxia suggests a potential role for ATF3 in the onset of stress-induced
112 developmental diseases. However, embryonic induction of endogenous ATF3 by diabetic promoting stress signals in pancreatic β-cells has not been demonstrated.
Analysis of ATF3-deficient islets
Since β-cell apoptosis plays an important role in the pathophysiological progression of diabetes, our results support the speculation that stress-induced expression of ATF3 plays a role in diabetes. However, much more work is required to substantiate this speculation. In an attempt to test the potential role of ATF3 in diabetes, we analyzed wild type and ATF3 knockout mice using the multiple low-dose streptozotocin model , where insulitis and hyperglycemia are induced in male mice in an accelerated manner (over a 2-week period) following five daily injections of low dose STZ (Like and Rossini, 1976).
Importantly, previous studies have demonstrated an autoimmune component in this diabetes model (Herold et al., 1997). Preliminary results from analysis of
20 mice in each group showed no significant difference in the blood glucose levels of ATF3 knockout mice from that of wild-type mice (data not shown). We suggest two potential explanations for this result. First, knockout of one stress- inducible gene, ATF3, is not sufficient to protect islets from the level of insults induced by STZ. As described above, ATF3 knockout does not provide significant protection from apoptosis when TNF-α or Fas pathway was activated. Since apoptosis is regulated by complex cellular processes that involve many cross-interacting pathways and genes, it is reasonable that
113 knockout of ATF3 alone is not sufficient for full protection. Second, ATF3 knockout mice may be partially protected from STZ-induced insults but the protection is not discernible by measuring the blood glucose levels. Thus, more work including detailed histological analysis is necessary for definitive conclusion.
On the basis of our observations and reports on iNOS in the literature, we propose the following model. Expression of ATF3 and iNOS genes is induced by cytokines, at least in part, through the NF-κB and JNK/SAPK signaling pathways. The induction of iNOS leads to NO production, which in turn further induces ATF3 gene expression. This supposition is supported by a recent observation that iNOS inhibitor reduced cytokine-induced ATF3 expression in
INS-1 β cells at late time points (>8 h) but not at the early time points (Kutlu et al., 2003). Since elimination of either ATF3 or iNOS reduced cytokine-induced apoptosis, it appears that induction of both genes is necessary for efficient β- cell death.
As shown in the results, ATF3 knockout islets were protected from 2 cytokine (IL-1β+IFN-γ)-induced apoptosis, but not three-cytokine or two- cytokine-plus-Fas-induced apoptosis. One element common to Fas and TNF-α is the activation of the death receptor pathway: the FADD-caspase 8 pathway
(Baud and Karin, 2001; Chen and Goeddel, 2002). Therefore, our results suggest that ATF3 plays a role for IL-1β+IFN-γ-induced apoptosis but may not play a significant role in the death-receptor pathway. We note that NO was
114 reported to mediate cell death in β-cells via a pathway distinct from Fas- mediated pathway (Zumsteg et al., 2000).
Recently, gadd153/CHOP knockout islets were demonstrated to be partially protected from NO-induced cell death, a result similar to that from the ATF3 knockout islets (Oyadomari et al., 2001). Previously, it was demonstrated that gadd153/CHOP is an ATF3-interacting protein and its corresponding gene may be a downstream target of ATF3 (Chen et al., 1996; Wolfgang et al., 1997).
Therefore, ATF3 may affect the ability of NO to modulate the cell death machinery either directly or indirectly, through the interaction with other proteins or the regulation of downstream genes. We note that both ATF3 and gadd153/CHOP are induced by endoplasmic reticulum (ER) stress.
Significantly, deletion of the gadd153/CHOP gene has been demonstrated to delay the onset of diabetes in Akita mice, a model where diabetes is thought to be induced by ER stress (Oyadomari et al., 2002). Therefore, it would be interesting to see whether the deletion of ATF3 also protects β-cells from ER stress-induced apoptosis and delays the onset of diabetes in Akita mice.
ACKNOWLEDGMENTS
I would like to thank Jan Parker-Thornberg (OSU Keck mouse facility) for transgenic injection of the PDX-ATF3 construct and initial ear and tail clips. I would also like to thank the OSU Veterinary Histology lab for preparation of paraffin-embedded pancreas or embryo sections. In addition, I would like to thank Dr. Donna Chicarachi at Duke University for preparation of embryo stress
115 model samples, Dr. David Ron at NYU School of Medicine for generation of the
ATF3-deficient mice, and Dr. Shane Grey at the Garvan Institute, Darlinghurst,
Australia for isolation and treatment of ATF3-deficient islets.
116 CHAPTER 4
EXAMINATION OF POTENTIAL CROSS-TALK AND FUNCTIONAL
INTERACTION BETWEEN ATF3 AND AKT IN β-CELLS
SUMMARY
The Akt serine/threonine kinase is a well-known pro-survival gene that has recently been shown to protect purified islets from cytokine-mediated apoptosis
(Aikin et al., 2004). The anti-apoptotic effects of Akt mainly occur through its ability to prevent activation of the intrinsic cell death pathway by blocking release of cytochrome c from the mitochondria. Work presented in this chapter examines the potential interaction between Akt and ATF3 in pancreatic β-cells, at the level of both signal transduction and β-cell viability. Results demonstrate the ability of Akt to inhibit c-jun phosphorylation and ATF3 upregulation, presumably by its ability to block JNK/SAPK activation. Insight into the mechanism of ATF3-mediated β-cell apoptosis has revealed that ATF3 expression is sufficient to promote caspase-9 activation, suggesting that both
ATF3 and Akt regulate cell viability in a reciprocal manner by converging on the intrinsic death pathway. Indeed, inhibition of ATF3 induction by Akt may represent a novel mechanism whereby Akt mediates cell survival. Support for
117 this hypothesis comes from the finding that ATF3 expression in β-cells reverses the hyperinsulinemic phenotype of the constitutively-active Akt transgenic mice.
INTRODUCTION
Akt isoforms and domain structure
Protein kinase Bα (PKBα/Akt1) was initially identified by homology cloning based on the similarity between its kinase domain with that found in protein kinase A (PKA) and protein kinase C (PKC) (Jones et al., 1991). Soon after this initial characterization, two additional PKB/Akt family members were identified and termed PKBβ/Akt2 and PKBγ/Akt3 (Cheng et al., 1992; Brodbeck et al.,
1999). The PKB/Akt family of kinases has been conserved throughout evolution and homologs have been identified in most eukaryotes (except yeast).
The amino acid identity between c. elegans and human PKB/Akt is around
60%, whereas that between mouse, rat, and human is more than 95%.
All three PKB/Akt family members contain the same highly conserved domains: an amino terminal pleckstrin homology (PH) domain, a central kinase domain, and a carboxyl-terminal regulatory domain containing a hydrophobic motif. The PH domain of PKB/Akt binds membrane-associated lipids, such as phosphatidylinositol (3,4,5) trisphosphate and is responsible for recruitment of
Akt to the plasma membrane (James et al., 1996). PH domain point mutations within residues responsible for lipid binding disrupt both PKB/Akt membrane translocation and phosphorylation by activating kinases. The kinase domain of
PKB/Akt is located within the central region of the protein and this domain
118 shares sequence similarity to the kinase domains of PKA, PKC, p70S6K, and p90RSK (Peterson and Schreiber, 1999). All three PKB/Akt family members contain an approximately 40 amino acid c-terminal extension which consists of a hydrophobic regulatory motif (FPQFSY). Phosphorylation of the serine residue within this motif is required for full kinase activation, as deletion of this motif abolished enzymatic activity (Andjelkovic et al., 1997) (Fig. 4.1).
Figure 4.1: Domain structure of Akt isoforms (a) and AGC kinases (b). All the Akt isoforms and AGC kinases possess the kinase domain in the central region of the molecule. The PH (pleckstrin homology) and PX (phox) domains act as phosphoinositide-binding modules. The hydrophobic motif (HM) is located at the carboxyl-terminal adjacent to the kinase domain. Phosphorylation sites in the activation loop in the kinase domain and the hydrophobic motif are indicated. SGK, serum and glucocorticoid induced protein kinase; AID, autoinhibitory domain; C1, phorbol esters/diacylglycerol binding domain; C2, calcium-dependent membrane targeting domain. (Hanada et al., 2003)
119 Regulation of Akt activation
Activation of Akt occurs through a multi-step process involving the concerted action of several regulatory events such as subcellular re-localization, protein modification, and protein-protein interactions. Several studies have demonstrated that Akt is activated following stimulation of receptor tyrosine kinases (RTKs) such as PDGF-R, insulin receptor, EGF-R, bFGF-R, and that this activation is dependent upon PI3-kinase function (Burgering and Coffer,
1995). The PI3-kinase classes of enzymes are heterodimeric proteins composed of a p110 catalytic subunit and a p85 regulatory subunit. The p85 regulatory subunit contains several Src homology 2 (SH2) domains which target
PI3-kinase to the plasma membrane through their ability to associate with phosphorylated tyrosine residues on RTKs. Once associated with the plasma membrane, the p110 catalytic subunit functions to phosphorylate phosphoinositol substrates. Increased levels of PIP3 result in the recruitment of
Akt to the plasma membrane through the interaction of phosphoinositides with the PH domain of Akt. The PTEN phosphatase has been shown to act as a negative regulator of Akt activation based on its ability to de-phosphorylate phosphoinositides (Maehama and Dixon, 1998; Stambolic et al., 1998).
Once anchored to the plasma membrane, Akt undergoes several phosphorylation modifications which are required for complete activation.
Ser124 and Thr450 are constitutively phosphorylated and seem to contribute to the stabilization of Akt protein. However, phosphorylation of residues Thr308 and Ser473 greatly increases upon RTK stimulation and this effect could be
120 blocked by treatment with the PI3-kinase inhibitor wortmannin (Alessi et al.,
1996). PDK1 was subsequently identified as the kinase responsible for phosphorylation of Akt at Thr308. PDK1 is associated with the plasma membrane through its PH domain and deletion of PDK1 in ES cells resulted in abolishment of Akt activation (Williams et al., 2000). Identification of the kinase responsible for Ser473 phosphorylation has produced controversial results, and recent observations suggest that phosphorylation of this site may be due to auto-phosphorylation by Akt itself (Toker and Newton, 2000).
Recently, protein-protein interactions have been shown to play a role in regulating the activation of Akt. CTMP was identified as an Akt binding partner in a yeast two-hybrid screen using the carboxyl-terminal of Akt as bait (Maira et al., 2001). CTMP physically interacts with Akt at the plasma membrane and stimulation with IGF-1 caused the dissociation of these proteins. In addition, overexpression of CTMP prevented phosphorylation of both Thr308 and Ser473 following IGF-1 treatment. Thus, it appears that CTMP keeps Akt in an inactive
(unphosphorylated) state through physical protein-protein interaction (Fig. 4.2).
121
Figure 4.2: Schematic representation of Akt activation. Oligomerization and activation of receptor tyrosine kinase (RTK) by its ligand activates phosphatidylinositol 3-kinase (PI3-kinase) to produce phosphatidylinositol 3,4,5 trisphosphate (PIP3). PIP3 organizes Akt, PDK1 and, probably, Ser473-kinase on the plasma membrane, where Akt becomes phosphorylated and activated. Activated Akt then translocates from the cytosol to the nucleus. PTEN phosphatase downregulates Akt signaling through its ability to dephosphorylate lipid molecules required for activation. (Hanada et al, 2003)
Physiological functions of Akt
Activated Akt has been demonstrated to affect several different cellular processes including metabolism, apoptosis, cellular proliferation and cell size
(Fig. 4.3). Following its activation, Akt functions to regulate cellular metabolism through several different mechanisms. First, Akt has been shown to regulate glycogen production through its ability to phosphorylate glycogen synthase kinase 3 (GSK3α and β). Both isoforms of GSK3 contain consensus phosphorylation sites on their amino terminus and they are phosphorylated and
122 inactivated by Akt, thereby allowing glycogen synthase to function (Burgering and Coffer, 1995). Second, Akt has been shown to phosphorylate phosphodiesterase 3B (PDE3B) on Ser273. This phosphorylation triggers
PDE3B enzymatic activation which is responsible for regulating intracellular levels of cyclic nucleotides, such as cAMP and cGMP in response to insulin
(Kitamura et al., 1999). Third, Akt promotes glycolysis due to its ability to directly phosphorylate the cardiac-specific isoform of 6-phosphofructo-2-kinase on Ser466 (Deprez et al., 1997). Fourth, Akt has been shown to directly phosphorylate mTOR, an important regulator of mRNA translation in response to nutrients (Schmelzle and Hall, 2000). Finally, Akt initiates a positive feedback response on the insulin signal transduction pathway by phosphorylating and inhibiting protein tyrosine phosphatase 1B (PTP1B).
PTP1B normally down-regulates insulin signaling by de-phosphorylating the insulin receptor (Ravichandran et al., 2001).
Apoptosis
Research conducted over the past several years suggests that a major physiological function of Akt is to attenuate activation of the intrinsic apoptosis pathway. Death stimuli targeting the intrinsic apoptosis pathway results in a conformational change of the Bcl-2 family proteins, Bax and Bak. This conformational change targets these proteins to the mitochondrial membrane where they promote the release of cytochrome c. Following its release, cytochrome c interacts with Apaf-1, dATP and caspase-9 to form the
123 apoptosome which can go on to activate effector caspases such as caspase-3.
The earliest step at which Akt acts to inhibit apoptosis through the intrinsic pathway is by blocking the stress-induced change in conformation of Bax and
Bak (Yamaguchi and Wang, 2001). By disrupting this conformational change,
Akt prevents mitochondrial release of cytochrome c. In addition, Akt directly phosphorylates BAD (Bcl-2/Bcl-X antagonist) on Ser136. BAD promotes apoptosis by binding to Bcl-2 and Bcl-X, thereby blocking their ability to inhibit mitochondrial release of cytochrome c. Following phosphorylation by Akt, BAD dissociates from Bcl-2 and Bcl-X at the mitochondria and forms a complex with
14-3-3 in the cytosol (Datta et al., 1997). In addition, Akt prevents apoptosis through its ability to directly regulate caspase activation. Akt has been shown to directly phosphorylate pro-caspase-9 on Ser196 and this modification inhibits caspase-9 cleavage following cytochrome c release (Cardone et al., 1998).
Transcription factors
Several well-characterized Akt substrates function as transcription factors, hence, Akt may block cell death by interfering with the apoptotic transcriptional program. In support of this notion, Akt has been shown to phosphorylate the three members of the FoxO subfamily of Forkhead transcription factors (FoxO1,
FoxO3, and FoxO4) (Biggs, III et al., 1999). Phosphorylation of FoxO proteins on three distinct regulatory sites results in their nuclear exclusion through binding to 14-3-3 proteins in the cytosol. Several key FoxO target genes that contribute to cellular apoptosis have been identified. FoxO induces expression
124 of FasL in neurons following growth factor withdrawal and FasL induces apoptosis of surrounding cells by activating the death receptor Fas (Brunet et al., 1999). FoxO also up-regulates expression of the pro-apoptotic BH3 only protein Bim in hematopoietic cells and this event contributes to growth factor withdrawal induced apoptosis (Dijkers et al., 2000).
Akt also inhibits programmed cell death through its ability to interfere with the p53 transcriptional response. Mdm2 is an E3 ubiquitin ligase that directly interacts with p53 and negatively regulates its protein stability and function. Akt has been reported to bind and phosphorylate Mdm2 on two residues, Ser166 and Ser186, resulting in up-regulation of its ubiquitin ligase activity and increased nuclear translocation (Mayo and Donner, 2001). Thus, Akt could protect cells from p53-mediated apoptosis by blocking its transcriptional response through ubiquitination and degradation.
In addition to inhibiting the function of pro-apoptotic transcription factors, Akt has been reported to activate several proteins involved in the anti-apoptotic transcriptional response. For example, Akt can phosphorylate and activate IKK, which results in degradation of IκB and activation of the pro-survival factor
NFκB (Kane et al., 1999). NFκB promotes survival by up-regulating expression of anti-apoptotic genes, such as IAPs and Bcl-XL. Also, phosphorylation of the cyclic AMP-response element binding protein (CREB) by Akt on Ser133 results in transcriptional activation through increased affinity for co-activators (Du and
Montminy, 1998). Activated CREB promotes survival by inducing expression of
Bcl-2 and the neurotrophin BDNF.
125 Cell cycle regulators
Several reports suggest that activated Akt influences cell cycle progression by phosphorylating key substrates involved in the control of cellular proliferation. p21 is a direct p53-target gene that functions to halt cell cycle progression by inhibiting activation of the cyclin/CDK complexes required for proliferation (Coqueret, 2003). Akt has been reported by several groups to directly phosphorylate p21 on Thr145; however, the functional significance of this modification remains controversial. Zhou et al. published that p21 phosphorylation by Akt inhibits nuclear localization of p21, thus allowing for the activation of cyclin/CDK complexes (Zhou et al., 2001). Rossig et al. did not detect any effects on subcellular localization; however, they reported that
Thr145 phosphorylation decreases the binding affinity between p21 and CDK2 or CDK4 (Rossig et al., 2001). p27/kip1 represents another member of the class of CDK inhibitors (CKI) that is a direct substrate of Akt kinase activity.
Several groups have demonstrated that Akt phosphorylates p27 on Thr157 in breast cancer cells. This residue is located within the nuclear localization sequence, and phosphorylation by Akt results in p27 cytoplasmic retention
(Viglietto et al., 2002; Liang et al., 2002; Shin et al., 2002). Indeed, the positive influence that Akt exerts on cell cycle progression makes it an intriguing target for cancer therapies (Nicholson and Anderson, 2002).
126
Figure 4.3: Physiological functions of Akt. Upon activation, Akt regulates a diverse array of biological processes including cell survival, cell cycle progression, glucose metabolism, protein synthesis, and cell size. Many of these downstream effects of Akt occur through direct phosphorylation of protein substrates. (Cell Signaling, Inc.)
127 Regulation of JNK and p38 activation
Recent observations suggest that regulation of the stress-activated protein kinase (SAPK) pathway may be an important mechanism whereby Akt promotes cell survival. The SAPK pathway consists of both the JNK and p38
MAPK and a wealth of data suggests that their activation contributes to cellular apoptosis (Johnson and Lapadat, 2002). Akt has been shown to inhibit activation of this pathway by several different mechanisms. Apoptosis signal- regulating kinase 1 (ASK-1) is an upstream MAPKKK that is involved in JNK and p38 activation during the stress response (Fig. 4.4). Phosphorylation of
ASK-1 by Akt on Ser83 inhibits activation of the SAPK pathway and blocks
ASK-1 induced apoptosis (Kim et al., 2001a). Akt has also been shown to phosphorylate and inhibit mixed lineage kinase 3 (MLK3), which is another upstream MAPKKK involved in JNK and p38 activation (Barthwal et al., 2003).
In addition, Akt has been shown to inhibit JNK activation through mechanisms independent of its kinase activity. JNK interacting protein (JIP1) serves as a molecular scaffold to bring together JNK and its upstream activating MAP kinases. Kim et al. have found that Akt physically interacts with JIP1, thereby displacing the MLK3 kinase without affecting the affinity of JIP1 for JNK or
MKK7 (Kim et al., 2002). Based on these reports, Akt appears to play a role in regulating stress-induced apoptosis by blocking the SAPK pathway through a variety of mechanisms. Recently, Aikin et al. demonstrated that Akt prevents stress-induced JNK activation and apoptosis in purified islets, suggesting that this mechanism holds true in pancreatic β-cells (Aikin et al., 2004).
128
Figure 4.4: Schematic representation of JNK/SAPK activation. Stress- activated protein kinases (JNK) are members of the MAPK family and are activated by a variety of environmental stresses, inflammatory cytokines, growth factors, and GPCR agonists. Stress signals are delivered to this cascade by members of small GTPases of the Rho family. As with the other MAPKs, the membrane proximal kinase is a MAPKKK or a member of the mixed lineage kinases (MLK) that phosphorylates and activates MKK4 or MKK7, the SAPK/JNK kinases. SAPK/JNK translocates to the nucleus where it regulates the activity of several transcription factors such as c-Jun, ATF-2, and p53. (Cell Signaling, Inc.)
129 Akt function in pancreatic β-cells
Recently Tuttle et al. examined the function of Akt in pancreatic β-cells by generating transgenic mice expressing a constitutively-active form of Akt specifically in β-cells (Tuttle et al., 2001). Pancreata from transgenic mice displayed increased β-cell mass (area) compared to nontransgenic littermates and the size of each individual β-cell appeared larger in the myr-Akt mice.
Analysis of the metabolic effects of the Akt transgene revealed increased serum insulin levels in the transgenic mice accompanied by a slight fasting and fed hypoglycemia. Pancreata from transgenic mice displayed increased insulin secretion in response to glucose overload and myr-Akt transgenic mice showed enhanced glucose clearance ability during glucose tolerance tests. In addition, myr-Akt expression prevented streptozotocin (STZ)-induced β-cell death and diabetes in the multiple low-dose STZ model.
Results presented in chapter 2 and chapter 3 demonstrate that ATF3 is induced during the stress response in pancreatic β-cells and that ATF3 expression is required for optimal β-cell killing by pro-inflammatory cytokines
(Hartman et al., 2004). In light of the known effect of Akt regarding inhibition of
SAPK pathway activation, we hypothesized that Akt may block ATF3 induction following cytokine treatment through inhibition of JNK activation. Several lines of evidence presented in this chapter suggest that activated Akt attenuates
ATF3 induction during the stress response and this effect is partly mediated at the transcriptional level. The finding that ATF3 expression is sufficient to promote caspase-9 cleavage suggests that the mechanism of ATF3-mediated
130 cell death may overlap with known anti-apoptotic functions of Akt. Expression of ATF3 reversed the hypoglycemic/hyperinsulinemic phenotype observed in the myrAkt transgenic mice, suggesting that ATF3 expression is sufficient to override the anti-apoptotic effects of Akt. Indeed, inhibition of ATF3 expression during the stress response may represent a novel mechanism whereby Akt mediates cell survival.
MATERIALS AND METHODS
Cell Culture and Treatments
INS-r3 cells were cultured as previously described (see chapter 2 methods).
For ATF3 induction experiments, cells were split out at 3x106 cells/6cm dish and allowed to attach overnight. The following day, cell media was changed to low glucose (5mM RPMI) approximately 24 hours before treatments. Cells were pre-treated with insulin for 30 minutes in low glucose media at the indicated concentrations followed by treatment with IL-1β (200U/ml) for 1 hour. Nuclear extracts were prepared as previously described (see chapter 2 methods). For samples containing the LY drug, cells were treated with either LY drug (25µM) or vehicle control (DMSO) 15 minutes prior to addition of insulin. Min-6 cells were cultured in DMEM medium containing 25mM glucose, 10% heat- inactivated FBS, penicillin/streptomycin, and 50µM β-mercaptoethanol. Min-6 cells were treated with IL-1β+IFN-γ (200U/ml each) for 3 hours during ortho- phosphate labeling experiments. Wild-type mouse embryonic fibroblasts
(MEFs) were grown in DMEM containing 5mM glucose, 10% FBS,
131 penicillin/streptomycin, 2mM L-glutamine, 0.1mM non-essential amino acids, and 55µM β-mercaptoethanol. For UV treatment, media was aspirated off and cells were placed into UV cross-linker and exposed to a dose of 50J/m2 UV.
Adenovirus Infection and Immunoblotting
INS-r3 cells were seeded at 3x106 cells/6cm plate approximately 24 hours before infection. Cells were infected with GFP-alone virus vs. GFP-myrAkt virus in low glucose (5mM) RPMI media at the indicated MOI and infection was allowed to proceed overnight (approximately 12-16 hours). The following day, cells were either left untreated or were treated with cytokines (IL-1β+TNF-α;
200U/ml each) for 6 hours. Cells were harvested and whole-cell extracts were generated by RIPA lysis and 150µg of protein extract was resolved by SDS-
PAGE. Immunoblotting was carried out as previously described using the following primary antibody conditions: rabbit-anti-ATF3 (Santa Cruz; 1:1,000), rabbit-anti-phospho-c-Jun (Cell Signaling; 1:1,000), rabbit-anti-phospho-Akt
(Cell Signaling; 1:1,000).
Transient Transfection and Luciferase Assay
Cos-1 cells were split out at 400,000 cells/6cm dish 24 hours before transfection. Cells were transfected with the indicated amounts of DNA using the Lipofectamine-PLUS (Invitrogen) method according to the manufacturer’s instructions. Cells were harvested 36 hours post-transfection and luciferase assays were carried out as previously described (see chapter 2 methods).
132 INS Cell Infection and Immunoblotting
INS-r3 cells were grown in media identical to INS832/13 cells (see chapter 2 methods) except for the addition of 150ug/mL G418 to maintain the stably integrated rtTA gene. INS-r3 cells were seeded at a density of 3 x 106 cells/
6cm plate approximately 24 hours before infection. During infection, added either β-gal control virus or tetO-ATF3 virus at 25 MOI to the cells in 2ml of complete medium. Cells were harvested 36 hours later and protein extracts were prepared by RIPA lysis. 150ug of whole cell extract was resolved by
SDS-PAGE and immunoblotting was carried out under the following antibody conditions: anti-cleaved caspase-9 (Cell Signaling; 1:1,000); bcl-xL (Cell
Signaling 1:1,000).
Generation of RIP-ATF3 Transgenic Mice
In order to generate the transgenic construct, a transgenic cassette containing the β-globin exon/intron junction, human HA-ATF3 cDNA, and Growth Hormone poly A sequence was cloned into the pSP72 vector containing a 700bp enhancer region of the rat insulin promoter (RIP). The RIP-HA-ATF3 fragment was digested out of the vector (cut with KpnI, PvuI, and SalI and gel isolate the
3643 base pair fragment) and isolated off of a 1% Seaplaque low melt agarose gel. (The Ohio State University Neurobiotechnology Center Transgenic Animal and ES Cell Facility). The RIP-HA-ATF3 fragment was injected into pronuclei of one-cell embryos from FVB/N females. Transgenic mice were identified by
PCR using the ATF3 specific upstream primer: 5’-
133 GCTGCAAAGTGCCGAAACAAG-3’ (#215) and the Growth Hormone polyA specific downstream primer: 5’-TTAGGACAAGGCTGGTGGG-3’ (#222).
Transgene expression was examined by ATF3 immunohistochemistry using paraffin-embedded sections of mouse pancreas tissue.
Immunohistochemistry/ Immunofluorescence
Insulin immunofluorescence was carried out using paraffin-embedded pancreas sections as previously described (see chapter 3 methods). Insulin immunohistochemistry was carried out using a 1:50 dilution of guinea pig-anti- insulin primary antibody, 1:200 dilution of anti-guinea pig-AP conjugated secondary antibody, followed by detection using the Alkaline Phosphatase substrate kit (Vector Labs). ATF3 immunohistochemistry was carried out using paraffin-embedded pancreas sections as previously described (see chapter 2 methods). Phospho-Akt immunostaining was carried out using the antigen retrieval method as previously described (see chapter 3 methods) at the following primary antibody concentration: rabbit anti-phospho-Akt (1:1,000).
Basal Glucose Measurement
Mice were faster 15-18 hours overnight after which blood glucose was measured with a Bayer Ascensia Elite Glucometer via small puncture in the tail vein.
134 GTT Procedure
Mice were fasted 15-18 hours overnight. The following day the mice were weighed and a basal glucose measurement was taken to establish a baseline.
Each mouse was then given an intraperitoneal injection of 1M glucose solution in the amount of 1g glucose/kg body weight. Blood glucose measurements were subsequently taken as described under basal glucose measurement at
15, 30, 60, 90, 120, and 180 minutes post injection
P32 Ortho-Phosphate Labeling Experiment
Min-6 cells or W.T. MEFs were seeded out into 6cm dishes 24 hours prior to transfection. Cells were transfected with pCG-empty vector or pCG-ATF3 using the Lipofectamine-PLUS (Invitrogen) method according to the manufacturer’s instructions. 36 hours post-transfection, cells were incubated in phosphate-free media for 2 hours to reduce the levels of endogenous, nonradioactive phosphorylation. Media was apirated off and replaced by phosphate-free media supplemented with 0.5mCi/ml P32-ortho-phosphate for 3 hours at 37ºC/ 5%
CO2. Cells were treated at this time (cytokines, UV) to induce expression of endogenous ATF3 protein. Media was carefully aspirated off and cells were scraped off plates in 750µl of PBS and transferred to an eppendorf tube on ice.
Cells were spun down, the supernatant was removed and the pellet was resuspended in 500µl RIPA lysis buffer containing protease and phosphatase inhibitors (sodium vanadate, sodium fluorite). The extract was precleared by incubation with proteinA-sepharose beads at 4ºC for 30 minutes. Pre-cleared
135 protein extract was added to protein-A-sepharose beads along with 1µl of anti-
ATF3 antibody (Santa Cruz) and immunoprecipitation was allowed to proceed with gentle mixing overnight at 4ºC. The following day, the beads were pelleted by gentle centrifugation and washed 2X (5min/wash) with 1ml of RIPA lysis buffer. SDS-sample loading buffer containing 1mM DTT was added to the beads and the bound proteins were released by boiling for 5 minutes. Samples were resolved by SDS-PAGE, transferred to PVDF membrane, and exposed to film to detect radioactive (phosphorylated) proteins. For activated kinase experiments, Min-6 cells were transfected with either pCG-ATF3 alone or in combination with MKK7+JNK1, MKK6+p38, MEK1-ERK2 fusion, or myr-Akt1.
RESULTS
Inhibition of ATF3 induction by Akt signaling
Previously, we demonstrated that ATF3 gene expression was induced following treatment of pancreatic β-cell lines with pro-inflammatory cytokines and that this induction was partly dependent upon JNK activation (Hartman et al., 2004). Recent reports have demonstrated that Akt activation mediates survival of pancreatic islets following cytokine treatment, in part, through its ability to phosphorylate and inhibit upstream kinases responsible for JNK activation (Aikin et al., 2004). These previous results prompted us to examine whether Akt activation effects ATF3 induction during the stress response. To address this question, INS-r3 cells were pre-treated with insulin for 30 minutes prior to the addition of IL-1β and ATF3 protein levels were examined by
136 immunoblotting. As shown in Fig. 4.5, activation of insulin signaling inhibited
ATF3 induction by IL-1β treatment in a dose-dependent manner. In addition, insulin pre-treatment partially blocked both cytokine-mediated expression and phosphorylation of c-jun, two well-characterized functional consequences of
JNK activation. Insulin treatment is known to activate several signal transduction pathways in β-cells including the PI3K-Akt pathway, Ras/MAPK pathway, and Protein Kinase C pathway (Saltiel and Kahn, 2001). In order to address whether the inhibitory effects of insulin are mediated by the PI3K-Akt pathway, ATF3 expression levels were examined in the presence of the PI3K inhibitor LY294002. As demonstrated in Fig. 4.6, the inhibitory effects of insulin on ATF3 induction were reversed in the presence of LY294002, suggesting that
PI3K activity is required for this effect. Akt is a well-established target of insulin signaling which becomes activated upon its recruitment to the plasma membrane through interaction with PI3K-generated phosphoinositides.
Infection of INS-r3 cells with a myr-Akt expressing adenovirus, but not a control
GFP virus, blocked c-jun phosphorylation and ATF3 expression in response to cytokine treatment (Fig. 4.7). In order to determine whether the effects of Akt are mediated at the transcriptional level, ATF3 basal promoter activity was measured in transient transfection experiments. Co-transfection of a constitutively active Akt mutant caused a dose-dependent decrease in ATF3 promoter activity (Fig. 4.8), whereas transfection of c-jun+ATF2 stimulated promoter activity as previously published (Liang et al., 1996). Based on these
137 results, we conclude that the PI3K-Akt pathway negatively regulates ATF3 expression at least, in part, through down-regulation of transcription.
P-Jun
Jun
Figure 4.5: Inhibition of IL-1β-mediated ATF3 induction by insulin signaling. INS-r3 cells were either left untreated or pre-treated with the indicated concentration of insulin for 30 minutes prior to IL-1β addition (200U/ml). Cells were harvested 1 h following IL-1β treatment and nuclear extracts were prepared as previously described. Approximately 60ug of NE was resolved by SDS-PAGE, transferred to PVDF membrane, and probed using anti-ATF3, anti-actin, anti-c-jun, or anti- phospho-c-jun antibodies.
138
Figure 4.6: Role for PI3K in insulin-mediated inhibition of ATF3 induction. INS-r3 cells were pre-treated with the PI3K inhibition LY294002 for 15 minutes prior to insulin treatment. Insulin treatment and IL-1β treatment were performed as previously described in Fig. 4.5. Approximately 60ug of NE was resolved by SDS-PAGE, transferred to PVDF membrane, and probed using anti-ATF3 or anti-actin antibodies.
139
Figure 4.7: Inhibition of IL-1β-mediated ATF3 induction by activated Akt. INS-r3 cells were infected with either GFP-alone or GFP-myrAkt expressing adenovirus at the indicated MOI for 12-14 h before cytokine treatment. Cells were treated with IL-1β (200U/ml) for 1 h and whole cell extracts were prepared by RIPA lysis. Approximately 150ug of whole cell extract was resolved by SDS- PAGE, transferred to PVDF membrane, and probed using anti-ATF3, anti- phospho-c-jun, or anti-phospho-Akt antibodies.
140
Figure 4.8: Inhibition of ATF3 basal promoter activity by activated Akt. COS-1 cells were transfected (Lipofectamine-PLUS method) in 6cm dishes with 1ug of ATF3 promoter-Luc reporter plasmid along with either pcDNA-empty vector, pcDNA-Akt1DD, or pCG-ATF2 + pCG-c-Jun (25ng each). The total DNA amount was kept constant between samples by addition of pBluescript DNA up to 2ug total DNA/sample. Cell extracts were prepared 36 h post- transfection as previously described and half of sample was used to measure luciferase activity. Luciferase activity from pcDNA transfected samples was set equal to 1 when comparing between 25ng and 100ng samples.
141 ATF3 expression stimulates the intrinsic cell death pathway
Data shown in chapter 3 suggests that ATF3 plays a pro-apoptotic role following its induction and ATF3 expression appears to be sufficient to promote caspase-3 activation. Apoptosis is a regulated physiological process that can occur through distinct pathways, leading to activation of specific caspase proteases based on the apoptosis inducing signal. For example, apoptosis can be induced through the activation of the family of death receptors, such as Fas and TNFR, which triggers cleavage of caspase-8 and -10. In contrast, stimulation of apoptosis through the intrinsic (mitochondrial) pathway results in formation of the apoptosome and activation of caspase-9 following cytochrome c release (fig4.9a). Recent studies indicate that caspase-12 is specifically activated under ER stress conditions (Nakagawa et al., 2000). However, a common feature of all three apoptotic pathways is that they converge on caspase-3 to promote its activation (cleavage). To begin to decipher which apoptotic pathway(s) is stimulated following ATF3 upregulation in β-cells, we examined caspase-9 cleavage following ATF3 expression. Cleaved caspase-9 was detected following infection with a tetracycline-responsive ATF3 adenovirus; however, no signal was detected following infection with a control
β-gal virus (Fig. 4.9b). Examination of Bcl-xL levels in these samples revealed no significant differences between ATF3 and β-gal infected cells. Therefore,
ATF3 appears to stimulate activation of the intrinsic cell death pathway through a mechanism independent of Bcl-xL expression.
142 a.
64 48 b. Procaspase-9 37
25 cleaved caspase-9
19
37
Bcl-xL 25
+ β-Gal ATF3 Cytokines 25 MOI
Figure 4.9: ATF3 expression stimulates the intrinsic cell death pathway. (a) schematic of caspase activation mediated through the extrinsic and intrinsic cell death pathways. (b) ATF3 expression promotes activation of caspase-9. INS-r3 cells were either left untreated, treated with cytokines, or infected with β- gal or ATF3 expressing adenovirus for 36 h. Whole cell extracts were prepared by RIPA lysis and 150ug of total cellular protein was resolved by SDS-PAGE. Membranes were probed using antibodies specific for the active (cleaved) form of caspase-9 and Bcl-xL.
143 Characterization of ATF3/Akt functional interaction
Previously, we reported that ATF3-deficient mouse islets were partially protected from IL-1β+IFN-γ-induced cell death, suggesting that ATF3 plays a pro-apoptotic role following its induction (Hartman et al., 2004). In addition, expression of ATF3 in pancreatic β-cell lines is sufficient to promote caspase-9 and caspase-3 activation, suggesting that the mechanisms whereby ATF3 and
Akt regulate cell survival may overlap. Based on these observations, we hypothesize that one mechanism whereby Akt promotes cell survival is by inhibiting the induction of pro-apoptotic genes, such as ATF3. Recently, Tuttle et al. examined the effects of Akt activation in pancreatic β-cells by generating transgenic mice expressing myr-Akt under control of the rat insulin promoter
(RIP) (Tuttle et al., 2001). These mice exhibited mild fasting and fed hypoglycemia, displayed increased islet area and β-cell size, and were resistant to STZ-induced β-cell apoptosis. In order to address whether ATF3 expression could reverse the phenotypic consequences of Akt activation in β-cells, we decided to generate transgenic mice which co-express ATF3 in the presence of activated Akt. In order to accomplish this, we first generated transgenic mice expressing ATF3 under control of the rat insulin promoter (Fig.4.10a). Similar to the PDX-ATF3 mice, the transgenic founders did not express the transgene, but could pass it on to their progeny. ATF3 immunostaining confirmed transgene expression in islets of transgenic mice and insulin immunostaining revealed decreased and abnormal distribution of insulin-positive cells (Fig.
4.10b). In contrast to the PDX-ATF3 mice, the RIP-ATF3 mice exhibited a
144 milder diabetic phenotype and transgenic lines were established following mating of F1 mice to WT FVB/N. RIP-ATF3 mice were crossed with RIP- myrAkt mice and the phenotypes of the double transgenic mice were evaluated.
As presented in Fig. 4.11a, RIP-ATF3 transgenic mice had reduced body weight compared to W.T. or RIP-myrAkt transgenic mice at four weeks of age.
Similar to the RIP-ATF3 mice, double transgenic mice exhibited a significant reduction in body weight, suggesting that the detrimental effects of ectopic
ATF3 expression are not blocked by co-expression of activated Akt. RIP-ATF3 mice displayed elevated non-fasted basal glucose levels at four weeks of age, as well as fasted hyperglycemia over a twelve week time course (Fig. 4.11b, c).
Although slightly lower than RIP-ATF3 mice, double transgenic mice showed increased fasted and fed basal glucose levels compared to non-transgenic and myr-Akt littermates. Next, we tested the ability of these mice to clear glucose from their blood during a glucose tolerance test and this measurement is indicative of islet function. myr-Akt mice were able to clear glucose more rapidly than non-transgenic littermates, whereas ATF3 mice showed defects in the ability to clear glucose from their blood (Fig. 4.11d). Analysis of islet function in the double transgenic mice revealed impaired ability of these mice to clear glucose, suggesting that ATF3 expression is sufficient to override the beneficial effects of Akt activation on islet cell function.
Next, we examined islet morphology and transgene expression in the double transgenic mice. As expected, RIP-ATF3 transgenic mice displayed smaller islets with ATF3-immunoreactive cells but no phospho-Akt positive cells,
145 whereas RIP-myrAkt pancreata had significantly larger islets and individual β- cells that showed intense phospho-Akt staining (Fig. 4.12a). Double transgenic mouse pancreata at twelve weeks of age showed islets containing both ATF3 and phospho-Akt positive cells, demonstrating expression of both transgenes.
Islet size in the double transgenic mice was significantly reduced compared to the non-transgenic and myr-Akt littermates, and double transgenic pancreata displayed reduced numbers of insulin-positive cells at twelve weeks of age (Fig.
4.12a,b). Based on these results, we conclude that ectopic expression of ATF3 is sufficient to overcome the beneficial effects of Akt activation in pancreatic β- cells.
146
GH HA PolyA -696 +9 705 bp TATA intron RIP Enhancer ATF3 cDNA Β-globin Exon/Intron
Figure 4.10: Generation of RIP-ATF3 transgenic mice. (a) schematic of the RIP-ATF3 transgenic construct. (b) analysis of ATF3 and insulin protein expression. Paraffin-embedded pancreas sections were generated from either non-txg or txg mice at 6 weeks of age. ATF3 or insulin levels were examined by immunohistochemistry using specific antibodies as previously described.
147
Figure 4.11: Characterization of RIP-myrAkt/ATF3 double transgenic mice. (a) measurement of mouse body weight at 4 weeks of age. (b) measurement of non-fasted blood glucose level at 8 weeks of age. (c) measurement of fasted blood glucose level over a time course. (d) Glucose Tolerance Test (GTT) of mice at 8 weeks of age.
148
Figure 4.12: Examination of islet morphology in RIP-myrAkt/ATF3 double transgenic mice. (a) analysis of transgene expression and islet size. Levels of ATF3 and phospho-Akt were examined between different types of mice at 8 weeks of age. (b) Analysis of insulin levels by immunofluorescence at 8 weeks of age.
149 Examination of ATF3 phosphorylation status
Phosphorylation is a common post-translational modification that has been shown to regulate many different aspects of protein function. Several members of the ATF/CREB family of transcription factors have been shown to undergo modification by phosphorylation. For example, CREB is activated by phosphorylation at Ser133 by various signaling pathways including ERK signaling, Ca2+ signaling and stress signaling. Phosphorylation of CREB at
Ser133 increases its transcriptional activity by promoting recruitment of the p300/CBP histone-acetyltransferase coactivator complex (Yin et al., 1994). In addition, cellular stress stimulates the phosphorylation of ATF2 at Thr69 and
Thr71. Both JNK and p38 MAPK have been shown to directly phosphorylate
ATF2 and mutation of these sites results in loss of stress-induced transcription by ATF2. In addition, mutations at these sites reduce the ability of E1A and Rb to stimulate gene expression via ATF2 (van Dam et al., 1995; Livingstone et al.,
1995). Based on these previous findings and the identification of several potential candidate sites, we decided to investigate whether ATF3 undergoes post-translational modification by phosphorylation. In vivo P32-orthophosphate labeling experiments demonstrated that ATF3 exists as a phosphorylated protein following its induction by stress or following its overexpression by transfection (Fig. 4.13a). In these experiments, endogenous ATF3 appeared to undergo phosphorylation following its induction by cytokines in Min-6 β-cells or
UV-treatment of MEFs. In an attempt to identify the phosphorylated residues, the ATF3 protein sequence was analyzed for consensus phosphorylation sites
150 using software available from www.scansite.mit.edu. Results from this computer analysis revealed that S24 shows high sequence homology to consensus phosphorylation sites for Proline-directed Ser/Thr kinases (Fig.
4.13b). Several well-characterized members of the MAPK family (JNK, p38,
ERK) are known to phosphorylate this consensus sequence. Co-transfection of the activated form of JNK or p38 MAPK stimulated ATF3 phosphorylation; however, no effect was seen following transfection of an activated MEK-ERK fusion protein (Fig. 4.13c). Interestingly, expression of myr-Akt appeared to slightly reduce the level of phosphorylated ATF3 using this in vivo labeling assay. These results suggest that ATF3 exists as a phospho-protein and the level of phosphorylation can be increased by stimulation of stress-activated
MAPK. However, additional experimentation is required to determine the phosphorylation site(s) and modifying kinase(s).
151
a.
b.
c.
Figure 4.13: Examination of ATF3 phosphorylation status. (a) Min-6 β-cells or WT MEFs were transfected with either pCG-vector or pCG-ATF3. Cells were treated (cytokines, UV) and labeled with 0.5mCi/ml P32-orthophosphate for 3 h. Extracts were prepared by RIPA lysis and ATF3 was immunoprecipitated from extracts and resolved by SDS-PAGE. Proteins were transferred to PVDF membrane and phosphorylated proteins were detected by autoradiography. (b) schematic of predicted proline-directed ser/thr phosphorylation site within ATF3 (c) Stimulation of ATF3 phosphorylation by MAPK activation. Min-6 β-cells were transfected with pCG-ATF3 along with several activated kinases. P32- orthophosphate labeling experiments were performed as described above and levels of phosphorylated ATF3 were determined by autoradiography. Total levels of ATF3 protein (loading control) were measured by immunoblot analysis of PVDF membrane.
152 DISCUSSION
Data presented in chapter 4 suggests that activation of the Akt serine/threonine kinase blocks ATF3 induction following cytokine treatment in β- cell lines. Several methods were used to test this hypothesis including examination of ATF3 protein levels following Akt activation (insulin treatment, myr-Akt adenovirus) and measurement of ATF3 promoter activity following transfection of a constitutively active Akt mutant. While this data appears promising, the validity of this hypothesis would be further strengthened by experiments that examine ATF3 induction in β-cells which harbor a stably transfected myr-Akt construct or purified primary islets from RIP-Akt transgenic mice. In the above mentioned co-transfection/reporter experiment, overexpression of a hyperactive Akt mutant was sufficient to reduce ATF3 basal promoter levels. It would be interesting to examine the effects of Akt activation on cytokine-induced upregulation of ATF3 promoter activity in pancreatic β- cells.
We hypothesize that the mechanism whereby Akt blocks ATF3 induction is through its ability to phosphorylate and inactivate ASK-1 kinase. ASK-1 is a well-characterized MAPKKK that is known to play a role in the activation of both
JNK and p38 kinases during the stress response. A recent report demonstrated that phosphorylation and inactivation of ASK-1 by Akt blocks both JNK activation and apoptosis following treatment of purified islets with pro- inflammatory cytokines. Several experiments should be performed in order to address whether or not ASK-1 plays a significant role in ATF3 induction. First,
153 knock-down of ASK-1 protein levels by siRNA technology could be used to determine whether ASK-1 is required for optimal ATF3 induction following cytokine treatment. Second, the ability of ASK-1 to stimulate ATF3 promoter activity should be examined by co-transfection experiments using β-cell lines. If
ASK-1 expression is sufficient to upregulate ATF3 promoter activity in these experiments, the effects of constitutively active Akt on ATF3 promoter upregulation mediated by WT-ASK-1 compared to ASK-1 containing a mutant
Akt phosphorylation site (S83A) should be examined. Finally, in vivo binding of
JNK-activated transcription factors (c-jun, ATF2) to the ATF3 promoter could be tested in the presence or absence of Akt. These experiments would establish a correlation suggesting that Akt inhibits ATF3 expression through its ability to phosphorylate and inactivate ASK-1 kinase.
Several mechanisms whereby Akt regulates cell survival have been well- characterized. Most of these effects involve inhibition of the intrinsic cell death pathway by the ability of Akt to phosphorylate Bad/Bax/Bak and prevent release of cytochrome c from the mitochondria. Based on data presented in this chapter, we hypothesize that one mechanism whereby Akt promotes cell survival is by downregulating expression of pro-apoptotic genes, such as ATF3.
The mechanism of ATF3-induced β-cell death is currently not known; however, results presented here suggest that expression of ATF3 is sufficient to stimulate the intrinsic cell death pathway as measured by caspase-9 and caspase-3 cleavage. Experiments should be performed in order to further characterize the effects of ATF3 expression on the intrinsic death pathway, such as examination
154 of mitochondrial membrane potential and release of cytochrome c from the mitochondria. In addition, the functional requirement of caspase activation for
ATF3-induced β-cell death should be tested using broad-range or specific caspase inhibitors. Loss-of-function experiments could be performed in which cleavage of caspase-9 and caspase-3 is monitored in the presence or absence of ATF3. These experiments should give insight into the potential role of ATF3 in activating the cell death machinery and this mechanism may overlap with known pro-survival effects mediated by Akt.
In support of the notion that the mechanism of ATF3-mediated cell death intersects with the Akt-mediated cell survival pathway, in vivo expression of
ATF3 in mouse pancreatic β-cells dramatically altered the phenotype of the
RIP-myrAkt transgenic mice. Double transgenic mice had smaller islets, reduced numbers of insulin-positive cells, higher fasted and fed blood glucose levels, and decreased glucose clearance ability in a GTT assay compared to the myrAkt alone transgenic mice. Future experiments should be designed in order to examine caspase activation in the transgenic mice. Perhaps ATF3 expression in the double transgenic mice is sufficient to activate the intrinsic cell death pathway, thereby overriding the anti-apoptotic effects of myrAkt.
Data presented in this chapter suggests that ATF3 exists as a phospho- protein and that the level of phosphorylation could be increased by expression of activated JNK or p38 MAPK. ATF3 residue S24 represents a potential phosphorylation site for these stress-activated MAPK, therefore, it would be intriguing to analyze the ability of JNK and p38 to increase phosphorylation of
155 ATF3 harboring an S24A mutation. In contradiction to this data, a recent report suggests that ATF3 does not serve as a JNK substrate. Although ATF3 was found to contain an identical phospho-acceptor site compared with JDP-2 at position Thr-148, phosphorylation of ATF3 was not observed following treatment of HEK-293 cells with anisomycin or UV (Katz and Aronheim, 2002).
However, phosphorylation of ATF3 was observed following expression of a chimera protein in which ATF3 was fused to a 14-amino acid JNK docking domain from JDP-2. This suggests that JNK may not directly phosphorylate
ATF3 due to the absence of a JNK docking domain; however, JNK or p38 may regulate ATF3 phosphorylation through an indirect mechanism.
Interestingly, expression of myr-Akt appeared to reduce the basal level of
ATF3 phosphorylation. Recent reports suggest that Akt functions to inhibit activation of both JNK and p38 MAPK through its ability to phosphorylate and inhibit upstream activators (ASK-1). Thus, the decreased levels of ATF3 phosphorylation may be due to inhibition of JNK and p38 basal activation by myr-Akt.
THESIS SUMMARY
In summary, data presented in this thesis describes the stress induction, functional consequences, and partial mechanism of ATF3 action in pancreatic
β-cells. Chapter two demonstrates ATF3 induction in β-cells following treatment with T1D stress signals (cytokines) and T2D stress signals (high glucose, FFA, oxidative stress). In addition, chapter two reveals elevated ATF3 protein levels
156 in pancreatic islets of non-obese diabetic (NOD) mice and human patients.
Using gain-of-function and loss-of-function approaches, data presented in chapter three suggests a pro-apoptotic role for ATF3 in β-cells following its induction. In addition, these experiments demonstrate cross-talk and functional cooperativity between ATF3 and nitric oxide (NO) in regulating β-cell apoptosis.
Finally, chapter four examines the signaling and functional interaction between
ATF3 and Akt, a well-known pro-survival factor. In these experiments, Akt activation blocked c-jun phosphorylation and ATF3 induction following IL-1β treatment. Examination of the mechanism whereby ATF3 promotes apoptosis revealed that ATF3 expression is sufficient to stimulate the intrinsic cell death pathway, as measured by caspase-9 cleavage. β-cell specific expression of
ATF3 reversed the anti-diabetic effects of activated Akt, suggesting that ATF3 affects factors downstream of Akt that play a role in regulating mitochondrial integrity (Fig. 4.14).
157
Apoptosis Metastasis (EMT)
Fig. 4.14: Current model of ATF3 induction and function in β-cells. In summary, ATF3 is induced in β-cells by a variety of T1D and T2D relevant stress signals. Both the JNK and NFκB pathways play a role in ATF3 induction following IL-1β treatment. ATF3 expression was sufficient for β-cell apoptosis following transgenic expression in the developing embryo and ATF3 expression was necessary for optimal levels of IL-1β+IFN-γ-induced apoptosis using purified islets. Akt activation inhibits c-jun phosphorylation and ATF3 expression in response to IL-1β treatment. Examination of their functional interaction revealed that ATF3 expression significantly reversed the anti- diabetic phenotype observed in the myrAkt transgenic mice. Insights into the mechanism whereby ATF3 regulates β-cell apoptosis revealed that ATF3 expression is sufficient to activate the intrinsic cell death pathway.
158 ACKNOWLEDGMENTS
I would like to thank Matthew Duer for help with maintenance, screening, and characterization of the RIP-ATF3/Akt transgenic mice.
159 CHAPTER 5
FUTURE PERSPECTIVES
Work presented in this thesis implicates a role for ATF3 in the pathogenesis of stress-associated diabetes. Data presented in chapter 2 describes the induction of ATF3 by stress signals relevant to type 1 and type 2 diabetes, as well as the examination of signal transduction pathways involved in this upregulation. Through the use of gain-of-function and loss-of-function approaches, data shown in chapter 3 describes a pro-apoptotic role for ATF3 in
β-cells following its expression. Chapter 4 examines the potential cross-talk in
β-cells between ATF3 and the well-characterized pro-survival gene Akt.
Results shown in this chapter demonstrate Akt-mediated inhibition of ATF3 induction through the ability of Akt to block JNK activation. In addition, the mechanism of ATF3-mediated β-cell apoptosis may directly overlap with known pro-survival effects of Akt at the level of the intrinsic (mitochondrial) cell death pathway. In conclusion, this body of work gives insight into the functional significance of ATF3 induction in pancreatic β-cells during the stress response and provides clues as to the mechanism whereby ATF3 kills β-cells.
Indeed, data presented in this thesis begins to address the mechanism whereby ATF3 promotes β-cell death; however, much work remains in order to
160 clarify this mystery. Recent experiments suggest that ATF3 expression in β-cell lines is sufficient to promote caspase protease activation. Caspases can be grouped into different categories based upon their ability to be activated through the extrinsic (death receptor) or intrinsic (mitochondrial) cell death pathways.
No significant difference in the level of apoptosis was observed between wild type and ATF3 KO islets following the addition of TNF-α (chpt.3), suggesting that ATF3 is not involved in the death receptor pathway. In addition, ATF3 expression appears to be sufficient to promote caspase-9 activation. Caspase-
9 is specifically activated (cleaved) through the intrinsic cell death pathway following release of cytochrome c from the mitochondria. Based on these results, we hypothesize that ATF3 mainly exerts its effects on β-cell killing by stimulating apoptosis through the intrinsic death pathway. Additional experiments should be designed to test this hypothesis including examination of mitochondrial membrane integrity and cytochrome c release following ATF3 expression. Cytochrome c release and caspase-9 activation should also be examined following cytokine (IL-1β+IFN-γ) treatment of wild type or ATF3 KO islets (or ATF3 siRNA-treated cell lines). It is possible that ATF3 promotes β- cell killing through mechanisms independent of apoptosis, such as necrosis or autophagy. To gain insight into this possibility, the ability of ATF3 to promote cell death should be examined in the presence of broad-acting caspase inhibitors.
The potential mechanism whereby ATF3 expression leads to caspase-9 and caspase-3 activation through the intrinsic death pathway has yet to be
161 addressed. ATF3 protein accumulates predominantly inside the nucleus and its effect on β-cell death may depend upon its ability to function as a transcriptional repressor. However, preliminary results showed no significant decline in expression levels of Bcl family proteins (Bcl-xL, Bcl-2) following ATF3 expression in β-cell lines. Genome-wide microarray analysis is currently being used by our lab to identify changes in gene expression patterns following ATF3 expression. This approach could lead to the identification of direct ATF3 target genes that are involved in β-cell apoptosis. In addition to its function as a transcription factor, ATF3 may exert its effects through protein-protein interactions with the cell death machinery or cell death regulatory proteins. Two different approaches are currently underway in our lab to identify ATF3- interacting proteins including a yeast-2-hybrid screen and ATF3- coimmunoprecipitation followed by mass spectrometry. Identification of ATF3 target genes and interacting proteins would give insight into the mechanism of
ATF3-mediated β-cell death.
Preliminary results suggest that ATF3 exists as a phosphorylated protein within the cell and that this phosphorylation could be stimulated by activation of
JNK or p38 pathways. Several different techniques could be used in order to identify the phosphorylation site(s) within ATF3 including 2-D tryptic peptide mapping, mass spectrometry analysis, or site-directed mutagenesis of individual amino acids. Identification of phosphorylation sites within ATF3 could give clues as to which kinase(s) are responsible for this post-translational modification. Alternatively, in-gel kinase assays could be performed using
162 purified ATF3 protein as the substrate in order to gain knowledge about the molecular weight of ATF3 kinases. Finally, studies aimed at understanding the functional significance of this phosphorylation event must be performed.
Phosphorylation has been shown to regulate many different aspects of protein function including association with chromatin remodeling complexes (CREB), nuclear translocation (FoxO), DNA binding (NFκB), and protein stability (p53).
A greater understanding of this phosphorylation event would give insight into the regulation of ATF3 at the post-translational level.
163
LIST OF REFERENCES
Abe,T., Oue,N., Yasui,W., and Ryoji,M. (2003). Rapid and preferential induction of ATF3 transcription in response to low doses of UVA light. Biochem. Biophys. Res. Commun. 310, 1168-1174.
Adler,V., Yin,Z., Tew,K.D., and Ronai,Z. (1999). Role of redox potential and reactive oxygen species in stress signaling. Oncogene 18, 6104-6111.
Adorini,L., Gregori,S., and Harrison,L.C. (2002). Understanding autoimmune diabetes: insights from mouse models. Trends Mol. Med. 8, 31-38.
Aguirre,V., Uchida,T., Yenush,L., Davis,R., and White,M.F. (2000). The c-Jun NH(2)-terminal kinase promotes insulin resistance during association with insulin receptor substrate-1 and phosphorylation of Ser(307). J. Biol. Chem. 275, 9047-9054.
Aguirre,V., Werner,E.D., Giraud,J., Lee,Y.H., Shoelson,S.E., and White,M.F. (2002). Phosphorylation of Ser307 in insulin receptor substrate-1 blocks interactions with the insulin receptor and inhibits insulin action. J. Biol. Chem. 277, 1531-1537.
Ahima,R.S. and Flier,J.S. (2000). Leptin. Annu. Rev. Physiol 62, 413-437.
Aikin,R., Maysinger,D., and Rosenberg,L. (2004). Cross-talk between phosphatidylinositol 3-kinase/AKT and c-jun NH2-terminal kinase mediates survival of isolated human islets. Endocrinology 145, 4522-4531.
Alessi,D.R., Andjelkovic,M., Caudwell,B., Cron,P., Morrice,N., Cohen,P., and Hemmings,B.A. (1996). Mechanism of activation of protein kinase B by insulin and IGF-1. EMBO J. 15, 6541-6551.
Allan,A.L., Albanese,C., Pestell,R.G., and LaMarre,J. (2001). Activating transcription factor 3 induces DNA synthesis and expression of cyclin D1 in hepatocytes. J. Biol. Chem. 276, 27272-27280.
Allen-Jennings,A.E., Hartman,M.G., Kociba,G.J., and Hai,T. (2001). The roles of ATF3 in glucose homeostasis. A transgenic mouse model with liver dysfunction and defects in endocrine pancreas. J. Biol. Chem. 276, 29507- 29514. 164 Allen-Jennings,A.E., Hartman,M.G., Kociba,G.J., and Hai,T. (2002). The roles of ATF3 in liver dysfunction and the regulation of phosphoenolpyruvate carboxykinase gene expression. J. Biol. Chem. 277, 20020-20025.
Ammendrup,A., Maillard,A., Nielsen,K., Aabenhus,A.N., Serup,P., Dragsbaek,M.O., Mandrup-Poulsen,T., and Bonny,C. (2000). The c-Jun amino- terminal kinase pathway is preferentially activated by interleukin-1 and controls apoptosis in differentiating pancreatic beta-cells. Diabetes 49, 1468-1476.
Amundson,S.A., Bittner,M., Chen,Y., Trent,J., Meltzer,P., and Fornace,A.J., Jr. (1999). Fluorescent cDNA microarray hybridization reveals complexity and heterogeneity of cellular genotoxic stress responses. Oncogene 18, 3666-3672.
Andjelkovic,M., Alessi,D.R., Meier,R., Fernandez,A., Lamb,N.J., Frech,M., Cron,P., Cohen,P., Lucocq,J.M., and Hemmings,B.A. (1997). Role of translocation in the activation and function of protein kinase B. J. Biol. Chem. 272, 31515-31524.
Anjos,S. and Polychronakos,C. (2004). Mechanisms of genetic susceptibility to type I diabetes: beyond HLA. Mol. Genet. Metab 81, 187-195.
Appels,B., Burkart,V., Kantwerk-Funke,G., Funda,J., Kolb-Bachofen,V., and Kolb,H. (1989). Spontaneous cytotoxicity of macrophages against pancreatic islet cells. J. Immunol. 142, 3803-3808.
Atzmon,G., Yang,X.M., Muzumdar,R., Ma,X.H., Gabriely,I., and Barzilai,N. (2002). Differential gene expression between visceral and subcutaneous fat depots. Horm. Metab Res. 34, 622-628.
Baekkeskov,S., Aanstoot,H.J., Christgau,S., Reetz,A., Solimena,M., Cascalho,M., Folli,F., Richter-Olesen,H., De Camilli,P., and Camilli,P.D. (1990). Identification of the 64K autoantigen in insulin-dependent diabetes as the GABA-synthesizing enzyme glutamic acid decarboxylase. Nature 347, 151-156.
Baker,M.S., Chen,X., Cao,X.C., and Kaufman,D.B. (2001). Expression of a dominant negative inhibitor of NF-kappaB protects MIN6 beta-cells from cytokine-induced apoptosis. J. Surg. Res. 97, 117-122.
Bakin,A.V., Stourman,N.V., Sekhar,K.R., Rinehart,C., Yan,X., Meredith,M.J., Arteaga,C.L., and Freeman,M.L. (2005). Smad3-ATF3 signaling mediates TGF- beta suppression of genes encoding Phase II detoxifying proteins. Free Radic. Biol. Med. 38, 375-387.
Barnabas,S., Hai,T., and Andrisani,O.M. (1997). The hepatitis B virus X protein enhances the DNA binding potential and transcription efficacy of bZip transcription factors. J. Biol. Chem. 272, 20684-20690.
165 Barthwal,M.K., Sathyanarayana,P., Kundu,C.N., Rana,B., Pradeep,A., Sharma,C., Woodgett,J.R., and Rana,A. (2003). Negative regulation of mixed lineage kinase 3 by protein kinase B/AKT leads to cell survival. J. Biol. Chem. 278, 3897-3902.
Baud,V. and Karin,M. (2001). Signal transduction by tumor necrosis factor and its relatives. Trends Cell Biol. 11, 372-377.
Benhamou,P.Y., Moriscot,C., Richard,M.J., Beatrix,O., Badet,L., Pattou,F., Kerr-Conte,J., Chroboczek,J., Lemarchand,P., and Halimi,S. (1998). Adenovirus-mediated catalase gene transfer reduces oxidant stress in human, porcine and rat pancreatic islets. Diabetologia 41, 1093-1100.
Biggs,W.H., III, Meisenhelder,J., Hunter,T., Cavenee,W.K., and Arden,K.C. (1999). Protein kinase B/Akt-mediated phosphorylation promotes nuclear exclusion of the winged helix transcription factor FKHR1. Proc. Natl. Acad. Sci. U. S. A 96, 7421-7426.
Birnbaum,M.J. (2001). Turning down insulin signaling. J. Clin. Invest 108, 655- 659.
Bonny,C., Oberson,A., Negri,S., Sauser,C., and Schorderet,D.F. (2001). Cell- permeable peptide inhibitors of JNK: novel blockers of beta-cell death. Diabetes 50, 77-82.
Brazil,D.P. and Hemmings,B.A. (2001). Ten years of protein kinase B signalling: a hard Akt to follow. Trends Biochem. Sci. 26, 657-664.
Brodbeck,D., Cron,P., and Hemmings,B.A. (1999). A human protein kinase Bgamma with regulatory phosphorylation sites in the activation loop and in the C-terminal hydrophobic domain. J. Biol. Chem. 274, 9133-9136.
Bruick,R.K. (2003). Oxygen sensing in the hypoxic response pathway: regulation of the hypoxia-inducible transcription factor. Genes Dev. 17, 2614- 2623.
Brunet,A., Bonni,A., Zigmond,M.J., Lin,M.Z., Juo,P., Hu,L.S., Anderson,M.J., Arden,K.C., Blenis,J., and Greenberg,M.E. (1999). Akt promotes cell survival by phosphorylating and inhibiting a Forkhead transcription factor. Cell 96, 857-868.
Buchanan,T.A. (2003). Pancreatic beta-cell loss and preservation in type 2 diabetes. Clin. Ther. 25 Suppl B, B32-B46.
Burgering,B.M. and Coffer,P.J. (1995). Protein kinase B (c-Akt) in phosphatidylinositol-3-OH kinase signal transduction. Nature 376, 599-602.
166 Busch,A.K., Cordery,D., Denyer,G.S., and Biden,T.J. (2002). Expression profiling of palmitate- and oleate-regulated genes provides novel insights into the effects of chronic lipid exposure on pancreatic beta-cell function. Diabetes 51, 977-987.
Butler,A.E., Janson,J., Bonner-Weir,S., Ritzel,R., Rizza,R.A., and Butler,P.C. (2003). Beta-cell deficit and increased beta-cell apoptosis in humans with type 2 diabetes. Diabetes 52, 102-110.
Cai,Y., Zhang,C., Nawa,T., Aso,T., Tanaka,M., Oshiro,S., Ichijo,H., and Kitajima,S. (2000). Homocysteine-responsive ATF3 gene expression in human vascular endothelial cells: activation of c-Jun NH(2)-terminal kinase and promoter response element. Blood 96, 2140-2148.
Cameron,M.J., Meagher,C., and Delovitch,T.L. (1998). Failure in immune regulation begets IDDM in NOD mice. Diabetes Metab Rev. 14, 177-185.
Cardone,M.H., Roy,N., Stennicke,H.R., Salvesen,G.S., Franke,T.F., Stanbridge,E., Frisch,S., and Reed,J.C. (1998). Regulation of cell death protease caspase-9 by phosphorylation. Science 282, 1318-1321.
Cardozo,A.K., Kruhoffer,M., Leeman,R., Orntoft,T., and Eizirik,D.L. (2001). Identification of novel cytokine-induced genes in pancreatic beta-cells by high- density oligonucleotide arrays. Diabetes 50, 909-920.
Castano,L. and Eisenbarth,G.S. (1990). Type-I diabetes: a chronic autoimmune disease of human, mouse, and rat. Annu. Rev. Immunol. 8, 647-679.
Chen,B.P., Liang,G., Whelan,J., and Hai,T. (1994). ATF3 and ATF3 delta Zip. Transcriptional repression versus activation by alternatively spliced isoforms. J. Biol. Chem. 269, 15819-15826.
Chen,B.P., Wolfgang,C.D., and Hai,T. (1996). Analysis of ATF3, a transcription factor induced by physiological stresses and modulated by gadd153/Chop10. Mol. Cell Biol. 16, 1157-1168.
Chen,G. and Goeddel,D.V. (2002). TNF-R1 signaling: a beautiful pathway. Science 296, 1634-1635.
Cheng,J.Q., Godwin,A.K., Bellacosa,A., Taguchi,T., Franke,T.F., Hamilton,T.C., Tsichlis,P.N., and Testa,J.R. (1992). AKT2, a putative oncogene encoding a member of a subfamily of protein-serine/threonine kinases, is amplified in human ovarian carcinomas. Proc. Natl. Acad. Sci. U. S. A 89, 9267-9271.
Chiang,S.H., Hwang,J., Legendre,M., Zhang,M., Kimura,A., and Saltiel,A.R. (2003). TCGAP, a multidomain Rho GTPase-activating protein involved in insulin-stimulated glucose transport. EMBO J. 22, 2679-2691. 167 Cooper,G.J., Willis,A.C., Clark,A., Turner,R.C., Sim,R.B., and Reid,K.B. (1987). Purification and characterization of a peptide from amyloid-rich pancreases of type 2 diabetic patients. Proc. Natl. Acad. Sci. U. S. A 84, 8628-8632.
Coqueret,O. (2003). New roles for p21 and p27 cell-cycle inhibitors: a function for each cell compartment? Trends Cell Biol. 13, 65-70.
Corbett,J.A., Mikhael,A., Shimizu,J., Frederick,K., Misko,T.P., McDaniel,M.L., Kanagawa,O., and Unanue,E.R. (1993). Nitric oxide production in islets from nonobese diabetic mice: aminoguanidine-sensitive and -resistant stages in the immunological diabetic process. Proc. Natl. Acad. Sci. U. S. A 90, 8992-8995.
Cross,D.A., Alessi,D.R., Cohen,P., Andjelkovich,M., and Hemmings,B.A. (1995). Inhibition of glycogen synthase kinase-3 by insulin mediated by protein kinase B. Nature 378, 785-789.
Darville,M.I. and Eizirik,D.L. (1998). Regulation by cytokines of the inducible nitric oxide synthase promoter in insulin-producing cells. Diabetologia 41, 1101- 1108.
Datta,S.R., Dudek,H., Tao,X., Masters,S., Fu,H., Gotoh,Y., and Greenberg,M.E. (1997). Akt phosphorylation of BAD couples survival signals to the cell-intrinsic death machinery. Cell 91, 231-241.
Deprez,J., Vertommen,D., Alessi,D.R., Hue,L., and Rider,M.H. (1997). Phosphorylation and activation of heart 6-phosphofructo-2-kinase by protein kinase B and other protein kinases of the insulin signaling cascades. J. Biol. Chem. 272, 17269-17275.
Dijkers,P.F., Medema,R.H., Lammers,J.W., Koenderman,L., and Coffer,P.J. (2000). Expression of the pro-apoptotic Bcl-2 family member Bim is regulated by the forkhead transcription factor FKHR-L1. Curr. Biol. 10, 1201-1204.
Dinarello,C.A. (1997). Interleukin-1. Cytokine Growth Factor Rev. 8, 253-265.
Drysdale,B.E., Howard,D.L., and Johnson,R.J. (1996). Identification of a lipopolysaccharide inducible transcription factor in murine macrophages. Mol. Immunol. 33, 989-998.
Du,K. and Montminy,M. (1998). CREB is a regulatory target for the protein kinase Akt/PKB. J. Biol. Chem. 273, 32377-32379.
Dupraz,P., Cottet,S., Hamburger,F., Dolci,W., Felley-Bosco,E., and Thorens,B. (2000). Dominant negative MyD88 proteins inhibit interleukin-1beta /interferon- gamma -mediated induction of nuclear factor kappa B-dependent nitrite production and apoptosis in beta cells. J. Biol. Chem. 275, 37672-37678.
168 Eizirik,D.L. and Darville,M.I. (2001). beta-cell apoptosis and defense mechanisms: lessons from type 1 diabetes. Diabetes 50 Suppl 1, S64-S69.
Eizirik,D.L. and Mandrup-Poulsen,T. (2001). A choice of death--the signal- transduction of immune-mediated beta-cell apoptosis. Diabetologia 44, 2115- 2133.
Eizirik,D.L. and Pavlovic,D. (1997). Is there a role for nitric oxide in beta-cell dysfunction and damage in IDDM? Diabetes Metab Rev. 13, 293-307.
Evans,J.L., Goldfine,I.D., Maddux,B.A., and Grodsky,G.M. (2003). Are oxidative stress-activated signaling pathways mediators of insulin resistance and beta- cell dysfunction? Diabetes 52, 1-8.
Fan,F., Jin,S., Amundson,S.A., Tong,T., Fan,W., Zhao,H., Zhu,X., Mazzacurati,L., Li,X., Petrik,K.L., Fornace,A.J., Jr., Rajasekaran,B., and Zhan,Q. (2002). ATF3 induction following DNA damage is regulated by distinct signaling pathways and over-expression of ATF3 protein suppresses cells growth. Oncogene 21, 7488-7496.
Federici,M., Hribal,M., Perego,L., Ranalli,M., Caradonna,Z., Perego,C., Usellini,L., Nano,R., Bonini,P., Bertuzzi,F., Marlier,L.N., Davalli,A.M., Carandente,O., Pontiroli,A.E., Melino,G., Marchetti,P., Lauro,R., Sesti,G., and Folli,F. (2001). High glucose causes apoptosis in cultured human pancreatic islets of Langerhans: a potential role for regulation of specific Bcl family genes toward an apoptotic cell death program. Diabetes 50, 1290-1301.
Friedman,J.M. and Halaas,J.L. (1998). Leptin and the regulation of body weight in mammals. Nature 395, 763-770.
George,S., Rochford,J.J., Wolfrum,C., Gray,S.L., Schinner,S., Wilson,J.C., Soos,M.A., Murgatroyd,P.R., Williams,R.M., Acerini,C.L., Dunger,D.B., Barford,D., Umpleby,A.M., Wareham,N.J., Davies,H.A., Schafer,A.J., Stoffel,M., O'Rahilly,S., and Barroso,I. (2004). A family with severe insulin resistance and diabetes due to a mutation in AKT2. Science 304, 1325-1328.
Gerrish,K., Gannon,M., Shih,D., Henderson,E., Stoffel,M., Wright,C.V., and Stein,R. (2000). Pancreatic beta cell-specific transcription of the pdx-1 gene. The role of conserved upstream control regions and their hepatic nuclear factor 3beta sites. J. Biol. Chem. 275, 3485-3492.
Girard,J.R., Cuendet,G.S., Marliss,E.B., Kervran,A., Rieutort,M., and Assan,R. (1973). Fuels, hormones, and liver metabolism at term and during the early postnatal period in the rat. J. Clin. Invest 52, 3190-3200.
169 Grey,S.T., Arvelo,M.B., Hasenkamp,W., Bach,F.H., and Ferran,C. (1999). A20 inhibits cytokine-induced apoptosis and nuclear factor kappaB-dependent gene activation in islets. J. Exp. Med. 190, 1135-1146.
Guttridge,D.C., Albanese,C., Reuther,J.Y., Pestell,R.G., and Baldwin,A.S., Jr. (1999). NF-kappaB controls cell growth and differentiation through transcriptional regulation of cyclin D1. Mol. Cell Biol. 19, 5785-5799.
Hai,T. and Hartman,M.G. (2001). The molecular biology and nomenclature of the activating transcription factor/cAMP responsive element binding family of transcription factors: activating transcription factor proteins and homeostasis. Gene 273, 1-11.
Hai,T., Wolfgang,C.D., Marsee,D.K., Allen,A.E., and Sivaprasad,U. (1999). ATF3 and stress responses. Gene Expr. 7, 321-335.
Hai,T.W., Liu,F., Coukos,W.J., and Green,M.R. (1989). Transcription factor ATF cDNA clones: an extensive family of leucine zipper proteins able to selectively form DNA-binding heterodimers. Genes Dev. 3, 2083-2090.
Halaas,J.L., Gajiwala,K.S., Maffei,M., Cohen,S.L., Chait,B.T., Rabinowitz,D., Lallone,R.L., Burley,S.K., and Friedman,J.M. (1995). Weight-reducing effects of the plasma protein encoded by the obese gene. Science 269, 543-546.
Hanafusa,T., Miyagawa,J., Nakajima,H., Tomita,K., Kuwajima,M., Matsuzawa,Y., and Tarui,S. (1994). The NOD mouse. Diabetes Res. Clin. Pract. 24 Suppl, S307-S311.
Hartman,M.G., Lu,D., Kim,M.L., Kociba,G.J., Shukri,T., Buteau,J., Wang,X., Frankel,W.L., Guttridge,D., Prentki,M., Grey,S.T., Ron,D., and Hai,T. (2004). Role for activating transcription factor 3 in stress-induced beta-cell apoptosis. Mol. Cell Biol. 24, 5721-5732.
Hartter,E., Svoboda,T., Ludvik,B., Schuller,M., Lell,B., Kuenburg,E., Brunnbauer,M., Woloszczuk,W., and Prager,R. (1991). Basal and stimulated plasma levels of pancreatic amylin indicate its co-secretion with insulin in humans. Diabetologia 34, 52-54.
Hashimoto,Y., Zhang,C., Kawauchi,J., Imoto,I., Adachi,M.T., Inazawa,J., Amagasa,T., Hai,T., and Kitajima,S. (2002). An alternatively spliced isoform of transcriptional repressor ATF3 and its induction by stress stimuli. Nucleic Acids Res. 30, 2398-2406.
Heimberg,H., Heremans,Y., Jobin,C., Leemans,R., Cardozo,A.K., Darville,M., and Eizirik,D.L. (2001). Inhibition of cytokine-induced NF-kappaB activation by adenovirus-mediated expression of a NF-kappaB super-repressor prevents beta-cell apoptosis. Diabetes 50, 2219-2224. 170 Herold,K.C., Vezys,V., Koons,A., Lenschow,D., Thompson,C., and Bluestone,J.A. (1997). CD28/B7 costimulation regulates autoimmune diabetes induced with multiple low doses of streptozotocin. J. Immunol. 158, 984-991.
Herrmann,J.L., Briones,F., Jr., Brisbay,S., Logothetis,C.J., and McDonnell,T.J. (1998). Prostate carcinoma cell death resulting from inhibition of proteasome activity is independent of functional Bcl-2 and p53. Oncogene 17, 2889-2899.
Hsu,J.C., Laz,T., Mohn,K.L., and Taub,R. (1991). Identification of LRF-1, a leucine-zipper protein that is rapidly and highly induced in regenerating liver. Proc. Natl. Acad. Sci. U. S. A 88, 3511-3515.
Ishiguro,T. and Nagawa,H. (2000). ATF3 gene regulates cell form and migration potential of HT29 colon cancer cells. Oncol. Res. 12, 343-346.
Ishiguro,T., Nagawa,H., Naito,M., and Tsuruo,T. (2000). Inhibitory effect of ATF3 antisense oligonucleotide on ectopic growth of HT29 human colon cancer cells. Jpn. J. Cancer Res. 91, 833-836.
Ishiguro,T., Nakajima,M., Naito,M., Muto,T., and Tsuruo,T. (1996). Identification of genes differentially expressed in B16 murine melanoma sublines with different metastatic potentials. Cancer Res. 56, 875-879.
James,S.R., Downes,C.P., Gigg,R., Grove,S.J., Holmes,A.B., and Alessi,D.R. (1996). Specific binding of the Akt-1 protein kinase to phosphatidylinositol 3,4,5- trisphosphate without subsequent activation. Biochem. J. 315 ( Pt 3), 709-713.
Johnson,G.L. and Lapadat,R. (2002). Mitogen-activated protein kinase pathways mediated by ERK, JNK, and p38 protein kinases. Science 298, 1911- 1912.
Jonas,J.C., Sharma,A., Hasenkamp,W., Ilkova,H., Patane,G., Laybutt,R., Bonner-Weir,S., and Weir,G.C. (1999). Chronic hyperglycemia triggers loss of pancreatic beta cell differentiation in an animal model of diabetes. J. Biol. Chem. 274, 14112-14121.
Jones,P.F., Jakubowicz,T., Pitossi,F.J., Maurer,F., and Hemmings,B.A. (1991). Molecular cloning and identification of a serine/threonine protein kinase of the second-messenger subfamily. Proc. Natl. Acad. Sci. U. S. A 88, 4171-4175.
Juan,C.C., Au,L.C., Fang,V.S., Kang,S.F., Ko,Y.H., Kuo,S.F., Hsu,Y.P., Kwok,C.F., and Ho,L.T. (2001). Suppressed gene expression of adipocyte resistin in an insulin-resistant rat model probably by elevated free fatty acids. Biochem. Biophys. Res. Commun. 289, 1328-1333.
171 Jun,H.S., Yoon,C.S., Zbytnuik,L., van Rooijen,N., and Yoon,J.W. (1999). The role of macrophages in T cell-mediated autoimmune diabetes in nonobese diabetic mice. J. Exp. Med. 189, 347-358.
Kadowaki,T., Hara,K., Kubota,N., Tobe,K., Terauchi,Y., Yamauchi,T., Eto,K., Kadowaki,H., Noda,M., Hagura,R., and Akanuma,Y. (2002). The role of PPARgamma in high-fat diet-induced obesity and insulin resistance. J. Diabetes Complications 16, 41-45.
Kadowaki,T., Hara,K., Yamauchi,T., Terauchi,Y., Tobe,K., and Nagai,R. (2003). Molecular mechanism of insulin resistance and obesity. Exp. Biol. Med. (Maywood. ) 228, 1111-1117.
Kagi,D., Odermatt,B., Seiler,P., Zinkernagel,R.M., Mak,T.W., and Hengartner,H. (1997). Reduced incidence and delayed onset of diabetes in perforin-deficient nonobese diabetic mice. J. Exp. Med. 186, 989-997.
Kane,L.P., Shapiro,V.S., Stokoe,D., and Weiss,A. (1999). Induction of NF- kappaB by the Akt/PKB kinase. Curr. Biol. 9, 601-604.
Kang,Y., Chen,C.R., and Massague,J. (2003). A self-enabling TGFbeta response coupled to stress signaling: Smad engages stress response factor ATF3 for Id1 repression in epithelial cells. Mol. Cell 11, 915-926.
Kannan,K., Amariglio,N., Rechavi,G., Jakob-Hirsch,J., Kela,I., Kaminski,N., Getz,G., Domany,E., and Givol,D. (2001). DNA microarrays identification of primary and secondary target genes regulated by p53. Oncogene 20, 2225- 2234.
Kappler,J.W., Roehm,N., and Marrack,P. (1987). T cell tolerance by clonal elimination in the thymus. Cell 49, 273-280.
Katz,S. and Aronheim,A. (2002). Differential targeting of the stress mitogen- activated protein kinases to the c-Jun dimerization protein 2. Biochem. J. 368, 939-945.
Kawauchi,J., Zhang,C., Nobori,K., Hashimoto,Y., Adachi,M.T., Noda,A., Sunamori,M., and Kitajima,S. (2002). Transcriptional repressor activating transcription factor 3 protects human umbilical vein endothelial cells from tumor necrosis factor-alpha-induced apoptosis through down-regulation of p53 transcription. J. Biol. Chem. 277, 39025-39034.
Kido,Y., Nakae,J., and Accili,D. (2001). Clinical review 125: The insulin receptor and its cellular targets. J. Clin. Endocrinol. Metab 86, 972-979.
172 Kim,A.H., Khursigara,G., Sun,X., Franke,T.F., and Chao,M.V. (2001a). Akt phosphorylates and negatively regulates apoptosis signal-regulating kinase 1. Mol. Cell Biol. 21, 893-901.
Kim,A.H., Yano,H., Cho,H., Meyer,D., Monks,B., Margolis,B., Birnbaum,M.J., and Chao,M.V. (2002). Akt1 regulates a JNK scaffold during excitotoxic apoptosis. Neuron 35, 697-709.
Kim,J.K., Kim,Y.J., Fillmore,J.J., Chen,Y., Moore,I., Lee,J., Yuan,M., Li,Z.W., Karin,M., Perret,P., Shoelson,S.E., and Shulman,G.I. (2001b). Prevention of fat- induced insulin resistance by salicylate. J. Clin. Invest 108, 437-446.
Kitamura,T., Kitamura,Y., Kuroda,S., Hino,Y., Ando,M., Kotani,K., Konishi,H., Matsuzaki,H., Kikkawa,U., Ogawa,W., and Kasuga,M. (1999). Insulin-induced phosphorylation and activation of cyclic nucleotide phosphodiesterase 3B by the serine-threonine kinase Akt. Mol. Cell Biol. 19, 6286-6296.
Kool,J., Hamdi,M., Cornelissen-Steijger,P., van der Eb,A.J., Terleth,C., and van Dam,H. (2003). Induction of ATF3 by ionizing radiation is mediated via a signaling pathway that includes ATM, Nibrin1, stress-induced MAPkinases and ATF-2. Oncogene 22, 4235-4242.
Kubota,N., Terauchi,Y., Miki,H., Tamemoto,H., Yamauchi,T., Komeda,K., Satoh,S., Nakano,R., Ishii,C., Sugiyama,T., Eto,K., Tsubamoto,Y., Okuno,A., Murakami,K., Sekihara,H., Hasegawa,G., Naito,M., Toyoshima,Y., Tanaka,S., Shiota,K., Kitamura,T., Fujita,T., Ezaki,O., Aizawa,S., and Kadowaki,T. (1999). PPAR gamma mediates high-fat diet-induced adipocyte hypertrophy and insulin resistance. Mol. Cell 4, 597-609.
Kutlu,B., Cardozo,A.K., Darville,M.I., Kruhoffer,M., Magnusson,N., Orntoft,T., and Eizirik,D.L. (2003). Discovery of gene networks regulating cytokine-induced dysfunction and apoptosis in insulin-producing INS-1 cells. Diabetes 52, 2701- 2719.
Larsen,C.M., Wadt,K.A., Juhl,L.F., Andersen,H.U., Karlsen,A.E., Su,M.S., Seedorf,K., Shapiro,L., Dinarello,C.A., and Mandrup-Poulsen,T. (1998). Interleukin-1beta-induced rat pancreatic islet nitric oxide synthesis requires both the p38 and extracellular signal-regulated kinase 1/2 mitogen-activated protein kinases. J. Biol. Chem. 273, 15294-15300.
Le Lay,S., Boucher,J., Rey,A., Castan-Laurell,I., Krief,S., Ferre,P., Valet,P., and Dugail,I. (2001). Decreased resistin expression in mice with different sensitivities to a high-fat diet. Biochem. Biophys. Res. Commun. 289, 564-567.
Lee,K.A., Hai,T.Y., SivaRaman,L., Thimmappaya,B., Hurst,H.C., Jones,N.C., and Green,M.R. (1987). A cellular protein, activating transcription factor,
173 activates transcription of multiple E1A-inducible adenovirus early promoters. Proc. Natl. Acad. Sci. U. S. A 84, 8355-8359.
Lee,Y., Hirose,H., Ohneda,M., Johnson,J.H., McGarry,J.D., and Unger,R.H. (1994). Beta-cell lipotoxicity in the pathogenesis of non-insulin-dependent diabetes mellitus of obese rats: impairment in adipocyte-beta-cell relationships. Proc. Natl. Acad. Sci. U. S. A 91, 10878-10882.
Levy,J.R., Davenport,B., Clore,J.N., and Stevens,W. (2002). Lipid metabolism and resistin gene expression in insulin-resistant Fischer 344 rats. Am. J. Physiol Endocrinol. Metab 282, E626-E633.
Liang,G., Wolfgang,C.D., Chen,B.P., Chen,T.H., and Hai,T. (1996). ATF3 gene. Genomic organization, promoter, and regulation. J. Biol. Chem. 271, 1695- 1701.
Liang,J., Zubovitz,J., Petrocelli,T., Kotchetkov,R., Connor,M.K., Han,K., Lee,J.H., Ciarallo,S., Catzavelos,C., Beniston,R., Franssen,E., and Slingerland,J.M. (2002). PKB/Akt phosphorylates p27, impairs nuclear import of p27 and opposes p27-mediated G1 arrest. Nat. Med. 8, 1153-1160.
Liang,L., Zhou,T., Jiang,J., Pierce,J.H., Gustafson,T.A., and Frank,S.J. (1999). Insulin receptor substrate-1 enhances growth hormone-induced proliferation. Endocrinology 140, 1972-1983.
Like,A.A., Biron,C.A., Weringer,E.J., Byman,K., Sroczynski,E., and Guberski,D.L. (1986). Prevention of diabetes in BioBreeding/Worcester rats with monoclonal antibodies that recognize T lymphocytes or natural killer cells. J. Exp. Med. 164, 1145-1159.
Like,A.A., Kislauskis,E., Williams,R.R., and Rossini,A.A. (1982). Neonatal thymectomy prevents spontaneous diabetes mellitus in the BB/W rat. Science 216, 644-646.
Like,A.A. and Rossini,A.A. (1976). Streptozotocin-induced pancreatic insulitis: new model of diabetes mellitus. Science 193, 415-417.
Lin,Y.S. and Green,M.R. (1988). Interaction of a common cellular transcription factor, ATF, with regulatory elements in both E1a- and cyclic AMP-inducible promoters. Proc. Natl. Acad. Sci. U. S. A 85, 3396-3400.
Lin,Y.Z., Yao,S.Y., Veach,R.A., Torgerson,T.R., and Hawiger,J. (1995). Inhibition of nuclear translocation of transcription factor NF-kappa B by a synthetic peptide containing a cell membrane-permeable motif and nuclear localization sequence. J. Biol. Chem. 270, 14255-14258.
174 Ling,V., Wu,P.W., Finnerty,H.F., Sharpe,A.H., Gray,G.S., and Collins,M. (1999). Complete sequence determination of the mouse and human CTLA4 gene loci: cross-species DNA sequence similarity beyond exon borders. Genomics 60, 341-355.
Lingohr,M.K., Dickson,L.M., Wrede,C.E., Briaud,I., McCuaig,J.F., Myers,M.G., Jr., and Rhodes,C.J. (2003). Decreasing IRS-2 expression in pancreatic beta- cells (INS-1) promotes apoptosis, which can be compensated for by introduction of IRS-4 expression. Mol. Cell Endocrinol. 209, 17-31.
Liu,D., Pavlovic,D., Chen,M.C., Flodstrom,M., Sandler,S., and Eizirik,D.L. (2000). Cytokines induce apoptosis in beta-cells isolated from mice lacking the inducible isoform of nitric oxide synthase (iNOS-/-). Diabetes 49, 1116-1122.
Livingstone,C., Patel,G., and Jones,N. (1995). ATF-2 contains a phosphorylation-dependent transcriptional activation domain. EMBO J. 14, 1785-1797.
Lizcano,J.M. and Alessi,D.R. (2002). The insulin signalling pathway. Curr. Biol. 12, R236-R238.
Lochhead,P.A., Salt,I.P., Walker,K.S., Hardie,D.G., and Sutherland,C. (2000). 5-aminoimidazole-4-carboxamide riboside mimics the effects of insulin on the expression of the 2 key gluconeogenic genes PEPCK and glucose-6- phosphatase. Diabetes 49, 896-903.
Lorenzo,A., Razzaboni,B., Weir,G.C., and Yankner,B.A. (1994). Pancreatic islet cell toxicity of amylin associated with type-2 diabetes mellitus. Nature 368, 756- 760.
Loweth,A.C., Williams,G.T., James,R.F., Scarpello,J.H., and Morgan,N.G. (1998). Human islets of Langerhans express Fas ligand and undergo apoptosis in response to interleukin-1beta and Fas ligation. Diabetes 47, 727-732.
Maechler,P., Jornot,L., and Wollheim,C.B. (1999). Hydrogen peroxide alters mitochondrial activation and insulin secretion in pancreatic beta cells. J. Biol. Chem. 274, 27905-27913.
Maeda,N., Shimomura,I., Kishida,K., Nishizawa,H., Matsuda,M., Nagaretani,H., Furuyama,N., Kondo,H., Takahashi,M., Arita,Y., Komuro,R., Ouchi,N., Kihara,S., Tochino,Y., Okutomi,K., Horie,M., Takeda,S., Aoyama,T., Funahashi,T., and Matsuzawa,Y. (2002). Diet-induced insulin resistance in mice lacking adiponectin/ACRP30. Nat. Med. 8, 731-737.
Maedler,K., Spinas,G.A., Dyntar,D., Moritz,W., Kaiser,N., and Donath,M.Y. (2001a). Distinct effects of saturated and monounsaturated fatty acids on beta- cell turnover and function. Diabetes 50, 69-76. 175 Maedler,K., Spinas,G.A., Lehmann,R., Sergeev,P., Weber,M., Fontana,A., Kaiser,N., and Donath,M.Y. (2001b). Glucose induces beta-cell apoptosis via upregulation of the Fas receptor in human islets. Diabetes 50, 1683-1690.
Maehama,T. and Dixon,J.E. (1998). The tumor suppressor, PTEN/MMAC1, dephosphorylates the lipid second messenger, phosphatidylinositol 3,4,5- trisphosphate. J. Biol. Chem. 273, 13375-13378.
Maira,S.M., Galetic,I., Brazil,D.P., Kaech,S., Ingley,E., Thelen,M., and Hemmings,B.A. (2001). Carboxyl-terminal modulator protein (CTMP), a negative regulator of PKB/Akt and v-Akt at the plasma membrane. Science 294, 374-380.
Mandrup-Poulsen,T. (1996). The role of interleukin-1 in the pathogenesis of IDDM. Diabetologia 39, 1005-1029.
Mandrup-Poulsen,T. (2001). beta-cell apoptosis: stimuli and signaling. Diabetes 50 Suppl 1, S58-S63.
Mandrup-Poulsen,T. (2003). Beta cell death and protection. Ann. N. Y. Acad. Sci. 1005, 32-42.
Mashima,T., Udagawa,S., and Tsuruo,T. (2001). Involvement of transcriptional repressor ATF3 in acceleration of caspase protease activation during DNA damaging agent-induced apoptosis. J. Cell Physiol 188, 352-358.
Mayo,L.D. and Donner,D.B. (2001). A phosphatidylinositol 3-kinase/Akt pathway promotes translocation of Mdm2 from the cytoplasm to the nucleus. Proc. Natl. Acad. Sci. U. S. A 98, 11598-11603.
McGrane,M.M., Yun,J.S., Patel,Y.M., and Hanson,R.W. (1992). Metabolic control of gene expression: in vivo studies with transgenic mice. Trends Biochem. Sci. 17, 40-44.
McTernan,P.G., McTernan,C.L., Chetty,R., Jenner,K., Fisher,F.M., Lauer,M.N., Crocker,J., Barnett,A.H., and Kumar,S. (2002). Increased resistin gene and protein expression in human abdominal adipose tissue. J. Clin. Endocrinol. Metab 87, 2407.
Meyer,T.E. and Habener,J.F. (1993). Cyclic adenosine 3',5'-monophosphate response element binding protein (CREB) and related transcription-activating deoxyribonucleic acid-binding proteins. Endocr. Rev. 14, 269-290.
Mirzabekov,T.A., Lin,M.C., and Kagan,B.L. (1996). Pore formation by the cytotoxic islet amyloid peptide amylin. J. Biol. Chem. 271, 1988-1992.
176 Moon,B., Kwan,J.J., Duddy,N., Sweeney,G., and Begum,N. (2003). Resistin inhibits glucose uptake in L6 cells independently of changes in insulin signaling and GLUT4 translocation. Am. J. Physiol Endocrinol. Metab 285, E106-E115.
Nakagawa,T., Zhu,H., Morishima,N., Li,E., Xu,J., Yankner,B.A., and Yuan,J. (2000). Caspase-12 mediates endoplasmic-reticulum-specific apoptosis and cytotoxicity by amyloid-beta. Nature 403, 98-103.
Nakagomi,S., Suzuki,Y., Namikawa,K., Kiryu-Seo,S., and Kiyama,H. (2003). Expression of the activating transcription factor 3 prevents c-Jun N-terminal kinase-induced neuronal death by promoting heat shock protein 27 expression and Akt activation. J. Neurosci. 23, 5187-5196.
Nawa,T., Nawa,M.T., Adachi,M.T., Uchimura,I., Shimokawa,R., Fujisawa,K., Tanaka,A., Numano,F., and Kitajima,S. (2002). Expression of transcriptional repressor ATF3/LRF1 in human atherosclerosis: colocalization and possible involvement in cell death of vascular endothelial cells. Atherosclerosis 161, 281- 291.
Nawa,T., Nawa,M.T., Cai,Y., Zhang,C., Uchimura,I., Narumi,S., Numano,F., and Kitajima,S. (2000). Repression of TNF-alpha-induced E-selectin expression by PPAR activators: involvement of transcriptional repressor LRF-1/ATF3. Biochem. Biophys. Res. Commun. 275, 406-411.
Neidle,S. (1979). The molecular basis for the action of some DNA-binding drugs. Prog. Med. Chem. 16, 151-221.
Nepom,B.S., Palmer,J., Kim,S.J., Hansen,J.A., Holbeck,S.L., and Nepom,G.T. (1986). Specific genomic markers for the HLA-DQ subregion discriminate between DR4+ insulin-dependent diabetes mellitus and DR4+ seropositive juvenile rheumatoid arthritis. J. Exp. Med. 164, 345-350.
Newman,J.R. and Keating,A.E. (2003). Comprehensive identification of human bZIP interactions with coiled-coil arrays. Science 300, 2097-2101.
Nicholson,K.M. and Anderson,N.G. (2002). The protein kinase B/Akt signalling pathway in human malignancy. Cell Signal. 14, 381-395.
Nilsson,M., Toftgard,R., and Bohm,S. (1995). Activated Ha-Ras but not TPA induces transcription through binding sites for activating transcription factor 3/Jun and a novel nuclear factor. J. Biol. Chem. 270, 12210-12218.
Nobori,K., Ito,H., Tamamori-Adachi,M., Adachi,S., Ono,Y., Kawauchi,J., Kitajima,S., Marumo,F., and Isobe,M. (2002). ATF3 inhibits doxorubicin-induced apoptosis in cardiac myocytes: a novel cardioprotective role of ATF3. J. Mol. Cell Cardiol. 34, 1387-1397.
177 Noorchashm,H., Noorchashm,N., Kern,J., Rostami,S.Y., Barker,C.F., and Naji,A. (1997). B-cells are required for the initiation of insulitis and sialitis in nonobese diabetic mice. Diabetes 46, 941-946.
Oakes,N.D., Thalen,P.G., Jacinto,S.M., and Ljung,B. (2001). Thiazolidinediones increase plasma-adipose tissue FFA exchange capacity and enhance insulin- mediated control of systemic FFA availability. Diabetes 50, 1158-1165.
Okamoto,Y., Chaves,A., Chen,J., Kelley,R., Jones,K., Weed,H.G., Gardner,K.L., Gangi,L., Yamaguchi,M., Klomkleaw,W., Nakayama,T., Hamlin,R.L., Carnes,C., Altschuld,R., Bauer,J., and Hai,T. (2001). Transgenic mice with cardiac-specific expression of activating transcription factor 3, a stress-inducible gene, have conduction abnormalities and contractile dysfunction. Am. J. Pathol. 159, 639-650.
Okuno,A., Tamemoto,H., Tobe,K., Ueki,K., Mori,Y., Iwamoto,K., Umesono,K., Akanuma,Y., Fujiwara,T., Horikoshi,H., Yazaki,Y., and Kadowaki,T. (1998). Troglitazone increases the number of small adipocytes without the change of white adipose tissue mass in obese Zucker rats. J. Clin. Invest 101, 1354-1361.
Oyadomari,S., Koizumi,A., Takeda,K., Gotoh,T., Akira,S., Araki,E., and Mori,M. (2002). Targeted disruption of the Chop gene delays endoplasmic reticulum stress-mediated diabetes. J. Clin. Invest 109, 525-532.
Oyadomari,S., Takeda,K., Takiguchi,M., Gotoh,T., Matsumoto,M., Wada,I., Akira,S., Araki,E., and Mori,M. (2001). Nitric oxide-induced apoptosis in pancreatic beta cells is mediated by the endoplasmic reticulum stress pathway. Proc. Natl. Acad. Sci. U. S. A 98, 10845-10850.
Palmer,J.P., Asplin,C.M., Clemons,P., Lyen,K., Tatpati,O., Raghu,P.K., and Paquette,T.L. (1983). Insulin antibodies in insulin-dependent diabetics before insulin treatment. Science 222, 1337-1339.
Pan,Y., Chen,H., Siu,F., and Kilberg,M.S. (2003). Amino acid deprivation and endoplasmic reticulum stress induce expression of multiple activating transcription factor-3 mRNA species that, when overexpressed in HepG2 cells, modulate transcription by the human asparagine synthetase promoter. J. Biol. Chem. 278, 38402-38412.
Pavlovic,D., Andersen,N.A., Mandrup-Poulsen,T., and Eizirik,D.L. (2000). Activation of extracellular signal-regulated kinase (ERK)1/2 contributes to cytokine-induced apoptosis in purified rat pancreatic beta-cells. Eur. Cytokine Netw. 11, 267-274.
Pavlovic,D., Chen,M.C., Gysemans,C.A., Mathieu,C., and Eizirik,D.L. (1999). The role of interferon regulatory factor-1 in cytokine-induced mRNA expression and cell death in murine pancreatic beta-cells. Eur. Cytokine Netw. 10, 403-412. 178 Perez,S., Vial,E., van Dam,H., and Castellazzi,M. (2001). Transcription factor ATF3 partially transforms chick embryo fibroblasts by promoting growth factor- independent proliferation. Oncogene 20, 1135-1141.
Peterson,R.T. and Schreiber,S.L. (1999). Kinase phosphorylation: Keeping it all in the family. Curr. Biol. 9, R521-R524.
Pietropaolo,M., Castano,L., Babu,S., Buelow,R., Kuo,Y.L., Martin,S., Martin,A., Powers,A.C., Prochazka,M., and Naggert,J. (1993). Islet cell autoantigen 69 kD (ICA69). Molecular cloning and characterization of a novel diabetes-associated autoantigen. J. Clin. Invest 92, 359-371.
Poitout,V. and Robertson,R.P. (2002). Minireview: Secondary beta-cell failure in type 2 diabetes--a convergence of glucotoxicity and lipotoxicity. Endocrinology 143, 339-342.
Pugliese,A., Brown,D., Garza,D., Murchison,D., Zeller,M., Redondo,M., Diez,J., Eisenbarth,G.S., Patel,D.D., and Ricordi,C. (2001). Self-antigen-presenting cells expressing diabetes-associated autoantigens exist in both thymus and peripheral lymphoid organs. J. Clin. Invest 107, 555-564.
Rabin,D.U., Pleasic,S.M., Palmer-Crocker,R., and Shapiro,J.A. (1992). Cloning and expression of IDDM-specific human autoantigens. Diabetes 41, 183-186.
Rabinovitch,A., Suarez-Pinzon,W.L., Sorensen,O., and Bleackley,R.C. (1996). Inducible nitric oxide synthase (iNOS) in pancreatic islets of nonobese diabetic mice: identification of iNOS- expressing cells and relationships to cytokines expressed in the islets. Endocrinology 137, 2093-2099.
Rath,P.C. and Aggarwal,B.B. (1999). TNF-induced signaling in apoptosis. J. Clin. Immunol. 19, 350-364.
Ravichandran,L.V., Chen,H., Li,Y., and Quon,M.J. (2001). Phosphorylation of PTP1B at Ser(50) by Akt impairs its ability to dephosphorylate the insulin receptor. Mol. Endocrinol. 15, 1768-1780.
Roduit,R., Morin,J., Masse,F., Segall,L., Roche,E., Newgard,C.B., Assimacopoulos-Jeannet,F., and Prentki,M. (2000). Glucose down-regulates the expression of the peroxisome proliferator-activated receptor-alpha gene in the pancreatic beta -cell. J. Biol. Chem. 275, 35799-35806.
Rosen,P., Nawroth,P.P., King,G., Moller,W., Tritschler,H.J., and Packer,L. (2001). The role of oxidative stress in the onset and progression of diabetes and its complications: a summary of a Congress Series sponsored by UNESCO-MCBN, the American Diabetes Association and the German Diabetes Society. Diabetes Metab Res. Rev. 17, 189-212.
179 Rossig,L., Jadidi,A.S., Urbich,C., Badorff,C., Zeiher,A.M., and Dimmeler,S. (2001). Akt-dependent phosphorylation of p21(Cip1) regulates PCNA binding and proliferation of endothelial cells. Mol. Cell Biol. 21, 5644-5657.
Saafi,E.L., Konarkowska,B., Zhang,S., Kistler,J., and Cooper,G.J. (2001). Ultrastructural evidence that apoptosis is the mechanism by which human amylin evokes death in RINm5F pancreatic islet beta-cells. Cell Biol. Int. 25, 339-350.
Saklatvala,J., Dean,J., and Finch,A. (1999). Protein kinase cascades in intracellular signalling by interleukin-I and tumour necrosis factor. Biochem. Soc. Symp. 64, 63-77.
Saltiel,A.R. and Kahn,C.R. (2001). Insulin signalling and the regulation of glucose and lipid metabolism. Nature 414, 799-806.
Sander,M. and German,M.S. (1997). The beta cell transcription factors and development of the pancreas. J. Mol. Med. 75, 327-340.
Sandler,S., Eizirik,D.L., Svensson,C., Strandell,E., Welsh,M., and Welsh,N. (1991). Biochemical and molecular actions of interleukin-1 on pancreatic beta- cells. Autoimmunity 10, 241-253.
Schlaepfer,I.R., Pulawa,L.K., Ferreira,L.D., James,D.E., Capell,W.H., and Eckel,R.H. (2003). Increased expression of the SNARE accessory protein Munc18c in lipid-mediated insulin resistance. J. Lipid Res. 44, 1174-1181.
Schmelzle,T. and Hall,M.N. (2000). TOR, a central controller of cell growth. Cell 103, 253-262.
Serreze,D.V. (1993). Autoimmune diabetes results from genetic defects manifest by antigen presenting cells. FASEB J. 7, 1092-1096.
Serreze,D.V., Chapman,H.D., Varnum,D.S., Hanson,M.S., Reifsnyder,P.C., Richard,S.D., Fleming,S.A., Leiter,E.H., and Shultz,L.D. (1996). B lymphocytes are essential for the initiation of T cell-mediated autoimmune diabetes: analysis of a new "speed congenic" stock of NOD.Ig mu null mice. J. Exp. Med. 184, 2049-2053.
Shimabukuro,M., Zhou,Y.T., Levi,M., and Unger,R.H. (1998). Fatty acid- induced beta cell apoptosis: a link between obesity and diabetes. Proc. Natl. Acad. Sci. U. S. A 95, 2498-2502.
Shin,I., Yakes,F.M., Rojo,F., Shin,N.Y., Bakin,A.V., Baselga,J., and Arteaga,C.L. (2002). PKB/Akt mediates cell-cycle progression by phosphorylation of p27(Kip1) at threonine 157 and modulation of its cellular localization. Nat. Med. 8, 1145-1152. 180 Sjoholm,A. (1996). Nitric oxide donor SIN-1 inhibits insulin release. Am. J. Physiol 271, C1098-C1102.
Stambolic,V., Suzuki,A., de la Pompa,J.L., Brothers,G.M., Mirtsos,C., Sasaki,T., Ruland,J., Penninger,J.M., Siderovski,D.P., and Mak,T.W. (1998). Negative regulation of PKB/Akt-dependent cell survival by the tumor suppressor PTEN. Cell 95, 29-39.
Stefan,Y., Orci,L., Malaisse-Lagae,F., Perrelet,A., Patel,Y., and Unger,R.H. (1982). Quantitation of endocrine cell content in the pancreas of nondiabetic and diabetic humans. Diabetes 31, 694-700.
Steppan,C.M., Bailey,S.T., Bhat,S., Brown,E.J., Banerjee,R.R., Wright,C.M., Patel,H.R., Ahima,R.S., and Lazar,M.A. (2001). The hormone resistin links obesity to diabetes. Nature 409, 307-312.
Suk,K., Kim,S., Kim,Y.H., Kim,K.A., Chang,I., Yagita,H., Shong,M., and Lee,M.S. (2001). IFN-gamma/TNF-alpha synergism as the final effector in autoimmune diabetes: a key role for STAT1/IFN regulatory factor-1 pathway in pancreatic beta cell death. J. Immunol. 166, 4481-4489.
Takamura,T., Kato,I., Kimura,N., Nakazawa,T., Yonekura,H., Takasawa,S., and Okamoto,H. (1998). Transgenic mice overexpressing type 2 nitric-oxide synthase in pancreatic beta cells develop insulin-dependent diabetes without insulitis. J. Biol. Chem. 273, 2493-2496.
Tau,G. and Rothman,P. (1999). Biologic functions of the IFN-gamma receptors. Allergy 54, 1233-1251.
Thomas,H.E., Darwiche,R., Corbett,J.A., and Kay,T.W. (2002). Interleukin-1 plus gamma-interferon-induced pancreatic beta-cell dysfunction is mediated by beta-cell nitric oxide production. Diabetes 51, 311-316.
Tiedge,M., Lortz,S., Drinkgern,J., and Lenzen,S. (1997). Relation between antioxidant enzyme gene expression and antioxidative defense status of insulin- producing cells. Diabetes 46, 1733-1742.
Todd,J.A., Bell,J.I., and McDevitt,H.O. (1987). HLA-DQ beta gene contributes to susceptibility and resistance to insulin-dependent diabetes mellitus. Nature 329, 599-604.
Toker,A. and Newton,A.C. (2000). Akt/protein kinase B is regulated by autophosphorylation at the hypothetical PDK-2 site. J. Biol. Chem. 275, 8271- 8274.
Trincavelli,M.L., Marselli,L., Falleni,A., Gremigni,V., Ragge,E., Dotta,F., Santangelo,C., Marchetti,P., Lucacchini,A., and Martini,C. (2002). Upregulation 181 of mitochondrial peripheral benzodiazepine receptor expression by cytokine- induced damage of human pancreatic islets. J. Cell Biochem. 84, 636-644.
Tuomilehto,J., Lindstrom,J., Eriksson,J.G., Valle,T.T., Hamalainen,H., Ilanne- Parikka,P., Keinanen-Kiukaanniemi,S., Laakso,M., Louheranta,A., Rastas,M., Salminen,V., and Uusitupa,M. (2001). Prevention of type 2 diabetes mellitus by changes in lifestyle among subjects with impaired glucose tolerance. N. Engl. J. Med. 344, 1343-1350.
Tuttle,R.L., Gill,N.S., Pugh,W., Lee,J.P., Koeberlein,B., Furth,E.E., Polonsky,K.S., Naji,A., and Birnbaum,M.J. (2001). Regulation of pancreatic beta-cell growth and survival by the serine/threonine protein kinase Akt1/PKBalpha. Nat. Med. 7, 1133-1137.
Ueda,H., Howson,J.M., Esposito,L., Heward,J., Snook,H., Chamberlain,G., Rainbow,D.B., Hunter,K.M., Smith,A.N., Di Genova,G., Herr,M.H., Dahlman,I., Payne,F., Smyth,D., Lowe,C., Twells,R.C., Howlett,S., Healy,B., Nutland,S., Rance,H.E., Everett,V., Smink,L.J., Lam,A.C., Cordell,H.J., Walker,N.M., Bordin,C., Hulme,J., Motzo,C., Cucca,F., Hess,J.F., Metzker,M.L., Rogers,J., Gregory,S., Allahabadia,A., Nithiyananthan,R., Tuomilehto-Wolf,E., Tuomilehto,J., Bingley,P., Gillespie,K.M., Undlien,D.E., Ronningen,K.S., Guja,C., Ionescu-Tirgoviste,C., Savage,D.A., Maxwell,A.P., Carson,D.J., Patterson,C.C., Franklyn,J.A., Clayton,D.G., Peterson,L.B., Wicker,L.S., Todd,J.A., and Gough,S.C. (2003). Association of the T-cell regulatory gene CTLA4 with susceptibility to autoimmune disease. Nature 423, 506-511.
Vafiadis,P., Bennett,S.T., Todd,J.A., Nadeau,J., Grabs,R., Goodyer,C.G., Wickramasinghe,S., Colle,E., and Polychronakos,C. (1997). Insulin expression in human thymus is modulated by INS VNTR alleles at the IDDM2 locus. Nat. Genet. 15, 289-292. van Dam,H., Wilhelm,D., Herr,I., Steffen,A., Herrlich,P., and Angel,P. (1995). ATF-2 is preferentially activated by stress-activated protein kinases to mediate c-jun induction in response to genotoxic agents. EMBO J. 14, 1798-1811. van Dam,R.M. (2003). The epidemiology of lifestyle and risk for type 2 diabetes. Eur. J. Epidemiol. 18, 1115-1125.
Viglietto,G., Motti,M.L., Bruni,P., Melillo,R.M., D'Alessio,A., Califano,D., Vinci,F., Chiappetta,G., Tsichlis,P., Bellacosa,A., Fusco,A., and Santoro,M. (2002). Cytoplasmic relocalization and inhibition of the cyclin-dependent kinase inhibitor p27(Kip1) by PKB/Akt-mediated phosphorylation in breast cancer. Nat. Med. 8, 1136-1144.
Waeber,G., Delplanque,J., Bonny,C., Mooser,V., Steinmann,M., Widmann,C., Maillard,A., Miklossy,J., Dina,C., Hani,E.H., Vionnet,N., Nicod,P., Boutin,P., and
182 Froguel,P. (2000). The gene MAPK8IP1, encoding islet-brain-1, is a candidate for type 2 diabetes. Nat. Genet. 24, 291-295.
Wang,A., Gu,J., Judson-Kremer,K., Powell,K.L., Mistry,H., Simhambhatla,P., Aldaz,C.M., Gaddis,S., and MacLeod,M.C. (2003a). Response of human mammary epithelial cells to DNA damage induced by BPDE: involvement of novel regulatory pathways. Carcinogenesis 24, 225-234.
Wang,G.L. and Semenza,G.L. (1995). Purification and characterization of hypoxia-inducible factor 1. J. Biol. Chem. 270, 1230-1237.
Wang,J., Cao,Y., and Steiner,D.F. (2003b). Regulation of proglucagon transcription by activated transcription factor (ATF) 3 and a novel isoform, ATF3b, through the cAMP-response element/ATF site of the proglucagon gene promoter. J. Biol. Chem. 278, 32899-32904.
Waterhouse,P., Penninger,J.M., Timms,E., Wakeham,A., Shahinian,A., Lee,K.P., Thompson,C.B., Griesser,H., and Mak,T.W. (1995). Lymphoproliferative disorders with early lethality in mice deficient in Ctla-4. Science 270, 985-988.
Welsh,N., Eizirik,D.L., Bendtzen,K., and Sandler,S. (1991). Interleukin-1 beta- induced nitric oxide production in isolated rat pancreatic islets requires gene transcription and may lead to inhibition of the Krebs cycle enzyme aconitase. Endocrinology 129, 3167-3173.
Wenger,R.H. (2002). Cellular adaptation to hypoxia: O2-sensing protein hydroxylases, hypoxia-inducible transcription factors, and O2-regulated gene expression. FASEB J. 16, 1151-1162.
Westermark,P. and Wilander,E. (1978). The influence of amyloid deposits on the islet volume in maturity onset diabetes mellitus. Diabetologia 15, 417-421.
Wick,K.R., Werner,E.D., Langlais,P., Ramos,F.J., Dong,L.Q., Shoelson,S.E., and Liu,F. (2003). Grb10 inhibits insulin-stimulated insulin receptor substrate (IRS)-phosphatidylinositol 3-kinase/Akt signaling pathway by disrupting the association of IRS-1/IRS-2 with the insulin receptor. J. Biol. Chem. 278, 8460- 8467.
Williams,M.R., Arthur,J.S., Balendran,A., van der,K.J., Poli,V., Cohen,P., and Alessi,D.R. (2000). The role of 3-phosphoinositide-dependent protein kinase 1 in activating AGC kinases defined in embryonic stem cells. Curr. Biol. 10, 439- 448.
Winer,N. and Sowers,J.R. (2004). Epidemiology of diabetes. J. Clin. Pharmacol. 44, 397-405.
183 Withers,D.J., Gutierrez,J.S., Towery,H., Burks,D.J., Ren,J.M., Previs,S., Zhang,Y., Bernal,D., Pons,S., Shulman,G.I., Bonner-Weir,S., and White,M.F. (1998). Disruption of IRS-2 causes type 2 diabetes in mice. Nature 391, 900- 904.
Wolf,E., Spencer,K.M., and Cudworth,A.G. (1983). The genetic susceptibility to type 1 (insulin-dependent) diabetes: analysis of the HLA-DR association. Diabetologia 24, 224-230.
Wolfgang,C.D., Chen,B.P., Martindale,J.L., Holbrook,N.J., and Hai,T. (1997). gadd153/Chop10, a potential target gene of the transcriptional repressor ATF3. Mol. Cell Biol. 17, 6700-6707.
Wollheim,C.B. and Sharp,G.W. (1981). Regulation of insulin release by calcium. Physiol Rev. 61, 914-973.
Wu,K.L., Gannon,M., Peshavaria,M., Offield,M.F., Henderson,E., Ray,M., Marks,A., Gamer,L.W., Wright,C.V., and Stein,R. (1997). Hepatocyte nuclear factor 3beta is involved in pancreatic beta-cell-specific transcription of the pdx-1 gene. Mol. Cell Biol. 17, 6002-6013.
Yamaguchi,H. and Wang,H.G. (2001). The protein kinase PKB/Akt regulates cell survival and apoptosis by inhibiting Bax conformational change. Oncogene 20, 7779-7786.
Yamauchi,T., Kamon,J., Waki,H., Terauchi,Y., Kubota,N., Hara,K., Mori,Y., Ide,T., Murakami,K., Tsuboyama-Kasaoka,N., Ezaki,O., Akanuma,Y., Gavrilova,O., Vinson,C., Reitman,M.L., Kagechika,H., Shudo,K., Yoda,M., Nakano,Y., Tobe,K., Nagai,R., Kimura,S., Tomita,M., Froguel,P., and Kadowaki,T. (2001). The fat-derived hormone adiponectin reverses insulin resistance associated with both lipoatrophy and obesity. Nat. Med. 7, 941-946.
Yan,C., Wang,H., and Boyd,D.D. (2002). ATF3 represses 72-kDa type IV collagenase (MMP-2) expression by antagonizing p53-dependent trans- activation of the collagenase promoter. J. Biol. Chem. 277, 10804-10812.
Yang,J., Cron,P., Good,V.M., Thompson,V., Hemmings,B.A., and Barford,D. (2002). Crystal structure of an activated Akt/protein kinase B ternary complex with GSK3-peptide and AMP-PNP. Nat. Struct. Biol. 9, 940-944.
Yin,J.C., Wallach,J.S., Del Vecchio,M., Wilder,E.L., Zhou,H., Quinn,W.G., and Tully,T. (1994). Induction of a dominant negative CREB transgene specifically blocks long-term memory in Drosophila. Cell 79, 49-58.
Yin,T., Sandhu,G., Wolfgang,C.D., Burrier,A., Webb,R.L., Rigel,D.F., Hai,T., and Whelan,J. (1997). Tissue-specific pattern of stress kinase activation in ischemic/reperfused heart and kidney. J. Biol. Chem. 272, 19943-19950. 184 Yoon,J.W., Jun,H.S., and Santamaria,P. (1998). Cellular and molecular mechanisms for the initiation and progression of beta cell destruction resulting from the collaboration between macrophages and T cells. Autoimmunity 27, 109-122.
Yu,R., Shtil,A.A., Tan,T.H., Roninson,I.B., and Kong,A.N. (1996). Adriamycin activates c-jun N-terminal kinase in human leukemia cells: a relevance to apoptosis. Cancer Lett. 107, 73-81.
Yuan,M., Konstantopoulos,N., Lee,J., Hansen,L., Li,Z.W., Karin,M., and Shoelson,S.E. (2001). Reversal of obesity- and diet-induced insulin resistance with salicylates or targeted disruption of Ikkbeta. Science 293, 1673-1677.
Zhang,C., Gao,C., Kawauchi,J., Hashimoto,Y., Tsuchida,N., and Kitajima,S. (2002). Transcriptional activation of the human stress-inducible transcriptional repressor ATF3 gene promoter by p53. Biochem. Biophys. Res. Commun. 297, 1302-1310.
Zhang,C., Kawauchi,J., Adachi,M.T., Hashimoto,Y., Oshiro,S., Aso,T., and Kitajima,S. (2001). Activation of JNK and transcriptional repressor ATF3/LRF1 through the IRE1/TRAF2 pathway is implicated in human vascular endothelial cell death by homocysteine. Biochem. Biophys. Res. Commun. 289, 718-724.
Zhou,B.P., Liao,Y., Xia,W., Spohn,B., Lee,M.H., and Hung,M.C. (2001). Cytoplasmic localization of p21Cip1/WAF1 by Akt-induced phosphorylation in HER-2/neu-overexpressing cells. Nat. Cell Biol. 3, 245-252.
Zimmermann,J., Erdmann,D., Lalande,I., Grossenbacher,R., Noorani,M., and Furst,P. (2000). Proteasome inhibitor induced gene expression profiles reveal overexpression of transcriptional regulators ATF3, GADD153 and MAD1. Oncogene 19, 2913-2920.
Zumsteg,U., Frigerio,S., and Hollander,G.A. (2000). Nitric oxide production and Fas surface expression mediate two independent pathways of cytokine-induced murine beta-cell damage. Diabetes 49, 39-47.
185