DOCSLIB.ORG

University of Florida Thesis Or Dissertation Formatting

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
University of Florida Thesis Or Dissertation Formatting CONSTRUCTING ARTIFICIAL GENETIC SYSTEMS: A NEW NUCLEOTIDE METABOLISM By MARIKO MATSUURA A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2017 © 2017 Mariko Matsuura This dissertation is dedicated to my family: mother Fumiko, father Yuji; brother Junya; sister Nanako; grandparents Isamu and Hisano Totsuka; and Kojiro and Hiroko Matsuura. ACKNOWLEDGMENTS I would like to thank Dr. Steven Benner for the guidance, patience, and the research opportunities he has given me. I am also indebted to all the current and former members and visiting scholars of the Foundation for Applied Molecular Evolution and the Firebird Biomolecular Sciences LLC, especially Dr. Ryan W. Shaw, Ms. Jennifer D. Moses, Dr. Christian B. Winiger, Dr. Dietlind L. Gerloff, Dr. Shuichi Hoshika, Dr. Hyo-Joong Kim, Dr. Myong-Jung Kim, Dr. Myong-Sang Kim, Dr. Nilesh Karalkar, Dr. Nicole A. Leal, Dr. Yoshihiro Furukawa, and Dr. Fei Chen for their guidance, support, and help. Also, I would like to thank my research collaborators Dr. Stefan Lutz (Emory Univ.), Dr. Ashley B. Daugherty (Emory Univ.), Dr. David Baker (U. of Washington), Dr. Per Jr Greisen (U. of Washington), Dr. JoAnne Stubbe (MIT), Dr. Khalil A. Abboud (UF), and Mr. Daisuke Takahashi (UF). I would also like to express appreciation to my current and former committee members, Dr. Steven D. Bruner, Dr. Jamie S. Foster, Dr. Jon D. Stewart, Dr. Weihong Tan, and Dr. Nigel Richards especially my committee chair, Dr. Bruner for his help. Also, Dr. Nicole A. Horenstein and Dr. Kari B. Basso for giving me opportunities and support for my research, Dr. Ben Smith, Ms. Lori Clark, Ms. Lori Ball, Ms. Cassandra Watkins for their administrative assistance, and the Bruner group members for sharing their research talks and discussions with me. I would also like to thank TA supervisors and members for their guidance, and all the students in my classes, who made me a better teacher and scientist. I want to express special gratitude to Dr. Shigeyuki Yokoyama and Dr. Eiko Seki from RIKEN, Japan, who kindly accepts me as a research intern. An additional thank you to the Department of Chemistry, the Foundation for Applied Molecular Evolution, NASA Astrobiology, the National Science Foundation, the Defense Advanced Research Projects 4 Agency, and Templeton World Charity Foundation provided essential educational and financial support, without which my studies would not have been possible. I would also like to thank people who supported me in many ways throughout the Ph.D. program. Firstly, I would like to express my sincere appreciation to my counselors, Dr. Linda A. Lewis and Dr. Jaime Jasser, and all the members in the counseling group. Ms. Megan Williams, Ms. Lauren P. Jadotte, Ms. Lauren McCarthy, and Mr. Robert Ross for their friendship and support for the improvement of my English language skills. I would also like to thank Ms. Stephanie Seguin, Ms. Tiffany Bagby, Ms. Rachel Damiani, and Mr. David Honeycutt for their help with the English language, and all the members in the Gator Toastmasters Club for their help with public speaking. I would like to specifically thank Dr. Eunhui Yoon, Dr. Jules Gliesche, Dr. Shanshan Wang, and Ms. Yuting Wang, for their friendship and D. Marcus Garcia for his love, support and understanding. Lastly, I would like to thank my family, especially my mother Fumiko, for her love and support. 5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ........................................................................................................... 4 LIST OF TABLES ...................................................................................................................... 9 LIST OF FIGURES .................................................................................................................. 11 LIST OF ABBREVIATIONS.................................................................................................... 14 ABSTRACT ............................................................................................................................. 14 CHAPTER 1 BACKGROUND ............................................................................................................... 17 Designing Systems ............................................................................................................. 17 Design in This Study ................................................................................................... 18 Metabolic and Protein Engineering .............................................................................. 19 Molecules and Analogues ................................................................................................... 19 Nucleotides ................................................................................................................. 19 Artificial Genetic Systems ........................................................................................... 19 Nucleoside/nucleotide Synthesis.................................................................................. 22 Kinases ....................................................................................................................... 24 Nucleoside kinase (NK)........................................................................................ 26 Nucleoside monophosphate kinases (NMPK) ....................................................... 28 Nucleoside diphosphate kinase (NDPK) ............................................................... 30 2 RESEARCH OBJECTIVES ............................................................................................... 32 3 GENERAL METHODS AND PROCEDURES .................................................................. 33 Materials ............................................................................................................................ 33 Nucleobase and Nucleoside/tide Synthesis .................................................................. 33 Oligonucleotides Synthesis .......................................................................................... 33 Standard Methods .............................................................................................................. 33 Cloning/Synthesis of Genes and Construction of Plasmids .......................................... 33 Transformation ............................................................................................................ 34 Enzyme Preparation .................................................................................................... 34 4 ASSAY DEVELOPMENT WITH WILD-TYPE ENZYMES............................................. 35 Materials and Methods ....................................................................................................... 35 Preparation of Enzymes ............................................................................................... 35 Kinase Assays ............................................................................................................. 35 Enzyme-coupled assay ......................................................................................... 35 TLC assay ............................................................................................................ 36 6 Luciferase assay ................................................................................................... 38 Modified 5′ nuclease assay ................................................................................... 39 Results ............................................................................................................................... 42 Assay Development..................................................................................................... 42 Activities of Wild-Type Kinases.................................................................................. 45 Drosophila melanogaster deoxynucleoside kinase (DmdNK) ............................... 46 Guanylate kinases ................................................................................................. 46 E. coli Nucleoside diphosphate kinase (Ndk) ........................................................ 48 Kinetic Parameters ...................................................................................................... 52 Discussion .......................................................................................................................... 54 Assay Comparison ...................................................................................................... 54 Kinase Specificities ..................................................................................................... 58 Ribonucleoside Triphosphate Synthesis ....................................................................... 58 5 KINASE VARIANTS SCREENING ................................................................................. 60 Materials and Methods ....................................................................................................... 60 Enzyme Design and Preparation .................................................................................. 60 D. melanogaster nucleoside kinase (DmdNK) ...................................................... 60 E. coli cytidylate kinase (EcCmk) ......................................................................... 61 E. coli thymidylate kinase (EcTmk) .....................................................................
Load more

Recommended publications
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • Peroxisomal Proliferator–Activated Receptor- Upregulates
    Peroxisomal Proliferator–Activated Receptor-␥ Upregulates Glucokinase Gene Expression in ␤-Cells Ha-il Kim,1 Ji-Young Cha,1 So-Youn Kim,1 Jae-woo Kim,1 Kyung Jin Roh,2 Je-Kyung Seong,2 Nam Taek Lee,3 Kang-Yell Choi,1 Kyung-Sup Kim,1 and Yong-ho Ahn1 Thiazolidinediones, synthetic ligands of peroxisomal because of severe hyperglycemia (2,3). Adenovirus-medi- proliferator–activated receptor-␥ (PPAR-␥), improve ated expression of GLUT2 and GK in IL cells results in peripheral insulin sensitivity and glucose-stimulated gaining of glucose sensitivity (4). Thus, GLUT2 and GK are insulin secretion in pancreatic ␤-cells. To explore the important in glucose sensing of ␤-cells. However, GLUT2, role of PPAR-␥ in glucose sensing of ␤-cells, we have being a low-affinity, high-capacity glucose transporter, is ␤ ␤ dissected the -cell–specific glucokinase ( GK) pro- believed to play a more permissive role in glucose sensing, moter, which constitutes glucose-sensing apparatus in pancreatic ␤-cells, and identified a peroxisomal prolif- allowing rapid equilibration of glucose across the plasma erator response element (PPRE) in the promoter. The membrane. GK traps glucose in ␤-cells by phosphorylation GK-PPRE is located in the region between ؉47 and (5) and is the flux-controlling enzyme for glycolysis in␤ ؉68 bp. PPAR-␥/retinoid X receptor-␣ heterodimer ␤-cells (4). Thus, it serves as the gatekeeper for metabolic binds to the element and activates the ␤GK promoter. signaling, suggesting that GK rather than GLUT2 is directly The ␤GK promoter lacking or having mutations in PPRE ␥ ␥ responsible for the insulin secretion in response to in- cannot be activated by PPAR- .
    [Show full text]
  • Journal of Biotechnology 193 (2015) 37–40
    Journal of Biotechnology 193 (2015) 37–40 Contents lists available at ScienceDirect Journal of Biotechnology j ournal homepage: www.elsevier.com/locate/jbiotec Short communication Blockage of the pyrimidine biosynthetic pathway affects riboflavin production in Ashbya gossypii 1 1 ∗ Rui Silva , Tatiana Q. Aguiar , Lucília Domingues CEB – Centre of Biological Engineering, University of Minho, 4710-057 Braga, Portugal a r t i c l e i n f o a b s t r a c t Article history: The Ashbya gossypii riboflavin biosynthetic pathway and its connection with the purine pathway have Received 10 September 2014 been well studied. However, the outcome of genetic alterations in the pyrimidine pathway on riboflavin Received in revised form 6 November 2014 production by A. gossypii had not yet been assessed. Here, we report that the blockage of the de novo Accepted 7 November 2014 pyrimidine biosynthetic pathway in the recently generated A. gossypii Agura3 uridine/uracil auxotrophic Available online 15 November 2014 strain led to improved riboflavin production on standard agar-solidified complex medium. When extra uridine/uracil was supplied, the production of riboflavin by this auxotroph was repressed. High concen- Keywords: trations of uracil hampered this (and the parent) strain growth, whereas excess uridine favored the A. Ashbya gossypii gossypii Agura3 growth. Considering that the riboflavin and the pyrimidine pathways share the same Pyrimidine pathway precursors and that riboflavin overproduction may be triggered by nutritional stress, we suggest that Riboflavin production Uridine/uracil auxotrophy overproduction of riboflavin by the A. gossypii Agura3 may occur as an outcome of a nutritional stress Nutritional stress response and/or of an increased availability in precursors for riboflavin biosynthesis, due to their reduced consumption by the pyrimidine pathway.
    [Show full text]
  • Enzymatic Manufacture of Deoxythymidine-5'-Triphosphate with Permeable Intact Cells of E. Coli Coexpressing Thymidylate Kinase
    J. Microbiol. Biotechnol. (2015), 25(12), 2034–2042 http://dx.doi.org/10.4014/jmb.1506.06020 Research Article Review jmb Enzymatic Manufacture of Deoxythymidine-5’-Triphosphate with Permeable Intact Cells of E. coli Coexpressing Thymidylate Kinase and Acetate Kinase Jiao Zhang, Yahui Qian, Qingbao Ding*, and Ling Ou* State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, Shanghai 200237, P.R. China Received: June 8, 2015 Revised: July 26, 2015 A one-pot process of enzymatic synthesis of deoxythymidine-5’-triphosphate (5’-dTTP) Accepted: September 11, 2015 employing whole cells of recombinant Escherichia coli coexpressing thymidylate kinase (TMKase) and acetate kinase (ACKase) was developed. Genes tmk and ack from E. coli were First published online cloned and inserted into pET28a(+), and then transduced into E. coli BL21 (DE3) to form September 15, 2015 recombinant strain pTA in which TMKase and ACKase were simultaneously overexpressed. It *Corresponding authors was found that the relative residual specific activities of TMKase and ACKase, in pTA Q.D. pretreated with 20 mM ethylene diamine tetraacetic acid (EDTA) at 25oC for 30 min, were 94% Phone: +86-21-64250676; Fax: +86-21-64250676; and 96%, respectively. The yield of 5’-dTTP reached above 94% from 5 mM deoxythymidine E-mail: [email protected] 5’-monophosphate (5’-dTMP) and 15 mM acetyl phosphate catalyzed with intact cells of pTA L.O. Phone: +86-21-64253257; pretreated with EDTA. The process was so effective that only 0.125 mM adenosine-5’- Fax: +86-21-64253257; triphosphate was sufficient to deliver the phosphate group from acetyl phosphate to dTMP E-mail: [email protected] and dTDP.
    [Show full text]
  • Polymerase Ribozyme with Promoter Recognition
    In vitro Evolution of a Processive Clamping RNA Polymerase Ribozyme with Promoter Recognition by Razvan Cojocaru BSc, Simon Fraser University, 2014 Thesis Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy in the Department of Molecular Biology and Biochemistry Faculty of Science © Razvan Cojocaru 2021 SIMON FRASER UNIVERSITY Summer 2021 Copyright in this work is held by the author. Please ensure that any reproduction or re-use is done in accordance with the relevant national copyright legislation. Declaration of Committee Name: Razvan Cojocaru Degree: Doctor of Philosophy Title: In vitro Evolution of a Processive Clamping RNA Polymerase Ribozyme with Promoter Recognition Committee: Chair: Lisa Craig Professor, Molecular Biology and Biochemistry Peter Unrau Supervisor Professor, Molecular Biology and Biochemistry Dipankar Sen Committee Member Professor, Molecular Biology and Biochemistry Michel Leroux Committee Member Professor, Molecular Biology and Biochemistry Mani Larijani Internal Examiner Associate Professor, Molecular Biology and Biochemistry Gerald Joyce External Examiner Professor, Jack H. Skirball Center for Chemical Biology and Proteomics Salk Institute for Biological Studies Date Defended/Approved: August 12, 2021 ii Abstract The RNA World hypothesis proposes that the early evolution of life began with RNAs that can serve both as carriers of genetic information and as catalysts. Later in evolution, these functions were gradually replaced by DNA and enzymatic proteins in cellular biology. I start by reviewing the naturally occurring catalytic RNAs, ribozymes, as they play many important roles in biology today. These ribozymes are central to protein synthesis and the regulation of gene expression, creating a landscape that strongly supports an early RNA World.
    [Show full text]
  • Different Munc18 Proteins Mediate Baseline and Stimulated Airway Mucin Secretion
    Different Munc18 proteins mediate baseline and stimulated airway mucin secretion Ana M. Jaramillo, … , Michael J. Tuvim, Burton F. Dickey JCI Insight. 2019;4(6):e124815. https://doi.org/10.1172/jci.insight.124815. Research Article Cell biology Pulmonology Graphical abstract Find the latest version: https://jci.me/124815/pdf RESEARCH ARTICLE Different Munc18 proteins mediate baseline and stimulated airway mucin secretion Ana M. Jaramillo,1,2 Lucia Piccotti,1 Walter V. Velasco,1 Anna Sofia Huerta Delgado,3 Zoulikha Azzegagh,1 Felicity Chung,4 Usman Nazeer,1 Junaid Farooq,1 Josh Brenner,1 Jan Parker-Thornburg,5 Brenton L. Scott,1 Christopher M. Evans,6 Roberto Adachi,1 Alan R. Burns,7 Silvia M. Kreda,4 Michael J. Tuvim,1 and Burton F. Dickey1 1Department of Pulmonary Medicine, University of Texas MD Anderson Cancer Center, Houston, Texas, USA. 2Institute of Bioscience and Technology, Texas A&M University Health Science Center, Houston, Texas, USA. 3Tecnologico de Monterrey, Escuela de Medicina y Ciencias de la Salud, Monterrey, Mexico. 4Marsico Lung Institute/Cystic Fibrosis Center, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, USA. 5Department of Genetics, University of Texas MD Anderson Cancer Center, Houston, Texas, USA. 6Division of Pulmonary Sciences and Critical Care Medicine, University of Colorado Denver School of Medicine, Aurora, Colorado, USA. 7College of Optometry, University of Houston, Houston, Texas, USA. Airway mucin secretion is necessary for ciliary clearance of inhaled particles and pathogens but can be detrimental in pathologies such as asthma and cystic fibrosis. Exocytosis in mammals requires a Munc18 scaffolding protein, and airway secretory cells express all 3 Munc18 isoforms.
    [Show full text]
  • Genome of Phaeocystis Globosa Virus Pgv-16T Highlights the Common Ancestry of the Largest Known DNA Viruses Infecting Eukaryotes
    Genome of Phaeocystis globosa virus PgV-16T highlights the common ancestry of the largest known DNA viruses infecting eukaryotes Sebastien Santinia, Sandra Jeudya, Julia Bartolia, Olivier Poirota, Magali Lescota, Chantal Abergela, Valérie Barbeb, K. Eric Wommackc, Anna A. M. Noordeloosd, Corina P. D. Brussaardd,e,1, and Jean-Michel Claveriea,f,1 aStructural and Genomic Information Laboratory, Unité Mixte de Recherche 7256, Centre National de la Recherche Scientifique, Aix-Marseille Université, 13288 Marseille Cedex 9, France; bCommissariat à l’Energie Atomique–Institut de Génomique, 91057 Evry Cedex, France; cDepartment of Plant and Soil Sciences, University of Delaware, Newark, DE 19711; dDepartment of Biological Oceanography, Royal Netherlands Institute for Sea Research, NL-1790 AB Den Burg (Texel), The Netherlands; eAquatic Microbiology, Institute for Biodiversity and Ecosystem Dynamics, University of Amsterdam, Amsterdam, The Netherlands; and fService de Santé Publique et d’Information Médicale, Hôpital de la Timone, Assistance Publique–Hôpitaux de Marseille, FR-13385 Marseille, France Edited by James L. Van Etten, University of Nebraska, Lincoln, NE, and approved May 1, 2013 (received for review February 22, 2013) Large dsDNA viruses are involved in the population control of many viruses: 730 kb and 1.28 Mb for CroV and Megavirus chilensis, globally distributed species of eukaryotic phytoplankton and have respectively. Other studies, targeting virus-specific genes [e.g., a prominent role in bloom termination. The genus Phaeocystis (Hap- DNA polymerase B (8) or capsid proteins (9)] have suggested tophyta, Prymnesiophyceae) includes several high-biomass-forming a close phylogenetic relationship between Mimivirus and several phytoplankton species, such as Phaeocystis globosa, the blooms of giant dsDNA viruses infecting various unicellular algae such as which occur mostly in the coastal zone of the North Atlantic and the Pyramimonas orientalis (Chlorophyta, Prasinophyceae), Phaeocys- North Sea.
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk Et Al
    US 2014O155567A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk et al. (43) Pub. Date: Jun. 5, 2014 (54) MICROORGANISMS AND METHODS FOR (60) Provisional application No. 61/331,812, filed on May THE BIOSYNTHESIS OF BUTADENE 5, 2010. (71) Applicant: Genomatica, Inc., San Diego, CA (US) Publication Classification (72) Inventors: Mark J. Burk, San Diego, CA (US); (51) Int. Cl. Anthony P. Burgard, Bellefonte, PA CI2P 5/02 (2006.01) (US); Jun Sun, San Diego, CA (US); CSF 36/06 (2006.01) Robin E. Osterhout, San Diego, CA CD7C II/6 (2006.01) (US); Priti Pharkya, San Diego, CA (52) U.S. Cl. (US) CPC ................. CI2P5/026 (2013.01); C07C II/I6 (2013.01); C08F 136/06 (2013.01) (73) Assignee: Genomatica, Inc., San Diego, CA (US) USPC ... 526/335; 435/252.3:435/167; 435/254.2: (21) Appl. No.: 14/059,131 435/254.11: 435/252.33: 435/254.21:585/16 (22) Filed: Oct. 21, 2013 (57) ABSTRACT O O The invention provides non-naturally occurring microbial Related U.S. Application Data organisms having a butadiene pathway. The invention addi (63) Continuation of application No. 13/101,046, filed on tionally provides methods of using Such organisms to produce May 4, 2011, now Pat. No. 8,580,543. butadiene. Patent Application Publication Jun. 5, 2014 Sheet 1 of 4 US 2014/O155567 A1 ?ueudos!SMS |?un61– Patent Application Publication Jun. 5, 2014 Sheet 2 of 4 US 2014/O155567 A1 VOJ OO O Z?un61– Patent Application Publication US 2014/O155567 A1 {}}} Hººso Patent Application Publication Jun.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2010/0317005 A1 Hardin Et Al
    US 20100317005A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2010/0317005 A1 Hardin et al. (43) Pub. Date: Dec. 16, 2010 (54) MODIFIED NUCLEOTIDES AND METHODS (22) Filed: Mar. 15, 2010 FOR MAKING AND USE SAME Related U.S. Application Data (63) Continuation of application No. 11/007,794, filed on Dec. 8, 2004, now abandoned, which is a continuation (75) Inventors: Susan H. Hardin, College Station, in-part of application No. 09/901,782, filed on Jul. 9, TX (US); Hongyi Wang, Pearland, 2001. TX (US); Brent A. Mulder, (60) Provisional application No. 60/527,909, filed on Dec. Sugarland, TX (US); Nathan K. 8, 2003, provisional application No. 60/216,594, filed Agnew, Richmond, TX (US); on Jul. 7, 2000. Tommie L. Lincecum, JR., Publication Classification Houston, TX (US) (51) Int. Cl. CI2O I/68 (2006.01) Correspondence Address: (52) U.S. Cl. ............................................................ 435/6 LIFE TECHNOLOGES CORPORATION (57) ABSTRACT CFO INTELLEVATE Labeled nucleotide triphosphates are disclosed having a label P.O. BOX S2OSO bonded to the gamma phosphate of the nucleotide triphos MINNEAPOLIS, MN 55402 (US) phate. Methods for using the gamma phosphate labeled nucleotide are also disclosed where the gamma phosphate labeled nucleotide are used to attach the labeled gamma phos (73) Assignees: LIFE TECHNOLOGIES phate in a catalyzed (enzyme or man-made catalyst) reaction to a target biomolecule or to exchange a phosphate on a target CORPORATION, Carlsbad, CA biomolecule with a labeled gamme phosphate. Preferred tar (US); VISIGEN get biomolecules are DNAs, RNAs, DNA/RNAs, PNA, BIOTECHNOLOGIES, INC. polypeptide (e.g., proteins enzymes, protein, assemblages, etc.), Sugars and polysaccharides or mixed biomolecules hav ing two or more of DNAs, RNAs, DNA/RNAs, polypeptide, (21) Appl.
    [Show full text]
  • Characterization of Human UMP/CMP Kinase and Its Phosphorylation of D- and 1 L-Form Deoxycytidine Analogue Monophosphates
    [CANCER RESEARCH 62, 1624–1631, March 15, 2002] Characterization of Human UMP/CMP Kinase and Its Phosphorylation of D- and 1 L-Form Deoxycytidine Analogue Monophosphates Jieh-Yuan Liou, Ginger E. Dutschman, Wing Lam, Zaoli Jiang, and Yung-Chi Cheng2 Department of Pharmacology, Yale University School of Medicine, New Haven, Connecticut 06520 ABSTRACT with leukemia, lymphoma, or solid tumors (11). Deoxycytidine ana- logues, such as ␤-D-2Ј,3Ј-dideoxycytidine and L-(Ϫ)-SddC (Lamivu- Pyrimidine nucleoside monophosphate kinase [UMP/CMP kinase dine), have been shown to have anti-HIV and antihuman hepatitis B (UMP/CMPK); EC 2.7.4.14] plays a crucial role in the formation of UDP, virus activities (12–17). L-(Ϫ)-SddC was the first nucleoside analogue CDP, and dCDP, which are required for cellular nucleic acid synthesis. Several cytidine and deoxycytidine analogues are important anticancer with an L configuration to show therapeutic activity and, thus, defined ␤ Ј Ј and antiviral drugs. These drugs require stepwise phosphorylation to their a new category for the design of nucleoside analogues. -L-2 ,3 - triphosphate forms to exert their therapeutic effects. The role of UMP/ dideoxy-5-fluoro-3Ј-thia-cytidine and ␤-L-2Ј,3Ј-dideoxy-2Ј,3Ј-dide- CMPK for the phosphorylation of nucleoside analogues has been indi- hydro-5-fluorocytidine have been shown to be potent antihuman hep- cated. Thus, we cloned the human UMP/CMPK gene, expressed it in atitis B virus agents in vitro and in animal studies (18–22). In studies Escherichia coli, and purified it to homogeneity. Its kinetic properties of other ␤-L-(Ϫ)-2Ј,3Ј-dideoxycytidine analogues, it was observed were determined.
    [Show full text]
  • Biological Phosphorylation of an Unnatural Base Pair (UBP) Using a Drosophila Melanogaster Deoxynucleoside Kinase (Dmdnk) Mutant
    RESEARCH ARTICLE Biological phosphorylation of an Unnatural Base Pair (UBP) using a Drosophila melanogaster deoxynucleoside kinase (DmdNK) mutant Fei Chen1,2,3☯*, Yuan Zhang4☯, Ashley B. Daugherty5, Zunyi Yang3, Ryan Shaw3, Mengxing Dong1,2, Stefan Lutz5, Steven A. Benner3* a1111111111 1 CAS Key Laboratory of Genome Sciences & Information, Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing, China, 2 University of Chinese Academy of Sciences, Beijing, China, 3 Foundation for a1111111111 Applied Molecular Evolution (FfAME), Alachua, Florida, United States of America, 4 College of Chemistry, a1111111111 Beijing Normal University, Beijing, China, 5 Department of Chemistry, Emory University School of Medicine, a1111111111 Atlanta, Georgia, United States of America a1111111111 ☯ These authors contributed equally to this work. * [email protected] (FC); [email protected] (SAB) OPEN ACCESS Abstract Citation: Chen F, Zhang Y, Daugherty AB, Yang Z, Shaw R, Dong M, et al. (2017) Biological One research goal for unnatural base pair (UBP) is to replicate, transcribe and translate phosphorylation of an Unnatural Base Pair (UBP) them in vivo. Accordingly, the corresponding unnatural nucleoside triphosphates must be using a Drosophila melanogaster deoxynucleoside available at sufficient concentrations within the cell. To achieve this goal, the unnatural kinase (DmdNK) mutant. PLoS ONE 12(3): nucleoside analogues must be phosphorylated to the corresponding nucleoside triphos- e0174163. https://doi.org/10.1371/journal. pone.0174163 phates by a cascade of three kinases. The first step is the monophosphorylation of unnatural deoxynucleoside catalyzed by deoxynucleoside kinases (dNK), which is generally consid- Editor: Giovanni Maga, Istituto di Genetica Molecolare, ITALY ered the rate limiting step because of the high specificity of dNKs.
    [Show full text]