DOCSLIB.ORG

Species Arcobacter Transfer PCR to Detect Fluorescence Resonance

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Species Arcobacter Transfer PCR to Detect Fluorescence Resonance DOWNLOADED FROM Development of a Real-Time Fluorescence Resonance Energy jcm.ASM.ORG - Transfer PCR To Detect Arcobacter Library July 1, 2010 Species Khalil Abdelbaqi, Alice Buissonnière, Valérie at DigiTop -- USDA's Digital Desktop Prouzet-Mauleon, et al. 2007. Development of a Real-Time Fluorescence Resonance Energy Transfer PCR To Detect Arcobacter Species. J. Clin. Microbiol. 45(9):3015-3021. doi:10.1128/JCM.00256-07. Updated information and services can be found at: http://jcm.asm.org/cgi/content/full/45/9/3015 These include: CONTENT ALERTS Receive: RSS Feeds, eTOCs, free email alerts (when new articles cite this article), more>> Information about commercial reprint orders: http://journals.asm.org/misc/reprints.dtl To subscribe to an ASM journal go to: http://journals.asm.org/subscriptions/ DOWNLOADED FROM JOURNAL OF CLINICAL MICROBIOLOGY, Sept. 2007, p. 3015–3021 Vol. 45, No. 9 0095-1137/07/$08.00ϩ0 doi:10.1128/JCM.00256-07 Copyright © 2007, American Society for Microbiology. All Rights Reserved. Development of a Real-Time Fluorescence Resonance Energy jcm.ASM.ORG - ᰔ Transfer PCR To Detect Arcobacter Species Library July 1, 2010 Khalil Abdelbaqi,1 Alice Buissonnie`re,1 Vale´rie Prouzet-Mauleon,1 Jessica Gresser,1 Irene Wesley,3 Francis Me´graud,1,2* and Armelle Me´nard1,2 Universite´ Victor Segalen Bordeaux 2, Centre National de Re´fe´rence des Helicobacters et Campylobacters, F33076 Bordeaux, France1; at DigiTop -- USDA's Digital Desktop INSERM U853, F33076 Bordeaux, France2; and National Animal Disease Center, ARS, USDA, 2300 Dayton Road, Ames, Iowa3 Received 1 February 2007/Returned for modification 26 March 2007/Accepted 17 May 2007 A real-time PCR targeting the gyrase A subunit gene outside the quinolone resistance-determining region has been developed to detect Arcobacter species. The species identification was done by probe hybridization and melting curve analysis, using fluorescence resonance energy transfer technology. Discrimination between Arcobacter species was straightforward, as the corresponding melting points showed significant differences with the characteristic melting temperatures of 63.5°C, 58.4°C, 60.6°C, and 51.8°C for the Arcobacter butzleri, Arcobacter cryaerophilus, Arcobacter cibarius, and Arcobacter nitrofigilis type strains, respectively. The specificity of this assay was confirmed with pure cultures of 106 Arcobacter isolates from human clinical and veterinary specimens identified by phenotypic methods and 16S rRNA gene sequencing. The assay was then used to screen 345 clinical stool samples obtained from patients with diarrhea. The assay detected A. butzleri in four of these clinical samples (1.2%). These results were confirmed by a conventional PCR method targeting the 16S rRNA gene with subsequent sequencing of the PCR product. In conclusion, this real-time assay detects and differ- entiates Arcobacter species in pure culture as well as in the competing microbiota of the stool matrix. The assay is economical since only one biprobe is used and multiple Arcobacter species are identified in a single test. Aerotolerant spirillum/vibrio-like organisms from aborted been linked to sporadic cases of diarrhea and abdominal bovine fetuses were first described by Ellis et al. in 1977 (9) and cramps in patients with chronic diseases (24), such as neonatal designated Campylobacter cryaerophila on the basis of their bacteremia (27), liver cirrhosis (44), and acute appendicitis Campylobacter-like morphology, aerotolerance, and growth at (22). More recently, a Belgian study revealed that 3.5% of 25°C (9). After examining human and veterinary isolates of campylobacters and related organisms isolated from human these aerotolerant campylobacters, Kiehlbauch et al. identified stool samples over an 8-year period were A. butzleri (38). In two species, Campylobacter butzleri, corresponding to the ma- one of our previous studies, A. butzleri ranked fourth among jority of human clinical isolates, and Campylobacter cryaerophi- the 2,855 strains of Campylobacter-like organisms received dur- lus, consisting of two distinct groups (20). Vandamme et al. ing a 17-month surveillance of Campylobacter infections in proposed the genus Arcobacter to encompass aerotolerant France (28). These infections were associated with intestinal campylobacters (36). This genus comprises human and veteri- disorders resembling those caused by Campylobacter jejuni. nary species, including Arcobacter butzleri, Arcobacter cryaerophi- These observations suggest that the prevalence of this emerg- lus, Arcobacter cibarius, and Arcobacter skirrowii, and also the ing pathogen may be underestimated due to inadequate cul- type strain from the root of a Spartina plant, Arcobacter nitro- ture conditions and/or false identification (14, 38). Traditional figilis. Two new species, Arcobacter sulfidicus, which inhabits isolation methods for Arcobacter are similar to those for coastal marine water (42), and Arcobacter halophilus, isolated Campylobacter, although the majority do not grow at 42°C. The from a hypersaline lagoon (8), represent the diversity of Arco- problems associated with culture failure or with the standard bacter and its capacity to survive in the environment. The genus phenotypic methods of identification have led to the investi- Arcobacter has been included with the genus Campylobacter in gation of new approaches for assistance in the preliminary the Campylobacteraceae family, which is part of the Epsilon- diagnosis of Arcobacter infections. Conventional PCR-based proteobacteria (11). techniques targeting ribosomal genes, such as the 16S RNA Despite the prevalence of Arcobacter species in food speci- gene (13, 15, 32, 41) and the 23S rRNA gene (15, 16, 18, 26), mens, few studies have reported human Arcobacter infections have been widely used for the detection and identification of (23). The bacterium was first identified in 2.4% of clinical Arcobacter species. The increasing relevance of nucleic acid isolates from 631 Thai children with diarrhea (34). An out- amplification tests for the detection and identification of break of recurrent abdominal cramps in 10 young children in Arcobacter species is now obvious, particularly in light of culture Italy was attributed to A. butzleri (37). Arcobacter butzleri has failure and misidentification. With respect to nucleic acid am- plification tests, different real-time PCR chemistries are avail- * Corresponding author. Mailing address: INSERM U853, Univer- able, with the most frequently used formats being SYBR green, site´ Victor Segalen Bordeaux 2, Laboratoire de Bacte´riologie, Bat. 2B hybridization probes, TaqMan probes, molecular beacons, and RDC—Zone Nord, 146 rue Le´o Saignat, 33076 Bordeaux cedex, Scorpion probes. These PCR formats are usually very sensitive, France. Phone: 33 (0)556795910. Fax: 33 (0)556796018. E-mail: francis [email protected]. can be performed in less than 3 hours, and minimize the risk of ᰔ Published ahead of print on 25 July 2007. cross-contamination with other PCR products since all of the 3015 DOWNLOADED FROM 3016 ABDELBAQI ET AL. J. CLIN.MICROBIOL. TABLE 1. Sequences of the primers and probes designed for FRET-PCR identification of Arcobacter species Primer function and Ј Ј Nucleotide Sequence (5 to 3 ) a designation positions jcm.ASM.ORG - gyrA gene amplification and Library July 1, 2010 sequencing F-Arco-FRET5 TTGAAGATTCTTATGATGAAATTGA (sense) 1460–1484 R-Arco-FRET5 TGTATTTCTTCCTGCTTTTCTAATTG (antisense) 2364–2339 LC-FRET assay F1-FRET5 ATCTTTAGTATTCTTTACAAGAAATGG (sense) 1830–1856 at DigiTop -- USDA's Digital Desktop R2-FRET5 AACTGTTGTTCGTTTTCCA (antisense) 2181–2163 S-Ab-FRET5 Red 640-ATCAAGGAAGAAGTACAAGAGGTGTAAG-p (antisense) 2039–2066 A-Ab-FRET5 AGTCTTGGTCAATGTATTAGATTTGAACTTGAAAAAACAAG-F (antisense) 2036–1996 a The nucleotide positions of primers and probes were compared to the gyrA gene numbering of Arcobacter butzleri D2682, the type strain. steps occur in the same tube and no postamplification handling CCUG 145401, Campylobacter fetus UA60, Campylobacter hyointestinalis CCUG is necessary. Among these methods, two specific TaqMan as- 14169, Campylobacter mucosalis CIP 103750, Campylobacter sputorum CCUG 9728, says were recently described for detection of A. butzleri and A. Campylobacter upsaliensis CCUG 14913, and Campylobacter lari CCUG 23947, and Helicobacter strains, such as Helicobacter pullorum CCUG 33839, cryaerophilus (4). Helicobacter canadensis NCTC 13221, Helicobacter pylori J99, Helicobacter Real-time PCR using the fluorescence resonance energy hepaticus ATCC 51448, Helicobacter bilis ATCC 51630, Helicobacter muridarum transfer (FRET) hybridization probe method is very promising ATCC 49282, Helicobacter felis CCUG 28539 T, “Flexispira rappini” (proposed since it can detect single nucleotide polymorphisms (SNP) with name) CCUG 29176, and Wolinella succinogenes DSMZ 1740. Other enteric bacteria (clinical isolates) commonly isolated from patients (Escherichia coli, only one biprobe. We have recently described a FRET real- Salmonella enterica serovar Enteritidis, and Salmonella enterica serovar Typhi- time PCR assay targeting the gyrA gene for rapid and sensitive murium) were also tested. identification and differentiation of C. jejuni and Campy- Genomic DNA was isolated by using a QIAamp DNA mini kit (QIAGEN SA, lobacter coli (25). The present study reports the development Courtaboeuf, France) and stored at Ϫ20°C until required for analysis. of a real-time PCR assay using FRET chemistry and targeting Stool samples. In total, 345 stool clinical samples were screened
Load more

Recommended publications
  • (12) Patent Application Publication (10) Pub. No.: US 2012/0277127 A1 Hendrickson Et Al
    US 20120277127A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2012/0277127 A1 Hendrickson et al. (43) Pub. Date: Nov. 1, 2012 (54) METHODS, STRAINS, AND COMPOSITIONS Publication Classification USEFUL FOR MICROBALLY ENHANCED Int. C. OIL RECOVERY ARCOBACTER CLADE 1 (51) C09K 8/582 (2006.01) (75) Inventors: Edwin R. Hendrickson, Hockessin, CI2N L/20 (2006.01) DE (US); Scott Christopher Jackson, Wilmington, DE (US); Abigail K. Luckring, (US) (52) U.S. Cl. ...................................... 507/201:435/252.1 (73) Assignee: E. DUPONT DE NEMOURS AND COMPANY, Wilmington, DE (US) (57) ABSTRACT Appl. No.: Methods, microorganisms, and compositions are provided (21) 13/280,972 wherein oil reservoirs are inoculated with microorganisms (22) Filed: Oct. 25, 2011 belonging to Arcobacter clade 1 and medium including an electron acceptor. The Arcobacter strains grow in the oil Related U.S. Application Data reservoir to form plugging biofilms that reduce permeability (60) Provisional application No. 61/408,739, filed on Nov. in areas of Subterranean formations thereby increasing Sweep 1, 2010. efficiency, and thereby enhancing oil recovery. Patent Application Publication Nov. 1, 2012 Sheet 1 of 12 US 2012/0277127 A1 - - - - - - - us is us r u u ulu - ul |eunôl Patent Application Publication Nov. 1, 2012 Sheet 2 of 12 US 2012/0277127 A1 Patent Application Publication Nov. 1, 2012 Sheet 3 of 12 US 2012/0277127 A1 veenfil Patent Application Publication Nov. 1, 2012 Sheet 7 of 12 US 2012/0277127 A1 #7ºInfil Patent Application Publication Nov. 1, 2012 Sheet 8 of 12 US 2012/0277127 A1 G3Infil Patent Application Publication Nov.
    [Show full text]
  • Specific PCR Detection Of
    1491 Journal of Food Protection, Vol. 72, No. 7, 2009, Pages 1491–1495 Copyright ᮊ, International Association for Food Protection Research Note Specific PCR Detection of Arcobacter butzleri, Arcobacter cryaerophilus, Arcobacter skirrowii, and Arcobacter cibarius in Chicken Meat DANIELA PENTIMALLI,1 NICOLETTE PEGELS,2 TERESA GARCI´A,2 ROSARIO MARTI´N,2 Downloaded from http://meridian.allenpress.com/jfp/article-pdf/72/7/1491/1680203/0362-028x-72_7_1491.pdf by guest on 28 September 2021 AND ISABEL GONZA´ LEZ2* 1Dipartimento di Sanita` Pubblica, Facolta` di Agraria, Universita` degli studi di Parma, Parma, Italy; and 2Departamento de Nutricio´n, Bromatologı´a y Tecnologı´a de los Alimentos, Facultad de Veterinaria, Universidad Complutense, 28040 Madrid, Spain MS 08-536: Received 23 October 2008/Accepted 28 December 2008 ABSTRACT An enrichment PCR assay using species-specific primers was developed for the detection of Arcobacter butzleri, Arco- bacter cryaerophilus, Arcobacter skirrowii, and Arcobacter cibarius in chicken meat. Primers for A. cryaerophilus, A. skirrowii, and A. cibarius were designed based on the gyrA gene to amplify nucleic acid fragments of 212, 257, and 145 bp, respectively. The A. butzleri–specific primers were designed flanking a 203-bp DNA fragment in the 16S rRNA gene. The specificity of the four primer pairs was assessed by PCR analysis of DNA from a panel of Arcobacter species, related Campylobacter, Helicobacter species, and other food bacteria. The applicability of the method was then validated by testing 42 fresh retail- purchased chicken samples in the PCR assay. An 18-h selective preenrichment step followed by PCR amplification with the four Arcobacter primer sets revealed the presence of Arcobacter spp.
    [Show full text]
  • Diversity of Mat-Forming Sulfide-Oxidizing Bacteria at Continental Margins
    Diversity of Mat-forming Sulfide-oxidizing Bacteria at Continental Margins Dissertation zur Erlangung des Doktorgrades der Naturwissenschaften - Dr. rer. nat. - dem Fachbereich Biologie/Chemie der Universität Bremen vorgelegt von Stefanie Grünke Bremen, April 2010 Die vorliegende Doktorarbeit wurde in der Zeit von Juni 2006 bis April 2010 am Max- Planck-Institut für Marine Mikrobiologie und am Alfred-Wegener-Institut für Polar- und Meeresforschung angefertigt. 1. Gutachterin: Prof. Dr. Antje Boetius 2. Gutachter: Prof. Dr. Rudolf Amann Tag des Promotionskolloquiums: 4. Juni 2010 Diese Arbeit ist all denjenigen gewidmet, die ihre Segel setzen, um neue Welten gu erkunden. Seien sie sich gewiss, dass auf Sturm immer ruhiges Wasserfolgt. Wertrauen sie auf ihr größtes Gut — ihre Freunde und Familie. Nutgen sie ihre Schwächen, um neue Stärken gu finden. Soll Zuversicht ihr Kompass sein! Summary In the oceans, microbial mats formed by chemosynthetic sulfide-oxidizing bacteria are mostly found in so-called ‘reduced habitats’ that are characterized by chemoclines where energy-rich, reduced substances, like hydrogen sulfide, are transported into oxic or suboxic zones. There, these organisms often thrive in narrow zones or gradients of their electron donor (sulfide) and their electron acceptor (mostly oxygen or nitrate). Through the build up of large biomasses, mat-forming sulfide oxidizers may significantly contribute to primary production in their habitats and dense mats represent efficient benthic filters against the toxic gas hydrogen sulfide. As gradient organisms, these mat-forming sulfide oxidizers seem to be adapted to very defined ecological niches with respect to oxygen (or nitrate) and sulfide gradients. However, many aspects regarding their diversity as well as their geological drivers in marine sulfidic habitats required further investigation.
    [Show full text]
  • Biodegradation of Aromatic Hydrocarbons by Methanogenic Consortia and Groundwater-Associated Microbial Communities
    University of Calgary PRISM: University of Calgary's Digital Repository Graduate Studies The Vault: Electronic Theses and Dissertations 2021-01-08 Biodegradation of Aromatic Hydrocarbons by Methanogenic Consortia and Groundwater-Associated Microbial Communities Taylor, Nicole Taylor, N. (2021). Biodegradation of Aromatic Hydrocarbons by Methanogenic Consortia and Groundwater-Associated Microbial Communities (Unpublished master's thesis). University of Calgary, Calgary, AB. http://hdl.handle.net/1880/112987 master thesis University of Calgary graduate students retain copyright ownership and moral rights for their thesis. You may use this material in any way that is permitted by the Copyright Act or through licensing that has been assigned to the document. For uses that are not allowable under copyright legislation or licensing, you are required to seek permission. Downloaded from PRISM: https://prism.ucalgary.ca UNIVERSITY OF CALGARY Biodegradation of Aromatic Hydrocarbons by Methanogenic Consortia and Groundwater- Associated Microbial Communities by Nicole Taylor A THESIS SUBMITTED TO THE FACULTY OF GRADUATE STUDIES IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE GRADUATE PROGRAM IN BIOLOGICAL SCIENCES CALGARY, ALBERTA JANUARY, 2021 © Nicole Taylor 2021 Abstract The biodegradation of hydrocarbons is an important environmental process responsible for in situ remediation of crude oil and gas components. Microorganisms of many lineages and redox conditions have been characterized to degrade numerous types of
    [Show full text]
  • Dissertação Mestrado Ana Carreira.Pdf
    Caracterização de isolados de Campylobacter jejuni e Campylobacter coli obtidos de cecos de frangos, em Portugal, no âmbito de um estudo comunitário de prevalência Genotipagem e elucidação dos determinantes associados ao crescimento em biofilme RESUMO A Campilobacteriose é a zoonose mais notificada em países desenvolvidos, sendo Campylobacter jejuni o agente etiológico mais frequente e o consumo da carne de aves um importante factor de risco. A análise dos polimorfismos dos fragmentos de restrição do gene flaA de 112 isolados de C. coli e 67 de C. jejuni, obtidos de frangos de abate, em Portugal, durante o estudo nacional de prevalência de Campylobacter (Decisão da Comissão 2007/516/EC), gerou 11 perfis de restrição com HinfI (índice de diversidade Simpson; D=0,62) e 48 perfis com DdeI (D=0,89), evidenciando elevada variabilidade genética e ampla distribuição geográfica dos genótipos prevalentes. A comparação dos biofilmes formados por isolados de C. jejuni e C. coli em poliestireno, vidro e aço inoxidável, sugeriu, ainda, que o crescimento em biofilme poderá promover a sobrevivência destas bactérias em diferentes superfícies e condições de stresse ambiental, favorecendo a persistência ao longo da cadeia de processamento alimentar. i Characterization of Campylobacter jejuni and Campylobacter coli isolates obtained from broilers caeca, in Portugal, in the framework of a prevalence community study Genotyping and elucidation of biofilm growth associated determinants ABSTRACT Campylobacteriosis is the most notified zoonosis in developed countries, Campylobacter jejuni being the most frequent etiological agent and poultry meat consumption representing an important risk factor. Restriction fragment length polymorphism analysis of the flaA gene (flaA-RFLP) of 112 C.
    [Show full text]
  • Microorganisms Overwinter Within the Ice Column of a Coastal Antarctic Lake
    RESEARCH ARTICLE When a habitat freezes solid: microorganisms over-winter within the ice column ofa coastal Antarctic lake Christine M. Foreman1, Markus Dieser1, Mark Greenwood2, Rose M. Cory3, Johanna Laybourn-Parry4, John T. Lisle5, Christopher Jaros3, Penney L. Miller6, Yu-Ping Chin7 & Diane M. McKnight3 1Department of Land Resources and Environmental Sciences, Center for Biofilm Engineering, Montana State University, Bozeman, MT, USA; 2Department of Mathematical Sciences, Montana State University, Bozeman, MT, USA; 3INSTAAR, University of Colorado, Boulder, CO, USA; 4Bristol Glaciology Centre, University of Bristol, Bristol, UK; 5USGS, Center for Coastal and Watershed Studies, St. Petersburg, FL, USA; 6Department of 7 Chemistry, Rose-Hulman Institute of Technology, Terre Haute, IN, USA; and 285 Mendenhall Laboratory, the Ohio State University, School of Earth Downloaded from https://academic.oup.com/femsec/article/76/3/401/486873 by guest on 27 September 2021 Sciences, Columbus, OH, USA Correspondence: Christine M. Foreman, Abstract Department of Land Resources and Environmental Sciences, Center for Biofilm A major impediment to understanding the biology of microorganisms inhabiting Engineering, Montana State University, 366 Antarctic environments is the logistical constraint of conducting field work EPS Building, Bozeman, MT 59717, USA. primarily during the summer season. However, organisms that persist throughout Tel.: 11 406 994 7361; fax: 11 406 994 the year encounter severe environmental changes between seasons. In an attempt 6098; e-mail: [email protected] to bridge this gap, we collected ice core samples from Pony Lake in early November 2004 when the lake was frozen solid to its base, providing an archive for the Present address: Rose M.
    [Show full text]
  • Revisiting the Taxonomy of the Genus Arcobacter: Getting Order from the Chaos
    fmicb-09-02077 September 1, 2018 Time: 10:25 # 1 ORIGINAL RESEARCH published: 04 September 2018 doi: 10.3389/fmicb.2018.02077 Revisiting the Taxonomy of the Genus Arcobacter: Getting Order From the Chaos Alba Pérez-Cataluña1, Nuria Salas-Massó1, Ana L. Diéguez2, Sabela Balboa2, Alberto Lema2, Jesús L. Romalde2* and Maria J. Figueras1* 1 Departament de Ciències Mèdiques Bàsiques, Facultat de Medicina, Institut d’Investigació Sanitària Pere Virgili, Universitat Rovira i Virgili, Reus, Spain, 2 Departamento de Microbiología y Parasitología, CIBUS-Facultad de Biología, Universidade de Santiago de Compostela, Santiago de Compostela, Spain Since the description of the genus Arcobacter in 1991, a total of 27 species have been described, although some species have shown 16S rRNA similarities below 95%, which is the cut-off that usually separates species that belong to different genera. Edited by: The objective of the present study was to reassess the taxonomy of the genus Martha E. Trujillo, Arcobacter using information derived from the core genome (286 genes), a Multilocus Universidad de Salamanca, Spain Sequence Analysis (MLSA) with 13 housekeeping genes, as well as different genomic Reviewed by: John Phillip Bowman, indexes like Average Nucleotide Identity (ANI), in silico DNA–DNA hybridization (isDDH), University of Tasmania, Australia Average Amino-acid Identity (AAI), Percentage of Conserved Proteins (POCPs), and Javier Pascual, Deutsche Sammlung von Relative Synonymous Codon Usage (RSCU). The study included a total of 39 strains Mikroorganismen und Zellkulturen that represent all the 27 species included in the genus Arcobacter together with 13 (DSMZ), Germany strains that are potentially new species, and the analysis of 57 genomes.
    [Show full text]
  • APORTACIONES a LA EPIDEMIOLOGÍA DE Arcobacter Y Helicobacter Spp.: APLICACIÓN DE MÉTODOS MOLECULARES a SU DETECCIÓN E IDENTIFICACIÓN EN ALIMENTOS
    Universidad Politécnica de Valencia Departamento de Biotecnología APORTACIONES A LA EPIDEMIOLOGÍA DE Arcobacter Y Helicobacter spp.: APLICACIÓN DE MÉTODOS MOLECULARES A SU DETECCIÓN E IDENTIFICACIÓN EN ALIMENTOS Tesis Doctoral Autor: Isidro Favian Bayas Morejón Directoras: Dra. Ma Antonia Ferrús Pérez Dra. Ana González Pellicer Valencia, Octubre de 2016 DEDICATORIA Este trabajo realizado con mucho esfuerzo lo dedico a mi hijo Anthony Fabián, el cual ha sido la fuerza principal que me impulsó día a día para seguir adelante; a mi amada esposa Rosa Angélica, que de manera incondicional y pese a la distancia me ha apoyado, y me ha dado fuerzas para continuar. A mi querida madre Laura Judith, que sé que desde el cielo me ha estado iluminando en este largo camino. A mí apreciado padre Elías Alberto, a mis queridas hermanas; Rocío, Maritza y Rosario que aunque a la distancia me supieron apoyar. ¡Los quiero mucho! AGRADECIMIENTOS Agradezco a DIOS por brindarme siempre nuevas oportunidades en los caminos de la vida para así aprender día a día lo maravilloso que es vivir. Al finalizar esta tesis es muy satisfactorio expresar mi agradecimiento a mis directoras, Mª Antonia Ferrús y Ana González. Gracias por ofrecerme la oportunidad de trabajar con vosotras, por vuestra dirección, y por supuesto, por haberme guiado con buena voluntad, paciencia, amplio conocimiento y experiencia a lo largo de este trabajo. También quiero agradecer a todos quienes conforman el Departamento de Biotecnología: A Manuel Hernández, Jorge García, Rosa Montes y Ma Ángeles Castillo, gracias por brindarme vuestra confianza y valiosos consejos. A Ana Jiménez y Salut Botella, gracias por haberme permitido compartir con vosotras esa bonita experiencia de impartir y aprender a través de la docencia en prácticas.
    [Show full text]
  • Molecular Detection and Study of Campylobacter and Related
    Molecular detection and study of Campylobacter and related microorganisms Nisreen Hoosain A thesis submitted in partial fulfillment of the requirements for the degree of Doctor Philosophiae in the Department of Biotechnology, University of the Western Cape. Supervisor: Professor Pieter Andries Gouws Co-supervisor: Professor Albert Joseph Lastovica November 2010 i DECLARATION I declare that “Molecular detection and study of Campylobacter and related microorganisms” is my own work, that it has not been submitted before for any degree or examination in any other university, and that all the sources I have used or quoted have been indicated and acknowledged as complete references. Nisreen Hoosain November 2010 Signed:………………………. ii ACKNOWLEDGEMENTS First and foremost, I wish to thank Allah for giving me the strength, wisdom and guidance during my PhD and allowing me to obtain my PhD degree. I would like to thank my supervisor, Prof. P.A. Gouws, and my co-supervisor, Prof. A.J. Lastovica for their support, guidance, encouragement and advice. A special thanks to my colleagues in the laboratory as well as all staff in the Biotechnology Department at the University of the Western Cape. Thank you for your friendship, advice and making my stay an enjoyable one. To my beloved parents, brother, sister in-law, niece, nephew and other family members: thank you for your prayers, love, understanding, encouragement and support through the years. It is greatly appreciated, I am truly blessed! In addition, I would like to extend my sincere gratitude to my financial assistants: Department of Biotechnology at the University of the Western Cape, the National Research Foundation (NRF) of South Africa, Muslim Hands of South Africa and the South African National Zakah Fund (SANZAF).
    [Show full text]
  • A Systematic Analysis of Research on Arcobacter: Public Health Implications from a Food–Environment Interphase Perspective
    foods Systematic Review A Systematic Analysis of Research on Arcobacter: Public Health Implications from a Food–Environment Interphase Perspective Chidozie Declan Iwu 1,2,* , Temitope Cyrus Ekundayo 1,2,3 and Anthony Ifeanyin Okoh 1,2,4 1 SAMRC Microbial Water Quality Monitoring Centre, University of Fort Hare, Alice 5700, South Africa; [email protected] (T.C.E.); [email protected] (A.I.O.) 2 Applied and Environmental Microbiology Research Group, Department of Biochemistry and Microbiology, University of Fort Hare, Alice 5700, South Africa 3 Department of Biological Sciences, University of Medical Sciences, Ondo PMB 536, Nigeria 4 Department of Environmental Health Sciences, University of Sharjah, Sharjah P.O. Box 27272, United Arab Emirates * Correspondence: [email protected] Abstract: This review maps the global research landscape of the public health implications of Arcobacter from the food–environment interphase using content analytics and integrated science mapping. The search term “Arcobacter” was used to retrieve relevant articles published in Web of Science and Scopus between 1991 to 2019. The number of articles included in the review was 524, with 1304 authors, 172 journal sources, and a collaborative index of 2.55. The annual growth rate of the publications was 9.74%. The most contributing author in the field was Houf K., with 40 publications, 26 h-index, and 2020 total citations. The most productive country was the USA (13.33%). The majority of the articles were published in English (96%) and in the Journal of Food Protection (8.02%). The highest research outputs were in the field of Microbiology (264). The frequently occurred keywords Citation: Iwu, C.D.; Ekundayo, T.C.; were Arcobacter, poultry, shellfish, cattle, and chicken.
    [Show full text]
  • Arcobacter Spp., What Is Known and Unknown About a Potential Foodborne Zoonotic Agent
    Arcobacter spp., what is known and unknown about a potential foodborne zoonotic agent Arcobacter spp, wat is bekend en nog onbekend omtrent een waarschijnlijk voedsel gerelateerd zoönotisch agens (met een samenvatting in het Nederlands) Arcobacter spp., những điều đã biết và chưa biết về vi khuẩn gây ngộ độc thực phẩm này (với bản tóm tắt bằng tiếng Việt) Proefschrift ter verkrijging van de graad van doctor aan de Universiteit Utrecht op gezag van de rector magnificus, prof. dr. J. C. Stoof, ingevolge het besluit van het college voor promoties in het openbaar te verdedigen op dinsdag 22 Januari 2008 des middags te 12.45 uur door Hồ Thị Kim Hoa geboren op 10 Juni 1966, te Vĩnh Long, Vietnam Promotor: Prof. dr. W. Gaastra Co-promotor: Dr. L. J. A. Lipman This study was supported by a grand from the Vietnamese Government (Project 322) Assessment Committee: Prof. dr. J. P. Butzler Department of Human Ecology, Faculty of Medicine Vrije Universiteit Brussel, Brussels, Belgium Prof. dr. A. Gröne Department of Pathobiology Faculty of Veterinary Medicine, Utrecht University, The Netherlands Prof. dr. F. van Knapen Institute for Risk Assessment Science (IRAS) Division of Veterinary Public Health, Utrecht University, The Netherlands Prof. dr. J. A. Stegeman Department of Farm Animal Health Faculty of Veterinary Medicine, Utrecht University, The Netherlands Prof. dr. J. H. M. Verheijden Department of Farm Animal Health Faculty of Veterinary Medicine, Utrecht University, The Netherlands Paranimfen (Supporters): Mw. Ali E. Eggenkamp Mw. Ing. Gertie C. A. M. Bokken This is dedicated to Grandma and Mother who have lighted and guided my life.
    [Show full text]
  • Emerging Pathogen Arcobacter Spp. in Food of Animal Origin
    sA sA Scuola di Dottorato in Scienze Veterinarie per la Salute Animale e la Sicurezza Alimentare Università degli Studi di Milano GRADUATE SCHOOL OF VETERINARY SCIENCES FOR ANIMAL HEALTH AND FOOD SAFETY Director: Prof. Vittorio Dell’Orto Doctoral Program in Animal Nutrition and Food Safety Academic Year: 2009-2010 Emerging pathogen Arcobacter spp. in food of animal origin Serena Milesi Tutor: Coordinator: Prof. Gabriella Soncini Prof. Valentino Bontempo 2 Index 1. Foreword 5 1.1The Genus Arcobacter 7 1.2 Arcobacter in Human 9 1.3 Virulence Factors 10 1.4 Antimicrobial Susceptibility 12 1.5 Arcobacter in Animals 13 1.5.1 Arcobacter in cattle 13 1.5.2 Pigs as an important Arcobacter Reservoir 15 1.5.3 Arcobacter in Poultry 17 1.5.4 Arcobacter in Other Animals 17 1.6Arcobacter in Food of Animal Origin 18 1.7 Identification and Characterization of Arcobacter 20 1.7.1 Molecular Identification 21 1.7.2 Molecular-Based Characterization 24 1.8 References 24 2. Objectives 39 2.1 Trial 1: Prevalence and Distribution of Arcobacter spp. 41 In Veal Calves in Northern Italy 2.2 Trial 2: Isolation and characterization of Arcobacter spp. 42 in bulk tank milk 2.3 Trial 3: Antimicrobial Susceptibility of Arcobacter spp. 42 Isolated from Food of Animal Origin 3. Prevalence and Distribution of Arcobacter spp. in 43 Veal Calves in Northern Italy 3.1 Abstract 45 3.2 Introduction 45 3.3 Materials and Methods 47 3.3.1 Animal Selection 47 3.3.2 Sample Collection at the Abattoir 47 3.3.3 Microbiological Analyses 48 3.3.4 Detection an Identification of Arcobacter spp.
    [Show full text]