DOWNLOADED FROM Development of a Real-Time Fluorescence Resonance Energy jcm.ASM.ORG - Transfer PCR To Detect Arcobacter Library July 1, 2010 Species Khalil Abdelbaqi, Alice Buissonnière, Valérie at DigiTop -- USDA's Digital Desktop Prouzet-Mauleon, et al. 2007. Development of a Real-Time Fluorescence Resonance Energy Transfer PCR To Detect Arcobacter Species. J. Clin. Microbiol. 45(9):3015-3021. doi:10.1128/JCM.00256-07. Updated information and services can be found at: http://jcm.asm.org/cgi/content/full/45/9/3015 These include: CONTENT ALERTS Receive: RSS Feeds, eTOCs, free email alerts (when new articles cite this article), more>> Information about commercial reprint orders: http://journals.asm.org/misc/reprints.dtl To subscribe to an ASM journal go to: http://journals.asm.org/subscriptions/ DOWNLOADED FROM JOURNAL OF CLINICAL MICROBIOLOGY, Sept. 2007, p. 3015–3021 Vol. 45, No. 9 0095-1137/07/$08.00ϩ0 doi:10.1128/JCM.00256-07 Copyright © 2007, American Society for Microbiology. All Rights Reserved. Development of a Real-Time Fluorescence Resonance Energy jcm.ASM.ORG - ᰔ Transfer PCR To Detect Arcobacter Species Library July 1, 2010 Khalil Abdelbaqi,1 Alice Buissonnie`re,1 Vale´rie Prouzet-Mauleon,1 Jessica Gresser,1 Irene Wesley,3 Francis Me´graud,1,2* and Armelle Me´nard1,2 Universite´ Victor Segalen Bordeaux 2, Centre National de Re´fe´rence des Helicobacters et Campylobacters, F33076 Bordeaux, France1; at DigiTop -- USDA's Digital Desktop INSERM U853, F33076 Bordeaux, France2; and National Animal Disease Center, ARS, USDA, 2300 Dayton Road, Ames, Iowa3 Received 1 February 2007/Returned for modification 26 March 2007/Accepted 17 May 2007 A real-time PCR targeting the gyrase A subunit gene outside the quinolone resistance-determining region has been developed to detect Arcobacter species. The species identification was done by probe hybridization and melting curve analysis, using fluorescence resonance energy transfer technology. Discrimination between Arcobacter species was straightforward, as the corresponding melting points showed significant differences with the characteristic melting temperatures of 63.5°C, 58.4°C, 60.6°C, and 51.8°C for the Arcobacter butzleri, Arcobacter cryaerophilus, Arcobacter cibarius, and Arcobacter nitrofigilis type strains, respectively. The specificity of this assay was confirmed with pure cultures of 106 Arcobacter isolates from human clinical and veterinary specimens identified by phenotypic methods and 16S rRNA gene sequencing. The assay was then used to screen 345 clinical stool samples obtained from patients with diarrhea. The assay detected A. butzleri in four of these clinical samples (1.2%). These results were confirmed by a conventional PCR method targeting the 16S rRNA gene with subsequent sequencing of the PCR product. In conclusion, this real-time assay detects and differ- entiates Arcobacter species in pure culture as well as in the competing microbiota of the stool matrix. The assay is economical since only one biprobe is used and multiple Arcobacter species are identified in a single test. Aerotolerant spirillum/vibrio-like organisms from aborted been linked to sporadic cases of diarrhea and abdominal bovine fetuses were first described by Ellis et al. in 1977 (9) and cramps in patients with chronic diseases (24), such as neonatal designated Campylobacter cryaerophila on the basis of their bacteremia (27), liver cirrhosis (44), and acute appendicitis Campylobacter-like morphology, aerotolerance, and growth at (22). More recently, a Belgian study revealed that 3.5% of 25°C (9). After examining human and veterinary isolates of campylobacters and related organisms isolated from human these aerotolerant campylobacters, Kiehlbauch et al. identified stool samples over an 8-year period were A. butzleri (38). In two species, Campylobacter butzleri, corresponding to the ma- one of our previous studies, A. butzleri ranked fourth among jority of human clinical isolates, and Campylobacter cryaerophi- the 2,855 strains of Campylobacter-like organisms received dur- lus, consisting of two distinct groups (20). Vandamme et al. ing a 17-month surveillance of Campylobacter infections in proposed the genus Arcobacter to encompass aerotolerant France (28). These infections were associated with intestinal campylobacters (36). This genus comprises human and veteri- disorders resembling those caused by Campylobacter jejuni. nary species, including Arcobacter butzleri, Arcobacter cryaerophi- These observations suggest that the prevalence of this emerg- lus, Arcobacter cibarius, and Arcobacter skirrowii, and also the ing pathogen may be underestimated due to inadequate cul- type strain from the root of a Spartina plant, Arcobacter nitro- ture conditions and/or false identification (14, 38). Traditional figilis. Two new species, Arcobacter sulfidicus, which inhabits isolation methods for Arcobacter are similar to those for coastal marine water (42), and Arcobacter halophilus, isolated Campylobacter, although the majority do not grow at 42°C. The from a hypersaline lagoon (8), represent the diversity of Arco- problems associated with culture failure or with the standard bacter and its capacity to survive in the environment. The genus phenotypic methods of identification have led to the investi- Arcobacter has been included with the genus Campylobacter in gation of new approaches for assistance in the preliminary the Campylobacteraceae family, which is part of the Epsilon- diagnosis of Arcobacter infections. Conventional PCR-based proteobacteria (11). techniques targeting ribosomal genes, such as the 16S RNA Despite the prevalence of Arcobacter species in food speci- gene (13, 15, 32, 41) and the 23S rRNA gene (15, 16, 18, 26), mens, few studies have reported human Arcobacter infections have been widely used for the detection and identification of (23). The bacterium was first identified in 2.4% of clinical Arcobacter species. The increasing relevance of nucleic acid isolates from 631 Thai children with diarrhea (34). An out- amplification tests for the detection and identification of break of recurrent abdominal cramps in 10 young children in Arcobacter species is now obvious, particularly in light of culture Italy was attributed to A. butzleri (37). Arcobacter butzleri has failure and misidentification. With respect to nucleic acid am- plification tests, different real-time PCR chemistries are avail- * Corresponding author. Mailing address: INSERM U853, Univer- able, with the most frequently used formats being SYBR green, site´ Victor Segalen Bordeaux 2, Laboratoire de Bacte´riologie, Bat. 2B hybridization probes, TaqMan probes, molecular beacons, and RDC—Zone Nord, 146 rue Le´o Saignat, 33076 Bordeaux cedex, Scorpion probes. These PCR formats are usually very sensitive, France. Phone: 33 (0)556795910. Fax: 33 (0)556796018. E-mail: francis [email protected]. can be performed in less than 3 hours, and minimize the risk of ᰔ Published ahead of print on 25 July 2007. cross-contamination with other PCR products since all of the 3015 DOWNLOADED FROM 3016 ABDELBAQI ET AL. J. CLIN.MICROBIOL. TABLE 1. Sequences of the primers and probes designed for FRET-PCR identification of Arcobacter species Primer function and Ј Ј Nucleotide Sequence (5 to 3 ) a designation positions jcm.ASM.ORG - gyrA gene amplification and Library July 1, 2010 sequencing F-Arco-FRET5 TTGAAGATTCTTATGATGAAATTGA (sense) 1460–1484 R-Arco-FRET5 TGTATTTCTTCCTGCTTTTCTAATTG (antisense) 2364–2339 LC-FRET assay F1-FRET5 ATCTTTAGTATTCTTTACAAGAAATGG (sense) 1830–1856 at DigiTop -- USDA's Digital Desktop R2-FRET5 AACTGTTGTTCGTTTTCCA (antisense) 2181–2163 S-Ab-FRET5 Red 640-ATCAAGGAAGAAGTACAAGAGGTGTAAG-p (antisense) 2039–2066 A-Ab-FRET5 AGTCTTGGTCAATGTATTAGATTTGAACTTGAAAAAACAAG-F (antisense) 2036–1996 a The nucleotide positions of primers and probes were compared to the gyrA gene numbering of Arcobacter butzleri D2682, the type strain. steps occur in the same tube and no postamplification handling CCUG 145401, Campylobacter fetus UA60, Campylobacter hyointestinalis CCUG is necessary. Among these methods, two specific TaqMan as- 14169, Campylobacter mucosalis CIP 103750, Campylobacter sputorum CCUG 9728, says were recently described for detection of A. butzleri and A. Campylobacter upsaliensis CCUG 14913, and Campylobacter lari CCUG 23947, and Helicobacter strains, such as Helicobacter pullorum CCUG 33839, cryaerophilus (4). Helicobacter canadensis NCTC 13221, Helicobacter pylori J99, Helicobacter Real-time PCR using the fluorescence resonance energy hepaticus ATCC 51448, Helicobacter bilis ATCC 51630, Helicobacter muridarum transfer (FRET) hybridization probe method is very promising ATCC 49282, Helicobacter felis CCUG 28539 T, “Flexispira rappini” (proposed since it can detect single nucleotide polymorphisms (SNP) with name) CCUG 29176, and Wolinella succinogenes DSMZ 1740. Other enteric bacteria (clinical isolates) commonly isolated from patients (Escherichia coli, only one biprobe. We have recently described a FRET real- Salmonella enterica serovar Enteritidis, and Salmonella enterica serovar Typhi- time PCR assay targeting the gyrA gene for rapid and sensitive murium) were also tested. identification and differentiation of C. jejuni and Campy- Genomic DNA was isolated by using a QIAamp DNA mini kit (QIAGEN SA, lobacter coli (25). The present study reports the development Courtaboeuf, France) and stored at Ϫ20°C until required for analysis. of a real-time PCR assay using FRET chemistry and targeting Stool samples. In total, 345 stool clinical samples were screened