Pleuronectes Platessa)––Identification by Data Mining and Cross-Species Amplification in Other flatfishes

Conserv Genet DOI 10.1007/s10592-008-9796-6

TECHNICAL NOTE

Novel microsatellites from the European plaice (Pleuronectes platessa)––identification by data mining and cross-species amplification in other flatfishes

L. Casas Æ L. Sa´nchez Æ L. Orban

Received: 11 December 2008 / Accepted: 16 December 2008 Ó Springer Science+Business Media B.V. 2009

Abstract The European plaice (Pleuronectes platessa; Keywords Microsatellites Genetic markers Pleuronectidae) is considered the most important flatfish Polymorphism Pleuronectes platessa Pleuronectiforms for fisheries in Europe. Overall catches have been reduced drastically throughout the past decades, indicating a severe decline in the natural populations. However, a limited set The European plaice (Pleuronectes platessa, Linnaeus of genetic tools are available to improve stock assessment 1758; Pleuronectidae) is a marine flatfish species inhabit- and management for the species. Sequences of European ing shallow waters from the Western Mediterranean to plaice and its congener, the winter flounder (Pleuronectes Iceland and the White Sea down to a depth of 100 m americanus) deposited in the public database were sear- (Nielsen 1986). It is considered the most important flatfish ched for short tandem repeats. Out of 22 loci derived from for fisheries in Europe. The heavy fishing pressure over the database sequences, eight were amplified successfully and past decades has reduced the overall catches by 60%, from genotyping of 23 wild-caught individuals showed expected 204,000 tonnes in the 1985 to 83,000 tonnes in 2006 (FAO heterozygosities ranging from 0.18 to 0.84. The average 2008) with landings at or near historical lows. Concern for allele number was 4.75 per locus (range 2–11). Successful collapse of the fishery has raised questions about the cross-species amplification of the markers was demon- number of populations as well as the overall genetic health strated from two related flatfishes. All eight markers were of the species. Evidence for earlier maturation at a smaller successfully amplified from the European flounder (Pla- size, compared to the beginning of the last century, has tichthys flesus), a phylogenetically closely related species, been shown by Rijnsdorp (1989). Recent genetic surveys of whereas three of them worked in Achiroides melanorhyn- European plaice populations based on microsatellite loci chus, an endemic species of Southeast Asia for which no (Hoarau et al. 2002b) and mitochondrial DNA fragments microsatellites have been described to date. (Hoarau et al. 2004) have revealed significant heterozygote deficiencies and low effective population size, raising the possibility for inbreeding depression (Hoarau et al. 2005). Out of the nine stocks recognized by the International L. Casas L. Sańchez Council for the Exploration of the Sea (ICES), only one is Departamento de Gene´tica, Facultad de Veterinaria, Universidad de Santiago de Compostela, Campus de Lugo, considered within safety limits, while three are over- 27002 Lugo, Spain exploited and the available information for the other five is inadequate to evaluate stocks trends and therefore their & L. Casas ( ) L. Orban state remains unknown (ICES 2007). A protected nursery Reproductive Genomics Group, Temasek Life Sciences Laboratory, The NUS, 1 Research Link, Singapore 117604, area was established in the North Sea in 1989 to enhance Singapore recruitment to the fishery but the measure has not pre- e-mail: [email protected] vented the stock from continuing to decline (Pastoors et al. 2000). L. Orban Department of Biological Sciences, National University of Genetic tools can be the key to develop sustainable Singapore, 14 Science Drive 4, Singapore 117543, Singapore management and recovery strategies. Microsatellite 123 Conserv Genet markers have been applied extensively in fisheries webpage (http://www.ncbi.nlm.nih.gov/Entrez), converted research, including studies of parentage, kinships, and to FASTA format and screened by using the Sputnik stock structure (Liu and Cordes 2004). The abundance, software (C. Abajian, University of Washington, http:// even genomic distribution, small locus size and high espressosoftware.com/pages/sputnik.jsp). We found a total polymorphism, together with their codominant nature make of 57 microsatellite regions, however only twenty-two microsatellites ideal to assess genetic variation within and those containing seven or more repeat units, were selected between P. platessa populations. However, their develop- for experimental analysis. ment still remains time-consuming and expensive when Fin clip samples were collected from 20 individuals relying on enrichment techniques. The development of originating from a natural population located in NW Spain. these markers through data mining of sequences submitted DNA was isolated by using the standard phenol-chloro- to public databases provides a time-and cost-effective phorm method (Sambrook et al. 1989). Flanking primers method to easily identify microsatellites, with absence of were designed using the online primer design software bias towards enriched repeats. PRIMER 3.0 (Rozen and Skaletsky 2000) and the 22 Eighteen microsatellite markers have been described to microsatellite loci were tested for polymorphisms. Poly- date for European plaice (Watts et al. 1999; Watts et al. merase chain reactions (PCR) were carried out in a total 2001; Hoarau et al. 2002a), but the decline in the natural volume of 15 ll using the GoTaqÒ Flexi DNA Polymerase populations demands increased knowledge about the (Promega) containing approximately 60 ng of total geno- genetic status of this species in order to improve stock mic DNA, 1 lM of each primer (the forward was assessment and management (Sunnucks 2000). fluorescently labelled with Cy5 (5-N–N0-diethyl-tetrame- We have developed eight novel polymorphic microsat- thylindodicarbocyanine)), 0.1 mM of dNTP each, 1.5X Ò ellite markers by screening through DNA sequences Colorless GoTaq Flexi Buffer, 2.5 mM MgCl2 and (genomic, mRNA and ESTs) from European plaice (P. 0.5 units of GoTaqÒ DNA polymerase. platessa) and its congener Winter flounder (P. americanus) PCRs were performed in PTC-200 thermal cycler (MJ deposited in GenBank by others. A total of 142 sequences Research) by using the following program: an initial corresponding to nucleotide and ESTs deposited in Gen- denaturation at 95°C for 10 min followed by 35 cycles at Bank for P. platessa and 59 sequences corresponding to 94°C for 45 s, 50 s at the specific annealing temperature nucleotide for P. americanus were downloaded from the (see Table 1) and 50 s at 72°C for extension. A final GenBank database using the Entrez nucleotide query extension step was performed at 72°C for 10 min.

Table 1 Characteristics of the eight novel microsatellite loci in Pleuronectes platessa

0 0 Locus Primer sequences (5 ?3 )TA (°C) Repeat motif Size range AHO HE PHW GenBank (bp) Accession no.

PPGB1 TGTCACGTTTCTGTTCTTCAGC 61 (GT)9AT(GT)1TT(GT)6 191–193 2 0.300 0.262 1 AJ539469 CAACCCTGTTTCCTGTCCTG

PPGB2 CAATTCTGCCTTCCCTGTTT 57 (GT)13G 199–205 4 0.600 0.664 0.596 AJ539469 GGACACAGACGAGTCCACAC

PPGB3 TGGATCATTCTTGGCATCAG 50 (GATA)21GA 178–236 11 0.750 0.841 0.630 AJ539469 AACACAATGGATGTCAGAAC

PPGB4 GCACGCGGTCTCTACGTTAT 58 (TG)8TC(TG)5T 193–195 2 0.200 0.185 1 AJ539467 GACAAGAACCCGAAGCATGT

PPGB5 CACTGCACCCGTTCCTTTAC 56 (CATC)5 203–207 2 0.550 0.450 0.607 AJ539469 CCCAGTGCGTTTATTTGTGA

PPGB6 TGTGCAGATGAGACAAAGTCG 60 (AG)7A 179–189 5 0.650 0.771 0.194 AJ569468 AAGTGACCGTTGTGGGAAAC

PAGB1 ACATGAGGCTGATTGTGTGC 60 (TG)5TA(TG)15T(TG)5(CG)2 185–225 8 0.850 0.776 0.972 U72067 CCAACACAGCATTGTCCTTG (TG)31(CG)(TG)6TT(TG)3

PAGB2 ACCTCCTCCTCCATTGTGGT 60 (AC)4AG(AC)4 158–170 4 0.250 0.232 1 U72067 CCACAGCACAAGCCACTAAA Average 4.75 0.519 0.523 0.750

Labels: TA, PCR annealing temperature (°C); A, number of alleles per locus; HO and HE, observed and expected heterozygosity; PHW, Probability value for Hardy–Weinberg equilibrium test

123 Conserv Genet

Table 2 Cross-species characterization of the eight novel microsatellite loci developed in European plaice Locus name Platichthys ﬂesus Achirus melanorhynchus

N A Size range (bp) HO HE PHW N A Size range (bp) HO HE PHW

PPGB1 23 2 192–194 0.261 0.294 0.519 12 1 192 PPGB2 23 6 201–209 0.522 0.671 0.410 – – – – – – PPGB3 23 10 178–218 0.870 0.882 0.274 – – – – – – PPGB4 23 2 195–197 0.174 0.162 1 – – – – – – PPGB5 23 2 206–210 0.174 0.487 0.003a ––– ––– PPGB6 23 5 179–189 0.783 0.786 0.033a 12 6 179–189 0.500 0.775 0.015a PAGB1 23 7 185–225 0.696 0.732 0.418 PAGB2 23 2 162–170 0.087 0.085 1 12 4 167–181 0.167 0.634 0.001a

N, Number of individuals tested; A, Number of observed alleles; HO and HE, observed and expected heterozygosity; PHW, Probability value for Hardy–Weinberg Equilibrium test a Departures from HWE using an exact test (P value \ 0.05; Raymond and Rousset 1995)

Genotyping of the PCR products was conducted on an phylogenetic data in Pleuronectiformes (Pardo et al. 2005; automated capillary electrophoresis sequencer model ABI Azevedo et al. 2008). Prism 3730 9 l DNA Analyzer (Applied Biosystems), with The characterization of the new loci for the additional POP-7TM polymer as separation medium and ROXTM-500 as two species which they have amplified successfully from is size standard (Applied Biosystems) following the supplier’s presented in Table 2. recommendation. Sizes of the PCR products were analyzed using GENEMAPPER software (Applied Biosystems). Acknowledgements We wish to thank Maria Victoria Castanõ for Eight of them, all derived from ESTs, yielded poly- providing plaice samples and Alex Chang for the Asian flatfish. LC is supported by a postdoctoral fellowship from the ‘‘Fundacion Juana de morphic products when amplified with flanking primers Vega’’ (A Corunã, Spain), whereas research in LO’s lab is financially (Table 1), while the rest produced multiple band profiles or supported by the Singapore Millenium Foundation and Temasek did not amplify from the region of interest. Holdings, Singapore. The number of alleles ranged from two to eleven (average 4.75) in the individuals examined. Deviations from Hardy–Weinberg equilibrium and genotypic linkage References disequilibrium between all pairs of loci were analyzed by using exact tests based on a Markov-chain algorithm and Azevedo MFC, Oliveira C, Pardo BG, Martinez P, Foresti F (2008) Fisher’s exact test implemented in program GENEPOP Phylogenetic analysis of the order Pleuronectiformes (Teleostei) version 4.0 (Raymond and Rousset 1995), respectively. All based on sequences of 12S and 16S mitochondrial genes. Genet Mol Biol, 31, 1 (suppl): 284–292 loci conformed to Hardy–Weinberg equilibrium whereas FAO (2008) Species fact Sheet Pleuronectes platessa. Fisheries significant linkage disequilibrium was observed between Global Information System (FIGIS, FAO, 2000–2008). http:// loci PPGB1 and PPGB6 in P. platessa (with Chi-Square www.fao.org/fishery/species/3354. Accessed on 07 Jan 2008 P-value of 0.009) but not in P. flesus. Heterozygosity Hoarau G, Cook D, Stam WT, Olsen JL (2002a) New microsatellites primers for plaice, Pleuronectes platessa L. (Teleostei: Pleuro- values were computed using Cervus 3.0 software nectidae). Mol Ecol Notes 2:60–61. doi:10.1046/j.1471-8286. (Kalinowski et al. 2007). 2002.00149.x A cross-species amplification for the newly developed Hoarau G, Rijnsdorp AD, Van Der Veer HW, Stam WT, Olsen JL microsatellites was performed in three other Pleuronecti- (2002b) Population structure of plaice (Pleuronectes platessa)in northern Europe: microsatellites revealed large scale spatial and formes species: the phylogenetically closely related temporal homogeinity. Mol Ecol 11:1165–1176. doi:10.1046/ Platichthys flesus (Linnaeus 1758), the more distantly j.1365-294X.2002.01515.x related turbot (Scophthalmus maximus, (Linnaeus 1758)) Hoarau G, Piquet A, Rijnsdorp AD, Van Der Veer HW, Stam WT, and a freshwater pleuronectiform, Achiroides melano- Olsen JL (2004) Population structure of plaice (Pleuronectes platessa) in northern Europe: a comparison of resolving power rhynchus (Bleeker 1851), endemic of South-East Asia. All between microsatellite loci and mtDNA data. J Sea Res 51:183– loci amplified successfully and showed polymorphism in 190. doi:10.1016/j.seares.2003.12.002 Platichthys, whereas 3 out of the 8 produced the expected Hoarau G, Boon E, Jongma DN, Ferber S, Rijnsdorp AD, Palsson J, band and two showed polymorphism in Achiroides. None Van der Veer HW, Stam WT, Olsen JL (2005) Low effective population size and evidence for inbreeding in a commercially of the primer pairs have produced the band of the expected overexploited flatfish: plaice (Pleuronectes platessa L.). Proc R size in turbot. This result is in agreement with existent Soc Lond B Biol Sci 272:497–503. doi:10.1098/rspb.2004.2963 123 Conserv Genet

ICES (2007) Report of the ICES Advisory Committee on Fishery Raymond M, Rousset F (1995) GENEPOP (version 1.2): population Management, Advisory Committee on the Marine Environment genetics software for exact tests and ecumenicism. J Hered and Advisory Committee on Ecosystems, 2007. ICES Advice. 86:248–249 Books 1–10 Rijnsdorp AD (1989) Maturation of male and female North sea plaice Kalinowski ST, Taper ML, Marshall TC (2007) Revising how the (Pleuronectes platessa L.). ICES J Mar Sci 46:35–51. computer program CERVUS accommodates genotyping error doi:10.1093/icesjms/46.1.35 increases success in paternity assignment. Mol Ecol 16:1099– Rozen S, Skaletsky HJ (2000) PRIMER3 code available at http:// 10060. doi:10.1111/j.1365-294X.2007.03089.x frodo.wi.mit.edu/primer3/primer3_code.html. In: Krawetz S, Liu ZJ, Cordes JF (2004) DNA marker technologies and their Misener S (eds) Bioinformatics methods and protocols: methods applications in aquaculture genetics. Aquaculture 238:1–37. in molecular biology. Humana Press: Totowa, NJ, pp 365–386 doi:10.1016/j.aquaculture.2004.05.027 Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a Nielsen JG (1986) Pleuronectidae. In: Whitehead PJP, Bouchot M-L, laboratory manual, 2nd edn. Cold Spring Harbor Laboratory Hureau J-C, Nielsen J, Tortonese E (eds) Fishes of the Press, New York Northeastern Atlantic and the Mediterranean. UNESCO, Paris, Sunnucks P (2000) Efficient genetic markers for population biology. pp 1305–1306 Trends Ecol Evol 15:199–203. doi:10.1016/S0169-5347(00) Pardo BG, Machordom A, Foresti F, Porto-Foresti F, Azevedo MFC, 01825-5 Banon R, Sanchez L, Martinez P (2005) Phylogenetic analysis of Watts PC, Nash RDM, George SG, Kemp SJ (1999) Isolation and flatfish (Order Pleuronectiformes) based on mitochondrial 16 s characterization of microsatellite loci in the European plaice, rDNA sequences. Sci Mar 69(4):531–543. doi:10.3989/scimar. Pleuronectes platessa L. (Teleostei: Pleuronectidae). Mol Ecol 2005.69n4531 8:2151–2152. doi:10.1046/j.1365-294x.1999.00802-6.x Pastoors MA, Rijnsdorp AD, Van beek FA (2000) Effects of a Watts PC, Nash RDM, Kemp SJ (2001) Polymorphic microsatellite partially closed area in the North sea (‘‘plaice box’’) on stock loci in the European plaice, Pleuronectes platessa, and their development of plaice. ICES J Mar Sci 57:1014–1022. doi: utility in flounder, lemon sole and dover sole. J Mar Biol Assoc 10.1006/jmsc.2000.0586 U K 81:367–368

123